CN108642147A - A kind of method of fast-amplifying nucleic acid - Google Patents
A kind of method of fast-amplifying nucleic acid Download PDFInfo
- Publication number
- CN108642147A CN108642147A CN201810647599.6A CN201810647599A CN108642147A CN 108642147 A CN108642147 A CN 108642147A CN 201810647599 A CN201810647599 A CN 201810647599A CN 108642147 A CN108642147 A CN 108642147A
- Authority
- CN
- China
- Prior art keywords
- pcr
- nucleic acid
- temperature
- amplification
- fast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The invention belongs to technical field of molecular biology, it is related to nucleic acid amplification technologies, more particularly to a kind of pervasive, on the basis of existing PCR system, existing PCR amplification instrument, it only needs simply to change PCR programs, so that PCR reaction solution is only heated up and is cooled down repeatedly between two temperature spots, do not do time stop in any temperature, or the residence time is extremely short (0 2s), and the nucleic acid amplification method to target sequence rapid amplifying can be realized during alternating temperature.This method breaks the normal procedure, is theoretical novel, easy to operate, easy, can significantly be saved by existence conditions and platform the time of nucleic acid amplification, improve unit interval productivity.This method is applicable to the nucleic acid amplification system of various based on PCR technologies, has very high practical value for the species identification etc. of the detection and analysis of clinical disease, environmental monitoring, food and medicine.
Description
Technical field
The invention belongs to nucleic acid amplification technologies, specifically by the way that the reaction solution of PCR (PCR) exists
It is heated up and is cooled down repeatedly between two temperature spots, one kind to the rapid amplifying of target sequence is realized during alternating temperature
Method.
Background technology
PCR method (Polymerase Chain Reaction, PCR) is that a kind of molecular biology often uses skill
Art has been widely used for clinical pathogenic microorganism and disease at present since it can specifically expand extremely micro DNA
Diagnosis, Forensic Identification, environment supervision, the food and medicine authenticity etc. of disease.Standard PCR technology relies on the lifting of thermal cycler
Temperature makes template DNA sequence extend three steps by high-temperature denatured, process annealing, thermophilic, completes the primary expansion to target sequence
Increase, by 20-40 repeated amplification, the exponential type amplification to minim DNA may be implemented.Molecular biology classical tool book
《Molecular Cloning:A Laboratory guide》Point out that a typical PCR program is usually 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min in one book,
Cycle 30 times, in addition the time in heating and cooling process, a typical PCR processes needs 1 are more than hour.But with PCR
The continuous extension of technical applications, the sample type and sample size for needing PCR to analyze are increasing, this is just to the analysis of sample
More stringent requirements are proposed for efficiency and cost.Therefore, further shorten the PCR amplification time, develop fast PCR technology, for big
The rapid gene of sample size detects and the development of real-time test (point-of-care testing) is all with highly important
Meaning.
Currently, the research about fast PCR is concentrated mainly in the transformation of thermal cycler, to greatly improve temperature rate
To realize that quick nucleic acid amplification, the means of generally use include：1. changing mode of heating, such as using light heating, air heating
Deng；2. using the faster reaction vessel that conducts heat；3. reducing reaction volume etc..However, since temperature rate increases substantially, make
The time shortening that polymerase extends is obtained, does not ensure that PCR has best amplification efficiency, so as to cause some long segment sequences
The amplification of row fails, and limits the use of fast PCR technology.Simultaneously because the fast PCR technology reported is required to using new
The PCR amplification device of type and novel example reaction device, economic cost and the time cost for implementing the technology are all higher, institute
There are no being widely used, not benefit corresponding industry and working people in existing fast PCR technical spirit yet
Member.
Invention content
The purpose of the present invention is must use particular instrument and special quick archaeal dna polymerase for current fast PCR
Limitation provides one kind under the premise of not changing PCR system, the quick expansion that can be thus achieved using existing Standard PCR instrument
Increase the method for nucleic acid.
Technical scheme is as follows：By the reaction solution of PCR (PCR) between two temperature spots into
The rapid amplifying to target sequence is realized in row heating and cooling during alternating temperature.
Two temperature spots according to the present invention are respectively high temperature dot and low temperature point：High temperature dot can be in target amplification sequence
Annealing temperature (Tm) to taking arbitrary value, low temperature point that can take arbitrary value near the annealing temperature of primer between 98 DEG C, generally
For Tm ± 5 DEG C.
Rapid nucleic acid amplification method of the present invention is that a kind of high temperature dot and low temperature point constantly replace reciprocal alternating temperature mistake
Journey, and time stop is not done at high temperature dot and low temperature point or time residence time is extremely short (0-2 seconds).This amplification pattern
Different from traditional PCR amplification pattern：(1) three-stage.Three temperature spots are set, PCR reaction solution is made to be stopped in each temperature spot
It to a few minutes etc., is denaturalized, annealed successively, extending three processes within tens seconds, by the amplifications of such patterns of multiple cycles,
Realize the rapid amplifying to target sequence.(2) two-part.Two temperature spots are set, PCR reaction solution is made to be stopped in each temperature spot
It to a few minutes etc., is denaturalized successively, (annealing+extension) two processes within tens seconds, by the expansion of multiple such patterns of cycle
Increase, realizes the rapid amplifying to target sequence.
Two temperature spots according to the present invention can be different value, only need in the different cycles of the same reaction
Ensure in the desirable range of above-mentioned high temperature dot and low temperature point.
The annealing temperature of primer according to the present invention can change between 40-80 DEG C, and Optimal Temperature is near 70 DEG C.
PCR reaction systems according to the present invention can be existing PCR reaction systems, such as include reaction buffer,
DNTP, thermophilic archaeal dna polymerase, primer, probe, template, water etc., without specially add special reaction component or will it is existing commonly
Reactive component is changed to the substance of specific function.
The primer used in PCR (PCR) according to the present invention, can draw used in regular-PCR
Object can also be appropriately extended to further save the time on the basis of regular-PCR the primer, and highest can make its annealing temperature
Degree is close to 70 DEG C.The calculating of annealing temperature should fully consider primer sequence itself, primer concentration, buffer solution system etc., specifically may be used
With with reference to Promega company's site (http://www.promega.com/a/apps/bi omath/Calc=tm it) is developed
Software calculated.
The method for the fast-amplifying nucleic acid that the present invention is established can be completed directly on existing Standard PCR instrument, without again
Develop new Rapid nucleic acid amplification instrument.
The method for the fast-amplifying nucleic acid that the present invention is established, while suitable for based on DNA non-specific binding dyestuffs
The quantitative analysis method of quantitative analysis method and sequence specific oligonucleotide primer or probe based on fluorochrome label, no
The qualitative analysis of nucleic acid is can be applied only to, the quantitative analysis of nucleic acid can also be applied to..
Involved Rapid nucleic acid expands pattern according to the present invention, can be to including real-time Quantitative
PCR、RT-PCR、touch-down PCR、nest PCR、asymmetric PCR、allel-specific PCR、mulit
The amplification pattern of all the relevant technologies based on PCR such as iplex PCR, digital PCR, sequencing is adjusted, with reality
The raising of existing working efficiency.
In PCR amplification, the heating rate of instrument can impact amplification, although too fast heating rate can pole
Short reaction time is limited, but the decline of amplification efficiency or the generation of non-specific amplification band can be caused.The present invention is to core
During acid is expanded, to ensure that amplification efficiency does not lose, the length pair according to target amplification segment is needed when necessary
The heating rate of instrument is adjusted, and to rate of temperature fall no requirement (NR), The faster the better.Specific parameter setting is shown in Fig. 1, that is, works as use
When common archaeal dna polymerase, for the target amplification segment that length is 100-500bp, maximum heating rate is respectively 5.2,
2.2,1.3,0.9,0.7 DEG C/s, i.e., under the same conditions, the heating rate that long segment needs are less than the heating speed that short-movie section needs
Rate；When using KAPA rapid DNA polymerases, for the target amplification segment that length is 100-500bp, maximum heating rate point
It Wei not 10.8,5.9,4.2,3.3,2.7 DEG C/s.Currently, the temperature rate of regular-PCR instrument is no more than 2 DEG C/s, and big portion
Point diagnosis, identification PCR system in target amplification segment usually within 150bp, so even if using common archaeal dna polymerase,
For the segment less than 200bp, all it is not necessarily to change heating rate this parameter.
The method of fast-amplifying nucleic acid according to the present invention, do not change PCR system, using Standard PCR instrument before
The amplification of 30 cycles can be completed in 15 minutes by putting, and the shortest time is that 25 cycles, realization pair are completed in 8 minutes at present
The amplification of lamada bacteriophage the preceding paragraph 98bp sequences.
As used herein, following word/term has following meanings, unless otherwise stated.
“DNA”：DNA.It is a kind of large biological molecule for carrying hereditary information, by 4 kinds of main deoxyriboses
Nucleotide is formed by connecting by 3 ', 5 '-phosphodiester bonds, is the carrier of hereditary information.
“PCR”：PCR.A kind of method of external enzyme' s catalysis specific DNA fragment, by it is high-temperature denatured,
Process annealing and thermophilic extend three-step reaction and form a cycle, and cycle carries out, and target DNA is enable to expand rapidly, has spy
Anisotropic strong, high sensitivity, it is easy to operate, time saving the features such as.
" target amplification segment/target amplification sequence "：The nucleic acid sequence expanded is needed, can be DNA sequence dna, RNA sequence
Deng.
" primer "：One section short of single stranded RNA or DNA fragmentation may be incorporated in region complementary therewith in nucleic acid chains, function
It is the starting point acted on as nucleotide polymerization, nucleic acid polymerase can be started to synthesize new nucleic acid chains by its 3 ' end." Tm values "：Make
50% double-stranded DNA (double-stranded DNA, dsDNA) unwinding forms random coil (random coil) or single-stranded
The temperature of DNA (single stranded DNA, ssDNA) state." archaeal dna polymerase "：One kind can be closed with catalytic deoxidation nucleotide
At the enzyme of DNA molecular, it is mainly used for the duplication of template DNA." Taq archaeal dna polymerases "：One kind of archaeal dna polymerase.It is from one kind
A kind of archaeal dna polymerase that thermus aquaticus (Thermusaquaticus) strain separation and Extraction obtains, high temperature of the enzyme in PCR cycle
Under the conditions of remain to keep higher activity, be a kind of most widely used archaeal dna polymerase, rate of amplification in current PCR system
For 35-100 bases/s.
" KAPA rapid DNAs polymerase "：One kind of archaeal dna polymerase.It is a kind of DNA come out through molecular evolution Platform Screening
The mutant of polymerase, its main feature is that can be with the synthesis of quick catalysis DNA, rate of amplification is up to 155 bases/s.
" PCR reaction solution/PCR reaction systems "：Including reaction buffer, dNTP, thermophilic archaeal dna polymerase, primer, probe,
Template, water etc. carry out the various material compositions needed for target nucleic acid amplification.
" amplification efficiency "：The amplification efficiency of quantitative PCR refers to the amplification efficiency E (%) of exponential amplification phase.E (%)=[10(-1/k)- 1), wherein k is the slope of standard curve y=kx+b.The amplification efficiency of regular-PCR can be by containing its PCR product
Amount is assessed, can specifically utilize quantitative gel software by agarose gel electrophoresis after the amplification of same loop number
The brightness of amplified production band be calculated compared with the brightness of DNA standard substance electrophoretic bands.
Method key disclosed by the invention is on the basis of existing PCR system, existing PCR amplification instrument, it is only necessary to simply change
Become PCR programs, so that PCR reaction solution is only heated up and is cooled down repeatedly between two temperature spots, do not do time stop in any temperature,
Or the residence time is extremely short (0-2s), is can be realized during alternating temperature to target sequence rapid amplifying.This method is broken often
Rule, theoretical novelty, it is easy to operate, easy, it can significantly save the time of nucleic acid amplification, improve by existence conditions and platform
Unit interval productivity.This method is applicable to the nucleic acid amplification system of various based on PCR technologies, the detection for clinical disease
There is very high practical value with the species identification etc. of analysis, environmental monitoring, food and medicine.With being substantially better than the prior art
Advantage, major advantage include：
(1) novelty.This method has theoretically broken the traditional understanding for PCR first.It is wanted according to traditional PCR technique
It asks, PCR reaction solution needs to stop the denaturation that 20-30s carries out double-strand at 94 DEG C, and 50-60 DEG C stops 20-30s and carry out moving back for primer
Fire, 72 DEG C of extensions that primer is carried out to a few minutes in tens seconds.Three steps that this method is put forward for the first time PCR can be in liter repeatedly
It is completed in temperature-fall period, cancel or greatly shortens the residence time that normal PCR each circulates in each temperature spot, do not reduced
The time of nucleic acid amplification has been greatly shortened on the basis of DNA amplification efficiency, has also simplified PCR amplification program.
(2) high efficiency.Nucleic acid amplification method of the present invention ensure that the expansion of each cycle by adjusting temperature rate
Increasing Efficiency does not sacrifice the amplification efficiency each recycled because reducing proliferation time, it is possible to it is suitable for the detection of quantitative nucleic acid,
Also there is higher reliability.Simultaneously as eliminating the residence time that normal PCR each circulates in each temperature spot, substantially
Degree shortens the time of nucleic acid amplification, has the characteristics that time-saving and efficiency.
Practicability.When the use that the rapid PCR methods developed at present rely on new instrument could realize shortening amplification
Between purpose, for these methods, the method for the present invention is not necessarily to change composition in PCR reaction systems, new without purchasing
Proliferation time directly can be shorten to the three of normal PCR by type PCR thermal cycler instruments on existing system, existing platform base
/ mono- is even shorter, the practicability with height.
Description of the drawings
Different length fragment template is best when attached drawing 1 uses general T aq archaeal dna polymerases and KAPA rapid DNA polymerases
Heating rate.
Attached drawing 2 is with regular-PCR method using the method for the fast-amplifying nucleic acid of the present invention simultaneously on lamda bacteriophages one
The result that the sequence of section 98bp is expanded.Wherein swimming lane 1 indicates the negative control (using water as template) of regular-PCR, 2 table of swimming lane
Show that regular-PCR amplification, swimming lane 3 indicate the negative control (using water as template) of fast-amplifying nucleic acid method, swimming lane 4 indicates fast
The amplification of fast amplification of nucleic acid method.
Attached drawing 3 is method and the regular-PCR method of the fast-amplifying nucleic acid of the present invention simultaneously to lamda bacteriophage the preceding paragraphs
The real-time monitoring result that the sequence of 98bp is expanded.Solid line is rapid amplifying real-time fluorescence amplification curve, reaches fluoroscopic examination
Time be 15 minutes, dotted line is regular-PCR real-time fluorescence amplification curve, reach fluoroscopic examination time be 45 minutes.
Attached drawing 4 is the method using the fast-amplifying nucleic acid of the present invention to separate sources (including plasmid, virus, bacterium, plant
Object, animal) the results that are expanded of DNA.Wherein swimming lane 1 is plasmid, and swimming lane 2 is virus, and swimming lane 3 is bacterium, and swimming lane 4 is to plant
Object, swimming lane 5 are the amplification of animal.
Attached drawing 5 is the real-time fluorescence Rapid nucleic acid amplification method (dye method) and common real-time fluorescence PCR method (dye of the present invention
Material method) to the fluorescent amplification curve and standard curve of DNA progress quantitative analyses, template concentrations are from left to right followed successively by 5 × 105-5
×101A copy.
Attached drawing 6 is that the real-time fluorescence Rapid nucleic acid amplification method (sonde method) of the present invention and common real-time fluorescence PCR method (are visited
The skill of handling needles) carry out the fluorescent amplification curve and standard curve of quantitative analysis to DNA, template concentrations are from left to right followed successively by 1.59 ×
100-1.59×10-4ng/ul。
Specific implementation mode
Below in conjunction with the accompanying drawings, it is further illustrated the present invention by example.It should be understood by those skilled in the art that these examples
It is merely to illustrate the present invention, rather than is limited the scope of the invention.
The results contrast (end-point method) of embodiment 1, fast-amplifying nucleic acid method and regular-PCR method.
1. positive anti-primer, target amplification sequence
Forward primer LA：5’-CATCGTCTGCCTGTCAT-3’
Reverse primer LRA：5’-TCGCCAGCTTCAGTT-3’
Target amplification sequence LT:5’-CATCGTCTGCCTGTCATGGGCTGTTAATCATTACCGTGATAACGCCATTAC
CTACAAAGCCCAGCGCGACAAAAATGCCAGAGAACTGAAGCTGGCGA-3’
2. amplification reaction system (rapid amplifying reaction system is identical as regular-PCR system)
3. rapid amplifying reaction condition：94 DEG C 0 second, 60 DEG C 0 second, recycle 30 times.(taking 16min 51s)
Common PCR reaction condition：95 DEG C 3 minutes；94 DEG C 30 seconds, 60 DEG C 30 seconds, recycle 30 times.(time-consuming 66min)
4. amplified production is analyzed：
The sample after 5 μ l amplifications is taken, is mixed with 1 μ l, 6 times of DNA sample-loading buffers, is containing Gelview nucleic acid dyes
Electrophoresis and colour developing are carried out on agarose gel, are observed under ultraviolet transmissive lamp, such as 2 regular-PCR of attached drawing and fast-amplifying nucleic acid method
Negative control in all without amplified band, and have identical band in purpose band position, show fast-amplifying nucleic acid method
Compared with regular-PCR, the time more than 2/3rds can be shortened, but obtain the amplification consistent with regular-PCR.
The results contrast (real-time fluorescence method) of embodiment 2, fast-amplifying nucleic acid method and regular-PCR method.
1. positive anti-primer, target amplification sequence
Forward primer LA：5’-CATCGTCTGCCTGTCAT-3’
Reverse primer LRA：5’-TCGCCAGCTTCAGTT-3’
Target amplification sequence LT:5’-CATCGTCTGCCTGTCATGGGCTGTTAATCATTACCGTGATAACGCCATTAC
CTACAAAGCCCAGCGCGACAAAAATGCCAGAGAACTGAAGCTGGCGA-3’
2. amplification reaction system (rapid amplifying reaction system is identical as regular-PCR system)
3. rapid amplifying reaction condition：94 DEG C 0 second, 60 DEG C 0 second, signal acquisition, recycle 40 times.(taking 24min 10s)
Common PCR reaction condition：95 DEG C 3 minutes；94 DEG C 30 seconds, 60 DEG C 30 seconds, signal acquisition, recycle 40 times.
(time-consuming 88min)
4. interpretation of result：
Attached drawing 3 is method and the regular-PCR method of the fast-amplifying nucleic acid of the present invention simultaneously to lamda bacteriophage the preceding paragraphs
The real-time monitoring result that the sequence of 98bp is expanded.It can be seen from the figure that rapid amplifying method was reached at 15 minutes or so
To the threshold value of fluoroscopic examination, and the threshold value that regular-PCR then can be only achieved fluoroscopic examination at 45 minutes, it was demonstrated that rapid amplifying method is true
2/3rds proliferation time can be saved in fact.
The method amplification separate sources (including plasmid, virus, bacterium, plant, animal) of the fast-amplifying nucleic acid of embodiment 3
DNA.
1. positive anti-primer, target amplification sequence
Template source 1：Plasmid-pEGFP-N1
Forward primer VF：5’-TACCTCGCTCTGCTAATCCT-3’
Reverse primer VRF：5’-GCGCCTTATCCGGTAACTATC-3’
Target amplification sequence VT:5’-TACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAG
TCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGC-3’(100bp)
Template source 2：Virus-λ c | 857Sam7 genomic DNAs
Forward primer LD：5’-CATCGTCTGCCTGTCATGGG-3’
Reverse primer LRD：5’-TCGCCAGCTTCAGTTCTCTGG-3’
Target amplification sequence LT:5’-CATCGTCTGCCTGTCATGGGCTGTTAATCATTACCGTGATAACGCCATTAC
CTACAAAGCCCAGCGCGACAAAAATGCCAGAGAACTGAAGCTGGCGA-3’(98bp)
Template source 3：Bacterium-staphylococcus aureus gene group DNA
Forward primer Sta-F-1：5’-CTGCGACATTAATTAAAGCGAT-3’
Reverse primer Sta-R-1：5’-AGGATGCTTTGTTTCAGGTG-3’
Target amplification sequence ST:5’-CTGCGACATTAATTAAAGCGATTGATGGTGATACGGTTAAATTAATGTACA
AAGGTCAACCAATGACATTCAGACTATTATTAGTTGATACACCTGAAACAAAGCATCCT-3’(110bp)
Template source 4：Plant-safflower genomic DNA
Forward primer F2：5’-TAGTGGTGGTTGTAAAGGACTTC-3’
Reverse primer R2：5’-CGTCGTAAGACGACACGTTAG-3’
Target amplification sequence FT:5’-TAGTGGTGGTTGTAAAGGACTTCGTAACGAGCCGTGTTGATGCTAGGGAAT
TGCTCTCTAAAGACCCTAACGTGTCGTCTTACGACG-3’(87bp)
Template source 5：Animal-pig mtdna
Forward primer PF：5’-CACACATCTGTCGAGACGTAAA-3’
Reverse primer PR：5’-CGGCCTACGTGGATGAATA-3’
Target amplification sequence PT:5’-CACACATCTGTCGAGACGTAAATTACGGATGAGTTATTCGCTACCTACATG
CAAACGGAGCATCCATGTTCTTTATTTGCCTATTCATCCACGTAGGCCG-3’(100bp)
2.DNA is extracted
For the template DNA of 5 kinds of separate sources, extraction of plasmid DNA kit, high-temperature cracking method, high anneal crack is respectively adopted
Solution, plant genome DNA extracts kit, animal DNA extracts kit carry out the extraction of DNA.3. amplification reaction system and
Condition
Plasmid (pEGFP-N1) amplification reaction system
Amplification reaction condition：94 DEG C 0 second, 65 DEG C 0 second, recycle 30 times.
Viral (bacteriophage lambda) amplification reaction system
Amplification reaction condition：94 DEG C 0 second, 68 DEG C 0 second, recycle 30 times.
Bacterium (staphylococcus aureus) amplification reaction system
Amplification reaction condition：94 DEG C 0 second, 61 DEG C 0 second, recycle 30 times.
Plant (safflower) amplification reaction system
Amplification reaction condition：94 DEG C 0 second, 65 DEG C 0 second, recycle 30 times.
Animal (pig) amplification reaction system
Amplification reaction condition：94 DEG C 0 second, 64 DEG C 0 second, recycle 30 times.
4. amplified production is analyzed：
The sample after 5 μ l amplifications is taken, is mixed with 1 μ l, 6 times of DNA sample-loading buffers, is containing Gelview nucleic acid dyes
Electrophoresis and colour developing are carried out on agarose gel, is observed under ultraviolet transmissive lamp, it can be seen that there is bright expansion in purpose band position
Increase band be respectively 100bp, 98bp, 110bp, 87bp, 100bp, show fast-amplifying nucleic acid method can shorten three/
Under the premise of two time, ideal amplification is obtained.
The Rapid nucleic acid amplification method of the real-time fluorescence of embodiment 4 carries out quantitative (dye method) DNA.
1. positive anti-primer, target amplification sequence
Forward primer LD：5’-CATCGTCTGCCTGTCATGGG-3’
Reverse primer LRD：5’-TCGCCAGCTTCAGTTCTCTGG-3’
Target amplification sequence LT:5’-CATCGTCTGCCTGTCATGGGCTGTTAATCATTACCGTGATAACGCCATTAC
CTACAAAGCCCAGCGCGACAAAAATGCCAGAGAACTGAAGCTGGCGA-3’(98bp)
2. amplification reaction system and condition (rapid amplifying reaction system is identical as regular-PCR system)
Rapid amplifying reaction condition：94 DEG C 0 second, 68 DEG C 0 second, signal acquisition, recycle 40 times.
Common PCR reaction condition：94 DEG C 30 seconds, 68 DEG C 30 seconds, signal acquisition, recycle 40 times.
3. interpretation of result：
Attached drawing 5 is that the real-time fluorescence Rapid nucleic acid amplification method of the present invention and common real-time fluorescence PCR method determine DNA
Measure the fluorescent amplification curve and standard curve of analysis.It can be seen from the figure that rapid amplifying method reached at 15 minutes or so
The threshold value of fluoroscopic examination, and the threshold value that regular-PCR then can be only achieved fluoroscopic examination at 40 minutes, it was demonstrated that rapid amplifying method really saves
About 2/3rds proliferation time.Two standard curves essentially coincide simultaneously, although showing that Rapid nucleic acid amplification method is saved
Time, but without reducing efficiency, the detection limit and linear relationship of quantitative analysis are consistent with regular-PCR.
The Rapid nucleic acid amplification method of the real-time fluorescence of embodiment 5 carries out quantitative (sonde method) DNA.
1. positive anti-primer, target amplification sequence
Forward primer F1：5’-TCGTTGTTTGTGCCTACTCTC-3’
Reverse primer R1：5’-TCGCCAGCTTCAGTTCTCTGG-3’
Taqman probes P1：(FAM)5'-CCTTGCCCTCAACAATGCGACATG-3'(BHQ1)
Target amplification sequence ZT:5’-TCGTTGTTTGTGCCTACTCTCCGTGTCCTTGCCCTCAACAATGCGACATGT
CGTCGTCGGACCCCTCACCATGGACCCTTCCGGCTTCCGAATAAGAAGAAGGAACCGTCCT-3’(98bp)
2. amplification reaction system and condition (rapid amplifying reaction system is identical as regular-PCR system)
Rapid amplifying reaction condition：94 DEG C 0 second, 60 DEG C 0 second, signal acquisition, recycle 40 times.
Common PCR reaction condition：94 DEG C 20 seconds, 60 DEG C 30 seconds, signal acquisition, recycle 40 times.
3. interpretation of result：
Attached drawing 6 is that the real-time fluorescence Rapid nucleic acid amplification method of the present invention and common real-time fluorescence PCR method determine DNA
Measure the fluorescent amplification curve and standard curve of analysis.It can be seen from the figure that rapid amplifying method reached at 15 minutes or so
The threshold value of fluoroscopic examination, and the threshold value that regular-PCR then can be only achieved fluoroscopic examination at 40 minutes, it was demonstrated that rapid amplifying method really saves
About 2/3rds proliferation time.Two standard curves essentially coincide simultaneously, although showing that Rapid nucleic acid amplification method is saved
Time, but without reducing efficiency, the detection limit and linear relationship of quantitative analysis are consistent with regular-PCR.
Sequence table
<110>Chengdu Inst. of Biology, Chinese Academy of Sciences
<120>A kind of method of fast-amplifying nucleic acid
<141> 2018-06-21
<160> 21
<170> SIPOSequenceListing 1.0
<210> 1
<211> 17
<212> DNA
<213> Artificial Sequence
<400> 1
catcgtctgc ctgtcat 17
<210> 2
<211> 15
<212> DNA
<213> Artificial Sequence
<400> 2
tcgccagctt cagtt 15
<210> 3
<211> 98
<212> DNA
<213> Artificial Sequence
<400> 3
catcgtctgc ctgtcatggg ctgttaatca ttaccgtgat aacgccatta cctacaaagc 60
ccagcgcgac aaaaatgcca gagaactgaa gctggcga 98
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 4
tacctcgctc tgctaatcct 20
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 5
gcgccttatc cggtaactat c 21
<210> 6
<211> 100
<212> DNA
<213> Artificial Sequence
<400> 6
tacctcgctc tgctaatcct gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt 60
accgggttgg actcaagacg atagttaccg gataaggcgc 100
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 7
catcgtctgc ctgtcatggg 20
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 8
tcgccagctt cagttctctg g 21
<210> 9
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 9
ctgcgacatt aattaaagcg at 22
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 10
aggatgcttt gtttcaggtg 20
<210> 11
<211> 110
<212> DNA
<213> Artificial Sequence
<400> 11
ctgcgacatt aattaaagcg attgatggtg atacggttaa attaatgtac aaaggtcaac 60
caatgacatt cagactatta ttagttgata cacctgaaac aaagcatcct 110
<210> 12
<211> 23
<212> DNA
<213> Artificial Sequence
<400> 12
tagtggtggt tgtaaaggac ttc 23
<210> 13
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 13
cgtcgtaaga cgacacgtta g 21
<210> 14
<211> 87
<212> DNA
<213> Artificial Sequence
<400> 14
tagtggtggt tgtaaaggac ttcgtaacga gccgtgttga tgctagggaa ttgctctcta 60
aagaccctaa cgtgtcgtct tacgacg 87
<210> 15
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 15
cacacatctg tcgagacgta aa 22
<210> 16
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 16
cggcctacgt ggatgaata 19
<210> 17
<211> 100
<212> DNA
<213> Artificial Sequence
<400> 17
cacacatctg tcgagacgta aattacggat gagttattcg ctacctacat gcaaacggag 60
catccatgtt ctttatttgc ctattcatcc acgtaggccg 100
<210> 18
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 18
tcgttgtttg tgcctactct c 21
<210> 19
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 19
tcgccagctt cagttctctg g 21
<210> 20
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 20
ccttgccctc aacaatgcga catg 24
<210> 21
<211> 112
<212> DNA
<213> Artificial Sequence
<400> 21
tcgttgtttg tgcctactct ccgtgtcctt gccctcaaca atgcgacatg tcgtcgtcgg 60
acccctcacc atggaccctt ccggcttccg aataagaaga aggaaccgtc ct 112
Claims (8)
1. a kind of method of fast-amplifying nucleic acid, which is characterized in that the method is by by PCR (PCR)
Reaction solution is heated up and is cooled down repeatedly between two temperature spots, and the quick expansion to target sequence is realized during alternating temperature
Increase.
2. two temperature spots according to claim 1, respectively high temperature dot and low temperature point, in amplification procedure, high temperature dot and
The temperature of low temperature point without accurately controlling, the temperature of high temperature dot can target amplification sequence annealing temperature (Tm) to 98 DEG C it
Between take arbitrary value, the temperature of low temperature point that can take arbitrary value, generally Tm ± 5 DEG C near the annealing temperature of primer.
3. Rapid nucleic acid detection method according to claim 1, which is characterized in that this method is in the mistake for realizing rapid amplifying
Cheng Zhong does not do time stop in high temperature dot and low temperature point or the residence time is extremely short (0-2 seconds).
4. the method for fast-amplifying nucleic acid according to claim 1, which is characterized in that two involved temperature spots,
In the different cycles of the same reaction, value is can be different, need to only be ensured in the desirable range of high temperature dot and low temperature point i.e.
It can.
5. the method for fast-amplifying nucleic acid according to claim 1, which is characterized in that the annealing temperature of involved primer can
Change between 40-80 DEG C, Optimal Temperature is near 70 DEG C.
6. the method for fast-amplifying nucleic acid according to claim 1, which is characterized in that this method can be applied to determining for nucleic acid
Property and quantitative analysis.
7. the method for fast-amplifying nucleic acid according to claim 1, which is characterized in that this method is suitable for non-based on DNA
The quantitative analysis method of specific binding dyestuff and the sequence specific oligonucleotide primer based on fluorochrome label or probe
Quantitative analysis method.
8. the method for fast-amplifying nucleic acid according to claim 1, which is characterized in that this method is suitable for using PCR as base
The nucleic acid amplification and analysis method of plinth, including real-time Quantitative PCR, RT-PCR, touch-down PCR,
Nest PCR, asymmetric PCR, allel-specific PCR, mulitiplex PCR, digital PCR, sequencing etc..
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810647599.6A CN108642147A (en) | 2018-06-22 | 2018-06-22 | A kind of method of fast-amplifying nucleic acid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810647599.6A CN108642147A (en) | 2018-06-22 | 2018-06-22 | A kind of method of fast-amplifying nucleic acid |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108642147A true CN108642147A (en) | 2018-10-12 |
Family
ID=63753109
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810647599.6A Pending CN108642147A (en) | 2018-06-22 | 2018-06-22 | A kind of method of fast-amplifying nucleic acid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108642147A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114214465A (en) * | 2022-01-26 | 2022-03-22 | 山东仕达思生物产业有限公司 | Primer, probe, kit and detection method for shortening detection time of novel coronavirus |
| CN114622006A (en) * | 2022-05-16 | 2022-06-14 | 浙江正合谷生物科技有限公司 | Nucleic acid temperature-changing amplification system based on 12V voltage drive |
-
2018
- 2018-06-22 CN CN201810647599.6A patent/CN108642147A/en active Pending
Non-Patent Citations (4)
| Title |
|---|
| PARK等: "Rapid sexing of pre-implantation bovine embryo using consecutive and multiplex polymerase chain reaction (PCR)with biopsied blastomere", 《THERIOGENOLOGY》 * |
| 张丰德等: "《现代生物学技术》", 31 December 2005 * |
| 李海静等: "PCR扩增牙釉基因X和Y染色体不同序列鉴定牛早期胚胎性别", 《中国畜牧杂志》 * |
| 王 栋等: "两温度梯度多重 PCR鉴别牛早期胚胎性别的技术", 《遗 传》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114214465A (en) * | 2022-01-26 | 2022-03-22 | 山东仕达思生物产业有限公司 | Primer, probe, kit and detection method for shortening detection time of novel coronavirus |
| CN114622006A (en) * | 2022-05-16 | 2022-06-14 | 浙江正合谷生物科技有限公司 | Nucleic acid temperature-changing amplification system based on 12V voltage drive |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Romsos et al. | Rapid PCR of STR markers: Applications to human identification | |
| US9487807B2 (en) | Compositions and methods for producing single-stranded circular DNA | |
| Rodríguez-Lázaro et al. | Real-time PCR in food science: introduction | |
| US20070003955A1 (en) | Normalization of samples for amplification reactions | |
| US8236498B2 (en) | Method of detecting nucleotide sequence with an intramolecular probe | |
| CN106636071B (en) | Method for synthesizing nucleic acid under constant temperature condition | |
| CN107760764B (en) | Target nucleic acid detection method and kit based on primer fluorescence and quenching label | |
| JP2018528780A (en) | Improved detection of short homopolymer repeats | |
| EP3555316B1 (en) | Modified multiplex and multistep amplification reactions and reagents therefor | |
| JP2022550469A (en) | Assay methods and kits for detecting rare sequence variants | |
| CN108642147A (en) | A kind of method of fast-amplifying nucleic acid | |
| JP2007125011A (en) | Method of detecting specific fragment of dna or rna with aid of polymerase chain reaction | |
| CN109563530A (en) | RNase H mutant in lotion | |
| JP6720161B2 (en) | Detection kit for a plurality of target nucleic acids and detection method using the same | |
| US10920285B2 (en) | Highly specific and sensitive methods for detecting enterohemorrhagic Escherichia coli serotypes O157:H7 and/or O145:H28 | |
| CN107988334B (en) | Method for SNP typing by direct PCR of oral swab | |
| KR20150134453A (en) | Simultaneous detection method of three mycoplasma species using PNA probe and FMCA | |
| Oberc et al. | Nucleic acid amplification test (NAAT) conducted in a microfluidic chip to differentiate between various ginseng species | |
| JP4437207B2 (en) | CYP2D6 mutation detection method and nucleic acid probe and kit therefor | |
| JP2004313120A (en) | METHOD FOR DETECTING beta3-ADRENALINE RECEPTOR VARIANT GENE AND NUCLEIC ACID PROBE AND KIT THEREFOR | |
| JP2016189704A (en) | Method for detecting gene mutation, and fluorescent-labeled oligonucleotide used for the same | |
| CN110684826A (en) | Recombinase-based loop-mediated amplification method | |
| WO2022222937A1 (en) | Primer group and method for detecting single-base mutations | |
| JP2018014924A (en) | PCR using helicase | |
| KR102220701B1 (en) | Multiplex identification method of pcr product using fluorescence-based multiple melting analysis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |