WO2023092861A1

WO2023092861A1 - Lamp-lfd primer set and kit for identifying origin of edible bird's nest, and detection method therefor and use thereof

Info

Publication number: WO2023092861A1
Application number: PCT/CN2022/074096
Authority: WO
Inventors: 李耿
Original assignee: 百年同康药业集团有限公司
Priority date: 2021-11-25
Filing date: 2022-01-26
Publication date: 2023-06-01
Also published as: CN114990224A

Abstract

Disclosed in the present invention are a LAMP-LFD primer set and kit for identifying the origin of an edible bird's nest, and a detection method therefor and a use thereof. In the present invention, the origin of an edible bird's nest is identified by using a LAMP-LFD, a nucleic acid of an edible bird's nest sample to be identified can be rapidly amplified by means of LAMP, and an amplification result is reflected by a LFD, thereby implementing an identification process.

Description

A LAMP-LFD primer set, kit, detection method and application for identifying bird's nest base

technical field

The invention relates to the technical field of detection of bird's nest bases, in particular to a LAMP-LFD primer set, a kit, a detection method and application thereof for identifying bird's nest bases.

Background technique

Bird's nest refers to the nest made of the saliva secreted by some swifts of the Swift family Swift family and several swiftlets of the genus Swiftlet, mixed with other substances. It is mainly produced in Southeast Asian countries such as Malaysia, Indonesia, Thailand and Myanmar, as well as the coastal areas of Fujian and Guangdong in my country. Bird's nest is rich in sugars, organic acids, free amino acids and a characteristic substance - sialic acid, which has certain nutritional value. As far as bird’s nest bases are concerned, bird’s nests of different bases are different, especially in that bird’s nests of different bases have different composition ratios, shapes, tastes, etc., such as: different proportions of sialic acid. Bird's nests of different bird's nest bases have distinguishing characteristics, therefore, identification of bird's nest bases is necessary. The identification of bird's nest bases is not only beneficial to the scientific research of bird's nest, but also facilitates the identification of bird's nest products in the market, avoiding counterfeit and inferior products in the market, and has a good promotion effect on the entire production and sales environment of bird's nest.

However, there are still many deficiencies in the existing identification methods of bird's nest bases, and it is impossible to achieve a more accurate and rapid identification of bird's nest. For example, sensory identification and physical and chemical property identification are commonly used in the prior art. Although this type of method is relatively simple, it has insufficient accuracy, low sensitivity, and poor reproducibility. Therefore, the prior art urgently needs a high-accuracy, high-sensitivity, and reproducible identification method for bird's nest origin, so as to make up for the deficiencies in the common identification methods of the prior art.

Loop-mediated isothermal amplification technology (Loop-mediated isothermal amplification, LAMP) is a rapid gene identification method developed in 2000, under the action of strand displacement DNA polymerase (Bst DNA polymerase) for strand cycle amplification, using a An outer primer and a pair of inner primers were paired with 6 regions of the target gene. Compared with ordinary PCR, it has higher specificity. 60-65°C is the intermediate temperature for renaturation and elongation of double-stranded DNA. DNA is in a state of dynamic equilibrium at around 65°C, making strand-displacing DNA synthesis self-circulating continuously.

LAMP amplification is divided into two stages. The first stage is the initial stage. When the double-stranded DNA is complementary and extended, the hydrogen bond between the two strands will break and become a single strand. The F2 sequence of the upstream internal primer FIP first combines with the template F2c, and is extended forward under the action of the strand-displacing DNA polymerase to initiate strand-displacement synthesis. The outer primer F3 binds and extends the template F3c, displacing the complete FIP-linked complementary single strand. F1c on FIP is complementary to F1 on this single chain. Self-base pairing forms a ring structure. Use this chain as a template. The downstream primers BIP and B3 successively initiate the synthesis similar to FIP and F3, forming a single strand with a dumbbell-like structure. Quickly start with the F1 segment at the 3' end. Using itself as a template, DNA synthesis is extended to form a stem-loop structure, which is the initial structure of the LAMP gene amplification cycle. The second stage is the amplification cycle stage, using the stem-loop structure as a template, and FIP binds to the F2c region of the stem-loop. Strand displacement synthesis starts, and a circular structure is also formed on the dissociated single-stranded nucleic acid. Rapidly starts with the B1 segment at the 3' end, using itself as a template. Carry out DNA synthesis extension and strand replacement. Two new stem-loop DNAs of different lengths are formed, and B2 on the BIP primer hybridizes to it. Start a new round of amplification. And the length of the product DNA is doubled. Two loop primers LF and LB are added to the reaction system, and they also combine with the stem-loop structure respectively to initiate strand displacement synthesis, and the cycle repeats. The final product of amplification is a mixture of DNA with different numbers of stem-loop structures and different lengths. And the product DNA is the alternating inverted repeat sequence of the amplified target sequence. The whole process generally takes 0.5-1h, which can achieve 10 ⁹ to 10 ¹⁰ amplification of the target gene, while ordinary PCR basically takes 1.5h or even longer, and LAMP shortens the time by more than half. Moreover, the whole process of LAMP is isothermal amplification, which requires less equipment, and has the advantages of fast, simple, high sensitivity, and strong specificity. However, LAMP also has some imperfections. There are three main detection methods for LAMP products, agarose gel electrophoresis, and observing the color change of SYBR Green I under natural light and ultraviolet light. contamination can affect the experimental results. Nucleic acid lateral-flow device (LFD) is a detection method based on immunochromatography technology, which combines nucleic acid amplification technology and paper chromatography technology. Compared with gel electrophoresis, it has the advantages of high sensitivity of nucleic acid amplification, and the advantages of easy operation and low price of chromatography test paper. In addition, the nucleic acid chromatography test paper device is cheap, and the fully sealed use method also has the effect of preventing aerosol pollution.

This application intends to combine the characteristics of LAMP and LFD to solve the shortcomings of common identification methods in the field of identification of bird's nest bases in the prior art, and to provide an accurate, fast and sensitive identification method and related primers, reagents, etc.

Contents of the invention

The present invention aims at overcoming at least one deficiency of the above-mentioned prior art, and provides a LAMP-LFD primer set for identifying bird's nest bases, a kit and its detection method and use, through which LAMP can rapidly amplify the bird's nest DNA to be identified and realize Identification, high accuracy, high sensitivity, reproducibility, and combined with LFD can avoid aerosol pollution, to achieve simple and more accurate detection.

The primary purpose of the present invention is to overcome the existing difficulties in morphological identification and provide a primer set for identifying bird's nest bases, which is applied to LAMP amplification and the corresponding LAMP-LFD system.

The object of the present invention is achieved through the following technical solutions:

A primer set for identifying bird’s nest origin, including outer primer F3, outer primer B3, inner primer FIP, and inner primer BIP; the sequences are F3: ACCTCTTCTCAGCAATCCCA; B3: AAGTAGGGGTGGAATGGGA; FIP: GTGTAGGGCGAAGAATCGGGTTATCGGCCAAACCCTCGTA; BIP: CCTTCCTAATCGCCGCCTCATTCCTAGGGGGTTGT TCGA. In one embodiment of the present invention, the primer set is designed based on the conserved sequence of the identified bird's nest base, and the primer set can specifically amplify the corresponding bird's nest base bird's nest DNA, combined with the color development of LFD, it can Effectively identify the bird's nest base of the sample.

Preferably, loop primers LF and LB are also included; the sequences are: LF: GCTGAGAAGAGGTTGGTAATGAC; LB: CTCAGTAGACAACCCACATTAAC. By adding loop primers LF and LB, the reaction speed can be significantly accelerated, the LAMP amplification reaction can be further accelerated, and the time required for the entire identification process can be shortened.

Preferably, the 5' end of LF is labeled with Biotin, and the 5' end of LB is labeled with fluorescein FAM. By adding corresponding labeled biotin and labeled fluorescein to LF and LB respectively, it is convenient to display the detection results of LAMP-LFD, so that the identification results can be obtained by directly observing the color development of the lateral flow chromatography test paper.

Preferably, the above primer set is used to identify swiftlet nests. In one embodiment of the present invention, the above primer set is designed based on the identified original bird's nest samples and the conserved sequence of Java swiftlet cytb gene published in the existing database, which can at least be used to identify whether the original bird's nest is golden silk Swallows.

Another object of the present invention is to provide a LAMP-LFD kit for identifying bird's nest bases, comprising the above-mentioned primer set and/or lateral flow test strip.

Preferably, the above-mentioned primer set is contained, wherein the LAMP reaction system is 25 μl, including:

Preferably, the detection condition of LAMP-LFD is: water bath at 63°C for 0.5h, and then stand at room temperature for 5-10min. When the present inventors use the above primer set for amplification and identification, for the above LAMP system, the optimum temperature for LAMP amplification is 63°C. The LAMP amplification process was completed in a water bath at 63°C for 0.5 h, and further placed at room temperature for 5-10 min, and the LFD would gradually develop color to complete the detection process.

Another object of the present invention is to provide a kind of LAMP-LFD detection method for identifying bird's nest base, comprising steps:

A1. Extract the DNA of the bird's nest sample to be identified;

A2, designing LAMP primers for amplifying specific gene DNA;

A3. Configure the corresponding LAMP reaction system based on the DNA obtained in A1 and the LAMP primers obtained in A2;

A4, the LAMP reaction system configured in A3 is placed in a nucleic acid detection device, the nucleic acid detection device is provided with nucleic acid chromatography test paper; the color development state of the nucleic acid chromatography test paper reflects the LAMP amplification result, to identify the bird's nest sample to be identified Is it the corresponding motif of the LAMP primer.

Preferably, in one embodiment of the present invention, the specific gene is a bird's nest motif of the genus Swiftlet.

Preferably, the LAMP primers in step A2 include: outer primer F3, outer primer B3, inner primer FIP, and inner primer BIP; the sequences are F3: ACCTCTTCTCAGCAATCCCA; B3: AAGTAGGGGTGGAATGGGA; FIP: GTGTAGGGCGAAGAATCGGGTTATCGGCCAAACCCTCGTA; BIP: CCTTCCTAATCGCCGCCTCATTCCTAGGGGGT TGTTCGA.

Preferably, the LAMP primers in step A2 include: outer primer F3, outer primer B3, inner primer FIP, inner primer BIP, loop primer LF, and loop primer LB; the sequences are F3: ACCTCTTCTCAGCAATCCCA; B3: AAGTAGGGGTGGAATGGGA; FIP: GTGTAGGGCGAAGAATCGGGTTATCGGCCAAACCCTCGTA; BIP: CCTTCCTAATCGCCGGCCTCATTCCTAGGGGGTTGTTCGA; LF: GCTGAGAAGAGGTTGGTAATGAC; LB: CTCAGTAGACAACCCACATTAAC.

Preferably, the LAMP reaction system is 25 μl, including:

Preferably, step A4 specifically includes the steps of:

A41. Configure the LAMP reaction system and place it in the nucleic acid detection device;

A42. Water bath at 63°C for 0.5h, then place at room temperature for 5-10min;

A43. Judge and identify the LAMP amplification result according to the color development state of the test paper.

Preferably, in step A43, the test strip of the nucleic acid chromatography test paper device is used for detection, and the criterion for judging the success of the nucleic acid chromatography test paper detection is: the first line from top to bottom of the nucleic acid test strip is the control line (C line), the second line is the detection line (T line), the color development of the C line proves that the device is effective, and the color development of the T line proves that the LAMP amplified fragment is detected, and the sample has a target fragment, which is positive; the T line does not develop color It proves that no LAMP amplified fragment is detected, and the sample has no target fragment and is negative.

Another object of the present invention is to provide the use of the above primer set in the preparation of products for identifying the origin of bird's nest.

Preferably, the products include sequencing platforms, reagents, and kits. In addition to using kits as detection reagents or products required for the identification of bird's nest origin, the above primer sets can also be applied to products such as sequencing platforms, and their specificity can be used to realize the corresponding identification process.

Compared with the prior art, the beneficial effects of the present invention are: the present invention adopts LAMP-LFD to rapidly amplify the nucleic acid of bird's nest samples to be identified, improve the detection efficiency and accuracy of bird's nest, facilitate the traceability of bird's nest products, and provide quality control for bird's nest products effective detection method. Compared with the sensory identification methods in the prior art, the LAMP-LFD detection method used in this application not only has the characteristics of high sensitivity and high specificity, but also has low requirements on equipment and simple operation, and can be observed only through test paper. Amplification results, intuitive identification, simple and fast, suitable for production and quick and direct identification. Through the primer set, kit, method and application provided in this application, the biological origin of bird's nest can be effectively identified, the quality of bird's nest products can be accurately controlled, a good market environment can be created, and the development and research in the field of bird's nest can be promoted.

Description of drawings

Figure 1 shows the LAMP-LFD detection situation of the present invention using different sample nucleic acids as templates.

Figure 2 shows the turbidity detection of LAMP amplification using different concentrations of bird's nest nucleic acid quality control products as templates.

Figure 3 shows the LAMP-LFD detection situation using different concentrations of bird's nest nucleic acid quality control products as templates.

Figure 4 shows the qPCR detection situation using different concentrations of bird's nest nucleic acid quality control products as templates.

Figure 5 shows the sequences of LAMP-specific primers used in this example.

Detailed ways

It should be pointed out that the following detailed description is exemplary and intended to provide further explanation to the present application. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

It should be noted that the terminology used here is only for describing specific implementations, and is not intended to limit the exemplary implementations according to the present application. As used herein, unless the context clearly dictates otherwise, the singular is intended to include the plural, and it should also be understood that when the terms "comprising" and/or "comprising" are used in this specification, they mean There are features, steps, operations, means, components and/or combinations thereof.

The present invention will now be further described in conjunction with specific examples. The following examples are only to explain the present invention, but not to limit the present invention. The test sample used in the following examples and the test process include the following (if the experimental specific conditions are not indicated in the examples, usually according to conventional conditions, or according to the conditions recommended by the reagent company; used in the following examples Reagents, consumables, etc., unless otherwise specified, can be obtained from commercial sources).

Example 1

Detection situation of LAMP-LFD with nucleic acid as template in different samples

Take 200mg of 7 different liquid nitrogen ground bird’s nest samples (sample information is shown in Table 1) in 1.5ml EP tube, extract DNA according to the instructions of EasyPure Micro Genomic DNAKit, and store it at -20°C for later use;

The cytb gene sequence of the identified bio-based original bird's nest sample was compared with the cytb gene sequence of Javan swiftlet (Aerodramus fuciphagus) in the NCBI database, and the conserved specific segment was determined. Design website (http://primerexplorer.jp/e/) to design bird's nest LAMP-specific primers and design fluorescent labels for primers according to the test paper characteristics of nucleic acid chromatography devices, and use primer 5 to design qPCR primers. The primer sequences are shown in Table 2 As shown, the detailed sequence is shown in Figure 5, and the primers were synthesized by Beijing Huada Biotechnology Co., Ltd.

Prepare the LAMP reaction system for each sample, and prepare the LAMP reaction system in a nucleic acid detection device containing nucleic acid chromatography test paper. Specifically, 25 μL LAMP reaction system: 12.5 μL of 2× reaction buffer (RM), enzyme solution (EM)) 1 μL, 10 μM outer primers F3 and B3 each 1 μL, 10 μM inner primers FIP and BIP 4 μL each, 10 μM loop primers LB and LF each 0.5 μL, DNA template 1 μL, ddH2O 2.5 μL.

After the preparation of the above 25 μL LAMP reaction system was completed, after mixing evenly by pipetting, place it in a 63°C water bath for 0.5h, then place it at room temperature for 10min and observe the results of the nucleic acid chromatography test paper.

The results are shown in Figure 1, where the corresponding relationship between serial numbers and samples is: 1.MY1, 2.VED1, 3.ID1, 4.TH1, 5.MYZM1, 6.CNH1, 7.CNH2, 8. Pigskin, 9. Tremella, 10. Fish gelatin; among them, ID1, MY1, VED1, MYZM1, TH1 are bird's nests belonging to the original Java swiftlet, and CNH1 and CNH2 are bird's nests that do not belong to the original Java swiftlet. In Figure 1, the C lines of Positive, Negative, Positive, and 1-10 are all colored, indicating that the device is effective. However, the T lines in the serial numbers 6-10 are not colored, which means that it is not the bird’s nest base corresponding to the primers designed in Example 1, and the LAMP primers in this example are specifically amplified Java swiftlets Bird's nest nucleic acid. Combined with 6-10 bird's nests that do not belong to this type of biological origin, it shows that the LAMP-LFD in this example can accurately identify the bird's nest origin.

Table 1 Bird's nest samples

Table 2 LAMP primer sequence

Note: When using LAMP combined with LFD detection method, the LF-5' end is labeled with Biotin, and the LB-5' end is labeled with fluorescein FAM.

Example 2

Sensitivity detection

The bird’s nest LAMP-specific primers designed in Example 1 were used, and the LF and LB primers of the LAMP reaction system in the constant temperature water bath were fluorescently labeled primers; for the bird’s nest nucleic acid quality control product with a known copy number of 4.23×10 ⁸ copies/μL Dilution is carried out in a 10-fold gradient for sensitivity detection. Specifically, parallel dilutions are several samples No. 1 to No. 9 required for the following experiments, and the copy number range of No. 1 to No. 9 samples is 4.23×10 ⁸ copies/ μL-4.23×10 ⁰ copies/μL, that is, the copy numbers of samples 1 to 9 are 4.23×10 ⁸ , 4.23×10 ⁷ , 4.23×10 ⁶ , 4.23×10 ⁵ , 4.23×10 ⁴ , 4.23×10 ³ , 4.23×10 ² , 4.23×10 ¹ , 4.23×10 ⁰ copies/μL. During the detection process that requires LAMP amplification, configure a LAMP reaction system and perform LAMP amplification according to the determined optimal amplification temperature of 63°C. Specifically, the following sensitivity tests are carried out:

(1) Turbidity detection of LAMP amplification with different concentrations of bird's nest nucleic acid quality control products as templates

Use a turbidimeter to perform LAMP amplification on a sample No. 1-9, measure its turbidity, and draw a turbidity curve.

The results are shown in Figure 2, the amplification curve appeared later with the decrease of the concentration, and when the concentration was diluted below 4.23×10 ³ copies/μL, the amplification curve disappeared.

(2) LAMP-LFD detection of different concentrations of bird's nest nucleic acid quality control products as templates.

Use a constant temperature water bath to perform LAMP amplification on a sample No. 1 to 9, and use the test strip of the nucleic acid chromatography test paper device for detection. The standard for judging whether the nucleic acid chromatography test paper is successful or not is: the nucleic acid test strip is from top to top The first line below is the control line (C line), and the second line is the detection line (T line). The color development of the C line proves that the device is effective, and the color development of the T line proves that the LAMP amplification fragment is detected, and the sample has a purpose. Fragment is positive; if the T line does not develop color, it proves that no LAMP amplified fragment is detected, and the sample has no target fragment, which is negative.

The results are shown in Figure 3. The LFD detection lines of samples No. 7 to 9 did not develop color, that is, when the concentration was diluted below 4.23×10 ³ copies/μL, the LFD detection line did not develop color either.

(3) qPCR detection of different concentrations of bird's nest nucleic acid quality control products as templates.

Further, qPCR detection was carried out on a sample No. 1-9 using the qPCR primers designed in Example 1. Specifically, the bird’s nest nucleic acid quality control product was subjected to SYBRGreen fluorescence quantitative analysis, and its amplification curve was shown in Figure 4. When the copy number was diluted to 4.23×10 ¹ copies/μL, that is, sample No. 8 in the figure, the amplification curve disappeared.

It can be seen from the above sensitivity test results that the LAMP-LFD rapid identification method adopted in this example can meet the amplification range of 4.23×10 ⁸ copies/μL to 4.23×10 ³ copies/μL, and has good sensitivity. The LAMP-LFD identification method provided in this application has high accuracy, sensitivity and reproducibility.

Example 3

This embodiment provides a LAMP-LFD kit for identification of bird's nest origin, comprising the above-mentioned primer set and lateral flow test strips.

Specifically, the primer set contains F3, B3, FIP, BIP, LB, and LF, and the LAMP reaction system is 25 μl, including:

During the use of the LAMP-LFD kit, the LAMP amplification system is configured in a nucleic acid detection device, and the nucleic acid detection device is equipped with a lateral flow test paper. The detection conditions of the LAMP-LFD are: 63°C in a water bath for 0.5h, and then placed at room temperature for 5-10min . When the present inventors use the above primer set for amplification and identification, for the above LAMP system, the optimum temperature for LAMP amplification is 63°C. The LAMP amplification process was completed in a water bath at 63°C for 0.5 h, and further placed at room temperature for 5-10 min, and the LFD would gradually develop color to complete the detection process.

Apparently, the above-mentioned embodiments of the present invention are only examples for clearly illustrating the technical solution of the present invention, rather than limiting the specific implementation manner of the present invention. Any modification, equivalent replacement and improvement made within the spirit and principle of the claims of the present invention shall be included in the protection scope of the claims of the present invention.

Claims

A primer set for identifying bird's nest origin, characterized in that it includes outer primer F3, outer primer B3, inner primer FIP, and inner primer BIP; the sequences are F3: ACCTCTTCTCAGCAATCCCA; B3: AAGTAGGGGTGGAATGGGA; FIP: GTGTAGGGCGAAGAATCGGGTTATCGGCCAAACCCTCGTA; BIP: CCTTCCTAATCGCCGGCCTCATTCCTAGGG GGTTGTTCGA.
The primer set according to claim 1, further comprising loop primers LF and LB; the sequences are respectively: LF: GCTGAGAAGAGGTTGGTAATGAC; LB: CTCAGTAGACAACCCCACATTAAC.
A LAMP-LFD kit for identifying bird's nest bases, characterized in that it contains the primer set and/or nucleic acid chromatography test paper according to claim 1 or 2.
The LAMP-LFD kit according to claim 3, characterized in that it contains the primer set according to claim 2, wherein the LAMP reaction system is 25 μl, comprising:
A LAMP-LFD detection method for identifying bird's nest bases, characterized in that it comprises the steps of:

A1. Extract the DNA of the bird's nest sample to be identified;

A2, designing LAMP primers for amplifying specific gene DNA;

A3. Configure the corresponding LAMP reaction system based on the DNA obtained in A1 and the LAMP primers obtained in A2;

A4, the LAMP reaction system configured in A3 is placed in a nucleic acid detection device, the nucleic acid detection device is provided with nucleic acid chromatography test paper; the color development state of the nucleic acid chromatography test paper reflects the LAMP amplification result, to identify the bird's nest sample to be identified Is it the corresponding motif of the LAMP primer.
The LAMP-LFD detection method according to claim 5, wherein the LAMP primers in step A2 include: outer primer F3, outer primer B3, inner primer FIP, and inner primer BIP; the sequences are respectively F3: ACCTCTTCTCAGCAATCCCA; B3: AAGTAGGGGTGGAATGGGA; FIP: GTGTAGGGCGAAGAATCGGGTTATCGGCCAAACCCTCGTA; BIP: CCTTCCTAATCGCCGGCCTCATTCCTAGGGGGTTGTTCGA.
The LAMP-LFD detection method according to claim 5, wherein the LAMP primers in step A2 include: outer primer F3, outer primer B3, inner primer FIP, inner primer BIP, loop primer LF, loop primer LB; F3: ACCTCTTCAGCAATCCCCA; B3: Aagtagggggggaatggga; FIP: GTGTAGGGCGAATCGGGGGGGGCCCCCCTCGTA; Ggttgttcga; LF: gctgagaagagggggtgtaatgac; LB: CTCAGTAGACCCCCCACACACACAC.
The LAMP-LFD detection method according to claim 7, wherein the LAMP reaction system is 25 μl, comprising:
The LAMP-LFD detection method according to claim 5, wherein step A4 specifically comprises steps:

A41. Configure the LAMP reaction system and place it in the nucleic acid detection device;

A42. Water bath at 63°C for 0.5h, then place at room temperature for 5-10min;

A43. Judge and identify the LAMP amplification result according to the color development state of the test paper.
The use of the primer set described in claim 1 or 2 in the preparation of products for identifying bird's nest bases.