WO2023099806A1

WO2023099806A1 - Method for the detection of scuticociliate parasites

Info

Publication number: WO2023099806A1
Application number: PCT/ES2022/070773
Authority: WO
Inventors: José Manuel LEIRO VIDAL; Jesús LAMAS FERNÁNDEZ; Oswaldo PALENZUELA RUÍZ
Original assignee: Universidade De Santiago De Compostela; Consejo Superior De Investigaciones Científicas (Csic)
Priority date: 2021-11-30
Filing date: 2022-11-30
Publication date: 2023-06-08
Also published as: ES2942317A1; ES2942317B2

Abstract

The present invention relates to the use of the polymerase chain reaction for detecting scuticociliates in samples, preferably scuticociliates which cause diseases in flat fish.

Description

DESCRIPTION

PROCEDURE FOR THE DETECTION OF PARASITIC SCUTICOCILIATES

FIELD OF THE INVENTION

The present invention relates to the use of polymerase chain reaction for the detection of scuticocilia in samples, preferably scuticocilia that cause disease in flatfish.

BACKGROUND

Scuticociliatosis, produced mainly by two species of ciliates: Philasterides dicentrarchi and Miamiensis avidus, is a serious disease that causes high mortality in flatfish farms of high commercial value, generating serious economic losses in this aquaculture sector. Specifically in Galicia, infections in turbot are attributed to the species P. dicentrarchi', while, in Asia, infections affecting farmed flatfish are related to both P. dicentrarchi and M. avidus. In this regard, it has recently been established that both pathogenic scuticociliates are cryptic species, that is, they are not morphologically differentiable, but that they have relevant differences at the genetic level. These scuticociliates are marine microorganisms, originally free-living, that have a single vegetative evolutionary form in their life cycle, the trophont, which can transform into facultative histiophagous parasites, producing a systemic infection that affects farmed flatfish, especially when it occurs an increase in seawater temperature. Currently, there are no chemotherapeutic measures capable of controlling this disease and only the use of autovaccines can partially prevent infectious outbreaks. However, due to the great capacity for antigenic variation, and other mechanisms of evasion of the host's immune response that these ciliates possess, as well as the appearance of different strains, in most cases, it is impossible to achieve effective control. in the medium and long term of infections with the use of these immunoprophylactic tools. Currently, the most effective measures available to the fish farmer to control the disease involve implementing measures to improve and optimize the management and hygiene conditions of the fish in order to eliminate those environmental factors that favor growth and development. of the ciliates in the culture tanks. The presence of these scuticociliates in the culture tanks of fish poses an obvious risk for the development of infectious outbreaks which, in turn, are favored by temperature conditions and the presence of high concentrations of nutrients for the scuticociliate in seawater. For all these reasons, in order to design an effective control and minimize the risk of infection in fish, it is necessary to monitor the concentration of trophonts of both species in the water to establish those levels of ciliates that, through epidemiological studies, have been shown to be may cause infectious outbreaks; as well as, locate the critical points of the culture system that may represent reservoirs or places of proliferation that act as sources of dissemination and propagation of parasites. To achieve this objective, it is necessary to have very sensitive identification and quantification tools that allow the detection of very low levels of ciliates in order to establish effective prophylaxis and control measures as quickly as possible.

SUMMARY OF THE INVENTION

The inventors have developed and optimized a quantitative real-time PCR (qPCR) assay using primers and a hydrolysis probe directed to the internal transcribed spacer-2 (ITS-2) region located between the small subunit 18 S and large subunit 23S of ribosomal DNA (rDNA) that allows to quantify in a sensitive and specific way the levels of trophonts of the scuticociliate parasites P. dicentrarchi and M. avidus. This method allows the detection of very low levels of parasitic ciliates and is especially suitable for their monitoring in fish farm water.

Thus, in a first aspect, the invention refers to a procedure for the detection of scuticociliates in a sample comprising: a) subjecting the nucleic acids obtained from said sample to an amplification reaction of a target region of the scuticociliate genome that has at least 80% identity with SEQ ID NO: 1 or a fragment thereof in the presence of a forward primer and a reverse primer specific for said region capable of amplifying said region or fragment, and b) detecting the amplification product produced in step a) where the detection of an amplification product is indicative of the presence of scuticocilia in the sample. Another aspect of the present invention relates to an oligonucleotide selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4.

Yet another aspect of the present invention refers to a kit comprising a pair of primers with sequences SEQ ID NO: 2 and SEQ ID NO: 3.

Yet another aspect of the present invention relates to the use of the oligonucleotide according to the invention or the kit according to the invention to detect scuticociliates in a sample.

DESCRIPTION OF THE FIGURES

Figure 1: 2% agarose gel showing the PCR results for the specific detection of P. dicentrarchi using the f/r ITS2 primers and the optimized conditions of 2.5 mM MgCh in the PCR reaction mix; at an alignment temperature of 60°C and 35 cycles of amplification. PCRs were performed by adding 50 ng of template DNA. M= molecular size markers (fragments of 50 base pairs). Channel 1: negative control -NTC- (substitution of the sample by distilled water); lane 2: DNA from P. dicentrarchi, strain 11; lane 3: DNA from P. dicentrarchi, strain C1; lane 4: DNA from P. dicentrarchi, strain D2; lane 5: DNA from P. dicentrarchi, strain D3; lane 6: DNA from P. dicentrarchi, strain S1; lane 7: DNA from M. avidus, strain Ma/2; lane 8: DNA from Uronema marinum, strain CTAS4/I; lane 9: DNA from U. marinum, strain CLIT/I; lane 10: Protocruzia adherens DNA, lane 11: Euplotes minuta DNA.

Figure 2: Calibration line constructed with the Cq values obtained by qPCR using the pSparkll vector cloned with the P. dicentrarchi ITS2 fragment as template. In the qPCR, different concentrations of the cloned plasmid with the ITS2 fragment and its corresponding number of copies were tested using the f/rlTS2 primers and the plTS2 probe. The graph also includes the value of the slope (m) of the line, the efficiency (E) of the PCR and the linearity (line correlation coefficient R ² ) of the line.

Figure 3: Calibration line constructed with the Cq values obtained from a qPCR using DNA obtained from between 1 and 64 ciliates as template. In the qPCR, the f/rlTS2 primers and the plTS2 probe from P. dicentrarchi were used. The figure also includes the values of the slope (m) of the straight line obtained, as well as the efficiency (E) of the PCR and the linearity (R ² ) of the straight line. Figure 4: Standard line constructed for the determination of the limit of detection (LOD) of the qPCR. The figure shows the Cq values obtained in the qPCR using the f/rlTS2 primers and the plTS2 probe and, as a template, DNA concentrations between 50 ng and 50 pg. The limit of detection (LOD) of the assay corresponds to the lowest concentration of DNA (in whole genome equivalents per reaction) that is reproducibly detected with 95% probability. For determination of the assay cutoff value, the mean Cq of the LOD + 2 times the standard deviation ("LOD+ 2SD) was calculated and the result was rounded to the nearest whole number. NTC: Cq obtained in the qPCR Replacing the template DNA with bidistilled water.

DETAILED DESCRIPTION

The present invention refers to a procedure developed to detect and quantify in a sensitive and specific way very low levels of the scuticociliates P. dicentrarchi and M. avidus, essential to be able to control and limit the contamination of these parasites in cultures of flatfish of high commercial value, generating serious economic losses in this sector of aquaculture.

To this end, the inventors have optimized a sensitive and specific polymerase chain reaction (PCR) assay. Thus, in a first aspect, the invention refers to a procedure for the detection of scuticociliates in a sample comprising: a) subjecting the nucleic acids obtained from said sample to an amplification reaction of a target region of the scuticociliate genome that has at least 80% identity with SEQ ID NO: 1 or a fragment thereof in the presence of a forward primer and a reverse primer specific for said region capable of amplifying said region or fragment, and b) detecting the amplification product produced in step a) where the detection of an amplification product is indicative of the presence of scuticocilia in the sample.

In the context of the present invention the term "detection" refers to the identification of the presence of a target substrate. In the present case, said identification refers to a region present in the scuticociliate genome. The term "scuticociliates" as used herein refers to ciliated eukaryotic unicellular microorganisms belonging to the subclass Scuticociliatia in the class Oligohymenophorea. These organisms are marine, normally free-living and widely distributed throughout the world's oceans. About 20 members of this subclass have been identified as causative agents of the disease scuticociliatosis, where these ciliates are parasites of other marine organisms. In one embodiment, scuticociliates belong to the order Philasterida. In a preferred embodiment, they belong to the Philasteridae family, more preferably to the Philasterides genus. In another preferred embodiment, they belong to the Parauronematidae family, more preferably to the Miamiensis genus. In a more preferred embodiment, the scuticociliates detected by the method of the invention are Philasterides dicentrarchi and/or Miamiensis avidus.

In a preferred embodiment of the invention the scuticociliates are parasites, preferably they are parasites of flatfish.

The term "parasite", as used in the present invention, refers to a type of relationship between two living beings, in which one of the participants, the parasite, depends on the other, the host (also called host, host or host) and makes some profit. In most cases of parasitism, the host perceives damage or harm, even death, by the parasite at some point in the relationship cycle.

The term "sample", in the context of the present invention, refers to a small amount or isolated part that is representative of the whole, that is, whose characteristics are identical to the whole from which the sample is drawn. In a particular embodiment of the procedure of the invention, the sample is a biological or environmental sample.

In another particular embodiment of the method of the invention, the biological sample is a biological fluid or a biological tissue. In yet another particular embodiment, the sample is a biological fluid selected from a group consisting of blood, peritoneal fluid, and urine. In another particular embodiment, the sample is a biological tissue that is selected from a group consisting of muscle, liver, skin, gills, brain, urethra, artery, stomach, spinal cord, pyloric cecum, olfactory bulb, eye, mouth, pharynx, spleen, pancreas, intestine, ovaries, swim bladder, urinary bladder, and anus. In a particular embodiment, the sample is a tissue or organ sample from a fish, preferably from a flatfish. In a preferred embodiment the flatfish is selected from the group consisting of turbot, sole, megrim, flounder, brill, halibut. In an even more preferred embodiment, the flatfish is turbot. In another particular embodiment of the method of the invention, the sample is an environmental sample selected from a group consisting of water or solid substrates, preferably water, more preferably salt water. The water can come, without limitation, from the sea, from the mouth of rivers (estuaries), from marshes, from estuaries, from marine fattening and breeding fish farms or from public or private aquariums with hot or cold salt water.

In another particular embodiment, the water is salt water obtained from an estuary, salt lake, marsh, sea, ocean, estuary, marine aquaculture in facilities on land or in cages, fish farms, or aquariums. In an even more particular embodiment, the water is water from a marine fish farm. In another particular embodiment, the water is from hot or cold water aquariums for marine animals. Examples of solid substrates are sand in contact with water, nets used in aquaculture systems, among others. In another particular embodiment, the solid substrates are sand or nets.

In a particular embodiment of the procedure of the invention, the sample is water and it is a pretreated sample in which the microorganisms present in the water sample have been concentrated. The concentration of microorganisms in the sample makes it possible to increase the sensitivity of the method of the invention. Thus, the concentration of microorganisms can be carried out in various ways. The most widely used techniques for concentrating microorganisms are centrifugation and filtering, both techniques known to those skilled in the art. One such technique is exemplified in the Examples section of the present description. In a particular embodiment, the volume of the water sample is at least 1 liter. In another particular embodiment, the volume of water is at least 2 liters. In a particular embodiment of the procedure of the invention, the concentration of microorganisms is carried out by means of a sequential vacuum filtration system. The term "sequential vacuum filtration", as used in the present invention, refers to a filtration method where the filtration is carried out with the aid of reduced pressure in a container that forces the passage of the liquid through the filter. This process is performed several times using filters with sequentially smaller pores. In a particular embodiment of the procedure of the invention, the concentration of microorganisms in a sample is done by sequential vacuum filtration with filters of 150 pm, 75 pm, 10 pm and 0.8 pm.

The term "microorganisms", in the present context, refers to living beings or biological systems that can only be visualized under a microscope. In a preferred embodiment of the present invention the term microorganism refers to the scuticociliates P. dicentrarchi and M. avidus.

Prior isolation procedure of the invention

As mentioned, the sample of the method of the invention can be pretreated to increase the concentration of scuticocilia and/or obtain the nucleic acids of the scuticocilia so that they are accessible to an amplification reaction. Thus, in a particular embodiment of the procedure of the invention, the water sample is previously processed according to a procedure to isolate nucleic acids, from now on the isolation procedure of the invention, which comprises:

(i) Concentration of microorganisms in the sample, obtaining a first solution;

(ii) Lysis of the first solution, obtaining a second solution;

(iii) Neutralization and removal of polysaccharides from the solution obtained in step (ii), obtaining a third solution;

(iv) Removal of proteins from the solution obtained in step (iii) obtaining a fourth solution; and

(v) Purification of the genetic material in the solution obtained in step (iv), obtaining a final solution containing the nucleic acids.

Step (i) of the isolation procedure of the invention makes it possible to concentrate the microorganisms existing in the sample, thus increasing the sensitivity of the procedure of the invention. The definitions of "concentration" and "microorganisms" have been previously described, as well as the particular embodiments referring to said concentration. Said definitions and particular embodiments are equally applicable in the present procedure.

After carrying out concentration through filtrations, the filters are collected, rehydrated and the deposits present on the filters are collected in a solution that is used in the process of the invention. In a particular embodiment of the isolation procedure of the invention, the filters obtained in sequential vacuum filtration are rehydrated with buffer solution for 15 minutes to 45 minutes, preferably 30 minutes, at room temperature. A "buffer solution" is a mixture of a weak acid and its conjugate base or a weak base and its conjugate acid. Buffer solutions serve to help maintain a stable pH value of another solution that is mixed with the buffer solution. In another particular embodiment of In the isolation procedure of the invention, the filters are shaken in the buffer solution. This step is carried out so that the deposits present in the filters pass into the buffer solution.

After obtaining the solution from step (i) of the isolation process of the invention, the lysis of said solution is continued in step (ii). The term "lysis", as used in the present description, refers to the disintegration of the cell wall and/or cell membrane of the microorganisms present in the solution through mechanical methods, such as sonication and freezing/freezing cycles. thawing, or chemical methods, such as lysis buffers that change the pH, or detergents that perforate the cell membrane. During cell lysis, protein-degrading proteolytic enzymes can also be used to remove enzymatically active proteins that act on nucleic acids and thus protect said nucleic acids from degradation. In a particular embodiment of the isolation procedure of the invention, step (ii) is carried out with sodium dodecyl sulfate (SDS) with a concentration of 1% to 20%, preferably 10%, and/or proteinase K with a concentration of 10 mg/ml to 30 mg/ml, preferably 20 mg/ml. In a particular embodiment, step (ii) of the isolation process of the invention is carried out with stirring. In another particular embodiment, step (ii) of the isolation procedure of the invention is carried out for 30 min to 90 min. In another particular embodiment, step (ii) of the isolation procedure of the invention is carried out for 60 min. In another particular embodiment, stage (ii) of the isolation process of the invention is carried out at a temperature of 30°C to 50°C. In another particular embodiment, step (ii) of the isolation procedure of the invention is carried out at a temperature of 37°C.

Once the cell lysis has been carried out, the next step, step (iii) of the isolation procedure of the invention, is the neutralization of the chemical compounds added in the previous step for cell lysis and, if applicable, for protein degradation. . This can be accomplished through precipitation in a solution with a high concentration of salts or with the use of detergents, such as hexadecyltrimethylammonium bromide (CTAB), which allows the separation of nucleic acids from polysaccharides. After the polysaccharides have precipitated, the solution can be centrifuged and the supernatant collected. In a particular embodiment, step (iii) of the isolation procedure of the invention is carried out with hexadecyltrimethylammonium bromide at a concentration of 1% to 20%. In a particular embodiment, step (iii) of the isolation procedure of the invention is carried out with hexadecyltrimethylammonium bromide at a concentration of preferably 10% and/or sodium chlorate at a concentration of 0.1M to 1.5M. In another particular embodiment, step (iii) of the isolation process of the invention is carried out for 5 min to 15 min, preferably 10 min, at a temperature of 55°C to 75°C, preferably 65°C.

The next step in the isolation procedure, step (iv), is the removal of the proteins still in solution. Typically this step is carried out with the precipitation of the proteins in a phenol/chloroform/isoamyl alcohol mixture followed by centrifugation and collection of the supernatant. In a particular embodiment, step (iv) of the isolation procedure of the invention is carried out with a mixture of phenol/chloroform/isoamyl alcohol. In another particular embodiment, said mixture contains a ratio of 25:24:1. In another particular embodiment of step (iv) of the isolation procedure of the invention, the collection of the supernatant is carried out by centrifugation.

Finally, the last stage of the isolation procedure, stage (v) of the invention, is the purification of the genetic material in the solution obtained in the previous stage. As described above, this step can be performed by precipitating the nucleic acids using an alcohol, such as isopropanol, for this purpose, followed by centrifugation to collect the precipitate. In a particular embodiment, step (v) of the isolation process of the invention is carried out with isopropanol. In another particular embodiment of step (v) of the isolation procedure of the invention, the precipitate is collected by centrifugation.

The isolation procedure of the invention allows obtaining concentrated samples of scuticociliates or their nucleic acids, so that said sample can be used in the procedure of the invention. The isolation procedure of the invention is fully exemplified in the Examples section of the present disclosure.

First stage of the detection procedure of the invention

The first stage of the detection procedure of the invention is "subjecting the nucleic acids obtained from said sample to an amplification reaction of a target region of the scuticociliate genome that has at least 80% identity with SEQ ID NO: 1 or of a fragment thereof in the presence of a forward primer and a reverse primer specific for said region capable of amplifying said region or fragment”. In the present invention, "nucleic acid" is understood to be the repeat of monomers called nucleotides, linked by phosphodiester bonds. There are two types of nucleic acids: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). In the present invention, "DNA" is understood to mean the genetic material of living organisms that controls heredity and is located in the nucleus or in the mitochondria of cells. In the present invention, "RNA" is understood to be the molecule resulting from the transcription of a DNA sequence. The nucleic acid of the invention may contain one or more modifications in the nucleobases, in the sugars and/or in the bonds between nucleotides.

After obtaining a sample or the nucleic acids contained in said sample, said sample or its nucleic acids are subjected to an amplification reaction of a target region of the scuticociliate genome. As understood by the person skilled in the art, an "amplification reaction" basically consists of the exponential multiplication of a target DNA molecule (or of a target region of a DNA molecule) by using oligonucleotides that hybridize with the ends of the target region to be amplified.

The different techniques or procedures for carrying out amplification reactions are widely described in the state of the art, for example, in Sambrook et al., 2001. (Molecular Cloning A Laboratory Manual. 3rd Edition, Vol. 1, Cold Spring Harbor Laboratory Press, New York). Examples of amplification reactions are, but are not limited to, the polymerase chain reaction (PCR) and variations thereof [regional amplification of the polymerase chain reaction (RA-PCR), Regional Amplification PCR, Real Time polymerase chain reaction (RT-PCR from English Real Time PCR, etc.). In a particular embodiment of the method of the invention, the amplification reaction is carried out by means of a chain reaction of the polymerase (PCR).The protocol followed to carry out a PCR is widely known in the state of the art and there are currently commercial kits that contain the necessary materials to carry out said amplification.In addition, the conditions of temperature, time, concentrations of reagents and number of PCR cycles will depend on the DNA polymerase used in the amplification reaction, the specificity of the primers, etc. Thus, in a particular embodiment of the procedure of the invention, the amplification reaction is carried out carried out using a real-time polymerase chain reaction (PCR). A Real Time PCR reaction is basically a conventional PCR in which the amplification equipment (called thermal cyclers) incorporates a detection system for fluorescence, said detection being based on the use of specific molecules. In another embodiment the amplification reaction is carried out by conventional PCR. In another particular embodiment, the amplification reaction is carried out by means of a digital PCR.

To carry out an amplification reaction, several components are necessary in a solution. Thus, in a particular embodiment of the method of the invention, the amplification reaction is carried out in the presence of reaction buffer, deoxyribonucleotide triphosphate (dNTP), magnesium ions and DNA polymerase. The term "reaction buffer" refers to a buffer solution that provides a suitable chemical environment for DNA polymerase activity. The pH of the buffer is usually between 8.0 and 9.5 and is often stabilized with Tris-HCl. A common component of the buffer is potassium ion (K+) from KCl, or ammonium sulfate (NH4)2S04, which favors primer annealing. Said reaction buffer is normally provided commercially in conjunction with DNA polymerase. The term "deoxyribonucleotide triphosphate" or its acronym "dNTP" refers to the nucleotide triphosphates adenine (dATP), cytosine (dCTP), thymine (dTTP), and guanine (dGTP), the bases necessary for the construction of DNA. The term "divalent ions", as used in the present description, refers to chemical elements, in this case ions, which have a valence of two, that is, they can form up to two bonds. In a particular embodiment, the divalent ion is magnesium (Mg ²⁺ ). In a particular embodiment, the magnesium ions are obtained from magnesium chloride (MgCh) present in the reaction mixture at a concentration of 2 to 3 mM. In another particular embodiment, the magnesium ions are obtained from magnesium chloride (MgCh) present at a concentration of 2.5 mM in the reaction mixture.

The term "DNA polymerase", as used in the present description, refers to enzymes (E.C.:2.7.7.7) (cellular or viral) that are involved in the DNA replication process and that carry out the synthesis of the new strand of DNA by pairing deoxyribonucleotide triphosphates (dNTPs) with the corresponding complementary deoxyribonucleotides of the template DNA.

The amplification reaction is carried out in specialized equipment called a thermocycler, which allows multiple cycles of a set of stages with different temperatures and different times per stage. Thus, in a particular embodiment of the process of the invention, the amplification reaction conditions comprise: (i) An initial denaturation step at a temperature between 90°C and 98°C for a time between 3 min and 10 min;

(ii) A denaturation step at a temperature between 90°C and 98°C for a time between 15 s and 60 s;

(iii) A hybridization step at a temperature between 50°C and 68°C for a time between 15 s and 45 s;

(iv) An extension step at a temperature between 68°C and 72°C for a time between 45 s and 90 s; and

(v) A final extension step at a temperature between 68°C and 72°C for a time between 5 min and 15 min, where steps (ii), (iii) and (iv) are repeated at least 20 times, at least 25 times, at least 30 times, at least 32 times, at least 35 times before carrying out step (v). In another particular embodiment of the process of the invention, the amplification reaction conditions comprise:

(i) An initial denaturation step at a temperature of 95°C for a time of 5 min;

(ii) A denaturation step at a temperature of 95°C for a time of 30 s;

(iii) A hybridization step at a temperature of 60°C for a time of 45 s;

(iv) An extension stage at a temperature of 72°C for a time of 90 s; and

(v) A final extension step at a temperature of 72°C for a time of 10 min, where steps (¡i), (iii) and (iv) are repeated 35 times before carrying out step (v). ).

In a more particular embodiment of the procedure of the invention, the amplification reaction conditions comprise:

(i) An initial denaturation step at a temperature between 90°C and 98°C for a time between 3 min and 10 min;

(ii) A denaturation step at a temperature between 90°C and 98°C for a time between 5 s and 15 s; and

(iii) A step of hybridization and extension at a temperature between 58°C and 62°C for a time between 30 s and 90 s; where steps (¡i) and (iii) are repeated at least 10 times. In a particular embodiment, steps (ii) and (iii) are repeated at least 14 times, at least 16 times, at least 18 times, at least 20 times, at least 22 times, at least 24 times, at least 26 times , at least 28 times, at least 29 times, at least 30 times, at least 32 times, at least 34 times, at least 36 times, at least 38 times, at least 40 times.

In yet another particular embodiment of the process of the invention, the amplification reaction conditions comprise:

(i) An initial denaturation step at a temperature of 95°C for a time of 5 min;

(¡i) A denaturation stage at a temperature of 95°C for a time of 10 s; and

(iii) A step of hybridization and extension at a temperature of 60°C for a time of 60 s; where steps (¡i) and (iii) are repeated 40 times.

The terms "denaturation", "hybridization" and "extension" in the context of the present invention refer to: the separation of the double strands of the nucleic acids present in the sample into single strands; hybridizing the primers to the previously formed nucleic acid single-strands, such that said primers have a DNA sequence complementary to the target region of the nucleic acids; and extension of a new strand of DNA by DNA polymerase from the 3' end of the primer such that the new strand is complementary to the template strand to which the primer has annealed.

The amplification reaction makes it possible to amplify a target region in the scuticociliate genome. The term "target region", in the context of the present invention, refers to a specific area of the scuticociliate genome that allows the unique identification of Philasterides dicentrarchi and Miamiensis avidus. This region is part of the internal transcribed spacer 2 and has at least 80% identity with SEQ ID NO: 1. The term "ITS" from English "internal transcribed spacer" or "internal transient spacer", as used in The present description refers to a fragment of the genome called spacer DNA, located between the ribosomal DNA (rDNA) for the small subunit and that of the large subunit. It can also be defined as the region already transcribed into RNA, or polycistronic precursor that corresponds to spacer DNA after transcription. In bacteria and archaea, there is a single ITS, located between the 16S and 23S rRNA genes. On the contrary, there two ITS in eukaryotes: ITS1, found between the 18S and 5.8S rRNA genes; while ITS2 is between the 5.8S and 28S rRNA genes (in opisthoconts or 25S in plants). ITS1 corresponds to the ITS in bacteria and archaea, whereas ITS2 originated as an insertion that disrupted the ancestral 23S rRNA gene.

In a particular embodiment of the method of the invention, the target region comprises or has at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86% , at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100% identity with SEQ ID NO: 1. In another particular embodiment of the procedure of the invention the target region consists of the sequence according to SEQ ID NO: 1.

SEQ ID NO : 1

TCCCGCTAAACTCGAAAAGCGCTGAATCGTTCAGTGCCGACCGAAGTAGTCACTTCTTCACAGAAAGTGA TCTCGGCT

The term "identity" as used herein refers to the degree of agreement between two aligned nucleotide sequences such that the number of identical nucleotides is maximized. Specifically, identity is represented by the percentage (%) of the number of identical nucleotides relative to the total number of nucleotides. Percent identity can be determined using known algorithms such as BLAST, FASTA or CLUSTAL. When the two sequences are of different sizes, the percent identity can be calculated relative to the smaller sequence (which will have a higher percent identity) or relative to the larger sequence (which will have a smaller percent identity). ). In the present invention, identity is calculated for the entire nucleotides of any of the sequences described herein, that is, it is calculated throughout the entire sequence described herein, regardless of the size of the other sequence being compared.

The target region allows the identification of scuticociliates due to its specificity for such organisms. In a particular embodiment of the method of the invention, the scuticociliates are selected from a group consisting of Philasterides dicentrarchi, Miamiensis avidus and combinations thereof. In the context of the present invention, the term "Philasterides dicentrarchi", as well as the term "P. dicentrarchi", used interchangeably, refers to a species of ciliated protozoan of the subclass Scuticociliatia that parasitizes fish, producing a fatal disease for farmed turbot and seabass. Infected fish show hemorrhagic ulcers on the skin (especially around the operculum), copious ascitic fluid in the abdominal cavity, unilateral or bilateral exophthalmia, and systemic infection with presence of ciliates in the blood, gills, gastrointestinal tract, liver, the spleen, the kidneys and the musculature. In the final phase of the infection, the ciliates reach the brain and cause softening and liquefaction of the tissue. The term Miamiensis avidus, in the present invention, as well as the term M. avidus, used interchangeably, refers to a species of ciliated protozoan of the subclass Scuticociliatia that lives as parasites of various types of teleost fish, such as turbot. and sea bass, as well as other groups of marine organisms such as seahorses, sharks, and crustaceans. The progression of the disease caused by M. avidus is entirely identical to that described for the disease caused by P. dicentrarchi.

The target region of the scuticociliate genome is the region that contains 80% identity with SEQ ID NO: 1. The method of the invention can be carried out by amplifying all of said region or a fragment of said region. The term "fragment", as used in the present description, refers to any portion of SEQ ID NO: 1 that has a sequence of less than 77 nucleotides and more than 20 nucleotides.

The amplification reaction of the target region of the scuticociliate is carried out with "a forward primer and a reverse primer specific for said region capable of amplifying said region or fragment".

The term "primer", as used herein, refers to an oligonucleotide that is capable of acting as an initiation point for the 5' to 3' synthesis of a primer extension product that is complementary to a nucleic acid strand. The primer extension product is synthesized in the presence of appropriate nucleotides and a polymerization agent, such as a DNA polymerase, in an appropriate buffer and at a suitable temperature. The primers may comprise only natural nucleotide residues or at least one or more nucleotide analogs, eg, chemically modified analogs, PNAs, etc.

Modifications of one or more nucleic acid backbone residues may comprise one or more of the following: 2' sugar modifications such as 2'-O-methyl (2'-OMe), 2'-O-methoxyethyl ( 2'-MOE), 2'-O-methoxyethoxy¡, 2'-fluoro(2'-F), 2'-Allyl, 2'-O-[2-(methylamino)-2-oxoethyl], 2'-O-(N-methylcarbamate);4' sugar modifications including 4'-thio, 4'-CH2-O-2' bridge, 4-(CH2)2-O-2'bridge; Locked Nucleic Acid (LNA); peptide nucleic acid (APN); intercalating nucleic acid (INA); coiled intercalating nucleic acid (TINA); hexitol nucleic acids (HNA); arabinonucleic acid (ANA); cyclohexane nucleic acids (CNA); cyclohexenylnucleic acid (CeNA); treosyl nucleic acid (TNA); morpholino oligonucleotides; gap-mers; Mix-groupers; incorporation of arginine-rich peptides; addition of 5'-phosphate to synthetic RNAs; or any combination thereof.

Modifications of one or more nucleoside linkages of the nucleic acids may comprise one or more of the following: phosphorothioate, phosphoramidate, phosphorodiamidate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, and phosphoranilidate, or any combination thereof.

Two types of primers are normally used, "forward" and "reverse" to amplify a region of double-stranded DNA. The forward primer is complementary to the antisense strand and the reverse primer is complementary to the sense strand. The 5' ends of both primers are joined to the 3' ends of each DNA strand. The primers are, in most cases, short oligonucleotides. In a preferred embodiment of step a) of the method of the invention the primers have between, preferably consist of, 18 to 30 nucleotides. In another particular embodiment of the method of the invention, the primers have between, preferably consist of, 20 to 26 nucleotides, more preferably 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides or 25 nucleotides. In another particular embodiment of step a) of the method of the invention, the forward primer consists of the sequence SEQ ID NO: 2.

In a more particular embodiment of the method of the invention, the primer comprises or consists of a sequence that has at least 80% identity with the sequence SEQ ID NO: 2. In another particular embodiment of step a) of the method of the invention the forward primer consists of the sequence according to SEQ ID NO: 2.

In a particular embodiment of the method of the invention, the primer comprises or consists of a sequence that has at least 80% identity with the sequence SEQ ID NO: 3. In another particular embodiment of step a) of the method of the invention, the primer reverse consists of the sequence according to SEQ ID NO: 3. SEQ ID NO: 2

TCCCGCTAAACTCGAAAAGC

SEQ ID NO : 3

AGCCGAGATCACTTTCTGTG

The expression "specific for said region capable of amplifying said region or fragment", as used in the present description, refers to the fact that one of the primers used comprises a sequence that is identical to a fragment of SEQ ID NO: 1 and another of the primers comprises a sequence that is identical to a reverse fragment and complementary to SEQ ID NO: 1, and that the two primers together, in an amplification reaction, bind to the chains of SEQ ID NO: 1 and thus they allow the amplification of SEQ ID NO: 1 or a fragment thereof.

The amplification reaction can also comprise components necessary for the detection or quantification of the amplification products or amplicons. Thus, in a particular embodiment of step a) of the method of the invention, the amplification reaction is carried out in the presence of an oligonucleotide probe or in the presence of a fluorescent marker, wherein the oligonucleotide probe comprises a sequence complementary to a fragment of the target region. In a particular embodiment, the hybrid probe with a sequence located in the region of SEQ ID NO: 1 between nucleotides 22 and 57 of SEQ ID NO: 1.

The term "probe" as used herein refers to a molecule used in an amplification reaction, typically for quantitative analysis or qPCR, as well as endpoint analysis. Such probes can be used to monitor amplification of the target region and may be suitable for monitoring the number of amplicons produced as a function of time. In a particular embodiment of step a) of the method of the invention, the oligonucleotide probe consists of or has between 18 to 30 nucleotides, preferably between 20 to 26 nucleotides, more preferably 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides. nucleotides or 25 nucleotides. In another particular embodiment of step a) of the method of the invention, the oligonucleotide probe consists of or comprises a sequence that has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of identity with SEQ ID NO: 4. In yet another particular embodiment of step a) of the method of the invention, the sequence of the oligonucleotide probe consists of SEQ ID NO: 4.

SEQ ID NO: 4

AATCGTTCAGTGCCGACCGAAGT

Said oligonucleotide probes may be modified so that the appearance of amplification reaction products is detected by the appearance of fluorescence. The foundation of this technique is based on the use of Forster's resonance energy transfer, which is an energy transfer mechanism between fluorochromes, where the presence of an energy acceptor near an energy donor blocks the emission. energy donor fluorescence. Various types of probes can be used, such as, without limitation, TaqMan type probes and Molecular Beacons type. TaqMan-type probes refer to probes that have a fluorophore at one end and a molecule at the other end that blocks its fluorescence emission (called a "quencher"). This type of probe hybridizes specifically in the central part of the product of PCR to obtain. In this way, when the amplification reaction is carried out, the hybrid probe is in the target region but, due to the proximity of the fluorophore to the quencher, no fluorescence is emitted. When the polymerase encounters the probe, it hydrolyzes it through its 5'-3' exonuclease activity, which causes the separation of the quencher from the fluorophore and, therefore, the emission of fluorescence, which is directly related to the amount of amplicon produced.In a particular embodiment of step a) of the method of the invention the oligonucleotide probe comprises a donor fluorophore at the 5' end or the 3' end and an acceptor fluorophore at the opposite end to the donor.In another particular embodiment, the donor fluorophore is selected from a group consisting of:

- 3',6'-dihydrox¡-1-oxospiro[2-benzofuran-3,9'-xanthene]-5-carboxylic acid (6-FAM);

Cyanine 3,5: (2Z)-2-[(3,6-dimethyl-2-phenylpyrimidin-3-io-4-yl)methylidene]-1-ethylquinoline chloride (Cy3 or Cy5);

[2',4,4',5',7,7'-hexachloro-6-[6-[2-cyanoethoxy¡-[di(propane-2-yl)amino]phosphanyl]oxyhexylcarbamoyl 2,2-dimethylpropanoate ]-6'-(2,2-dimethylpropanoyloxy)-3-oxospiro[2-benzofuran-1,9'-xantheno]-3'-yl](HEX); - 3R,4S,5S,6R,7R,9R, 11S, 12R, 13S,14R)-6-[(2S,3R,4S,6R)-4-(dimethylamino)-3-hydroxy-6-methyloxane- 2-yl]oxy-14-ethyl-7,12,13-trihydroxy-4-[(2R,4R,5S,6S)-5-hydroxy-4-methoxy-4,6-dimethyloxan-2-yl]oxy -10-(2-methoxyethoxymethoxyamino)-

3,5,7,9,11,13-hexamethyl-oxacyclotetradecane-2-one (ROX); 5-chlorosulfonyl-2-(3-oxa-23-aza-9- azoniaheptacyclo[17.7.1.1 ⁵ ' ⁹ .0 ² ' ¹⁷ .0 ⁴ ' ¹⁵ .0 ²³ ' ²⁷ .0 ¹³ ' ²⁸ ]octacosa-1 ( 27),2(17),4,9(28),13,15,18-heptaen-16-yl)benzenesulfonate (Texas Red); 2-(7-ethyl-3,3,8,8,10-pentamethyl-7-aza-21-azoniahexacyclo[15.7.1.0 ² ' ¹⁵ .0 ⁴ ' 13 ^.0 ⁶ ' ¹¹ .0 ²¹ ' ²⁵ ]pentacose - 1,4(13),5,11,14,16,18,21(25)-octaen-14-yl)-N-methyl-N-(4-oxopentyl)benzamide (ATTO® 647N); (2,5-dioxopyrrolidine) 4',5'-dichloro-3',6'-dihydroxy-2',7'-dimethoxy-1-oxospiro[2-benzofuran-3,9'-xanthene]-5-carboxylate -1 -yl) (6-JOE);

- (2S,4R)-N-[(1S)-2-methyl-1-[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-methylsulfaniloxan-2-yl]propyl ]-4-propylpiperidine-2-carboxamide (VIC); and 4,5,6,7-tetrachloro-3',6'-dihydroxyspiro[2-benzofuran-3,9'-xanthene]-1-one (TET).

In a more particular embodiment the acceptor fluorophore is selected from a group consisting of:

2,5-Bis(2-methyl-2-propan¡l)-7,4-benzened¡ol (BHQ1, BHQ2);

- A/-[2-[[(E)-3-[1-[(2 ,4S,5 )-5-[[bis(4-methoxyphenyl)-phenylmethoxy]methyl]-4-[2-cyanoethoxy- [di(propane-2-yl)amino]phosphanyl]oxyoxolan-2-yl]-2,4-dioxopyrimidin-5-yl]prop-2-enoyl]amino]ethyl]-6-[[7-[[2 ,5-dimethoxy-4-[(4-nitrophenyl)diazenyl]phenyl]diazenyl]-1-azatricyclo[7.3.1.0 ⁵ ' ¹³ ]trideca-5(13),6,8-trien-6-yl]oxy] hexanamide (BBQ650);

2-[3-(dimethylamino)-6-dimethylazanioylidenexanthen-9-yl]benzoate (TAMRA);

- (2S)-2-[4-(3,4-dimethylphenyl)-2-methylquinolin-3-yl]-2-[(2-methylpropan-2-yl)oxy]acetic acid (TQ2); and

5-phenylsulfanylquinazolin-2,4-diamine (TQ3).

Molecular Beacons-type probes are also single-stranded oligonucleotides that, due to their structure, have an internal base-pairing region and therefore form a hairpin. In the presence of the target region, the probe opens and preferentially binds to it, resulting in fluorescence emission. Structurally, they have the zone complementary to the target region in the fork turn, the internal complementarity zone in the neck, and the donor and acceptor at its ends. When the probe is closed in a hairpin, the acceptor prevents fluorescence emission by the donor, which is not the case when binding to the amplicon.

The term "fluorescent label" as used herein refers to a double-strand intercalating agent or fluorophore that fluoresces when bound to the double-strand. Agents suitable for this purpose include SYTO 15, SYTO 25, SYTO 13, SYTO 9, SYBR Green I, SYTO 16, SYTO 17, SYTO 21, SYTO 59, SYTOX, SYTO BC, DAPI, Hoechst 33342, Hoechst 33258, PicoGreen, and any combination thereof. In a particular embodiment of step a) of the process of the invention, the amplification reaction also comprises an intercalating agent selected from a group consisting of: SYTO 15, SYTO 25, SYTO 13, SYTO 9, [N', N'-dimethyl-N-[4-[(E)-(3-methyl-1,3-benzothiazol-2-yldeno)methyl]-1-phenylquinolin-1-io-2-yl]- N-propylpropane-1,3-diamine (SYBR Green I), SYTO 16, SYTO 17, SYTO 21, SYTO 59, SYTOX, SYTO BC, 4',6-diamidino-2-phenylindole (DAPI), Hoechst 33342, Hoechst 33258, PicoGreen, and any combination thereof. In an even more specific embodiment, the intercalating agent is N',N'-dimethyl-N-[4-[(E)-(3-methyl-1,3-benzothiazol-2-ylidene)methyl]-1 -phenylquinolin-1-io-2-yl]-N-propylpropane-1,3-diamine, with CAS number 163795-75-3.

Second stage of the detection procedure of the invention

Once the amplification reaction has been carried out, it is necessary to detect the product of said amplification. Techniques for detecting amplification products are widely described in the state of the art, for example, in Sambrook et al., 2001 (Molecular Cloning A Laboratory Manual. 3rd Edition, Vol. 1, Cold Spring Harbor Laboratory Press, New York ). In a particular embodiment of step b) of the method of the invention, the detection of the amplification product is carried out by gel electrophoresis and/or DNA sequencing. "Gel electrophoresis," particularly agarose gel electrophoresis, is a technique that allows DNA molecules to be separated based on their size or shape. Gel electrophoresis is a technique widely known by the person skilled in the art and its performance is part of the routine knowledge of said expert. "DNA sequencing", in the context of the present invention, refers to a set of biochemical methods and techniques whose purpose is the determination of the order of nucleotides in a DNA sequence. There are several DNA sequencing methods, the best known being the Sanger method (Sanger F, et al., 1977, Proc Natl Acad Sci US A. Dec;74(12):5463-7). The detection of an amplification product in step b) of the method of the invention is indicative of the presence of scuticociliates in the original sample. In addition to allowing the detection of a target region in the scuticociliate genome, the method of the invention also enables the quantification of scuticociliates in the sample. Thus, in a particular embodiment, the procedure of the invention also comprises a step to quantify the concentration of scuticociliates in the sample. The term "quantify", in the context of the present invention, refers to the determination of the number, concentration, density, or any other quantifiable parameter obtained directly or indirectly from the amplification reaction of step a) of the method of the invention. .

To determine the number of scuticociliates present in the sample through the amplification reaction, it is possible to generate a standard curve to be able to relate the amount of reaction product obtained in step a) of the procedure with the amount of scuticociliate nucleic acids and /or from scuticociliate cells originally present in the sample. Thus, in a particular embodiment of the procedure of the invention, the quantification of scuticociliates in the sample is done through a standard curve. The term "standard curve" or calibration curve, as used herein, refers to a type of graph that is used as a quantitative research technique. Several samples with known properties are measured and plotted, which then allows the same properties to be determined for unknown samples by interpolation on the plot. The samples with known properties are the standards and the graph is the standard curve. The concentration of the unknown can be calculated from the mass in the test. In the present invention, the known samples are senate dilutions of DNA concentrations obtained from ciliates in the range of 1 to 60 ciliates per microliter. These samples make it possible to determine, for example, the Cq value of the ORP in real time, that is, the cycle of the amplification reaction from which the increase in fluorescence is sufficiently above the noise to be detectable. An example of how to determine the standard curve is exemplified in the examples section of the present description.

Oligonucleotides of the invention

Another aspect of the present invention relates to an oligonucleotide selected from a group consisting of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, hereinafter the oligonucleotide of the invention. All definitions and particular embodiments described for other aspects of the present invention are equally valid for the present aspect. In a particular embodiment of the oligonucleotide of the invention, the oligonucleotide according to SEQ ID NO: 4 comprises a donor fluorophore at the 5' or 3' end and an acceptor fluorophore at the opposite end to the donor. In another particular embodiment, the donor fluorophore is selected from a group consisting of: 6-FAM, Cy5, Cy3, HEX, ROX, Texas Red, ATTOO647N, 6-JOE, VIC and TET. In another particular embodiment, the acceptor fluorophore is selected from a group consisting of: BHQ, BBQ, TAMRA, TQ2 and TQ3. In an even more particular embodiment, BHQ is selected from BHQ1 and BHQ2. In another more particular embodiment, BBQ is BBQ650.

Said oligonucleotide can be obtained by routine experimental practices such as oligonucleotide synthesis (Verma and Eckstein, 1998, Annual Review of Biochemistry Vol. 67:99-134).

In a particular embodiment, the oligonucleotide is isolated. The term "isolated" as used herein is intended to indicate that the particular component of interest, i.e., the oligonucleotide, is separated or isolated from the other components to such an extent that there is no detectable contamination by those other components. components, as measured using standard purity test procedures.

invention kit

Another aspect of the present invention relates to a kit comprising a pair of primers for the sequences SEQ ID NO: 2 and SEQ ID NO: 3, hereinafter the kit of the invention.

All definitions and particular embodiments described for other aspects of the present invention are equally valid for the present aspect.

In the context of the present invention, the term "kit" is understood as a product or device that contains the different reagents necessary to carry out the processes of the invention packaged to allow their transport and storage. Suitable materials for packaging the kit components include glass, plastic (polyethylene, polypropylene, polycarbonate, and the like), bottles, vials, paper, envelopes, and the like. In addition, the kits of the invention may contain instructions for the simultaneous, sequential or separate use of the different components that are in the kit. Said instructions may be in the form of printed material or in the form of an electronic support capable of storing instructions so that they can be read by a subject, such as electronic storage media (magnetic disks, tapes and the like), optical media (CD-ROM, DVD) and the like. Additionally or alternatively, the media may contain Internet addresses that provide such instructions. Reagents for use in the methods of the invention may be formulated as a "kit" and thus may be combined with one or more other types of items or components (for example, other types of biochemical reagents, containers, packets, etc.). such as packaging intended for commercial sale, substrates to which the reagents are attached, electronic hardware components, etc.).

In a particular embodiment, the kit of the invention also comprises the oligonucleotide probe with sequence SEQ ID NO: 4. In a particular embodiment of the kit of the invention, the oligonucleotide probe with sequence SEQ ID NO: 4 comprises a donor fluorophore at the 5' end or 3' end and an acceptor fluorophore at the opposite end from the donor.

In a particular embodiment of the kit of the invention, the donor fluorophore is selected from a group consisting of: 6-FAM, Cy5, Cy3, HEX, ROX, Texas Red, ATTO®647N, 6-JOE, VIC and TET. In another particular embodiment of the kit of the invention, the acceptor fluorophore is selected from a group consisting of: BHQ, BBQ, TAMRA, TQ2 and TQ3. In another more particular embodiment, BHQ is selected from BHQ1 and BHQ2. In another more particular embodiment, BBQ is BBQ650. In yet another particular embodiment, the kit of the invention also comprises a fluorescent marker selected from the group consisting of: SYTO 15, SYTO 25, SYTO 13, SYTO 9, N',N'-dimethyl-N-[4 -[(E)-(3-methyl-1,3-benzothiazol-2-ylidene)methyl]-1-phenylquinolin-1-io-2-yl]-N-propylpropane-1,3-diamine (SYBR Green I ), SYTO 16, SYTO 17, SYTO 21, SYTO 59, SYTOX, SYTO BC, 4',6-diamidino-2-phenylindole (DAPI), PicoGreen, and any combination thereof.

In a particular embodiment, the kit of the invention also comprises one or more of the components selected from the group consisting of reaction buffer, deoxyribonucleotide triphosphate (dNTP), magnesium chloride, and DNA polymerase.

Uses of the invention

Another aspect of the present invention is the use of the oligonucleotide of the invention or the kit of the invention to detect scuticociliates in a sample, hereinafter the use of the invention. All definitions and particular embodiments described above for other aspects of the present invention are equally valid for the present aspect.

In a particular embodiment of the use of the invention, the detection of scuticociliates is carried out by means of the method of the invention.

The invention will be described by means of the following examples, which should be considered merely illustrative and not limiting of the scope of the invention.

EXAMPLES

EXAMPLE 1 : MATERIAL AND METHODS

Obtaining ciliate control samples for the evaluation of PCR and real-time PCR (qPCR) assays

The control samples of ciliates for the evaluation of the qPCR assays come from axenic cultures of isolate 11 of P. dicentrarchi (Iglesias et al., 2001, Dis Aquat Organ. 46:47-55). The ciliates were obtained under aseptic conditions from the peritoneal fluid of turbot, Scophthalmus maximus, experimentally infected as previously described (Paramá et al., 2003, Aquaculture 217:73-80). Once the ciliates were isolated, they were cultured axenically at 21°C in sterile Leibovitz's L-15 medium, as previously described (Iglesias et al., 2003, Vet Parasitol. 111:19-30). Isolates C1, D2, D3 and S1 of P. dicentrarchi were obtained from ascitic fluid from naturally infected turbot in various Galician fish farms and cultured under the same conditions as isolate 11 (Budiño et al., 2011, Vet Parasitol 175:260-272). The ciliates of the species M. avidis strain Ma/2 were purchased from the American Type Culture Collection (ATCC, USA) and were cultured in ATCC Medium 1651 (ATCC®50180™) at 25°C. The environmental ciliates Uronema marinum, Protocruzia adherens and Euplotes minuta were obtained from water samples from turbot culture tanks by differential filtration (see section on water sample processing). For the individual isolation of the ciliates, the limit dilution technique was used, which was carried out in 96-well microtiter plates. The concentrated mixture of ciliates present in the water was included in 100 pL of sterile seawater containing 0.1% of 1651 medium. Subsequently, multiple 1/2 dilutions were made and those wells that contained a single ciliate, HE incubated for 72 h. Finally, the isolated ciliates were identified by amplifying the gene that encodes the 18S rRNA subunit and comparing the sequences obtained using the BLAST bioinformatics tool (Blastn, National Center for Biotechnology Information -NCBI-, USA).

Sample preparation and DNA extraction

For the collection and transport of the water samples, autoclavable 10-L polypropylene drums were used. 10 L of water were collected from the different critical points of the turbot farming and fattening system of a Galician fish farm by siphoning the bottom and/or walls of the tanks where there was an abundant presence of organic matter and/or bacterial biofilm. . Once the samples were collected, they were immediately sent to the Laboratory for analysis.

Processing of samples in the Laboratory

Immediately before processing the samples, the drums containing the seawater were shaken well.

2 L of the seawater samples were collected in a jug and subjected to differential filtration through filters of 150, 75, 10 and 0.8 pm.

The 10 and 0.8 pm filters (Cytiva, Whatman™, Germany) were collected, cut into small pieces and placed in 2 mL eppendorf tubes containing 100 pL of 700 pL diameter 150 pm zirconia beads. of TE buffer.

They were incubated for 30 min at room temperature to rehydrate the filters, and then they were shaken for 1 min and in 20-sec pulses. at 30,000 rpm in a ball mill (Retsch MM400, Germany). The sample was allowed to settle for 5 min at 4°C, the supernatant was collected and transferred to 1.5 mL eppendorf tubes.

Obtaining genomic DNA

537 pL of supernatant were collected and transferred to a 1.5 mL eppendorf tube. 30 pL of 10% SDS and 3 pL of proteinase K (20 mg/mL in water) were added. It was mixed by shaking and incubated for 1 h at 37°C. 100 pL of 5M NaCI was added and shaken. 80 pL of a 10% cetyl-tmethylammonium detergent (CTAB)/0.7 M NaCI solution was added and incubated for 10 min at 65 °C.

The same volume (750 pL) of chloroform/isoamyl alcohol (24:1) was added, mixed, and centrifuged at 10,000 x g for 5 min. 750 pL of the supernatant were transferred to 2 new 1.5 mL eppendorf tubes.

750 pL of phenol/chloroform/isoamyl alcohol (25:24:1) was added to each tube, mixed by vortexing, and centrifuged at 10,000 x g for 5 min. Supernatants were transferred to new 1.5 mL eppendorf tubes.

0.6 volumes of isopropanol was added to each tube and mixed gently. It was centrifuged at 10,000 xg for 5 min. The supernatant was removed and 1 mL of 70% ethanol was added to the precipitate without resuspending.

It was centrifuged at 10,000 xg, the supernatant removed and the pellet dried briefly in a Speed-Vac. The dried precipitate was rehydrated in 100 pL of TE buffer.

The concentration and purity of the DNA were quantified in a spectrophotometer (Nanodrop, Thermo Scientific, USA), adjusting the sample to 50 ng/pL.

Conventional PCR method and qPCR

The primers and the probe were designed based on the sequence corresponding to the rDNA formed by the 18S subunit, the internal transcribed spacer 1 (ITS-1), the 5S subunit, the internal transcribed spacer 2 (ITS-2) and the 23 subunit. S deposited in the GenBank database (NCBI, USA) with accession number MK002746. The primers were named flTS2 (5'-TCC CGC TAA ACT CGA AAA GC -3') (SEQ ID NO: 2) and rlTS2 (5'-AGC CGA GAT CAC TTT CTG TG-3') (SEQ ID NO: 3 ) and the plTS2 probe (FAM-5'-AAT CGT TCA GTG CCG ACC GAA GT-3'-BBQ650) (SEQ ID NO: 4).

standard PCR A 25 pL reaction mixture was prepared containing 19.6 pL of sterile MilliQ water, 2.5 pL of 10X reaction buffer, 0.5 pL of a 25 mM MgCh solution, 0.5 pL of 0.2 dNTPs mM, 0.5 of a mixture of the ITS2 /rlTS2 20 pM, 0.5 pL, 0.4 pL of a high affinity Taq DNA polymerase (NZY Proof DNA polymerase, Nzytech, Portugal) at 2.5 LI/pL and 1 pL of template DNA at 50 ng/pL. The PCR reaction was performed under the following programming conditions in a T100 Thermal Cycler (BioRad, USA): 95°C for 5 min, 35 cycles of 95 °C for 30 seconds, 60 °C for 45 seconds and 72 °C for 90 sec. and finally a third stage of 72°C for 10 min. After carrying out the PCR, the amplicons were analyzed by electrophoresis in 2% agarose gel containing 1x RedSafe dye (Intron Biotechnology, Korea). The amplification bands obtained were visualized by exposing the gel to ultraviolet radiation (312 nm) using a variable light intensity transilluminator (Spectroline, USA). qPCR

A 20 pL reaction mix was prepared containing 10 pL of NZYSpeedy qPCR Probe Master Mix (2x), ROX plus (Nzytech, Portugal), 0.6 pL of a 20 pM flTS2 / rlTS2 primer mix, 0.4 pL of 10 pM plTS2 probe, 0.5 pL of BSA (10 mg/mL), 7.5 pL of sterile MilliQ water, and 1 pL of a 50 ng/mL dilution of template DNA (or, alternatively, at the concentrations specified in each experiment). PCR was performed on a Step One Plus equipment (Real-Time PCR System, Applied Biosystems -ThermoFisherScientific, USA) under the following programming conditions: 95°C for 5 min, 40 cycles of 95°C for 10 sec. and 60°C for 60 sec. The results obtained from the analysis of the samples were analyzed using the StepOnePlus Real-Time PCR system version 2.3 software (life technologies, USA). For the quantification of the ciliates present in the samples, standard curves were constructed based on serial dilutions % of DNA concentrations obtained from ciliates in a range between 1-60 ciliates/pL. For the other calibration curves, a minimum of 6Log of DNA concentrations were used. The C _q values obtained were plotted against the logarithm of the sample concentrations and the slope (m) of the standard curves was calculated from a linear regression. The efficiency (E) of the qPCR was calculated according to the formula: E = 10 ^1/m -1 . To calculate the coefficient of variation (CV) the formula was used: CV (%) = mean/standard deviation x 100.

Cloning and sequencing of the ITS-2 region The PCR product containing the 78 base pair (bp) ITS-2 fragment (SEQ ID NO: 1) was cloned into the pSparkll vector using the pSparkll cloning kit (Canvax, Spain), following the instructions of the commercial house, and transformed into competent Escherichia coli strain DH-5a bacteria which were grown for 24 h at 37°C in LB/ampicillin/IPTG/X-Gal medium. The white colonies obtained were grown for 24 h at 37 °C in LB/ampicillin liquid medium and the plasmids were purified using the GeneJet Plasmid Miniprep kit (thermoscientific, USA), following the instructions of the commercial company. The cloned inserts were sequenced by Sanger sequencing by the commercial company Eurofins Genomics (Germany). The identity between the different nucleotide sequences of the ITS-2 fragments of the tested ciliates was determined by multiple alignment using the Clustal Omega bioinformatics tool (European Bioinformatics Institute, EMBL-EBI). To determine the number of copies of the ciliate genome, standard curves were constructed from 1/10 serial dilutions of known concentrations of plasmids with the cloned fragment in a range between 10' ² and 10 ³ ng/pL. The number of copies corresponding to each dilution was obtained from the following formula:

N° copies = DNA concentration (ng) x 6,022 x 10 ²³ / length of the plasmid containing the insert (bp) x 10 ⁹ (conversion factor to ng) x 660 (average mass of double-stranded DNA).

EXAMPLE 2: RESULTS AND DISCUSSION

Analysis of the specificity and sensitivity of the assay

Initially, the specificity of the flTS2 /rlTS2 primers (Table 1) was evaluated by conventional PCR and the results obtained are shown in Figure 1. In this experiment, a 78 base pair (bp) fragment located in the ITS2 region of the gene encoding ribosomal RNA (rRNA) corresponding to 5 isolates of P. dicentrarchi (isolates 11, C1, D2, D3 and S1), the Ma/2 strain of M. avidus and the environmental ciliates U. marinum , P. adherens and E. minuta. As can be seen in figure 1, the pair of primers designed amplifies all the isolates of P. dicentrarchi and the Ma/2 strain of M. avidus, however, it does not amplify the environmental ciliates U. marinum, P. adherens and E. .minute. Table 1: Table of nucleotide identities, expressed as a percentage, between the sequences of the ITS2 fragment of the species P. dicentrarchi and the marine ciliates U. marinum, P. adherens, and E. minuta calculated using the Clustal omega program.

Sequence analysis of the ITS2 fragment amplified by the flTS2/rlTS2 primers confirms that the sequences of the P. dicentrarchi isolates and the M. avidus strain Ma/2 show 100% and lower identity with U. marinum (74.55%), E. minuta (44.87%) and P. adherens (42.31%) (Table 1).

Analysis of qPCR characteristics

The PCR characteristics were defined after the construction of standard curves from the assay of different concentrations at a 1/10 dilution of plasmids cloned with the ITS2 fragment amplified with the flTS2/rlTS2 primers, in a Cq range between 14 and 29. cycles (Figure 2). The lowest and highest concentrations of the standard included in the calibration curve must be determined according to a linear dynamic range of at least 6 Log (Krallik and Ricchi, 2017, Front. Microbiol. 8: 108).

The slope (m) of the calibration curve should be calculated by linear regression. In order for the m to be a real gain indicator (rather than a drift signal), there has to be a breakpoint in the gain graph. The slope of the linear regression line is ideally -3.3219, which results in an efficiency (E) of qPCR of 1. With this E, the number of target molecules is exactly doubled in one PCR cycle and one m between -3.1 and -3.6, with an E between 90 and 110 are generally acceptable (Svec et al., 2015, Biomol Detect Quantif. 3:9-16). The calculated m of the regression line corresponding to the amplification with the plasmids cloned with the ITS2 fragment is -3.0585 (Fig. 2), while that obtained for the quantification of the ciliates is -3.3928 (Fig. .3), both values are are within the range -3.6 < m < -3.1 that are considered optimal for qPCR (Raymaekers et al., 2009, J Clin Lab Anal. 23:145-151).

The amplification efficiency (E) is one of the most important parameters when optimizing qPCR since it decisively affects the results obtained, since even small changes in E lead to considerable differences in the final data ( Rao et al., 2013, J Comput Biol. 20:703-711). qPCR E is defined as the fraction of target molecules that are copied in one PCR cycle such that a well-designed assay should amplify template DNA with at least 90% E (Svec et al., 2015, Biomol Detect Quantif 3:9-16). The E must be in the range of 0-1 (0-100%) in such a way that when E=1 the number of generated DNA amplicons doubles in each cycle; however, in practice this parameter is in the range between 90-105% (Johnson et al., 2013, Methods Mol. Biol. 943: 1-16). This parameter is usually estimated from the m of the calibration curve (Krallik and Ricchi, 2017, Front. Microbiol. 8: 108). Regarding the estimate of the E of the qPCR used, both when the regression line is constructed with the cloned plasmids and with the DNA of the ciliates, E between 1.1 and 0.9 are obtained (110-90 %), respectively (Fig. 2 and 3), values that are in the range of 0.9 < E < 1.1, which are considered optimal for qPCR (Raymaekers et al., 2009, J Clin Lab Anal. 23 :145-151).

Internal quality control: Linearity, limit of detection and quantification and precision of the qPCR assay

Standard curves are also used, in addition to evaluating the performance of the qPCR assay by estimating its E, to determine the assay's dynamic range, limit of detection (LOD), and limit of quantification (LOQ) (Svec et al. , 2015, Biomol Detect Quantif. 3:9-16).

Linearity: The correlation coefficient (R ² ) obtained in the standard curves is greater than 0.99 (Figs. 2 and 3), which indicates a high linearity of the qPCR assay, as well as a very high correlation between Cq and concentration. of sample DNA. In qPCR assays, the R ² obtained in the analysis should be >0.98 (Breeders et al., 2014, Trends in Food Science & Technology, 37: 115-126).

Limit of detection (LOD) and limit of quantification (LOQ)) The determination of the LOD of the assay was carried out using a standard curve constructed from the means of samples tested in triplicate. The concentration ranges of P. dicentrarchi DNA used for the construction of the standard curve were between 50 ng/pL and 50 pg/pL. Negative controls that do not have template DNA (NTC) and samples of 50 ng/pL of DNA from a mixture of environmental ciliates isolated from seawater (EC) were also included in the assay. The mean values of Cq obtained in the qPCR using the NTC and EC controls were 35 and 34.3, respectively. Experimental results showed that the LOD of the assay was at least 120 pg/pL giving a Cq of 30 (Fig. 3). To determine the LOQ, a standard curve obtained after testing DNA samples extracted individually from ciliates in a range of 1-64 trophonts was constructed. The experimental results obtained after amplification by qPCR show that it is possible to reliably detect up to 1 ciliate per reaction, so this value represents the LOQ of the assay (Fig. 4).

Assay precision: In general, the precision of qPCR methods is analyzed by calculating the coefficients of variation (CV) that measure the variation around the mean and are a useful tool to assess the degree of inconsistency of the data (Taylor et al. ., 2019, Trends Biotechnol. Jul;37(7):761-774). Precision is defined as the closeness of agreement of measurements under specified conditions; however, for the practical determination of precision, two conditions called: repeatability and reproducibility were introduced (Kralik and Ricchi, 2017, Front. Microbiol. 8: 108) that allow describing the variability of the results obtained and that can be determined through of two different variables: intra-assay variability (variability in replicates performed in the same experiment) and inter-assay variability (variability between different assays performed on different days). In the qPCR we have analyzed 10 samples in each trial where we evaluated the intraspecific and interspecific variation obtained. Specifically, we have tested the variability in the Cq obtained from positive samples and negative samples, the results of which are shown in Table 2. As can be seen, the calculated CVs vary between 0.55 and 2.05% in the inter-assay and between 0.27 and 7.57 in the inter-assay, all values much lower than 25%, which is the limit of variability considered for a qPCR assay to present adequate repeatability and reproducibility.

Table 2: Determination of the degree of precision after the analysis of the intra- and inter-assay coefficients of variation of the Cq obtained in the qPCR.

NTC: Negative control without template (MilliQ water); CN: Negative control (seawater autoclaved for 15 min at 121°C and subjected to the same processing and DNA extraction conditions as the samples); PC: Positive control (template: 50 ng/mL of DNA extracted from ciliates grown in vitro); CPC: Contaminated positive control (template: seawater autoclaved for 15 min at 121°C and contaminated with 1.5x1o ³ ciliates/mL); CC: Control mixture of environmental ciliates; S: Positive experimental sample (presence of P. dicentrarchi) of water obtained from the fish farm; SD: standard deviation; CV: Coefficient of variation (in percentage). CV= SD/mean x 100. n=10 samples

Evaluation of the sample collection and processing protocol

Finally, experiments were carried out to determine the efficiency and performance of obtaining and recovering ciliates in seawater samples. For the isolation of the ciliates, a concentration method was followed using a sequential vacuum filtration system. Previously, the sample volume to be analyzed was also established experimentally, which was a total of 2L. Once the isolation conditions were established, a DNA isolation and purification method was also used from the ciliates concentrated by means of the filtration system. The performance of the entire procedure was evaluated on a 2L water sample obtained from a turbot culture tank that had previously been tested positive for ciliates and subsequently contaminated with a known amount of 4x10 ³ ciliates. obtained from an in vitro culture in the laboratory. For this assay, the extracted samples were subjected to qPCR and the ciliates were quantified by extrapolating the Cq obtained to a calibration line constructed with different amounts of ciliate DNA, specifically from a known number of trophonts of P.dicentrarchi strain 11 (Fig. 3). As can be seen in Table 3, the final quantification of the ciliates in the contaminated sample was practically equal to the number of ciliates with which it was contaminated (adding the number of original ciliates that the sample itself had with the added ciliates), obtaining a recovery of 100% of the ciliates.

Table 3: Yield of the ciliate extraction method from seawater (% recovery).

Conclusions The qPCR method designed is very specific, allowing the determination and quantification of the presence of scuticociliate trophonts (specifically of the species P. dicentrarchi and M. avidus), it has high efficiency and sensitivity, being able to detect up to 1 ciliate/sample. Likewise, qPCR has a high precision, as indicated by the low percentages of intra- and inter-assay variation and the isolation protocol for the quantification of ciliates in water presents a performance of practically 100%.

***

The term "Artificial Sequence" in the sequence listing is translated as "Artificial Sequence"

Claims

1. A procedure for the detection of scuticociliates in a sample comprising: a) subjecting the nucleic acids obtained from said sample to an amplification reaction of a target region of the scuticociliate genome that has at least 80% identity with SEQ ID NO: 1 or a fragment thereof in the presence of a forward primer and a reverse primer specific for said region capable of amplifying said region or fragment, and b) detecting the amplification product produced in step a) where the detection of a amplification product is indicative of the presence of scuticociliates in the sample.

2. The method according to claim 1, wherein the scuticociliates are selected from a group consisting of Philasterides dicentrarchi, Miamiensis avidus and combinations thereof.

The method according to any of claims 1 or 2, wherein the sample is a salt water sample.

4. The method according to claim 3, wherein the water sample is water obtained from estuaries, saltwater lakes, marshes, seas, oceans, estuaries, aquaculture in land-based facilities or in cages in the open sea, marine fish farms or aquariums. of warm or cold water marine animals.

5. The method according to any of claims 3 or 4, wherein the water sample is previously processed according to a method for isolating nucleic acids comprising:

(i) Concentration of microorganisms, obtaining a first solution;

(ii) Lysis of the first solution, obtaining a second solution;

6. The procedure according to claim 5, wherein the concentration of microorganisms in the water sample is carried out by means of a sequential vacuum filtration system.

The method according to any of claims 5 or 6, wherein the volume of the water sample is at least 1 litre, preferably at least 2 litres.

8. The method according to any of claims 1 to 7, wherein the target region of the scuticociliate genome has at least 85% identity with SEQ ID NO: 1.

9. The method according to claim 8, wherein the target region of the scuticociliate genome has at least 92% identity with SEQ ID NO: 1.

10. The method according to any of claims 1 to 9, wherein the target region of the scuticociliate genome consists of the sequence SEQ ID NO: 1.

The method according to any of claims 1 to 10, wherein the primers comprise between 18 to 30 nucleotides.

12. The method according to claim 11, wherein the primers comprise between 20 to 26 nucleotides.

The method according to any of claims 1 to 12, wherein the primers consist of 20 nucleotides.

The method according to any of claims 1 to 13, wherein the forward primer comprises a sequence that has at least 80% identity with the sequence SEQ ID NO: 2.

15. The method according to any of claims 1 to 14, wherein the forward primer consists of the sequence SEQ ID NO: 2.

The method according to any of claims 1 to 15, wherein the reverse primer comprises a sequence having at least 80% identity with the sequence SEQ ID NO: 3.

17. The method according to any of claims 1 to 16, wherein the reverse primer consists of the sequence SEQ ID NO: 3.

18. The method according to any of claims 1 to 17, wherein the amplification reaction is carried out by means of a polymerase chain reaction (POR) in real time.

The method according to any of claims 1 to 18, wherein the amplification reaction is performed in the presence of reaction buffer, deoxyribonucleotide triphosphate (dNTP), magnesium ions, and DNA polymerase.

The process according to claim 19, wherein the magnesium ions are obtained from magnesium chloride (MgCh) present at a concentration of 2 to 3 mM in the reaction mixture.

The process according to claim 20, wherein the magnesium ions are obtained from magnesium chloride (MgCh) present at a concentration of 2.5 mM in the reaction mixture.

22. The method according to any of claims 1 to 21, wherein the amplification reaction is performed in the presence of an oligonucleotide probe or in the presence of a fluorescent marker, wherein the oligonucleotide probe comprises a sequence complementary to a fragment of the target region.

23. The method according to claim 22, wherein the hybrid oligonucleotide probe with a sequence located in the region of SEQ ID NO: 1 between nucleotides 22 and 57 of SEQ ID NO: 1.

The method according to any of claims 22 or 23, wherein the oligonucleotide probe comprises a sequence having at least 80% identity with the sequence SEQ ID NO: 4.

25. The method according to claim 24, wherein the oligonucleotide probe consists of the sequence SEQ ID NO: 4.

The method according to any of claims 22 to 25, wherein the oligonucleotide probe comprises a donor fluorophore at the 5' end or 3' end and an acceptor fluorophore at the opposite end to the donor.

The method according to claim 26, wherein the donor fluorophore is selected from the group consisting of:

[2',4,4',5',7,7'-hexachloro-6-[6-[2-cyanoethoxy¡-[di(propane-2-yl)amino]phosphanyl]oxyhexylcarbamoyl 2,2-dimethylpropanoate ]-6'-(2,2-dimethylpropanoyloxy)-3-oxospiro[2-benzofuran-1,9'-xantheno]-3'-yl](HEX);

- 3R,4S,5S,6R,7R,9R, 11S, 12R, 13S,14R)-6-[(2S,3R,4S,6R)-4-(dimethylamino)-3-hydroxy-6- methyloxane-2-yl]oxy-14-ethyl-7,12,13-trihydroxy-4-[(2R,4R,5S,6S)-5-hydroxy-4-methoxy-4,6-dimethyloxan-2-yl ]oxy-10-(2-methoxyethoxymethoxyamino)-

3,5,7,9,11,13-hexamethyl-oxacyclotetradecane-2-one (ROX);

5-chlorosulfonyl-2-(3-oxa-23-aza-9-azoniaheptacyclo[17.7.1.1 ⁵ ' ⁹ .0 ² ' ¹⁷ .0 ⁴ ' ¹⁵ .0 ²³ ' ²⁷ .0 ¹³ ' ²⁸ ]octacosa-1( 27),2(17),4,9(28),13,15,18-heptaen-16-yl)benzenesulfonate (Texas Red);

2-(7-ethyl-3,3,8,8,10-pentamethyl-7-aza-21-azoniahexacyclo[15.7.1.0 ² ' ¹⁵ .0 ⁴ ' 13 ^.0 ⁶ ' ¹¹ .0 ²¹ ' ²⁵ ]pentacose - 1,4(13),5,11,14,16,18,21(25)-octaen-14-yl)-N-methyl-N-(4-oxopentyl)benzamide (ATTO® 647N);

(2,5-dioxopyrrolidine) 4',5'-dichloro-3',6'-dihydroxy-2',7'-dimethoxy-1-oxospiro[2-benzofuran-3,9'-xanthene]-5-carboxylate -1 -yl) (6-JOE);

The method according to either of claims 26 or 27, wherein the acceptor fluorophore is selected from a group consisting of:

2,5-Bis(2-methyl-2-propanyl)-7,4-benzenedol (BHQ1, BHQ2);

- A/-[2-[[(E)-3-[1-[(2 ,4S,5 )-5-[[bis(4-methoxyphenyl)-phenylmethoxy]methyl]-4-[2-cyanoethoxy- [di(propane-2-yl)amino]phosphanyl]oxyoxolan-2-yl]-2,4-dioxopyrimidin-5-yl]prop-2-enoyl]amino]ethyl]-6-[[7-[[2 ,5-dimethoxy-4-[(4- nitrophenyl)diazenyl]phenyl]diazenyl]-1-azatricyclo[7.3.1.0 ^{5 13} ]trideca-5(13),6,8-trien-6-yl]oxy]hexanamide (BBQ650);

2-[3-(dimethylamino)-6-dimethylazanioylidenexanthen-9-yl]benzoate (TAMRA);

5-phenylsulfanylquinazolin-2,4-diamine (TQ3).

The method according to any of claims 22 to 25, wherein the fluorescent marker is selected from a group consisting of: SYTO 15, SYTO 25, SYTO 13, SYTO 9, N',N'-dimethyl-N-[4 -[(E)-(3-methyl-1,3-benzothiazol-2-ylidene)methyl]-1-phenylquinolin-1-io-2-yl]-N-propylpropane-1,3-diamine (SYBR Green I ), SYTO 16, SYTO 17, SYTO 21 , SYTO 59, SYTOX, SYTO BC, 4',6-diamid¡no-2-phenylindole (DAPI), PicoGreen, and any combination thereof.

The method according to any of claims 1 to 29, wherein the amplification reaction conditions comprise:

(v) A final extension step at a temperature between 68°C and 72°C for a time between 5 min and 15 min, where steps (ii), (iii) and (iv) are repeated at least 20 times before carrying out step (v).

(iii) A hybridization step at a temperature between 58°C and 62°C for a time between 30 s and 90 s; where steps (¡i) and (iii) are repeated at least 10 times.

32. The method according to any of claims 1 to 31, wherein the detection of the amplification product is carried out by gel electrophoresis and/or DNA sequencing.

The method according to any of claims 1 to 32, wherein the method further comprises a step to quantify the concentration of scuticociliates in the sample.

34. The method according to claim 33, where the quantification is done through a standard curve.

35. An oligonucleotide selected from a group consisting of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4.

The oligonucleotide of claim 35, wherein the oligonucleotide according to SEQ ID NO: 4 comprises a donor fluorophore at the 5' end or 3' end and an acceptor fluorophore at the opposite end to the donor.

The oligonucleotide of claim 36, wherein the donor fluorophore is selected from the group consisting of:

3,5,7,9,11,13-hexamethyl-oxacyclotetradecane-2-one (ROX);

5-chlorosulfonyl-2-(3-oxa-23-aza-9-azoniaheptacyclo[17.7.1.1 ⁵ ' ⁹ .0 ² ' ¹⁷ .0 ⁴ ' ¹⁵ .0 ²³ ' ²⁷ .0 ¹³ ' ²⁸ ]octacosa-1( 27),2(17),4,9(28),13,15,18-heptaen-16-yl)benzenesulfonate (Texas Red); 2-(7-ethyl-3,3,8,8,10-pentamethyl-7-aza-21-azoniahexacyclo[15.7.1.0 ² ' ¹⁵ .0 ⁴ ' 13 ^.0 ⁶ ' ¹¹ .0 ²¹ ' ²⁵ ]pentacose - 1,4(13),5,11,14,16,18,21(25)-octaen-14-yl)-N-methyl-N-(4-oxopentyl)benzamide (ATTO® 647N);

The oligonucleotide according to claim 36 or 37, wherein the acceptor fluorophore is selected from the group consisting of:

2,5-Bis(2-methyl-2-propanyl)-7,4-benzenediol (BHQ1, BHQ2);

- /V-[2-[[(E)-3-[1-[(2 ,4S,5 )-5-[[bis(4-methoxyphenyl)-phenylmethoxy]methyl]-4-[2- cyanoethoxy- [di(propane-2-yl)amino]phosphanyl]oxyoxolan-2-yl]-2,4-dioxopyrimidin-5-yl]prop-2-enoyl]amino]ethyl]-6-[[7-[[2 ,5-dimethoxy-4-[(4-nitrophenyl)diazenyl]phenyl]diazenyl]-1-azatricyclo[7.3.1.0 ^{5 13} ]trideca-5(13),6,8-trien-6-yl]oxy]hexanamide (BBQ650);

2-[3-(dimethylamino)-6-dimethylazanioylidenexanthen-9-yl]benzoate (TAMRA);

5-phenylsulfanylquinazolin-2,4-diamine (TQ3).

39. A kit comprising a pair of sequence primers SEQ ID NO: 2 and SEQ ID NO: 3.

40. The kit according to claim 39, which also comprises the oligonucleotide probe with sequence SEQ ID NO: 4.

41. The kit according to claim 40, wherein the oligonucleotide probe of sequence SEQ ID NO: 4 comprises a donor fluorophore at the 5' end or 3' end and an acceptor fluorophore at the opposite end to the donor.

42. The kit according to claim 41, wherein the donor fluorophore is selected from a group consisting of: - 3',6'-dihydroxy-1-oxospiro[2-benzofuran-3,9'-xanthene]-5-carboxylic acid (6-FAM);

[2',4,4',5',7,7'-hexachloro-6-[6-[2-cyanoethoxy-[di(propane-2-yl)amino]phosphanyl]oxyhexylcarbamoyl] 2,2-dimethylpropanoate -6'-(2,2-dimethylpropanoyloxy)-3-oxospiro[2-benzofuran-1,9'-xantheno]-3'-yl](HEX);

- 3R,4S,5S,6R,7R,9R, 11S, 12R, 13S,14R)-6-[(2S,3R,4S,6R)-4-(dimethylamino)- 3-hydroxy-6-methyloxane- 2-yl]oxy-14-ethyl-7,12,13-trihydroxy-4-[(2R,4R,5S,6S)-5-hydroxy-4-methoxy-4,6-dimethyloxan-2-yl]oxy -10-(2-methoxyethoxymethoxyamino)-

3,5,7,9,11,13-hexamethyl-oxacyclotetradecane-2-one (ROX); 5-chlorosulfonyl-2-(3-oxa-23-aza-9- azoniaheptacyclo[17.7.1.1 ⁵ ' ⁹ .0 ² ' ¹⁷ .0 ⁴ ' ¹⁵ .0 ²³ ' ²⁷ .0 ¹³ ' ²⁸ ]octacosa-1 ( 27),2(17),4,9(28),13,15,18-heptaen-16-yl)benzenesulfonate (Texas Red); 2-(7-ethyl-3,3,8,8,10-pentamethyl-7-aza-21-azoniahexacyclo[15.7.1.0 ² ' ¹⁵ .0 ⁴ ' 13 ^.0 ⁶ ' ¹¹ .0 ²¹ ' ²⁵ ]pentacose -

1,4(13),5,11,14,16,18,21(25)-octaen-14-yl)-N-methyl-N-(4-oxopentyl)benzamide (ATTO® 647N); (2,5-dioxopyrrolidine) 4',5'-dichloro-3',6'-dihydroxy-2',7'-dimethoxy-1-oxospiro[2-benzofuran-3,9'-xanthene]-5-carboxylate -1 -yl) (6-JOE);

- (2S,4R)-N-[(1S)-2-methyl-1-[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-methylsulfaniloxan-2-yl]propyl ]-4-propylpiperidine-2-carboxamide (VIC); and 4,5,6,7-tetrachloro-3',6'-dihydroxyspiro[2-benzofuran-3,9'-xanthene]-1-one (TET). The kit according to either of claims 41 or 42, wherein the acceptor fluorophore is selected from a group consisting of:

2,5-Bis(2-methyl-2-propanyl)-7,4-benzenediol (BHQ1, BHQ2);

- /V-[2-[[(E)-3-[1-[(2 ,4S,5 )-5-[[bis(4-methoxyphenyl)-phenylmethoxy]methyl]-4-[2- cyanoethoxy- [di(propane-2-yl)amino]phosphanyl]oxyoxolan-2-yl]-2,4-dioxopyrimidin-5-yl]prop-2-enoyl]amino]ethyl]-6-[[7-[[2 ,5-dimethoxy-4-[(4-nitrophenyl)diazenyl]phenyl]diazenyl]-1-azatricyclo[7.3.1.0 ⁵ ' ¹³ ]trideca-5(13),6,8-trien-6-yl]oxy] hexanamide (BBQ650);

2-[3-(dimethylamino)-6-dimethylazanioylidenexanthen-9-yl]benzoate (TAMRA);

5-phenylsulfanylquinazolin-2,4-diamine (TQ3).

44. The kit according to any of claims 39 to 43, further comprising a fluorescent marker selected from the group consisting of: SYTO 15, SYTO 25, SYTO 13, SYTO 9, N',N'-dimethyl- N-[4-[(E)-(3-methyl-1,3-benzothiazol-2-ylidene)methyl]-1-phenylquinolin-1-io-2-yl]-N-propylpropane-1,3 -diamine (SYBR Green I), SYTO 16, SYTO 17, SYTO 21, SYTO 59, SYTOX, SYTO BC, 4',6-diamidino-2-phenylindole (DAPI), PicoGreen, and any combination thereof.

The kit according to any of claims 39 to 44, further comprising one or more of the components selected from the group consisting of reaction buffer, deoxyribonucleotide triphosphate (dNTP), magnesium ions and DNA polymerase.

46. The use of the oligonucleotide according to any of claims 35-38 or the kit according to any of claims 39 to 45 to detect scuticociliates in a sample.

47. The use of claim 46, wherein the detection of scuticociliates is carried out by the method according to any of claims 1 to 34.