WO2023101277A1 - 증진된 효능을 갖는 면역세포 - Google Patents

증진된 효능을 갖는 면역세포 Download PDF

Info

Publication number
WO2023101277A1
WO2023101277A1 PCT/KR2022/018215 KR2022018215W WO2023101277A1 WO 2023101277 A1 WO2023101277 A1 WO 2023101277A1 KR 2022018215 W KR2022018215 W KR 2022018215W WO 2023101277 A1 WO2023101277 A1 WO 2023101277A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
tet2
cell
immune
activity
Prior art date
Application number
PCT/KR2022/018215
Other languages
English (en)
French (fr)
Inventor
박영광
박지훈
김영린
최상운
이흥경
Original Assignee
한국화학연구원
주식회사 앱타이론바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국화학연구원, 주식회사 앱타이론바이오 filed Critical 한국화학연구원
Publication of WO2023101277A1 publication Critical patent/WO2023101277A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/17—Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues

Definitions

  • the present invention relates to a composition for improving immune cell activity, a method for producing immune cells with improved activity, immune cells with improved activity, and their use.
  • Cell therapy is a drug that induces therapeutic effects such as regeneration by using living cells to restore damaged or diseased cells, tissues, or objects.
  • natural killer cell, NK cell natural killer cell, NK cell
  • T cell and other immune cells are used to control the body's immune response to treat disease.
  • the immunoregulatory cell therapy product activates various immune cells such as PBMC (peripheral blood mononuclear cells), T cells, and NK cells isolated from patients with various antibodies and cytokines, and then proliferates them in vitro and injects them back into the patient, It is done by injecting immune cells with genes such as T-Cell Receptor (TCR) or Chimeric Antigen Receptor (CAR) back into the patient.
  • PBMC peripheral blood mononuclear cells
  • T cells tumor cells
  • NK cells isolated from patients with various antibodies and cytokines
  • CAR is an artificial chimeric protein that fuses a single-chain antibody that recognizes a cell surface antigen of cancer cells with a signal transduction region that induces T cell activation.
  • a CAR-encoding gene into normal peripheral blood T cells (peripheral blood T lymphocytes) that do not have tumor reactivity
  • CAR-expressing T cells expressing CAR hereinafter referred to as 'CAR-T cells'
  • MHC major histocompatibility gene complex
  • CAR-T cell therapy has attracted attention by showing dramatic effects in clinical trials, especially for hematological tumors. That is, in the case of CAR-T cell therapy using an antibody recognizing CD19, a B lymphocyte hematological tumor antigen, in an initial clinical trial for patients with acute lymphocytic leukemia who were refractory to all existing treatments, 90% of patients (out of 30 patients) 27 patients) achieved complete remission within one month, and the 6-month overall survival rate was astonishing, reaching 78%. Based on these results, at the end of 2017, two types of CD19 CAR-T cell therapy were successfully commercialized under FDA approval.
  • CAR-T cell therapy is limited to CD19-positive acute leukemia, and in the case of solid tumors, the treatment efficiency is reported to be low.
  • CAR-T cells are exposed to abundant amounts of malignant B cells in the lymph nodes or during the treatment of highly immunogenic tumors such as melanoma, as opposed to resulting in a potent activation profile and strong cytotoxic effects
  • weakly activated T cells resulting from limited exposure to tumor antigens result in an unstable immune response, lethargic clonal expansion and premature clonal shrinkage.
  • RNA interference (RNAi) mechanism in which siRNA and shRNA suppress gene expression in cells, is highly likely to be a therapeutic agent in that it can control genes related to cancer and infectious diseases, and RNAi phenomenon can be used to treat intractable cancer diseases. Gene therapy is getting a lot of attention. Because RNAi has high sequence specificity, the RNAi system can specifically knockdown one type of transcript and does not affect other mRNAs with similar sequences. These properties make RNAi mechanisms of potential and value for gene inhibition, gene function studies and drug target validation. In addition, RNAi mechanisms may be involved in (1) diseases caused by overexpression or misexpression of genes; (2) It can be used for the treatment of related diseases including diseases caused by gene mutations.
  • One object of the present invention is to provide a composition for improving immune cell activity and a method for producing immune cells with improved activity.
  • Another object of the present invention is to provide a recombinant vector for preparing immune cells with improved activity.
  • Another object of the present invention is to provide immune cells with improved activity.
  • Another object of the present invention is to provide a pharmaceutical composition for cancer treatment containing immune cells with improved activity.
  • one aspect of the present invention provides a composition for improving immune cell activity comprising a TET2 (Tet Methylcytosine Dioxygenase 2) inhibitor.
  • TET2 Tet Methylcytosine Dioxygenase 2
  • Another aspect of the present invention provides a method for producing immune cells with improved activity comprising injecting a TET2 inhibitor into the immune cells.
  • Another aspect of the invention provides a recombinant vector comprising a nucleic acid encoding a TET2 inhibitor.
  • Another aspect of the present invention provides immune cells with improved activity transduced with the recombinant vector.
  • Another aspect of the present invention provides a pharmaceutical composition for treating cancer comprising the immune cells with improved activity as an active ingredient.
  • a target sequence and shRNA that effectively knockdown long TET2 with a cDNA of about 6000 bp were selected, and TET2-knockdown immune cells were prepared using the target sequence. Since immune cells in which TET2 is knocked down by the shRNA of the present invention exhibit improved tumor treatment efficiency compared to immune cells in which TET2 is not knocked down or other types of shRNA are knocked down, they can be usefully used for immune cell therapy for cancer treatment. there is.
  • Figure 1 confirms the knockdown efficiency of TET2 due to the shRNA reaction in 293T cells introduced with TET2 shRNA by Western blotting.
  • FIG. 2A shows a schematic diagram of a recombinant vector containing a nucleic acid encoding a chimeric antigen receptor (CAR) and a nucleic acid encoding a TET2 inhibitor
  • FIG. 2B shows a CD19 CAR gene.
  • CAR chimeric antigen receptor
  • Figure 4 shows the expression levels of PD-1 and Tim-3, which are immunosuppressive receptors, measured by FACS to confirm that TET2-knockdown CAR-T cells have improved activity compared to normal T cells and CAR-T cells. .
  • FIG. 5 shows a schematic experimental protocol for confirming the in vivo anticancer efficacy improvement effect of TET2 knockdown CAR-T cells.
  • Figure 6 shows the degree of in vivo proliferation of tumors through the intensity of luminescence emitted by tumor cell populations using imaging equipment (IVIS, PerkinElmer) after administering CAR-T cells in which TET2 is knocked down to immunodeficient mice. is shown.
  • One aspect of the present invention provides a composition for enhancing immune cell activity comprising a Tet Methylcytosine Dioxygenase 2 (TET2) inhibitor.
  • TET2 Tet Methylcytosine Dioxygenase 2
  • the activity improvement may be at least one selected from the group consisting of survival rate improvement, proliferation rate improvement, and cytokine expression increase.
  • Immune cells with improved activity can exhibit significantly improved tumor treatment efficiency compared to normal immune cells.
  • CAR-T cells into which a TET2 inhibitor was introduced showed a decrease in the expression of immunosuppressive receptors such as PD-1 and TIM-3 compared to CAR-T cells into which no TET2 inhibitor was introduced, resulting in TET2 inhibition. It was confirmed that the activity of immune cells was improved by
  • the “TET2 (Tet Methylcytosine Dioxygenase 2)” is one of the genes (TET1, TET2, TET3) encoding a protein that converts 5-methylcytosine to 5-hydroxymethylcytosine, and is known to be involved in maintaining DNA methylation .
  • DNA methylation/demethylation is dynamically coordinated throughout hematopoietic differentiation and TET proteins regulate gene expression levels through the balance of DNA methylation during hematopoietic and immune cell activation and expansion.
  • Sequence information of the mRNA and protein of the TET2 gene can be found in a known gene database. For example, the nucleic acid sequence of human TET2 is Genbank No. BC150180.1 and others.
  • the "TET2 inhibitor” is used as a general term for all agents that reduce the expression or activity of TET2, and reduces the expression level of TET2 at the level of transcription, mRNA, or translation, or reduces the level of TET2. It may include any agent that reduces the activity of TET2 by interfering with its activity.
  • the TET2 inhibitor can be used without limitation in the form of a compound, nucleic acid, peptide, virus, or vector containing the nucleic acid that can target TET2 and inhibit its expression or activity.
  • the TET2 inhibitor may be a miRNA, siRNA or shRNA that degrades the mRNA of the TET2 gene, an antisense oligonucleotide that reduces the expression of the TET2 protein, and the like.
  • the TET2 inhibitor may be shRNA.
  • shRNA is to overcome disadvantages such as high cost of biosynthesis of siRNA, short-term maintenance of RNA interference effect due to low cell transfection efficiency, and adenovirus, lentivirus and plasmid expression vector system from RNA polymerase III promoter It can be introduced and expressed into cells using . It is known that such shRNAs are converted into siRNAs having precise structures by siRNA processing enzymes (Dicer or Rnase III) present in cells to induce silencing of target genes.
  • siRNA processing enzymes Dier or Rnase III
  • the siRNA refers to a short double-stranded RNA capable of inducing an RNAi phenomenon through cleavage of a specific mRNA, and is composed of a sense RNA strand having a sequence homologous to the mRNA of a target gene and an antisense RNA strand having a sequence complementary thereto . Since the shRNA or siRNA can suppress the expression of a target gene, it can be provided as an efficient gene knockdown method or a gene therapy method.
  • the nucleic acid encoding the shRNA may have the nucleotide sequence of SEQ ID NO: 10 or SEQ ID NO: 18, and may be synthesized or modified such as homologues, isotypes, variants, derivatives, fragments thereof, ,
  • the loop sequence (underlined in Table 1 below) present in the center of the nucleotide sequence of SEQ ID NO: 10 or SEQ ID NO: 18 may be modified.
  • the TET2 inhibitor may have the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 9 as a target sequence.
  • target sequence is a nucleotide sequence present in a target gene or nucleic acid, and may be a nucleic acid sequence complementary to a nucleic acid sequence included in a TET2 inhibitor, for example, at least 70%, 75%, 80%, 85%, 90% % or 95% or more complementary or completely complementary nucleic acid sequences.
  • the TET2 inhibitor may be a shRNA that forms a complementary bond to a target sequence of SEQ ID NO: 1 or SEQ ID NO: 9 among the nucleic acid sequences of TET2.
  • the expression level of the TET2 gene was confirmed by Western blotting, and as a result, complementary binding to the target sequence of SEQ ID NO: 1 or SEQ ID NO: 9 It was confirmed that the shRNA forming the inhibited the expression of the TET2 gene significantly more than the shRNA binding to other target sequences.
  • the immune cells are cells involved in the immune response, and include all cells directly or indirectly involved in the immune response and cells before their differentiation.
  • the pre-differentiated cells may be embryonic stem cells, adult stem cells, and induced pluripotent stem cells having self-replication and differentiation capabilities.
  • the immune cells may be human-derived immune cells or immune cells derived from non-human mammals such as dogs, cats, pigs, and mice.
  • the immune cells can be obtained by isolation and purification from immune cells infiltrating body fluids such as blood and bone marrow, tissues such as the spleen, thymus, and lymph nodes, or cancer tissues such as primary tumors, metastatic tumors, and cancerous ascites. .
  • the immune cells may be CD3 positive cells, for example, T cells.
  • the immune cells may be CD56 positive cells, for example, NK cells.
  • the immune cells may be CD3 and CD56 double positive cells, for example, NKT (Natural Killer T) cells or CIK (Cytokine Induced Killer cells).
  • NKT Natural Killer T
  • CIK Cytokine Induced Killer cells
  • Another aspect of the present invention provides a method for producing immune cells with improved activity, comprising the step of injecting a TET2 inhibitor into immune cells.
  • the injecting may be performed in vivo or ex vivo.
  • the injection method may be at least one method selected from electroporation, liposome, plasmid, viral vector, and nanoparticles.
  • the viral vector may be at least one selected from the group consisting of retrovirus, lentivirus, adenovirus, adeno-associated virus, vaccinia virus, poxvirus, and herpes simplex virus.
  • the TET2 inhibitor may be a miRNA, siRNA or shRNA that degrades the mRNA of the TET2 gene, an antisense oligonucleotide that reduces the expression of the TET2 protein, and the like, and shRNA can be used in terms of economy and durability.
  • Another aspect of the present invention provides a recombinant vector containing a nucleic acid encoding a TET2 inhibitor.
  • the TET2 inhibitor may be shRNA.
  • a vector useful for delivering the shRNA may be a viral vector, and the virus is one selected from the group consisting of retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, vaccinia viruses, poxviruses, and herpes simplex viruses can be over
  • the recombinant vector may be constructed by a recombinant DNA method known in the art.
  • a nucleic acid having a nucleotide sequence represented by SEQ ID NO: 10 or SEQ ID NO: 18 can be prepared based on the shRNA sequence.
  • the shRNA suppressing the expression of TET2 is preferably operably linked to at least a promoter in order to be properly transcribed in the transferred cell.
  • Any promoter may be used as the promoter, as long as it can function in eukaryotic cells.
  • the U6 promoter which is advantageous for small size RNA production, may be used.
  • Regulatory sequences including leader sequences, polyadenylation sequences, promoters, enhancers, upstream activation sequences, signal peptide sequences, and transcription terminator may be additionally included as necessary for efficient transcription of shRNA that inhibits TET2 expression. there is.
  • operably linked means that linkages between nucleic acid sequences are functionally linked. Any nucleic acid sequence is operably linked when it is positioned such that it is functionally related to another nucleic acid sequence. For example, if any transcriptional regulatory sequence affects transcription of the shRNA, the transcriptional regulatory sequence is said to be operably linked to the shRNA.
  • the recombinant vector may additionally include a nucleic acid encoding a chimeric antigen receptor (CAR).
  • CAR chimeric antigen receptor
  • nucleic acid encoding the CAR is not particularly limited as long as it is a nucleic acid encoding a polypeptide constituting the CAR, and encodes a single-chain antibody that recognizes a cell surface antigen of cancer cells, a transmembrane domain, and a polypeptide of an intracellular signal transduction domain.
  • a nucleic acid is included.
  • the single-chain antibody may include an oligo or polypeptide consisting of a light chain variable region and a heavy chain variable region (scFv) derived from an antigen-binding site of a monoclonal antibody, and a linker peptide positioned between the light chain variable region and the heavy chain variable region.
  • scFv heavy chain variable region
  • the cell surface antigen of cancer cells recognized by the single-chain antibody is a biomolecule specifically expressed in cancer cells and their precursor cells, a biomolecule whose expression is newly confirmed by cancerization of cells, or an expression level in cancer cells compared to normal cells.
  • This increased biomolecule can be, for example, CD20, EGFR, FITC, CD19, CD22, CD33, PSMA, GD2, EGFRvariant, ROR1, c-Met, HER2, CEA, mesothelin, GM2, CD7, CD10, CD30 , CD34, CD38, CD41, CD44, CD74, CD123 CD133, CD171, MUC16, MUC1, CS1 (CD319), IL-13 Ra2, BCMA, LewisY, IgG kappa chain, Folate receptor-alpha, PSCA, or EpCAM.
  • the intracellular signal transduction domain is a region capable of intracellular signal transduction when the single chain antibody recognizes a cell surface antigen of a cancer cell, CD28, 4-1BB (CD137), GITR, CD27, OX40, HVEM, CD3 ⁇ , It may include at least one or two or more selected from polypeptides of the intracellular domain of Fc Receptorassociated ⁇ chain.
  • polypeptides of the intracellular domain When two or more kinds of polypeptides of the intracellular domain are included, they may be linked through an oligopeptide linker or a polypeptide linker consisting of 2 to 10 amino acids, and such a linker sequence may be, for example, a glycine-serine continuous sequence.
  • the transmembrane domain is CD28, CD3 ⁇ CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, GITR It may be a polypeptide of a cell transmembrane domain derived from. By such a cell membrane penetrating domain, CAR is anchored to the cell membrane of immune cells such as T cells.
  • a spacer region composed of an arbitrary oligopeptide or polypeptide may be installed between the single-chain antibody recognizing the cell surface antigen of the cancer cell, the cell membrane penetrating domain, and the intracellular signal transduction domain.
  • the length of the spacer region may be 1 to 100 amino acids or 10 to 50 amino acids, and such spacer region may be, for example, a glycine-serine contiguous sequence.
  • any nucleic acid may be included as long as each nucleic acid can be expressed, for example, a self-cleaving peptide (2A peptide) or an IRES (internal ribozyme entry site). By linking using these sequences, each nucleic acid can be efficiently expressed.
  • the nucleic acid encoding the CAR is chemically synthesized based on a base sequence encoding a single-chain antibody against a cell surface antigen of cancer cells, a cell membrane penetrating domain, and a polypeptide of an intracellular signal transduction domain, or amplification by PCR It can be manufactured by well-known techniques, such as.
  • Another aspect of the present invention provides an immune cell with improved activity into which the recombinant vector is introduced.
  • the activity improvement may be at least one selected from the group consisting of survival rate improvement, proliferation rate improvement, and cytokine expression increase.
  • Immune cells with improved activity may be immune cells in which TET2 is inactivated.
  • TET2 The inactivation of TET2 can be achieved by regulating the expression of the TET2 gene or protein, and since TET2 is an endogenous gene that affects the proliferation, survival and/or function of immune cells, targeting some or all of the non-coding or coding regions of TET2 Thus, expression of the TET2 gene or protein can be regulated.
  • TET2 The expression of TET2 can be regulated through mRNA degradation or translational inhibition, and as a result of the regulation, both knock down and knock out forms can be included.
  • the “knock down” means reducing the transcription and/or translation of a target gene or nucleic acid or reducing the expression of a target protein. Through knockdown, the activity of immune cells can be improved by regulating the expression of the overexpressed TET2 gene or protein.
  • the “knock out” means inactivating a target gene or nucleic acid, and the inactivation of a target gene or nucleic acid means a state in which transcription and/or translation of the target gene or nucleic acid is not possible. Through knockout, the transcription and translation of the TET2 gene can be inhibited, thereby preventing the expression of the TET2 protein.
  • the targeting can be, for example, the promoter region of the TET2 gene, or a transcriptional sequence, such as an intron or exon sequence, and a coding sequence, such as a coding region, an early coding region can be altered and knocked out.
  • a transcriptional sequence such as an intron or exon sequence
  • a coding sequence such as a coding region, an early coding region can be altered and knocked out.
  • the expression of the gene or protein may be inactivated by inactivating the TET2 gene by degrading the mRNA of the TET2 gene or inhibiting translation by an RNAi mechanism after the shRNA is injected into the cell.
  • the immune cells are cells involved in the immune response, and include all cells directly or indirectly involved in the immune response and cells before their differentiation.
  • the pre-differentiated cells may be embryonic stem cells, adult stem cells, and induced pluripotent stem cells having self-replication and differentiation capabilities.
  • the immune cells may be human-derived immune cells or immune cells derived from non-human mammals such as dogs, cats, pigs, and mice.
  • the immune cells can be obtained by isolation and purification from immune cells infiltrating body fluids such as blood and bone marrow, tissues such as the spleen, thymus, and lymph nodes, or cancer tissues such as primary tumors, metastatic tumors, and cancerous ascites. .
  • the immune cells may be CD3 positive cells, for example, T cells.
  • the immune cells may be CD56 positive cells, for example, NK cells.
  • the immune cells may be CD3 and CD56 double positive cells, for example, NKT (Natural Killer T) cells or CIK (Cytokine Induced Killer cells).
  • NKT Natural Killer T
  • CIK Cytokine Induced Killer cells
  • the T cells include ⁇ T cells, ⁇ T cells, CD8 positive T cells (e.g., CD8+ naive T cells, CD8+ effector T cells, central memory T cells, or effector memory T cells), CD4 positive T cells, natural killer T cells ( Natural Killer T (NKT) cells, regulatory T cells (Treg), memory T cells, tumor infiltrating T cells, lymphoid progenitor cells, hematopoietic stem cells, It may be at least one selected from the group consisting of T cells isolated from peripheral blood mononuclear cells (PBMC).
  • the immune cells express a chimeric antigen receptor (CAR) It may be immune cells that do.
  • the single-chain antibody expressed in the CAR-expressing immune cells is located in the extracellular region, and by having such a single-chain antibody, the CAR-expressing immune cells can recognize tumor-associated antigen (TAA) expressed on the surface of cancer cells. .
  • TAA tumor-associated antigen
  • the chimeric antigen receptor may include an antibody or antigen-binding fragment thereof that specifically binds to CD19.
  • the CD19 is a Cluster of Differentiation (CD), which is assigned a number 19 to identify cell surface molecules according to immunophenotype. It is known to provide ideal targets.
  • Methods for introducing the recombinant vector into immune cells are not particularly limited, but include methods known in the art such as viral infection, calcium phosphate, lipofection, microinjection, and electroporation. there is.
  • the virus infection method may be a method of transfecting packaging cells with the recombinant vector and packaging plasmid to prepare a recombinant virus, and infecting T cells with the recombinant virus.
  • Another aspect of the present invention provides a pharmaceutical composition for the treatment of cancer comprising the immune cells with improved activity as an active ingredient.
  • cancer and “tumor” are used interchangeably and refer to or refer to a mammalian physiological condition typically characterized by unregulated cell growth/proliferation.
  • the cancer includes not only angiogenic tumors but also non-vascularized or yet substantially nonvascularized tumors.
  • the cancer may include a non-solid tumor (eg, a hematological tumor such as leukemia and lymphoma) or may include a solid tumor.
  • the types of cancer include, but are not limited to, carcinomas, blastomas, and sarcomas, and certain leukemias or lymphoid malignancies, benign and malignant tumors such as sarcomas, carcinomas, and melanomas.
  • Adult tumors/cancers and juvenile tumors/cancers are also included.
  • the hematological cancer is cancer of the blood or bone marrow.
  • hematological (or hematopoietic) cancers include acute leukemias (eg acute lymphocytic leukemia, acute myeloid leukemia and myeloblastic, prolymphocytic, myelomonocytic, monocytic and erythroleukemia), chronic leukemia (eg For example, chronic lymphocytic (granulocytic) leukemia, chronic myeloid leukemia, and chronic lymphocytic leukemia), polycythemia vera, lymphoma, Hodgkin's disease, non-Hodgkin's lymphoma (delayed and high-stage forms), multiple myeloma, leukemias including Waldenstrom's macroglobulinemia, heavy chain disease, myelodysplastic syndrome, hairy cell leukemia and myelodysplasia.
  • acute leukemias eg acute lymphocytic
  • a solid tumor is an abnormal mass of tissue that usually does not contain cysts or fluid areas. Solid tumors can be benign or malignant. Different types of solid tumors are named for the type of cells that form them (eg, sarcomas, carcinomas, and lymphomas).
  • solid tumors such as sarcomas and carcinomas include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, pyalamyosarcoma, rhabdomyosarcoma , rectal carcinoma, lymphoid malignancy, colorectal cancer, gastric cancer, pancreatic cancer, breast cancer, lung cancer, ovarian cancer, prostate cancer, laryngeal cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, gland carcinoma, medullary thyroid carcinoma, Papillary thyroid carcinoma, pheochromocytoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, medullary carcinoma, bronchial carcinoma, renal cell carcinoma, liver tumor, chol
  • treatment refers to any action that suppresses or delays the progression of cancer by administering the composition of the present invention, and includes suppression of cancer development, alleviation or elimination of symptoms.
  • the pharmaceutical composition may additionally include a pharmaceutically acceptable excipient.
  • excipients include surfactants, preferably polysorbate-based nonionic surfactants; buffers such as neutral buffered saline and human salt buffered saline; sugars or sugar alcohols such as glucose, mannose, sucrose or dextran, and mannitol; amino acids such as glycine and histidine, or proteins or polypeptides; antioxidants; chelating agents such as EDTA or glutathione; penetrant; adjuvant; and preservatives may be included, but are not limited thereto.
  • the pharmaceutical composition may be formulated using methods known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to a non-human mammal.
  • the dosage form may be in the form of a powder, granule, tablet, emulsion, syrup, aerosol, soft or hard gelatin capsule, sterile injectable solution, or sterile powder.
  • shRNAs binding to various target sequences and viral vectors expressing shRNAs were constructed, infected 293T cells, and only transduced cells were obtained through Puromycin selection, followed by Tet2 antibody Western blot was performed using .
  • the shRNAs listed in Table 1 were cloned into the pLKO.1-puro vector.
  • the pLKO.1-puro vector (#8453) purchased from Addgene was digested with AgeI and EcoRI.
  • Sense primers and antisense primers having the target sequences in Table 1 were custom-made by Macrogen.
  • Sense primers and antisense primers were annealed.
  • the primer duplex was cloned into the pLKO.1-puro vector using ligase.
  • 293T cells were cultured in DMEM medium (SH30243.01, Hyclone) containing 10% FBS (16000-044, Hyclone).
  • Transfer vector pLKO.1-puro vector
  • packaging vector pLKO.1-puro vector
  • envelope vector pLKO.1-puro vector
  • the medium was changed after 24 hours, and virus soups were collected after 24 and 48 hours. After filtering the virus soup with a 0.45 ⁇ m filter (SLHPR33TB, Millipore corp.), it was stored at -70 ° C.
  • the pLKO.1 virus soup obtained in Example 1-2 was infected with 293T cells using polybrene (H9268, Sigma). After 3 days, cells were treated with puromycin (1 ⁇ g/ml). Cells were continuously grown for more than one week, and only 293T cells containing the gene were selected.
  • CAR-T cells were prepared using sh-A and sh-I, which effectively knocked down Tet2 in 293T cells.
  • the shRNA cloned pLKO.1-tet2 sh-A and pLKO.1-tet2 sh-I vectors were digested with BamHI and NsiI. After PCR of the CD19 CAR gene, it was inserted into the pLKO.1 sh-A and pLKO.1-tet2 sh-I vectors using ligase to secure vectors in which Tet2 knockdown and CD19-CAR expression were simultaneously implemented (FIG. 2). Lentiviral particles were made through 293T cells using each vector.
  • PBMCs were grown in 100 mm culture plates.
  • dynabead human T-activator CD3/CD28 (11132D, Thermofisher) and IL-2 (202-IL-500, R&D system) were added.
  • T cells were infected with lentivirus containing pLKO.1 sh-A vector and pLKO.1-tet2 sh-I vector. 4 days after infection, CAR expression was confirmed by western blot using lysate (FIG. 3).
  • CD3 ⁇ antibody 51-6527GR, BD bioscience
  • Immunosuppressive receptors are known to function to suppress the activation of T cells.
  • changes in immunorepressor expression in T cells, CAR-T cells, and TET2-inactivated CAR-T cells were measured by FACS analysis.
  • 3 X 10 6 cells of T cell, CD19 CAR T cell, and TET2-shRNA-CD19 CAR T cell were prepared, respectively, and samples were prepared with 1 mL of cold stain buffer (0.2% BSA, 0.08% NaN3 in PBS). washed once. (4 °C, 4000 rpm, 5 min) The supernatant of the last wash step was discarded, and each sample was released with 300 ⁇ L of cold stain buffer.
  • CAR-T cells were administered to immunodeficient mice, and then tumor proliferation and survival rates of the mice were measured.
  • CAR-T cells in which TET2 was suppressed by shRNA particularly CAR-T cells expressing sh-A, showed significantly improved therapeutic efficacy compared to conventional CAR-T cells.
  • CAR-T cells were inoculated into CD19-expressing cells or non-CD19-expressing cells. After administration, tumor cell inhibitory activity was compared as follows.
  • control T cells (Control T cells), CD19 CAR T cells targeting CD19, CD19 CAR-Tet2 sh A cells and CD19 CAR-Tet2 sh I cells prepared in Example 2 above were used as CD19-expressing NALM6 Cells or 293T cells that do not express CD19 were co-cultured in a 96-well plate at an E:T ratio of 10:1. After 4 hours of culture, lysis of target cells was confirmed by measuring luminescence using luciferase expressed in NALM6 cells or 293T cells that do not express CD19.
  • CD19 CAR-T cells expressing sh-A exhibited lytic properties of killing about 50% of NALM6 tumor cells expressing CD19, whereas CD19 expressing sh-I CAR-T cells were confirmed to exhibit similar levels of tumor cytolytic properties to CD19 CAR T cells that do not inhibit TET2. Furthermore, it was confirmed that 293T cells, which do not express CD19, showed almost no cytolytic properties in all experimental groups.
  • CD19 CAR-T cells expressing sh-A increase the activity of CAR T cells targeting CD19, thereby exhibiting excellent anti-tumor effects.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Hematology (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physics & Mathematics (AREA)
  • Developmental Biology & Embryology (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Toxicology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 TET2 발현 억제제를 포함하는 면역세포 활성 향상용 조성물 및 활성이 향상된 면역세포의 제조 방법에 관한 것이다. 또한, 본 발명은 TET2 억제제를 암호화하는 핵산을 포함하는 재조합 벡터, 상기 재조합 벡터가 형질 도입된 활성이 향상된 면역세포 및 상기 면역세포를 포함하는 암 치료용 약학적 조성물에 관한 것이다.

Description

증진된 효능을 갖는 면역세포
본 발명은 면역세포 활성 향상용 조성물, 활성이 향상된 면역세포의 제조 방법, 활성이 향상된 면역세포 및 그 이용에 관한 것이다.
세포치료제는 손상되었거나 질병이 있는 세포, 조직, 개체를 회복시키기 위해 살아있는 세포를 사용해 재생 등의 치료 효능을 유도하는 의약품으로, 그 중에서, 면역조절 세포치료제란 수지상세포(dendritic cell), 자연살해세포(natural killer cell, NK cell), T 세포 등의 면역세포를 이용하여 체내의 면역반응을 조절하여 질병을 치료할 목적으로 사용되는 의약품이다.
상기 면역조절 세포치료제는 환자로부터 분리한 PBMC(peripheral blood mononuclear cell), T 세포, NK 세포 등의 다양한 면역세포를 다양한 항체 및 사이토카인으로 활성화 시킨 뒤, 이를 체외에서 증식시켜 다시 환자에게 주입하거나, T 세포 수용체(T-Cell Receptor, TCR)이나 키메라 항원 수용체(Chemeric Antigen Receptor, CAR) 등의 유전자를 도입한 면역세포를 환자에게 다시 주입하는 방식으로 이루어진다.
CAR는 암세포의 세포 표면 항원을 인식하는 단일사슬 항체와 T 세포의 활성화를 유도하는 신호 전달 영역을 융합시킨 인공적인 키메라 단백질이다. 종양 반응성을 갖지 않는 통상적인 말초혈 T 세포(말초혈 T 림프구)에 CAR을 코딩하는 유전자를 도입함으로써, CAR을 발현하는 CAR 발현 T 세포(이하, 'CAR-T 세포' 라고 한다)를 대량으로 제작하는 것이 가능해진다. 이러한 CAR-T 세포는 종양 반응성을 가져, 주요 조직 적합 유전자 복합체(MHC)와의 상호작용에 의존하지 않고 암세포의 상해를 이끌어내는 것이 가능해진다.
CAR-T 세포 치료제는 특히 혈액종양을 대상으로 한 임상시험에서 극적인 효과를 보임으로써 주목 받게 되었다. 즉, B 림프구계 혈액종양 항원인 CD19을 인지하는 항체를 이용한 CAR-T 세포 치료의 경우, 기존 모든 치료에 불응했던 급성림프구성 백혈병 환자를 대상으로 한 초기 임상시험에서 90%의 환자(30명중 27명)가 한달 이내에 완전 관해를 이루었으며, 6개월 전체 생존율이 78%에 달하는 놀라운 치료 효과를 보였다. 이러한 결과를 바탕으로 2017년 말에 2종의 CD19 CAR-T 세포 치료제가 FDA 승인 하에 상업화에 성공하였다.
현재 CAR-T 세포 치료의 성공사례는 CD19 양성 급성백혈병에 국한되어 있으며, 고형 종양의 경우, 그 치료 효율이 떨어지는 것으로 보고되고 있다. 일 예로, CAR-T 세포가 림프절에서 풍부한 양의 악성 B 세포에 노출되는 혈액 종양에서 또는 흑색종과 같은 고도 면역원성 종양의 치료 동안, 강력한 활성화 프로필 및 강한 세포독성 효과를 야기하는 것과는 대조적으로, 고형 종양의 CAR-T 치료법 동안, 종양 항원에 대한 제한된 노출로부터 생성되는 약하게 활성화된 T 세포는 불안정한 면역 반응, 무기력한 클론 증대 및 조기 클론 축소를 야기한다.
이러한 클론 축소 및 약한 T 세포 활성화 문제를 극복하기 위한 다양한 방법이 채택되어 온건한 성공을 거두었다. 예를 들어, 클론 축소를 극복하고, 신속한 증식을 촉진하고, 사이토카인 결핍을 극복하기 위해, CD28 신호전달 분자가 CAR의 세포내 부분에 추가된 2세대 CAR-T 세포를 제작하였다. 그러나, 2세대 CAR-T 세포는 고형 종양에서는 치료 효율이 떨어졌다. 이에, 41BB 및/또는 OX40과 같은 부가된 공동자극 분자를 갖는 "3세대" CAR을 생성하기 위해 추가 변형이 수행되었다. 또한, 전달된 T 세포를 생존하고 기능하도록 유지하기 위해 환자는 일상적으로 IL-2 치료법으로 치료되어, 치료 T 세포에 의한 제어되지 않는 사이토카인 생산을 일으킨다. 이러한 방법은 고형 종양의 치료에서 어느 정도까지 T 세포 활성화를 증강시킬 수 있었지만, 클론 축소를 완전히 극복하고 T 세포의 신속한 증식 및 활성화를 촉진하여 T 세포의 기능을 보다 향상시킬 필요성이 여전히 존재한다.
세포 내에서 siRNA, shRNA 등이 유전자 발현을 억제하는 RNA interference(RNAi) 메커니즘은 암, 감염성 질환과 관련된 유전자를 제어할 수 있다는 점에서 치료제로서의 가능성이 높으며, 난치성 암질환의 치료에 RNAi 현상을 이용한 유전자 치료가 새롭게 조명되고 있다. RNAi는 높은 서열 특이성을 가지므로 RNAi 시스템은 특이적으로 한 가지 유형의 전사물을 녹다운(knockdown) 시킬 수 있으며, 서열이 비슷한 기타 mRNA에 영향을 주지 않는다. 이러한 특성은 RNAi 메커니즘이 유전자 발현 억제, 유전자 기능 연구와 약물 표적 검증 방면에서의 잠재력과 가치를 갖도록 한다. 또한, RNAi 메커니즘은 (1) 유전자의 과발현 또는 잘못된 발현에 의한 질병; (2) 유전자 돌연변이에 의한 질병을 포함한 관련 질병의 치료에 사용될 수 있다.
본 발명의 일 목적은 면역세포 활성 향상용 조성물 및 활성이 향상된 면역세포의 제조방법을 제공하는 것이다.
본 발명의 다른 일 목적은 활성이 향상된 면역세포를 제조하기 위한 재조합 벡터를 제공하는 것이다.
본 발명의 또 다른 일 목적은 활성이 향상된 면역세포를 제공하는 것이다.
본 발명의 또 다른 일 목적은 활성이 향상된 면역세포를 포함하는 암 치료용 약학적 조성물을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명의 일 측면은 TET2(Tet Methylcytosine Dioxygenase 2) 억제제를 포함하는 면역세포 활성 향상용 조성물을 제공한다.
본 발명의 다른 측면은 면역세포에 TET2 억제제를 주입하는 단계를 포함하는 활성이 향상된 면역세포의 제조 방법을 제공한다.
본 발명의 또 다른 측면은 TET2 억제제를 암호화하는 핵산을 포함하는 재조합 벡터를 제공한다.
본 발명의 또 다른 측면은 상기 재조합 벡터가 형질 도입된, 활성이 향상된 면역세포를 제공한다.
본 발명의 또 다른 측면은 상기 활성이 향상된 면역세포를 유효성분으로 포함하는 암 치료용 약학적 조성물을 제공한다.
본 발명에서는 cDNA가 약 6000bp에 달하는 긴 TET2를 효과적으로 녹다운(knockdown) 시키는 표적 서열 및 shRNA를 선별하고 이를 이용하여 TET2가 녹다운된 면역세포를 제작하였다. 본 발명의 shRNA에 의해 TET2가 녹다운된 면역세포는 TET2가 녹다운되지 않거나 다른 종류의 shRNA에 의해 녹다운된 면역세포에 비해 향상된 종양 치료 효율을 나타내므로, 암 치료를 위한 면역세포 치료에 유용하게 사용될 수 있다.
본 발명의 효과는 상기에서 언급한 효과로 제한되지 아니하며, 언급되지 않은 또 다른 효과들은 하기의 기재로부터 당업자에게 명확히 이해될 수 있을 것이다.
도 1은 TET2 shRNA를 도입한 293T 세포에서 shRNA 반응으로 인한 TET2의 녹다운 효율을 웨스턴 블롯으로 확인한 것이다.
도 2의 A는 키메라 항원 수용체(CAR)를 암호화하는 핵산 및 TET2 억제제를 암호화하는 핵산을 포함하는 재조합 벡터의 모식도를 나타낸 것이고, 도 2의 B는 CD19 CAR의 유전자를 나타낸 것이다.
도 3은 재조합 벡터가 T 세포에 도입되어 CAR를 발현하는지 여부를 웨스턴 블롯을 통해 확인한 것이다.
도 4는 TET2가 녹다운 된 CAR-T 세포가 일반적인 T 세포 및 CAR-T 세포와 비교하여 활성이 향상되는지 확인하기 위하여 면역억제수용체인 PD-1 및 Tim-3의 발현 수준을 FACS로 측정한 것이다.
도 5는 TET2가 녹다운 된 CAR-T 세포의 생체 내 항암 효능 개선 효과를 확인하기 위한 개략적인 실험 프로토콜을 나타낸 것이다.
도 6은 면역결핍마우스에 TET2가 녹다운 된 CAR-T 세포를 투여한 후 이미징 장비(IVIS, PerkinElmer)를 이용하여 종양세포군이 방출하는 생체 내 발광(luminescence)의 세기를 통해 종양의 생체 내 증식 정도를 나타낸 것이다.
도 7은 면역결핍마우스에 TET2가 녹다운 된 CAR-T 세포를 투여한 후 마우스의 생존율을 나타낸 것이다.
도 8은 sh-A 또는 sh-I를 발현하는 CD19 CAR-T 세포의 인 비트로 항암 효능을 확인하기 위하여, CD19를 발현하는 세포 또는 CD19를 발현하지 않는 세포에 CAR-T 세포를 투여한 후, 종양 세포 억제 활성을 확인한 도이다.
이하, 본 발명을 상세히 설명한다.
본 발명의 일 측면은 TET2(Tet Methylcytosine Dioxygenase 2) 억제제를 포함하는 면역세포 활성 향상용 조성물을 제공한다.
상기 활성 향상은 생존율 향상, 증식 속도 향상 및 사이토카인 발현 증가로 이루어진 군으로부터 선택된 1종 이상일 수 있다. 활성이 향상된 면역세포는 일반적인 면역세포와 비교하여 월등하게 향상된 종양 치료 효율을 나타낼 수 있다.
본 발명의 구체적인 실시예에서는 TET2 억제제가 도입된 CAR-T 세포는 TET2 억제제가 도입되지 않은 CAR-T 세포 보다 PD-1, TIM-3과 같은 면역억제수용체의 발현이 감소하는 것으로부터 TET2 억제에 의해 면역세포의 활성이 향상됨을 확인하였다.
상기 “TET2(Tet Methylcytosine Dioxygenase 2)”는 5-메틸시토신을 5-히드록시메틸시토신으로 전환하는 단백질을 암호화하는 유전자들(TET1, TET2, TET3) 중 하나로, DNA 메틸화 유지에 관여하는 것으로 알려져 있다. DNA 메틸화/탈메틸화는 조혈 분화 전반에 걸쳐 동적으로 조정되며 TET 단백질은 조혈 및 면역 세포 활성화 및 확장 동안 DNA 메틸화의 균형을 통해 유전자 발현 수준을 조절한다. 상기 TET2 유전자의 mRNA 및 단백질의 서열 정보는 공지된 유전자 데이터베이스에서 확인할 수 있다. 예를 들어, 인간 TET2의 핵산 서열은 Genbank No. BC150180.1 등에서 확인할 수 있다.
상기 "TET2 억제제"는 TET2의 발현 또는 활성을 감소시키는 제제를 모두 통칭하는 의미로 사용되며, TET2의 발현양을 전사(transcription), mRNA 수준, 또는 번역(translation) 수준에서 감소시키거나, TET2의 활성을 방해함으로써 TET2의 활성을 감소시키는 모든 제제를 포함할 수 있다. 상기 TET2 억제제는 TET2를 표적으로 하여 그 발현 또는 활성을 억제할 수 있는 화합물, 핵산, 펩타이드, 바이러스 또는 상기 핵산을 포함하는 벡터 등 그 형태에 제한없이 사용할 수 있다. 예를 들어, 상기 TET2 억제제는 TET2 유전자의 mRNA를 분해시키는 miRNA, siRNA 또는 shRNA, TET2 단백질의 발현을 감소시키는 안티센스 올리고뉴클레오티드 등 일 수 있다.
예시적인 일 구현예에서, 상기 TET2 억제제는 shRNA일 수 있다.
상기 “shRNA”는 siRNA의 고가의 생합성 비용, 낮은 세포 형질감염 효율로 인한 RNA 간섭 효과의 단시간 유지 등의 단점을 극복하기 위한 것으로 RNA 중합효소 Ⅲ의 프로모터로부터 아데노 바이러스, 렌티 바이러스 및 플라스미드 발현 벡터 시스템을 이용하여 이를 세포 내로 도입하여 발현시킬 수 있다. 이러한 shRNA는 세포 내에 존재하는 siRNA 프로세싱 효소(Dicer or Rnase Ⅲ)에 의해 정확한 구조를 갖는 siRNA로 전환되어 목적 유전자의 사일런싱을 유도하는 것으로 알려져 있다. 상기 siRNA는 특정 mRNA의 절단을 통하여 RNAi 현상을 유도할 수 있는 짧은 이중사슬 RNA를 의미하고, 표적 유전자의 mRNA와 상동인 서열을 가지는 센스 RNA 가닥과 이와 상보적인 서열을 가지는 안티센스 RNA 가닥으로 구성된다. 상기 shRNA 또는 siRNA는 표적 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 녹다운 방법으로서 또는 유전자 치료의 방법으로 제공될 수 있다.
예시적인 일 구현예에서, 상기 shRNA를 암호화 하는 핵산은 서열번호 10 또는 서열번호 18의 염기서열을 갖는 것일 수 있고, 이의 동족체, 동종형, 변이체, 유도체, 단편 등의 합성, 변형된 것일 수 있으며, 예를 들어, 서열번호 10 또는 서열번호 18의 염기서열에서 중앙에 존재하는 loop sequence(아래 표 1의 밑줄)가 변형된 것일 수 있다.
상기 TET2 억제제는 서열번호 1 또는 서열번호 9로 표시되는 염기서열을 표적 서열로 하는 것일 수 있다.
상기 “표적 서열”은 표적 유전자 또는 핵산 내에 존재하는 염기서열로, TET2 억제제에 포함되는 핵산 서열과 상보적인 핵산 서열일 수 있으며, 예를 들어 최소한 70%, 75%, 80%, 85%, 90% 또는 95% 이상의 상보적이거나 또는 완전하게 상보적인 핵산 서열일 수 있다.
예시적인 일 구현예에서, 상기 TET2 억제제는 TET2의 핵산 서열 중 서열번호 1 또는 서열번호 9의 표적 서열에 상보적인 결합을 형성하는 shRNA일 수 있다.
본 발명의 구체적인 실시예에서는 TET2 유전자에 포함된 다양한 표적 서열에 결합하는 shRNA를 도입한 후, TET2 유전자의 발현 수준을 웨스턴 블롯으로 확인한 결과, 서열번호 1 또는 서열번호 9의 표적 서열에 상보적인 결합을 형성하는 shRNA가 다른 표적 서열에 결합하는 shRNA 보다 TET2 유전자의 발현을 월등하게 억제하는 것을 확인하였다.
상기 면역세포는 면역반응에 관여하는 세포로서, 면역반응에 직접 또는 간접적으로 관여하는 모든 세포 및 이들의 분화하기 전 세포를 포함한다. 상기 분화하기 전 세포는 자가 복제와 분화 능력을 가진 배아줄기세포, 성체줄기세포, 유도만능줄기세포 일 수 있다.
상기 면역세포는 사람 유래의 면역세포나, 개, 고양이, 돼지, 마우스 등의 비인간 포유동물 유래의 면역세포일 수 있다. 또한, 상기 면역세포는 혈액, 골수액 등의 체액이나, 비장, 흉선, 림프절 등의 조직, 또는 원발 종양, 전이성 종양, 암성 복수 등의 암 조직에 침윤하는 면역세포로부터 단리, 정제하여 얻을 수 있다.
상기 면역세포는 CD3 양성 세포일 수 있고, 예를 들어, T 세포일 수 있다.
상기 면역세포는 CD56 양성 세포일 수 있고, 예를 들어, NK 세포일 수 있다.
상기 면역세포는 CD3 및 CD56 이중 양성 세포일 수 있고, 예를 들어, NKT(Natural Killer T)세포 또는 CIK(Cytokine Induced Killer cell)일 수 있다.
본 발명의 다른 일 측면은, 면역세포에 TET2 억제제를 주입하는 단계를 포함하는, 활성이 향상된 면역세포의 제조 방법을 제공한다.
상기 면역세포 및 TET2 억제제에 대한 설명은 상기에서 기술한 바와 같다.
상기 주입하는 단계는 생체 내 또는 생체 외에서 수행될 수 있다.
상기 주입하는 방법으로는 전기천공법 (electroporation), 리포좀, 플라스미드, 바이러스 벡터 및 나노파티클(nanoparticles) 중 선택되는 1 이상의 방법일 수 있다.
상기 바이러스 벡터는 레트로바이러스, 렌티바이러스, 아데노바이러스, 아데노-연관 바이러스, 백시니아바이러스, 폭스바이러스 및 단순포진 바이러스로 구성된 군에서 선택되는 1이상 일 수 있다.
상기 TET2 억제제는 TET2 유전자의 mRNA를 분해시키는 miRNA, siRNA 또는 shRNA, TET2 단백질의 발현을 감소시키는 안티센스 올리고뉴클레오티드 등 일 수 있고, 경제성 및 지속성의 측면에서 shRNA를 이용할 수 있다.
본 발명의 또 다른 일 측면은, TET2 억제제를 암호화하는 핵산을 포함하는 재조합 벡터를 제공한다.
구체적인 실시예에서 상기 TET2 억제제는 shRNA 일 수 있다.
상기 shRNA를 전달하기에 유용한 벡터는 바이러스 벡터일 수 있고, 상기 바이러스는 레트로바이러스, 렌티바이러스, 아데노바이러스, 아데노-연관 바이러스, 백시니아바이러스, 폭스바이러스 및 단순포진 바이러스로 구성된 군에서 선택되는 1종 이상 일 수 있다.
상기 재조합 벡터는 당해 분야서 공지된 재조합 DNA 방법에 의해 구성될 수 있다.
바이러스에 상기 shRNA를 도입하기 위하여, shRNA 서열을 근거로 하여 서열번호 10 또는 서열번호 18로 표시되는 염기서열을 갖는 핵산을 제작할 수 있다.
상기 TET2의 발현을 억제하는 shRNA는 전달된 세포에서 적절히 전사되기 위하여 적어도 프로모터에 작동 가능하게 연결되는 것이 바람직하다. 상기 프로모터는 진핵세포에서 기능할 수 있는 프로모터라면 어떤 것이든지 무방하고, 예를 들어 RNA 중합효소 Ⅲ로서 small size RNA 생성에 유리한 U6 프로모터를 사용할 수 있다. TET2 발현을 억제하는 shRNA의 효율적인 전사를 위하여 필요에 따라 리더 서열, 폴리아데닐화 서열, 프로모터, 인핸서, 업스트림(upstream) 활성화 서열, 시그널 펩타이드 서열 및 전사 종결인자를 비롯한 조절서열을 추가로 포함할 수도 있다.
상기 "작동 가능하게 연결된"이란 핵산 서열간의 결합이 기능적으로 연관되어 있는 것을 의미한다. 임의의 핵산 서열이 작동 가능하게 연결된 경우는 임의의 핵산 서열이 다른 핵산 서열과 기능적으로 관련성을 가지도록 위치해 있는 경우이다. 예를 들어, 임의의 전사 조절서열이 shRNA의 전사에 영향을 미치는 경우, 상기 전사 조절서열이 상기 shRNA에 작동 가능하게 연결되어 있다고 말한다.
상기 재조합 벡터는 키메라 항원 수용체(CAR)를 암호화 하는 핵산을 추가적으로 포함할 수 있다.
상기 “CAR를 암호화하는 핵산”은 CAR를 구성하는 폴리펩티드를 암호화하는 핵산이면 특별히 제한되지 않고, 암세포의 세포 표면 항원을 인식하는 단일사슬 항체, 세포막 관통 도메인, 및 세포 내 신호 전달 도메인의 폴리펩티드를 암호화하는 핵산이 포함된다.
상기 단일사슬 항체는 단일 클론 항체의 항원 결합 부위에 유래하는 경쇄 가변 영역 및 중쇄 가변 영역(scFv)으로 이루어지고, 경쇄 가변 영역 및 중쇄 가변 영역의 사이에 링커 펩티드가 위치하는 올리고 또는 폴리펩티드를 들 수 있다.
상기 단일사슬 항체가 인식하는 암세포의 세포 표면 항원은 암세포 및 그 전구 세포에 특이적으로 발현하는 생체 분자, 세포의 암화에 의해 새롭게 발현이 확인되게 된 생체 분자, 또는 암세포에서 정상세포에 비해 발현 수준이 증가한 생체 분자일 수 있고, 예를 들어, CD20, EGFR, FITC, CD19, CD22, CD33, PSMA, GD2, EGFRvariant, ROR1, c-Met, HER2, CEA, 메소텔린, GM2, CD7, CD10, CD30, CD34, CD38, CD41, CD44, CD74, CD123　CD133, CD171, MUC16, MUC1, CS1(CD319), IL-13 Ra2, BCMA, LewisY, IgG kappa　chain, Folate　receptor-alpha, PSCA, EpCAM일 수 있다.
상기 세포 내 신호 전달 도메인은 상기 단일사슬 항체가 암세포의 세포 표면 항원을 인식했을 때 세포 내에 신호 전달하는 것이 가능한 영역으로, CD28, 4-1BB(CD137), GITR, CD27, OX40, HVEM, CD3ζ, Fc　Receptorassociated γ chain의 세포 내 도메인의 폴리펩티드에서 선택되는 적어도 1종 또는 2종 이상을 포함할 수 있다.
상기 세포 내 도메인의 폴리펩티드를 2종 이상 포함할 경우, 2 내지 10개의 아미노산으로 이루어지는 올리고 펩티드 링커 또는 폴리펩티드 링커를 통해 연결될 수 있고, 이러한 링커 서열은 예를 들어, 글리신-세린 연속 서열일 수 있다.
상기 세포막 관통 도메인은, CD8, T 세포 수용체의 α, β 사슬 CD28, CD3ε CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, GITR 유래의 세포막 관통 도메인의 폴리펩티드일 수 있다. 이러한 세포막 관통 도메인에 의해, CAR가 T 세포 등의 면역세포의 세포막에 고정된다.
상기 암세포의 세포 표면 항원을 인식하는 단일사슬 항체와 세포막 관통 도메인과 세포 내 신호 전달 도메인 사이는 임의의 올리고 펩티드 또는 폴리펩티드로 이루어지는 스페이서 영역을 설치할 수 있다. 스페이서 영역의 길이는 1 내지 100개의 아미노산 또는 10 내지 50개의 아미노산일 수 있고, 이러한 스페이서 영역은 예를 들어, 글리신-세린 연속 서열일 수 있다.
상기 CAR를 암호화하는 핵산과 TET2 억제제를 암호화하는 핵산의 사이에는, 각각의 핵산을 발현할 수 있는 한, 임의의 핵산을 포함할 수 있고, 예를 들어, 자기 절단형 펩티드(2A 펩티드) 또는 IRES(internal ribozyme entry site)를 코딩하는 서열을 통해 연결될 수 있다. 이러한 서열을 이용하여 연결함으로써 각각의 핵산을 효율적으로 발현할 수 있다.
상기 CAR를 암호화하는 핵산은 암세포의 세포 표면 항원에 대한 단일사슬 항체, 세포막 관통 도메인, 및 세포 내 신호 전달 도메인의 폴리펩티드를 암호화하는 염기 서열을 바탕으로 화학 합성하는 방법이나, PCR 에 의해 증폭하는 방법 등의 공지된 기술로 제작할 수 있다.
또한, 상기 암세포의 세포 표면 항원에 대한 단일사슬 항체, 세포막 관통 도메인, 및 세포 내 신호 전달 도메인의 폴리펩티드를 암호화하는 염기 서열의 정보는 공지된 문헌이나 NCBI(http://www.ncbi.nlm.nih.gov/guide/) 등의 데이터베이스를 검색하여 적절히 입수할 수 있다.
본 발명의 또 다른 일 측면은, 상기 재조합 벡터가 도입된, 활성이 향상된 면역세포를 제공한다.
상기 활성 향상은 생존율 향상, 증식 속도 향상 및 사이토카인 발현 증가로 이루어진 군으로부터 선택된 1종 이상 일 수 있다.
상기 활성이 향상된 면역세포는 TET2가 비활성화된 면역세포일 수 있다.
상기 TET2의 비활성화는 TET2 유전자 또는 단백질의 발현 조절을 통해 이루어질 수 있고, TET2는 면역세포의 증식, 생존 및/또는 기능에 영향을 미치는 내인성 유전자이므로 TET2의 비 암호 또는 암호 영역의 일부 또는 전부를 타겟팅하여 TET2 유전자 또는 단백질의 발현을 조절할 수 있다.
상기 TET2의 발현 조절은 mRNA의 분해 또는 번역 억제를 통해 이루어 질 수 있고, 조절 결과로서, 녹다운(Knock down), 녹아웃(knock out)의 형태를 모두 포함할 수 있다.
상기 “녹다운(knock down)”은 표적 유전자 또는 핵산의 전사 및/또는 번역을 감소시키거나 표적 단백질의 발현을 감소시키는 것을 의미한다. 녹다운을 통해 과발현 되는 TET2 유전자 또는 단백질의 발현을 조절하여 면역세포의 활성을 향상시킬 수 있다.
상기 “녹아웃(knock out)”은 표적 유전자 또는 핵산을 불활성화 시키는 것을 의미하며, 표적 유전자 또는 핵산의 불활성화는 표적 유전자 또는 핵산의 전사 및/또는 번역이 되지 못하는 상태를 의미한다. 녹아웃을 통해 TET2 유전자의 전사 및 번역을 억제하여 TET2 단백질의 발현을 막을 수 있다.
상기 타겟팅은 예를 들어, TET2 유전자의 프로모터 영역, 또는 전사 서열, 예를 들어 인트론 또는 엑손 서열을 표적으로 할 수 있고, 암호 서열, 예를 들어 암호 영역, 초기 암호 영역은 발현의 변경 및 녹아웃을 위한 표적이 될 수 있다.
구체적인 실시예에서, 상기 유전자 또는 단백질의 발현 조절은 shRNA가 세포 내로 주입된 후 RNAi 메커니즘이 일어나서 TET2 유전자의 mRNA를 분해하거나 번역을 억제하여 TET2 유전자를 불활성화 시키는 것일 수 있다.
상기 면역세포는 면역반응에 관여하는 세포로서, 면역반응에 직접 또는 간접적으로 관여하는 모든 세포 및 이들의 분화하기 전 세포를 포함한다. 상기 분화하기 전 세포는 자가 복제와 분화 능력을 가진 배아줄기세포, 성체줄기세포, 유도만능줄기세포 일 수 있다.
상기 면역세포는 사람 유래의 면역세포나, 개, 고양이, 돼지, 마우스 등의 비인간 포유동물 유래의 면역세포일 수 있다. 또한, 상기 면역세포는 혈액, 골수액 등의 체액이나, 비장, 흉선, 림프절 등의 조직, 또는 원발 종양, 전이성 종양, 암성 복수 등의 암 조직에 침윤하는 면역세포로부터 단리, 정제하여 얻을 수 있다.
상기 면역세포는 CD3 양성 세포일 수 있고, 예를 들어, T 세포일 수 있다.
상기 면역세포는 CD56 양성 세포일 수 있고, 예를 들어, NK 세포일 수 있다.
상기 면역세포는 CD3 및 CD56 이중 양성 세포일 수 있고, 예를 들어, NKT(Natural Killer T)세포 또는 CIK(Cytokine Induced Killer cell)일 수 있다.
상기 T 세포로는, αβT 세포, γδT 세포, CD8 양성 T 세포 (e.g., CD8+ naive T 세포, CD8+ effector T 세포, central memory T 세포, 또는 effector memory T 세포), CD4 양성 T 세포, 자연 살해 T(Natural Killer T, NKT) 세포, 조절 T 세포 (regulatory T cell, Treg), 기억 T 세포(memory T cell), 종양 침윤 T 세포, 림프구 전구세포 (lymphoid progenitor cell), 조혈모세포(hematopoietic stem cell), 말초혈액 단핵세포(Peripheral blood mononuclear cell, PBMC)에서 분리한 T 세포 등으로 이루어진 군에서 선택된 1종 이상일 수 있다.구체적인 실시예에서, 상기 면역세포는 키메라 항원 수용체(chimeric antigen receptor, CAR)를 발현하는 면역세포 일 수 있다. 상기 CAR 발현 면역 세포에서 발현하는 단일사슬 항체는 세포 외 영역에 위치하고, 이러한 단일사슬 항체를 구비함으로써, CAR 발현 면역세포는 암세포의 표면 상에 발현되는 종양 관련 항원(TAA)을 인식하는 것이 가능해진다.
구체적인 실시예에서, 상기 키메라 항원 수용체(CAR)는 CD19에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편을 포함하는 것일 수 있다. 상기 CD19는 세포표면항원무리(Cluster of Differentiation; CD)로서 면역표현형에 따라 세포 표면 분자를 식별하는 번호 19를 할당한 것으로, 상기 CD19는 대부분의 B 세포, 악성 종양 암세포에서 발현하여 이들 암종에 대한 이상적인 표적을 제공하는 것으로 알려져 있다.
상기 재조합 벡터를 면역세포에 도입하는 방법으로는 특별히 제한되지 않지만, 바이러스 감염법, 칼슘 인산법, 리포펙션법, 마이크로인젝션법, 일렉트로포레이션법 등의 공지된 방법에 의해 도입하는 방법을 들 수 있다.
상기 바이러스 감염법은 상기 재조합 벡터와 패키징 플라스미드를 패키징 세포에 트랜스펙션하여 재조합 바이러스를 제작하고, 이러한 재조합 바이러스를 T 세포에 감염시키는 방법일 수 있다.
면역세포에 대한 재조합 벡터의 도입은 유동세포계수법, 노던블롯팅, 서던블롯팅, RT-PCR 등의 PCR, ELISA, 웨스턴 블롯팅에 의해 CAR의 발현을 조사하는 것에 의해 확인할 수 있다.
본 발명의 또 다른 일 측면은 상기 활성이 향상된 면역세포를 유효성분으로 포함하는 암의 치료용 약학적 조성물을 제공한다.
본 발명의 구체적인 실시예에서는 TET2 억제제가 도입된 면역세포를 면역결핍마우스에 처리하였을 때 TET2 억제제가 도입되지 않은 면역세포를 처리하는 경우와 비교하여 종양의 증식을 억제하는 능력이 훨씬 향상되고 면역결핍마우스의 생존율이 월등하게 증가하는 것을 확인하였다.
상기 “암”과 “종양”은 동일한 의미로 사용되며, 전형적으로 조절되지 않은 세포 성장/증식을 특징으로 하는 포유동물의 생리학적 상태를 지칭하거나 의미한다.
상기 암은 혈관 생성된 종양뿐만 아니라 혈관이 생성되지 않거나 아직까지 실질적으로 혈관이 생성되지 않는 종양을 포함한다. 상기 암은 비-고형 종양(예를 들어, 혈액학적 종양, 예를 들어 백혈병 및 림프종)을 포함할 수 있거나, 고형 종양을 포함할 수 있다. 상기 암의 유형으로는 암종, 아세포종, 및 육종, 및 특정 백혈병 또는 림프성 악성 종양, 양성 및 악성 종양, 예를 들어, 육종, 암종 및 흑색종을 들 수 있지만, 이에 제한되지 않는다. 성인성 종양/암 및 소아성 종양/암이 또한 포함된다.
상기 혈액암은 혈액 또는 골수의 암이다. 혈액(또는 조혈성) 암의 예로는 급성 백혈병(예를 들어, 급성 림프구성 백혈병, 급성 골수성 백혈병 및 골수모세포성, 전림프구성, 골수 단구성, 단구성 및 적백혈병), 만성 백혈병(예를 들어, 만성 림프구성(과립구성) 백혈병, 만성 골수성 백혈병, 및 만성 림프구성 백혈병), 진성 적혈구 증가증, 림프종, 호지킨병, 비-호지킨 림프종(지연형 및 높은 단계의 형태), 다발성 골수종, 왈덴스트룀 마크로글로불린 혈증(Waldenstrom's macroglobulinemia), 중쇄 질병, 골수이형성 증후군, 모발 세포 백혈병 및 골수이형성증을 포함한 백혈병을 들 수 있다.
고형 종양은 일반적으로 피낭 또는 액체 구역을 포함하지 않는 비정상적인 조직 덩어리이다. 고형 종양은 양성 또는 악성일 수 있다. 상이한 유형의 고형 종양은 이들(예를 들어, 육종, 암종 및 림프종)을 형성하는 세포의 유형에 대해 명명되어 있다. 육종 및 암종과 같은 고형 종양의 예로는 섬유육종, 점액육종, 지방육종, 연골육종, 골육종, 및 기타 육종, 윤활막종(synovioma), 중피종(mesothelioma), 유위(Ewing) 종양, 평할근육종, 횡문근육종, 직장 암종, 림프성 악성 종양, 대장암, 위암, 췌장암, 유방암, 폐암, 난소암, 전립선암, 인후두암, 간세포성 암종, 편평 세포 암종, 기저 세포 암종, 선암, 땀샘 암종, 수질 갑상선 암종, 유두성 갑상선 암종, 갈색 세포종, 피지선 암종, 유두성 암종, 유두성 선암, 수질성 암종, 기관지 암종, 신장 세포 암종, 간종양, 담관 암종, 융모막암종, 윌름즈 종양(Wilms' tumor), 자궁 경부암, 고환 종양, 정상피종(seminoma), 방광암, 흑색종, 및 CNS 종양(예를 들어, 신경교종(예를 들어,뇌간 신경교종 및 혼합형 신경교종), 교아세포종(다형성 교아세포종으로도 공지됨), 성상세포종, CNS 림프종, 배아세포종, 수질아세포종, 신경초종 두개인두종(Schwannoma craniopharyogioma), 상의세포종(ependymoma), 송과체종(pinealoma), 혈관모세포종, 청신경종(acoustic neuroma), 희소돌기 아교세포종(oligodendroglioma), 수막종, 신경아세포종, 망막아세포종 및 뇌전이)을 들 수 있다.
상기 “치료”는 본 발명의 조성물의 투여로 암을 억제시키거나 진행을 지연시키는 모든 행위를 의미하며, 암의 발전의 억제, 증상의 경감 또는 제거를 포함한다.
상기 약학 조성물에는 약제학적으로 허용되는 부형제가 추가적으로 포함될 수 있다. 그러한 부형제의 예로는, 계면활성제, 바람직하게는 폴리소르베이트 계열의 비이온성 계면활성제; 중성 완충 염수, 인간염 완충 염수 등의 완충제; 글루코스, 만노스, 수크로스 또는 덱스트란, 만니톨 등의 당 또는 당알콜류; 글리신, 히스티딘 등의 아미노산이나 단백질 또는 폴리펩티드; 항산화제; EDTA 또는 글루타티온 등의 킬레이트제 예컨대; 침투제; 보조제; 및 보존제가 포함될 수 있지만, 이에 한정되는 것은 아니다.
상기 약학적 조성물은 인간을 제외한 포유동물에 투여된 후 활성 성분의 신속, 지속 또는 지연된 방출을 제공할 수 있도록 당업계에 공지된 방법을 사용하여 제형화될 수 있다. 제형은 분말, 과립, 정제, 에멀젼, 시럽, 에어로졸, 연질 또는 경질 젤라틴 캅셀, 멸균 주사용액, 멸균 분말의 형태일 수 있다.
이하, 본 발명을 실시예 및 실험예에 의해 상세히 설명한다. 단, 하기 실시예 및 실험예는 본 발명을 예시하기 위한 것일 뿐, 본 발명의 내용이 하기 실시예 및 실험예에 의해 한정되는 것은 아니다.
[실시예 1]
Tet2의 침묵(silencing)을 효과적으로 유도하는 타겟 및 shRNA 선정
Tet2의 침묵을 효과적으로 유도하는 표적 서열을 찾기 위하여, 다양한 표적 서열에 결합하는 shRNA 및 shRNA를 발현하는 바이러스 벡터를 제작하고 293T 세포에 infection 한 후 Puromycin selection을 통해서 유전자 transduce 된 세포만을 획득한 후 Tet2 antibody를 이용해서 western blot을 수행하였다.
<1-1>. Tet2 녹다운 플라스미드 구축
Tet2를 knockdown 시키기 위해 표 1에 기재된 shRNA를 pLKO.1-puro vector에 클로닝하였다. Addgene에서 구매한 pLKO.1-puro vector (#8453) 를 AgeI과 EcoRI으로 절단하였다. 표 1의 표적 서열을 가지는 센스 프라이머와 안티센스 프라이머를 마크로젠에서 주문 제작하였다. 센스 프라이머와 안티센스 프라이머를 annealing 하였다. Ligase 를 이용하여 프라이머 이중가닥을 pLKO.1-puro 벡터에 클로닝하였다.
shRNA
번호 		shRNA의 표적 서열 서열번호 Tet2 shRNA를 코딩하는 핵산 서열
번호
A TTTCACGCCAAGTCGTTATTT 1 CCGG TTTCACGCCAAGTCGTTATTT GCTAGC AAATAACGACTTGGCGTGAAA TTTTTG 10
B GCACACACATGTATATGTATA 2 CCGG GCACACACATGTATATGTATA GCTAGC TATACATATACATGTGTGTGC TTTTTG 11
C GCACCACCAGAAAACAAAA 3 CCGG GCACCACCAGAAAACAAAA GCTAGC TTTTGTTTTCTGGTGGTGC TTTTTG 12
D GGATGACCCAAAAGAGGAA 4 CCGG GGATGACCCAAAAGAGGAA GCTAGC TTCCTCTTTTGGGTCATCC TTTTTG 13
E GGAAACTAGAAGCCAAGAA 5 CCGG GGAAACTAGAAGCCAAGAA GCTAGC TTCTTGGCTTCTAGTTTCC TTTTTG 14
F GCAATCCAAACATGGACTA 6 CCGG GCAATCCAAACATGGACTA GCTAGC TAGTCCATGTTTGGATTGC TTTTTG 15
G GCATCTAGGAAAAGACCAA 7 CCGG GCATCTAGGAAAAGACCAA GCTAGC TTGGTCTTTTCCTAGATGC TTTTTG 16
H GCATAGTCATGGAACACAA 8 CCGG GCATAGTCATGGAACACAA GCTAGC TTGTGTTCCATGACTATGC TTTTTG 17
I GAAGCAGTTTCACGCCAAGTC 9 CCGG GAAGCAGTTTCACGCCAAGTC GCTAGC GACTTGGCGTGAAACTGCTTC TTTTTG 18
<1-2>. 렌티바이러스의 제작
293T 세포를 10% FBS (16000-044, Hyclone)가 포함된 DMEM 배지 (SH30243.01, Hyclone) 로 배양하였다. 293T cell에 transfer vector (pLKO.1-puro vector), packaging vector, envelope vector를 co-transfection 하였다. 24시간 후에 배지를 교환한 후 24시간과 48시간 후에 바이러스 수프를 모았다. 0.45μm filter (SLHPR33TB, Millipore corp.) 로 바이러스 수프를 필터 한 후 -70℃에서 보관하였다.
<1-3>. Tet2를 비활성화 시킨 293T 세포 제작
실시예 1-2에서 얻은 pLKO.1 바이러스 수프를 polybrene (H9268, Sigma)을 이용하여 293T cell에 infection하였다. 3일 뒤 puromycin (1μg/ml) 을 세포에 처리하였다. 일주일 이상 세포를 계속 키워서 유전자가 들어간 293T 세포만을 선택 하였다.
Cell lysate을 만든 후 Tet2 antibody (18950, CST) 를 이용하여 western blot을 수행하였다.
그 결과, 도 1에 나타난 바와 같이, 9개의 shRNA 중에서 sh-A와 sh-I가 Tet2의 발현을 효과적으로 억제함을 확인하였다. 이를 통해 tet2를 효과적으로 침묵시키는 표적 서열 및 shRNA를 선정하였다.
[실시예 2]
Tet2를 비활성화 시킨 CAR-T 세포의 제작
293T cell에서 Tet2를 효과적으로 녹다운한 sh-A과 sh-I을 이용하여 CAR-T cell을 제작하였다.
먼저, shRNA가 cloning된 pLKO.1-tet2 sh-A 와 pLKO.1-tet2 sh-I vector 를 BamHI 과 NsiI 으로 절단하였다. CD19 CAR 유전자를 PCR 한 후 ligase를 이용하여 pLKO.1 sh-A 및 pLKO.1-tet2 sh-I vector에 삽입하여 Tet2 knockdown과 CD19-CAR 발현이 동시에 구현되는 vector를 확보하였다(도 2). 각 vector를 이용하여 293T cell을 통해 lentiviral particle을 만들었다.
다음으로, PBMC를 100mm 배양 plate에서 증식시켰다. 여기에 dynabead human T-activator CD3/CD28 (11132D, Thermofisher) 와 IL-2 (202-IL-500, R&D system) 를 첨가하였다. 24시간 뒤에 pLKO.1 sh-A vector, pLKO.1-tet2 sh-I vector를 가지는 렌티바이러스를 T cell에 infection 하였다. Infection 후 4일 뒤에 lysate를 이용하여 western blot을 통해 CAR의 발현을 확인하였다(도 3). 이를 위해 CD3ζ antibody (51-6527GR, BD bioscience) 를 이용하였다.
[실시예 3]
TET2 비활성화에 의한 면역억제수용체의 발현 감소 효과
면역억제수용체는 T 세포의 활성화를 억제시키는 기능을 하는 것으로 알려져있다. TET2 비활성화가 면역세포의 활성화에 미치는 영향을 확인하기 위하여 T 세포, CAR-T 세포 및 TET2가 비활성화된 CAR-T 세포에서 면역억제수용체의 발현 변화를 FACS 분석을 통해 측정하였다.
구체적으로, T cell, CD19 CAR T cell, TET2-shRNA-CD19 CAR T cell을 각각 3 X 106 cells 씩 준비하여, cold stain buffer(0.2% BSA, 0.08% NaN3 in PBS) 1 mL로 샘플을 2번 세척하였다. (4 ℃, 4000 rpm, 5 min) 마지막 wash 단계의 상층액을 버리고, cold stain buffer 300 μL 로 각각의 sample을 풀어주었다. 풀어준 sample을 3개로 나누고 하나에는 Pacific Blue™ anti-human CD8 Antibody (344718, biolegend), PE anti-human CD279 (PD-1) Antibody (329905, biolegend)를 각각 3 μL 씩 넣어주고, 다른 하나에는 Pacific Blue™ anti-human CD8 Antibody (344718, biolegend), Human TIM-3 PE-conjugated Antibody (Fab2365P, R&D systems)를 3 μL 씩 넣어주고, 나머지 하나에는 항체를 넣지 않았다. 이후, 빛이 차단된 4 ℃ 환경에서 20분 동안 반응 시키고. cold stain buffer 1 mL로 sample을 2번 씻어 주었다. (4 ℃, 4000 rpm, 5 min) 마지막 세척 단계의 상층액을 버리고 Fixation buffer(4% Formaldehyde in PBS) 250 μL 로 cell을 풀어주고, 빛이 없는 4 ℃ 환경에서 10분 반응 시켰다. 반응을 마친 뒤, cold stain buffer 1 ml로 샘플을 2번 세척하였다. (4 ℃, 4000 rpm, 5 min) 그리고 마지막 세척 단계의 상층액을 버리고 cold stain buffer 500 μL로 각각 sample의 cell을 풀어주었다. O/N 후에 cell strainer snap cap tube를 이용하여 cell을 분리 시킨 뒤, FACS 기계로 형광을 측정하였다.
그 결과, 도 4에 나타난 바와 같이 PD-1 및 Tim-3 모두 일반 T 세포와 비교하여 CAR-T 세포에서 발현 수준이 증가하였으나, TET2가 비활성화된 CAR-T 세포에서는 발현이 다시 감소하는 것으로 나타났다.
이로부터, shRNA에 의해 TET2가 억제된 CAR-T 세포의 경우, 기존 CAR-T 세포에 비해 활성이 향상되는 것을 확인하였다.
[실시예 4]
Tet2가 비활성화된 CAR-T 세포의 생체 내 항암 효능 개선 효과
실시예 2에서 제작한 CAR-T 세포의 생체 내(in vivo) 항암 효능을 확인하기 위하여, 면역결핍마우스에 CAR-T 세포를 투여한 후, 종양의 생체 내 증식 및 마우스의 생존율을 측정하였다.
구체적으로, 면역결핍 NSG mice(Charles River)에 luciferase를 발현하는 종양 세포인 CD19-positive NALM6-luc 세포 1 X 106개를 꼬리로 정맥주사(IV injection) 하였다. 다음날 실시예 3에서 제작한 CAR-T 세포 1 X 107 개를 정맥주사 하였다. 이후, 30mg/mL Luciferin(122799, PerkinElmer) 100μL를 복강 주사(IP injection) 한 후 일주일 후부터 이미징 장비(IVIS, PerkinElmer)를 이용하여 종양세포군이 방출하는 생체 내 발광(luminescence)의 세기를 확인함으로써 항암 활성을 관찰하였다.
그 결과, 도 6에 나타난 바와 같이 sh-A 또는 sh-I를 발현하는 CD19 CAR-T 세포를 주입하였을 때 기존의 CD19 CAR-T 세포를 투여한 경우 보다 종양의 성장을 현저하게 저해함이 관찰되었다. 특히, sh-A를 발현하는 CD19 CAR-T cell를 투여한 군에서는 모든 종양세포가 제거된 것으로 확인되었다.
그 결과로, 기존의 CD19 CAR-T 세포를 투여받은 군은 종양 접종 후 30일 이내에 모든 개체가 사망하였으나, sh-I를 발현하는 CAR-T 세포와 sh-A를 발현하는 CAR-T 세포를 투여받은 마우스들은 30일 이후에도 생존하였고, 특히 sh-A를 발현하는 CAR-T 세포 투여군의 경우, 실험이 종료된 80일째까지도 모든 개체가 생존하였다(도 7).
이로부터, shRNA에 의해 TET2가 억제된 CAR-T 세포, 특히 sh-A를 발현하는 CAR-T 세포의 경우, 기존 CAR-T 세포에 비해 현저하게 개선된 치료 효능을 보이는 것이 확인되었다.
[실시예 5]
sh-A 또는 sh-I를 포함하는 CD19 CAR T 세포의 종양 세포 용해 활성 비교
상기 실시예 2에서 제작한 sh-A 또는 sh-I를 발현하는 CD19 CAR-T 세포의 인 비트로 항암 효능을 확인하기 위하여, CD19를 발현하는 세포 또는 CD19를 발현하지 않는 세포에 CAR-T 세포를 투여한 후, 종양 세포 억제 활성을 아래와 같이 비교하였다.
구체적으로, 대조군 T 세포(Control T cell), CD19를 표적으로 하는 CD19 CAR T cell, 상기 실시예 2에서 제작한 CD19 CAR-Tet2 sh A cell과 CD19 CAR-Tet2 sh I cell을 CD19를 발현하는 NALM6 세포 또는 CD19를 발현하지 않는 293T 세포와 96 웰 플레이트에서 E:T ratio는 10:1로 공배양(co-culture)시켰다. 배양 4시간 후 NALM6 세포 또는 CD19를 발현하지 않는 293T 세포에서 발현되는 루시퍼레이즈(luciferase)를 이용하여 luminescence를 측정함으로써 표적 세포의 용해 특성(lysis)을 확인하였다.
그 결과, 도 8에 나타난 바와 같이, sh-A를 발현하는 CD19 CAR-T 세포는 CD19를 발현하는 NALM6 종양 세포를 약 50% 사멸시키는 용해 특성을 나타내었으나, 이에 반해 sh-I를 발현하는 CD19 CAR-T 세포는 TET2를 억제하지 않는 CD19 CAR T 세포와 유사한 수준의 종양 세포 용해 특성을 나타내는 것으로 확인되었다. 나아가, 모든 실험군에서 CD19를 발현하지 않는 293T 세포에 대해서는 세포 용해 특성을 거의 나타내지 않는 것으로 확인되었다.
이로부터, sh-A를 발현하는 CD19 CAR-T 세포는 CD19를 표적으로 하는 CAR T 세포의 활성을 증가시켜, 매우 우수한 항 종양 효과를 나타냄을 알 수 있다.

Claims (19)

  1. TET2(Tet Methylcytosine Dioxygenase 2) 억제제를 포함하고,
    상기 TET2 억제제는 TET2의 핵산 서열 중 서열번호 1 또는 서열번호 9의 표적 서열에 상보적인 결합을 형성하는 것인, 면역세포 활성 향상용 조성물.
  2. 청구항 1에 있어서,
    상기 활성 향상은 생존율 향상, 증식 속도 향상 및 사이토카인 발현 증가로 이루어진 군으로부터 선택된 1종 이상인 것인, 면역세포 활성 향상용 조성물.
  3. 청구항 1에 있어서,
    상기 TET2 억제제는 miRNA, siRNA, shRNA 또는 안티센스 올리고뉴클레오타이드를 포함하는 것인, 면역세포 활성 향상용 조성물.
  4. 청구항 3에 있어서,
    상기 shRNA를 암호화하는 핵산은 서열번호 10 또는 서열번호 18의 염기서열을 갖는 것인, 면역세포 활성 향상용 조성물.
  5. 청구항 1에 있어서,
    상기 면역세포는 키메라 항원 수용체(CAR)를 발현하는 면역세포인, 면역세포 활성 향상용 조성물.
  6. 청구항 1에 있어서,
    상기 면역세포는 T 세포 또는 NK 세포인, 면역세포 활성 향상용 조성물.
  7. 면역세포에 TET2 억제제를 주입하는 단계를 포함하고,
    상기 TET2 억제제는 TET2의 핵산 서열 중 서열번호 1 또는 서열번호 9의 표적 서열에 상보적인 결합을 형성하는 것인, 활성이 향상된 면역세포의 제조 방법.
  8. 청구항 7에 있어서,
    상기 주입은 전기천공법 (electroporation), 리포좀, 플라스미드, 바이러스 벡터 및 나노파티클(nanoparticles)로 이루어진 군에서 선택되는 1이상의 방법으로 수행되는 것인, 활성이 향상된 면역세포의 제조 방법.
  9. TET2 억제제를 암호화하는 핵산을 포함하는 재조합 벡터.
  10. 청구항 9에 있어서,
    상기 재조합 벡터는 레트로바이러스, 렌티바이러스, 아데노바이러스, 아데노-연관 바이러스, 백시니아바이러스, 폭스바이러스 및 단순포진 바이러스로 구성된 군에서 선택되는 1이상인 것인, 재조합 벡터.
  11. 청구항 9에 있어서,
    키메라 항원 수용체(CAR)를 암호화 하는 핵산을 추가적으로 포함하는 것인, 재조합 벡터.
  12. 청구항 9에 있어서,
    TET2 억제제를 암호화하는 핵산은 서열번호 10 또는 서열번호 18의 염기서열을 갖는 것인, 재조합 벡터.
  13. 청구항 9의 재조합 벡터가 도입된, 활성이 향상된 면역세포.
  14. 청구항 13에 있어서,
    상기 면역세포는 키메라 항원 수용체(CAR)를 추가적으로 포함하는, 활성이 향상된 면역세포.
  15. 청구항 14에 있어서,
    상기 키메라 항원 수용체는 CD19에 특이적으로 결합하는 항체 또는 이의 항원 결합 단편을 포함하는 것인, 활성이 향상된 면역세포.
  16. 청구항 13에 있어서,
    상기 면역세포는 T 세포 또는 NK 세포인, 활성이 향상된 면역세포.
  17. 청구항 16에 있어서,
    상기 T 세포는 헬퍼 T 세포, 세포독성 T 세포, 메모리 T 세포, 조절 T 세포 또는 자연 살해 T 세포인, 활성이 향상된 면역세포.
  18. 청구항 13에 있어서,
    상기 활성 향상은 생존율 향상, 증식 속도 향상 및 사이토카인 발현 증가로 이루어진 군으로부터 선택된 1종 이상인 것인, 활성이 향상된 면역세포.
  19. 청구항 13 내지 청구항 18 중 어느 한 항의 면역 세포를 유효성분으로 포함하는 암 치료용 약학적 조성물.
PCT/KR2022/018215 2021-12-02 2022-11-17 증진된 효능을 갖는 면역세포 WO2023101277A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0171191 2021-12-02
KR1020210171191A KR102521500B1 (ko) 2021-12-02 2021-12-02 증진된 효능을 갖는 면역세포

Publications (1)

Publication Number Publication Date
WO2023101277A1 true WO2023101277A1 (ko) 2023-06-08

Family

ID=85946764

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/018215 WO2023101277A1 (ko) 2021-12-02 2022-11-17 증진된 효능을 갖는 면역세포

Country Status (2)

Country Link
KR (1) KR102521500B1 (ko)
WO (1) WO2023101277A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170218338A1 (en) * 2008-09-26 2017-08-03 The Children's Medical Center Corporation Selective oxidation of 5-methylcytosine by tet-family proteins
KR20180051625A (ko) * 2015-09-17 2018-05-16 노파르티스 아게 증진된 효능을 갖는 car t 세포 요법
KR20190127892A (ko) * 2017-03-22 2019-11-13 노파르티스 아게 바이오마커 및 효능이 증진된 car t 세포 요법

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170218338A1 (en) * 2008-09-26 2017-08-03 The Children's Medical Center Corporation Selective oxidation of 5-methylcytosine by tet-family proteins
KR20180051625A (ko) * 2015-09-17 2018-05-16 노파르티스 아게 증진된 효능을 갖는 car t 세포 요법
KR20190127892A (ko) * 2017-03-22 2019-11-13 노파르티스 아게 바이오마커 및 효능이 증진된 car t 세포 요법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
JOSEPH A. FRAIETTA, CHRISTOPHER L. NOBLES, MORGAN A. SAMMONS, STEFAN LUNDH, SHANNON A. CARTY, TYLER J. REICH, ALEXANDRIA P. COGDIL: "Disruption of TET2 promotes the therapeutic efficacy of CD19-targeted T cells", NATURE, NATURE PUBLISHING GROUP UK, LONDON, vol. 558, no. 7709, 1 June 2018 (2018-06-01), London, pages 307 - 312, XP055486057, ISSN: 0028-0836, DOI: 10.1038/s41586-018-0178-z *
MINGHAO WU, ZHANG YU, TANG ANLIU, TIAN LI, WU M, ZHANG Y, TANG A, MIR TIAN L: "miR-506 inhibits cell proliferation and invasion by targeting TET family in colorectal cancer", IRANIAN JOURNAL OF BASIC MEDICAL SCIENCES, vol. 19, no. 3, 1 March 2016 (2016-03-01), pages 316 - 322, XP055316439 *
YAJING MI, XINGCHUN GAO, JINXIANG DAI, YUE MA, LIXIAN XU, WEILIN JIN: "A Novel Function of TET2 in CNS: Sustaining Neuronal Survival", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 16, no. 9, pages 21846 - 21857, XP055631415, DOI: 10.3390/ijms160921846 *

Also Published As

Publication number Publication date
KR102521500B1 (ko) 2023-04-14

Similar Documents

Publication Publication Date Title
JP6767347B2 (ja) Ｐｄ−ｌ１によって誘導される免疫寛容の低減
US10227409B2 (en) CS1-specific chimeric antigen receptor engineered immune effector cells
Chu et al. CS1-specific chimeric antigen receptor (CAR)-engineered natural killer cells enhance in vitro and in vivo antitumor activity against human multiple myeloma
CN106999552B (zh) 治疗癌症的方法和组合物
CA2982963C (en) Chimeric antigen receptor specific for tumor cells
WO2017120998A1 (zh) 治疗脑胶质母细胞瘤的治疗组合物
CN111733186A (zh) 靶向cd19的人源化嵌合抗原受体制备及其应用
CN110404061B (zh) 改进的t细胞治疗方法
EP4273175A1 (en) Novel chimeric antigen receptor and use thereof
JP2022512891A (ja) 抗ｃｄ７９ｂ抗体およびキメラ抗原レセプターおよびそれらの使用方法
WO2023101277A1 (ko) 증진된 효능을 갖는 면역세포
US11672827B2 (en) Pharmaceutical chimeric receptor composition and method thereof
EP4194472A1 (en) Chimeric antigen receptor comprising novel co-stimulatory domain and use thereof
JP6964364B2 (ja) 免疫チェックポイント阻害剤
Gavriil Chimeric antigen receptor (CAR) T-cell immunotherapy for MUC1-positive breast cancer
JP7458318B2 (ja) 癌治療のためのｓｌａｍｆ６スプライスバリアントの調節
WO2023015300A1 (en) Compositions and methods for enhancing car t cell efficacy through the engineered secretion of c. perfringens neuraminidase
WO2022096425A2 (en) Chimeric antigen receptor comprising an antigen binding domain specific for msln having a specificity for tumor cells
CN113710703A (zh) Lym-1和lym-2抗体组合物及改进的car构建体

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22901635

Country of ref document: EP

Kind code of ref document: A1