WO2023092314A1 - Humanized antibody binding to bp specific antigen peptide, preparation method, and use - Google Patents

Abstract

The present disclosure relates to the field of biological medicines, and relates to a humanized antibody binding to a bullous pemphigoid (BP) specific antigen peptide, a preparation method, and a use. Specifically, the present disclosure relates to a monoclonal antibody, the antibody specifically binding to an NC16A domain of a BP180 antigen protein, a preparation method for the monoclonal antibody, and a use of the monoclonal antibody in the preparation of a drug for diagnosing, preventing or treating BP. The anti-BP180 antibody or antigen binding fragment screened in the present disclosure specifically binds to a BP180 antigen, and can be used as a reference standard for the quantitative detection of positive BP180, realizing the quantitative detection of the level of an anti-BP180NC16A autoantibody in a BP patient, and achieving important significance for clinical diagnosis, illness state monitoring and treatment of the BP patient.

Description

Human antibody binding to BP-specific antigen peptide, preparation method and use technical field

The disclosure belongs to the field of biomedicine, and relates to a human antibody that binds to a BP-specific antigen peptide, a preparation method and an application. Specifically, the present disclosure relates to a monoclonal antibody that specifically binds to the NC16A domain of the BP180 antigenic protein, a method for preparing the monoclonal antibody, and the use of the aforementioned monoclonal antibody in preparing, diagnosing, preventing, or treating bullous Use in medicine for pemphigus.

Background technique

Bullous Pemphigoid (BP), an autoimmune disease that occurs when the immune system attacks the skin and causes blisters, most commonly affects older adults aged 60-80. The characteristic clinical manifestations of the disease are tense blisters and intense, generalized pruritus. Histopathologically, hematoxylin and eosin (HE) staining showed subepidermal fissures with eosinophil infiltration, and direct immunofluorescence (DIF) showed linear deposition of autoantibodies and/or complement along the basement membrane zone, salt Split indirect immunofluorescence (ssIIF) shows autoantibodies and/or complement deposition on the epidermal side.

The target antigens of autoantibodies in the serum of BP patients are BP180 and BP230, also known as BPAG1 and BPAG2, and the molecular weights of these two antigens are 180KD and 230KD, respectively. BP180 is considered a direct target of autoantibodies. BP180 is a type II transmembrane protein with a cytoplasmic NH2 terminus and an extracellular COOH domain. The N-terminal domain, transmembrane stretch and extracellular C-terminus have 466, 23 and 1008 amino acids, respectively. The extracellular domain contains 15 collagen subdomains (COL1–COL15) interspersed with 16 noncollagenous sequences (NC1–NC16). The NC16A domain is the paramembrane junction region, which is the core of collagen-like triple helix formation. The extracellular domain contains a helical structure that is physiologically shed from the cell surface by disintegrin metalloproteinases (ADAMs). The NC16A domain has seven antigenic sites, including NC16A1(aa 490-506), NC16A1-3(aa 490-534), NC16A1-5(aa 490-562), NC16A2(aa 507-520), NC16A2.5 (aa 514-532), NC16A3 (aa 521-534), and NC16A3-4 (aa 522-545). Among these sites, NC16A2 and NC16A2.5 are the main antigenic sites that can be captured by all IgG and IgE antibodies. BP180-NC16A antibody titers have been reported to correlate with disease severity in BP patients. Replacing mouse BP180-NC14A with the homologous human BP180-NC16A cluster region and injecting mice with intact IgG or affinity-purified IgG antibodies against BP180-NC16A from BP patients showed increased skin fragility. The structure and localization of BP180 indicated that it is the core anchor protein connecting extracellular and extracellular hemidosomal proteins and plays a key role in the pathogenesis of BP. The NC16A domain of BP180 is considered to be the main pathogenic epitope of BP. Therefore, identifying the target region of BP180 is of great significance for understanding the pathogenesis and clinical characteristics of BP180.

BP is a spectrum disease. Although most patients can achieve clinical remission after treatment, there is still a considerable mortality rate in elderly patients, especially in patients over 80 years old. The mortality rate can reach 25%. In addition, the development of immunotherapy in cancer patients can also lead to the occurrence of BP disease. PD-1/PD-L1 checkpoint inhibitors are mostly used to treat various solid and hematological malignancies, and are a class of drugs that induce BP that have been reported more in recent years. Vesicles or bullae occurred within 6-8 months after starting PD-1/PD-L1 inhibitor therapy in most cases, and mucosal involvement occurred in a few cases. With the popularization of PD-1 immunotherapy, the demand for BP detection will increase in the future. At present, how to quickly and accurately diagnose such diseases lacks effective detection methods.

IgG is a kind of BP pathogenic autoantibody, and its target antigen is mainly BP180. The combination of BP-IgG and BP180 activates complement, induces the internalization of antigenic peptides, and weakens the adhesion between keratinocytes and basement membrane. The serum level of heat shock protein 90 (HSP90) in BP patients is inversely proportional to the BP180-NC16A IgG antibody, that is, the anti-BP180-NC16A IgG antibody indirectly enhances the expression of intracellular HSP90 through the inflammatory response generated by soluble inflammatory chemotactic mediators, and at the same time Inhibit the release of HSP90 from cells to peripheral blood. The abnormally high expression of HSP90 in the cells releases related chemokines to infiltrate inflammatory cells such as eosinophils and neutrophils, and releases some proteolytic enzymes and various inflammatory mediators to participate in the pathological changes of BP and the formation of blisters .

The diagnostic criteria for BP include clinical manifestations, histopathology, direct immunofluorescence, indirect immunofluorescence, and specific antibody tests. Different treatment options are adopted according to the severity of the disease, mainly relying on glucocorticoids, antibiotics, and immunosuppressants. At present, glucocorticoids are recognized as the first-line drug for the treatment of BP, with remarkable clinical efficacy, but long-term use can cause a large number of complications, and some serious complications even hinder the clinical use of this drug in some patients. Therefore, it is necessary to provide a reagent for the diagnosis or treatment of bullous pemphigoid.

At the same time, the classic hybridoma technology requires a lot of time and energy to obtain high-affinity antibodies, and subsequent humanization is required, making it difficult to obtain human monoclonal antibodies and to achieve absolute quantification of antibody levels . Therefore, these treatment methods lack specificity, poor curative effect and long course of treatment. Phage display technology was first established by Smith in 1985. After more than 30 years of development and improvement, it has been widely used in the establishment of antigen antibody library, drug design, vaccine research, pathogen detection, gene therapy, epitope research and cell Signal transduction research, etc. Phage antibody library technology is to screen and enrich specific antibodies by preparing a human antibody library (library) and expressing proteins or polypeptides on the surface of phages. The possibility has been raised that almost all recombinant human monoclonal antibodies that specifically react with an antigen can be screened from a single-pot antibody library system, and therefore, when using phage antibody technology, various antibodies that can be applied to in vivo diagnosis or therapy can be obtained. Antibody fragments (Fab or ScFv).

Contents of the invention

The problem to be solved by the invention

Based on the problems in the prior art, the present disclosure screens out a humanized monoclonal antibody against bullous pemphigoid antigen BP180.

solutions to problems

In a first aspect, the present disclosure provides an isolated anti-BP180 antibody or an antigen-binding fragment thereof, which comprises a heavy chain variable region, wherein the sequence encoding the heavy chain variable region comprises one of the sequences shown below or Various:

(a ₁ ) the amino acid sequence shown in SEQ ID NO: 4;

( _a2 ) Compared with the sequence shown in SEQ ID NO: 4, there are 1, 2 or 3 amino acid sequences of conservative mutations;

( _a3 ) the amino acid sequence shown in SEQ ID NO: 8;

( _a4 ) Compared with the sequence shown in SEQ ID NO: 8, there are 1, 2 or 3 amino acid sequences of conservative mutations;

( _a5 ) the amino acid sequence shown in SEQ ID NO: 12;

(a ₆ ) Compared with the sequence shown in SEQ ID NO: 12, there are 1, 2 or 3 amino acid sequences of conservative mutations;

The heavy chain variable region is encoded according to the analysis method of IMGT.

In some embodiments, the antibody or antigen-binding fragment thereof according to the present disclosure comprises a light chain variable region, wherein the sequence encoding the light chain variable region comprises one or more of the sequences shown below kind:

(b ₁ ) the amino acid sequence shown in SEQ ID NO: 3;

( _b2 ) Compared with the sequence shown in SEQ ID NO: 3, there are 1, 2 or 3 amino acid sequences of conservative mutations;

(b ₃ ) the amino acid sequence shown in SEQ ID NO: 7;

(b ₄ ) Compared with the sequence shown in SEQ ID NO: 7, there are 1 or 2 amino acid sequences with conservative mutations;

(b ₅ ) the amino acid sequence shown in SEQ ID NO: 11;

(b ₆ ) Compared with the sequence shown in SEQ ID NO: 11, there are 1, 2 or 3 amino acid sequences of conservative mutations;

The light chain variable region is encoded according to the analysis method of IMGT.

In some embodiments, an antibody or antigen-binding fragment thereof according to the present disclosure, comprising a heavy chain variable region (VH) and a light chain variable region (VL), the light chain variable region (VL) comprising VL complementarity determining region (CDR) 1, VL complementarity determining region (CDR) 2 and VL complementarity determining region (CDR) 3, the heavy chain variable region (VH) comprises VH complementarity determining region (CDR) 1, VH complementarity determining region region (CDR) 2 and VH complementarity determining region (CDR) 3; and,

The VL is encoded by the following amino acids: VLCDR1 comprises the amino acid sequence shown in SEQ ID NO: 3, VLCDR2 comprises the amino acid sequence shown in SEQ ID NO: 7, and VLCDR3 comprises the amino acid sequence shown in SEQ ID NO: 11;

The VH is encoded by the following amino acids: VHCDR1 contains the amino acid sequence shown in SEQ ID NO: 4, VHCDR2 contains the amino acid sequence shown in SEQ ID NO: 8, and VHCDR3 contains the amino acid sequence shown in SEQ ID NO: 12.

In some embodiments, the antibody or antigen-binding fragment thereof according to the present disclosure, wherein the encoding of the antibody or antigen-binding fragment thereof comprises one or more of the following sequences:

(i) VH comprises the amino acid sequence shown in SEQ ID NO: 16, and VL comprises the amino acid sequence shown in SEQ ID NO: 18;

(ii) Compared with the sequence shown in (i), there is a sequence of conservative mutations.

In a second aspect, the present disclosure provides a polynucleotide, wherein the polynucleotide is selected from any one of (a)-(d):

(a) comprising a nucleotide sequence as shown in any sequence of SEQ ID NO: 15, SEQ ID NO: 17 or a combination thereof;

(b) a nucleotide sequence comprising the reverse complement of the nucleotide sequence shown in any one of SEQ ID NO: 15, SEQ ID NO: 17 or a combination thereof;

(c) under high stringency hybridization conditions or very high stringency hybridization conditions, the reverse complement of the sequence capable of hybridizing to the nucleotide sequence shown in any one of (a)-(b);

(d) has at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% of the nucleotide sequence shown in any one of (a)-(c) sequence of sequence identity.

In a third aspect, the present disclosure provides a vector, wherein the vector comprises the polynucleotide according to the second aspect.

In a fourth aspect, the present disclosure provides an isolated host cell, wherein the host cell comprises the vector as described in the third aspect.

In a fifth aspect, the present disclosure provides a method for preparing a host cell stably expressing a target protein, wherein the method comprises the step of transforming the initial host cell with the vector described in the third aspect.

In a sixth aspect, the present disclosure provides a method for preparing a target protein, the method comprising preparing the target protein by using the host cell described in the fourth aspect or by the method described in the fifth aspect.

In a seventh aspect, the present disclosure provides an antibody or binding fragment thereof prepared according to the method of the fifth aspect.

In an eighth aspect, the present disclosure provides a method for detecting an anti-BP180 antibody, wherein the method includes the step of using the antibody or antigen-binding fragment thereof described in the first aspect or the seventh aspect to detect the sample to be tested;

Optionally, the method includes the step of quantifying the anti-BP180 antibody in the sample to be tested.

In a ninth aspect, the present disclosure provides a kit, wherein the kit comprises the antibody or antigen-binding fragment thereof according to the first aspect or the seventh aspect.

In a tenth aspect, the present disclosure provides a composition, wherein the composition contains the antibody or antigen-binding fragment thereof according to the first or seventh aspect.

In an eleventh aspect, the present disclosure provides the antibody or antigen-binding fragment thereof according to the first aspect or the seventh aspect, or the composition described in the tenth aspect in at least one of the following (1)-(4) use:

(1) Detecting anti-BP180 antibodies, or preparing reagents or kits for detecting anti-BP180 antibodies;

(2) Preparation of reagents or kits for diagnosing bullous pemphigoid;

(3) Preparation of reagents or kits for monitoring the progression of bullous pemphigoid;

(4) Preparation of reagents or kits for studying the pathogenic mechanism of bullous pemphigoid.

In a twelfth aspect, the present disclosure provides a method for preventing or treating bullous pemphigoid, wherein the antibody or antigen-binding fragment thereof according to the first aspect or the seventh aspect is used, or according to the tenth aspect The composition is administered to a subject.

The effect of the invention

The present disclosure screens out a humanized monoclonal antibody against bullous pemphigoid antigen BP180. By binding to BP180, the antibody has high activity, good stability, and strong specificity. It can be used as a reference standard for qualitative detection of BP180 positivity, and can quantitatively detect the level of anti-BP180NC16A autoantibodies in BP patients, thereby monitoring disease activity. It can be used for clinical diagnosis and treatment of BP patients.

Description of drawings

Fig. 1 shows the PCR agarose gel electrophoresis pattern of the monoclonal bacteria of the VL phage library, which corresponds to the VL phage library constructed in the present disclosure. Among them, lane M is DL2000, lanes 1-16 are pATA-VK, and lanes 17-32 are pATA-Vλ.

Figure 2 shows the PCR agarose gel electrophoresis image of the monoclonal KH phage library, which corresponds to the KH phage library constructed in the present disclosure. Wherein, lane M is DL2000, and lanes 1-48 are pATA-scFv-KH respectively.

Fig. 3 shows the PCR agarose gel electrophoresis image of the monoclonal phage library of λH, which corresponds to the phage library of λH constructed in the present disclosure. Among them, lane M is DL2000, and lanes 1-48 are pATA-scFv-λH, respectively.

Figure 4 shows the results of monoclonal sequencing analysis of the phage display library. Among them, the left picture is the light chain analysis result of the library sequence, and the right picture is the heavy chain analysis result of the library sequence.

Figure 5 shows the SDS-PAGE electrophoresis of the target protein BP180. According to the results of the aforementioned electrophoresis diagram, the protein size is 34KDa, and the purity is greater than 90%.

Fig. 6 shows the ELISA results of 76F-GST-NC16A-R2P1-H2 antibody diluted at different concentrations.

Detailed ways

definition

In the claims and/or specification of the present disclosure, the word "one (a)" or "one (an)" or "one (the)" may mean "one", but may also mean "one or more", "at least one" and "one or more than one".

As used in the claims and specification, the words "comprising", "having", "comprising" or "containing" mean inclusive or open-ended and do not exclude additional, non-recited elements or means step. At the same time, "comprising", "having", "including" or "comprising" can also mean enclosing, excluding additional, unrecited elements or method steps.

Throughout this application, the term "about" means that a value includes the standard deviation of error of the apparatus or method used to determine the value.

Although the disclosure supports the definition of the term "or" as an alternative only and "and/or", the term "or" in the claims refers to "and / or".

As used in this disclosure, the term "Bullous Pemphigoid" (Bullous Pemphigoid, BP) is generally considered to be an autoimmune disease. Most patients have anti-basilar membrane zone autoantibodies in their serum, and the combination of antigen and antibody leads to basal Damage to the membranous bands forms blisters.

The term "individual", "patient" or "subject" as used in the context of the present invention includes mammals. Mammals include, but are not limited to, domesticated animals (e.g., cattle, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., , mice and rats).

As used in this disclosure, the term "BP180 antigen" (abbreviated as BP180) is also called BPAG1 antigen, and its molecular weight is 180KD, respectively. BP180 is considered a direct target of autoantibodies. BP180 is a type II transmembrane protein with a cytoplasmic NH2 terminus and an extracellular COOH domain. The N-terminal domain, transmembrane stretch and extracellular C-terminus have 466, 23 and 1008 amino acids, respectively. The extracellular domain contains 15 collagen subdomains (COL1–COL15) interspersed with 16 noncollagenous sequences (NC1–NC16).

As used in this disclosure, the term "conservative mutation" refers to a mutation (eg, amino acid substitution, insertion and/or deletion) that can normally maintain the function of a protein. Exemplary, conservative mutations are conservative substitutions.

As used in this disclosure, "conservative substitutions" generally exchange one amino acid at one or more positions in a protein. Such substitutions may be conservative. Specific examples of substitutions considered conservative substitutions include substitution of Ala to Ser or Thr, substitution of Arg to Gln, His, or Lys, substitution of Asn to Glu, Gln, Lys, His, or Asp, substitution of Asp to Asn, Glu or Gln substitution, Cys to Ser or Ala substitution, Gln to Asn, Glu, Lys, His, Asp or Arg substitution, Glu to Gly, Asn, Gln, Lys or Asp substitution, Gly to Pro substitution Substitution, His to Asn, Lys, Gln, Arg or Tyr, Ile to Leu, Met, Val or Phe, Leu to Ile, Met, Val or Phe, Lys to Asn, Glu, Gln, His or Substitution of Arg, substitution of Met to Ile, Leu, Val or Phe, substitution of Phe to Trp, Tyr, Met, Ile or Leu, substitution of Ser to Thr or Ala, substitution of Thr to Ser or Ala, substitution of Trp to Phe or Substitution of Tyr, substitution of Tyr to His, Phe or Trp, and substitution of Val to Met, Ile or Leu. In addition, conservative mutations also include naturally occurring mutations due to individual differences in gene origin, differences in strains, and species.

"Sequence identity" and "percent identity" in the present disclosure refer to the percentage of nucleotides or amino acids that are identical (ie identical) between two or more polynucleotides or polypeptides. Sequence identity between two or more polynucleotides or polypeptides can be determined by aligning the nucleotide or amino acid sequences of the polynucleotides or polypeptides and comparing the sequence identity in the aligned polynucleotides or polypeptides. The number of positions containing the same nucleotide or amino acid residue is scored and compared to the number of positions in the aligned polynucleotide or polypeptide containing a different nucleotide or amino acid residue. Polynucleotides may differ at one position, for example, by containing different nucleotides (ie substitutions or mutations) or missing nucleotides (ie nucleotide insertions or nucleotide deletions in one or both polynucleotides). Polypeptides may differ at one position, for example, by containing different amino acids (ie, substitutions or mutations) or missing amino acids (ie, amino acid insertions or amino acid deletions in one or both polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. Percent identity can be calculated, for example, by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of nucleotides or amino acid residues in the polynucleotide or polypeptide and multiplying by 100.

The term "phage display technology" in this disclosure is to insert the DNA sequence of foreign protein or polypeptide into the appropriate position of the phage coat protein structural gene, so that the foreign gene is expressed along with the expression of the coat protein, and at the same time, the foreign protein is Phage reassembly and display on the surface of phage biotechnology.

The term "antibody" in this disclosure refers to an immunoglobulin or a fragment thereof or a derivative thereof, and includes any polypeptide comprising an antigen-binding site therein, whether produced in vitro or in vivo. The term includes, but is not limited to, polyclonal, monoclonal, monospecific, multispecific, nonspecific, humanized, single-stranded, chimeric, synthetic, recombinant, hybrid, Mutated, grafted antibodies. The term "antibody" also includes antibody fragments such as Fab, F(ab')2, Fv, scFv, Fd, dAb, and other antibody fragments that retain antigen binding function. Typically, such fragments will include antigen binding fragments.

The term "single-chain antibody" (scFv) in this disclosure is an antibody formed by linking the variable region of the heavy chain and the variable region of the light chain through a short peptide (also called a linker, linker) with a limited number of amino acids. .

The term "Fab" fragment in this disclosure includes the variable domain of the heavy chain and the variable domain of the light chain, and also includes the constant domain of the light chain as well as the first constant domain (CH1) of the heavy chain. Fab' fragments differ from Fab fragments by the addition of some residues at the carboxy-terminus of the CH1 domain of the heavy chain, including one or more cysteines from the antibody hinge region. F(ab') ₂ antibody fragments were originally produced as pairs of Fab' fragments with hinge cysteines between them.

The term "IMGT numbering scheme" in this disclosure is a new standardized numbering system introduced by Lefranc et al. for all protein sequences of the immunoglobulin superfamily, including variable domains from antibody light and heavy chains as well as sequences from different species. T cell receptor chain. The IMGT numbering method is based on consecutive counting of residues based on germ-line V sequence (germ-line V) alignments.

In the technical solutions described in the present disclosure, unless otherwise specified, the antibody numbering scheme adopted for antibodies in the present disclosure is the IMGT numbering scheme.

In some aspects, the present disclosure relates to the stringency of hybridization conditions used to define the degree of complementarity of two polynucleotides. Optionally, the aforementioned polynucleotides may be selected from DNA. As used in this disclosure, "stringency" refers to the conditions of temperature and ionic strength during hybridization, as well as the presence or absence of certain organic solvents. The higher the stringency, the higher the degree of complementarity between the target nucleotide sequence and the labeled polynucleotide sequence. "Stringent conditions" refer to temperature and ionic conditions under which only nucleotide sequences with a high frequency of complementary bases will hybridize. The term "hybridizes under high stringency or very high stringency conditions" as used herein describes the conditions for hybridization and washing. Guidance for performing hybridization reactions can be found in Current Protocols in Molecular Biology, John Wiley and Sons, N.Y. (1989), 6.3.1-6.3.6. The specific hybridization conditions mentioned in the present disclosure are as follows: 1) High stringency hybridization conditions: in 6X sodium chloride/sodium citrate (SSC) at about 45°C, then wash with 0.2X SSC, 0.1% SDS at 65°C One or more times; 2) Very high stringency hybridization conditions: 0.5M sodium phosphate at 65°C, 7% SDS, and then washed one or more times with 0.2X SSC, 1% SDS at 65°C.

Technical solutions

In the technical solution of the present disclosure, the meanings represented by the numbers in the nucleotide and amino acid sequence listings of the description are as follows:

The sequence shown in SEQ ID NO: 1 is the amino acid sequence of 76F-GST-NC16A-R2P1-H2 antibody VL FR1;

The sequence shown in SEQ ID NO: 2 is the amino acid sequence of 76F-GST-NC16A-R2P1-H2 antibody VH FR1;

The sequence shown in SEQ ID NO: 3 is the amino acid sequence of 76F-GST-NC16A-R2P1-H2 antibody VL CDR1;

The sequence shown in SEQ ID NO: 4 is the amino acid sequence of 76F-GST-NC16A-R2P1-H2 antibody VH CDR1;

The sequence shown in SEQ ID NO: 5 is the amino acid sequence of 76F-GST-NC16A-R2P1-H2 antibody VL FR2;

The sequence shown in SEQ ID NO: 6 is the amino acid sequence of 76F-GST-NC16A-R2P1-H2 antibody VH FR2;

The sequence shown in SEQ ID NO: 7 is the amino acid sequence of 76F-GST-NC16A-R2P1-H2 antibody VL CDR2;

The sequence shown in SEQ ID NO: 8 is the amino acid sequence of 76F-GST-NC16A-R2P1-H2 antibody VH CDR2;

The sequence shown in SEQ ID NO: 9 is the amino acid sequence of 76F-GST-NC16A-R2P1-H2 antibody VL FR3;

The sequence shown in SEQ ID NO: 10 is the amino acid sequence of 76F-GST-NC16A-R2P1-H2 antibody VH FR3;

The sequence shown in SEQ ID NO: 11 is the amino acid sequence of 76F-GST-NC16A-R2P1-H2 antibody VL CDR3;

The sequence shown in SEQ ID NO: 12 is the amino acid sequence of 76F-GST-NC16A-R2P1-H2 antibody VH CDR3;

The sequence shown in SEQ ID NO: 13 is the amino acid sequence of 76F-GST-NC16A-R2P1-H2 antibody VL FR4;

The sequence shown in SEQ ID NO: 14 is the amino acid sequence of 76F-GST-NC16A-R2P1-H2 antibody VH FR4;

The sequence shown in SEQ ID NO: 15 is the nucleotide sequence encoding 76F-GST-NC16A-R2P1-H2 antibody VH;

The sequence shown in SEQ ID NO: 16 is the amino acid sequence of 76F-GST-NC16A-R2P1-H2 antibody VH;

The sequence shown in SEQ ID NO: 17 is the nucleotide sequence encoding 76F-GST-NC16A-R2P1-H2 antibody VL;

The sequence shown in SEQ ID NO: 18 is the amino acid sequence of the 76F-GST-NC16A-R2P1-H2 antibody VL;

The sequences shown in SEQ ID NO: 19-34 are primer sequences;

The sequence shown in SEQ ID NO: 35 is the amino acid sequence of BP180 protein;

The sequence shown in SEQ ID NO: 36 is the nucleotide sequence encoding the BP180 protein.

Anti-BP180 antibody or antigen-binding fragment thereof

Bullous pemphigoid is an autoimmune blistering disease mediated by pathogenic autoantibodies. The severity of disease in BP patients is related to the titer of anti-BP180 antibodies. Therefore, detection of anti-BP180 antibody levels is important for the pathogenesis of BP. It is important for research, disease diagnosis and monitoring.

In some embodiments, the present disclosure prepares BP180 protein, its amino acid sequence is shown in SEQ ID NO: 35, and the nucleotide sequence encoding BP180 protein is shown in SEQ ID NO: 36.

In some specific embodiments, the preparation method of BP180 protein comprises the following steps:

(1) The BP180 gene sequence was artificially synthesized, and the BP180 gene was recombined into the expression vector plasmid pGEX-6P-1 to obtain the BP180-pGEX expression vector; the cloning site was BamHI/XhoI.

(2) The BP180-pGEX expression vector was transfected into BL21(DE3) competent culture, and the precipitate was collected for GST tag affinity chromatography to obtain BP180 protein.

In some embodiments, phage display technology is used to screen for antibodies or antigen-binding fragments with high affinity to BP180 protein. Exemplary, antibodies or antigen-binding fragments with high affinity to BP180 protein include polyclonal, monoclonal, monospecific, multispecific, non-specific, humanized, single-chain, chimeric, synthetic recombinant, hybrid, mutated, grafted antibodies, or antibody fragments such as Fab, F(ab') ₂ , FV, scFv, Fd, dAb and others retaining antigen-binding function.

In some embodiments, the present disclosure isolates PBMCs of BP180 antibody-positive patients, and constructs phages comprising heavy chain variable regions (VH) and light chain variable regions (VL) by amplifying antibody VH and VL gene fragments therein The library was displayed, and the human antibody capable of specifically binding to the BP180 antigen was screened through biopanning with the BP180 protein.

In some specific embodiments, the disclosed method for screening anti-BP180 antibodies comprises the following steps:

S1, PBMCs of BP180 antibody-positive patients were isolated, RNA was extracted, and RNA quality control was performed. RT-PCR technology is used to reverse-transcribe the qualified RNA into cDNA, and amplify all the antibody VH and VL gene fragments in it. The VH and VL gene fragments amplified in vitro were cloned into the pATA-scFv-2 vector to construct an antibody combinatorial library.

S2, the antibody gene combination library is inserted into the immediate downstream of the leader series of the gene III (g3) of the membrane protein encoded by the phage, and the polypeptide or protein expressed by the foreign antibody gene can be displayed in the form of a fusion protein through the superinfection of the helper phage At the N-terminus of the phage coat protein pIII. Each phage particle encodes and presents a different antibody, which contains billions of individual clones. In these antibody libraries, the genes encoding those antibodies that can bind to antigens are subjected to affinity enrichment-gentle elution-phage amplification for antigens in vitro, and then repeat the above enrichment screening process until specificity is obtained after several cycles. Antibody phage library with good sex and strong affinity, and positive clones were screened from the antibody phage library. Positive clones were identified by ELISA method, and finally fully human antibodies with good specificity and strong affinity were screened from them.

In some more specific implementation manners, step S1 includes: using

The III 1st Strand cDNA Synthesis Kit (+gDNA wiper) reverse transcription kit reverse-transcribes the RNA of BP180 antibody-positive patients into cDNA, and amplifies the VH and VL fragments of the DNA. The VK and Vλ gene fragments amplified in vitro were cloned into pATA-scFv-2 vector by cloning technology to form VK library and Vλ library. The plasmid vectors of the VK library and the Vλ library were extracted using a plasmid extraction kit, and the VH gene fragments amplified in vitro were inserted into the plasmid vectors of the VK library and the Vλ library to form the KH library and the λH library.

In this disclosure, after three rounds of screening of antibody phage library, the clones whose antigen group is 3 times larger than that of the control group are determined as positive clones, and these single clones are sequenced and analyzed. After eliminating the wrong antibody sequence and repeated antibody sequence, combined with the antigen-antibody specific binding ability reflected by the ELISA experiment, a high-affinity antibody was finally obtained, which was named 76F-GST-NC16A-R2P1-H2. The antibody has high activity, good stability, and strong specificity. It can be used as a reference standard for qualitative detection of BP180 positive, and can also quantitatively detect the level of anti-BP180 autoantibodies in BP patients. Provide effective information for diagnosis, monitoring of disease development, clinical drug treatment, and research on pathogenic mechanisms.

Example

Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and specific examples, while indicating specific embodiments of the disclosure, are given for illustrative purposes only, since, upon reading this detailed description, all further changes will be made within the spirit and scope of the disclosure. Various changes and modifications will become apparent to those skilled in the art.

All reagents used in the examples are commercially available unless otherwise noted.

Example 1: Construction method of human ScFv phage display library

The reagents mainly used in this example are shown in Table 1.

The main reagent used in the embodiment 1 of table 1

1. Library construction

1.1 Assembly of heavy chain variable region (VH) and light chain variable region (VL)

Table 2 PCR reaction conditions and steps

Among them, the three steps of denaturation, annealing and extension (1) were repeated 30 times.

The primer sequences used in this example are as follows:

Forward(F):

5'L-VH 1: ACAGGTGCCCACTCCCAGGTGCAG (SEQ ID NO: 19)

5′ L-VH 3: AAGGTGTCCAGTGTGARGTGCAG (SEQ ID NO: 20)

5'L-VH 4/6: CCCAGATGGGTCCTGTCCCAGGTGCAG (SEQ ID NO: 21)

5'L-VH 5/7: CAAGGAGTCTGTTCCGAGGTGCAG (SEQ ID NO: 22)

5'L VK 1/2: ATGAGGSTCCCYGCTCAGCTGCTGG (SEQ ID NO: 23)

5'L VK 3: CTCTTCCTCCTGCTACTCTGGCTCCCAG (SEQ ID NO: 24)

5'L VK 4/5: ATTTCTCTGTTGCTCTGGATCTCTG (SEQ ID NO: 25)

5'L Vλ1: GGTCCTGGGCCCAGTCTGTGCTG (SEQ ID NO: 26)

5'L Vλ2: GGTCCTGGGCCCAGTCTGCCCTG (SEQ ID NO: 27)

5'L Vλ3: GCTCTGTGACCTCCTATGAGCTG (SEQ ID NO: 28)

5'L Vλ4/5: GGTCTCTCTCSCAGCYTGTGCTG (SEQ ID NO: 29)

5'L Vλ6: GTTCTTGGGCCAATTTTATGCTG (SEQ ID NO: 30)

5'L Vλ7: GGTCCAATTCYCAGGCTGTGGTG (SEQ ID NO: 31)

5′L Vλ8/9/10: GAGTGGATTCTCAGACTGTGGTG (SEQ ID NO: 32)

Reverse(R):

3'CK: TGCTGTCCTTGCTGTCCTGCT (SEQ ID NO: 33)

3'Cλ: CACCAGTGTGGCCTTGTTGGCTTG (SEQ ID NO: 34)

1.2 Construction of light chain variable region phage display library

1.2.1 Preparation of pATA-scFv-2 vector for library cloning

1.2.2 Digest vector and PCR product

Table 3 Reaction system for digesting vector and PCR product

Through the technical scheme recorded in Table 3, PCR products were obtained.

1.2.3 Connection

Table 4 Connection reaction system

the	pATA-VK	pATA-Vλ
T4 DNA Ligase (Thermo)	3μL		3μL
10×T4 DNA Ligase Buffer	8μL	8μL
Vector (NheI/NotI)	1μg	1μg
VK or Vλfragment(NheI/NotI)	0.3μg	0.3μg
H 2 O	Add to the reaction system a total of 80μL	Add to the reaction system a total of 80μL

The connection is carried out by the technical scheme described in Table 4. Incubate overnight at 16°C and heat inactivate at 65°C for 10 minutes to obtain ligation products.

1.2.4 Electric transfer

1.2.4.1 Preparation of TG1 competent cells.

1.2.4.2 Pre-warm 1mL SOC medium (Sigma, S1797) at 37°C. Place electroporation cuvettes (0.1 cm gap) and microcentrifuge tubes on ice (one cuvette and one microcentrifuge tube per transformation reaction).

1.2.4.3 Take out the Electrocompetent cells from the -80°C freezer and place them on ice until they completely melt (10-15 minutes). After the cells are thawed, mix gently. Place 50 μL of cells into a chilled microcentrifuge tube on ice.

1.2.4.4 Carefully add 3 μL of the DNA mixture to the frozen electroporation cuvette without creating air bubbles. Flick the tube down quickly with your wrist to settle the cells to the bottom.

1.2.4.5 Electroporation at 600 Ω, 10 μF and 1.8 kV. Immediately add 1 mL of pre-warmed SOC medium to each tube within 10 s of the pulse. 37°C, shake at 250rpm for 1 hour.

1.2.4.6 Collect all electroporation medium. Serially dilute 10 μL of the culture into 90 μL of SOC medium and spread on LB/Amp/Glucose. Incubate overnight at 37°C. Calculate the total number of transformants by counting the number of colonies, multiplying by the culture volume, and dividing by the plating volume.

1.3 Construction of VL-VH phage display library

1.3.1 Digest vector and PCR product

Table 5 digestion reaction system

Through the digestion reaction system and reaction steps in Table 5, the digested PCR product was obtained.

1.3.2 Connection

Table 6 Connection reaction system

The connection is carried out by the technical scheme described in Table 6. Incubate overnight at 16°C and heat inactivate at 65°C for 10 minutes to obtain ligation products.

1.3.3 Electric transfer

1.3.3.1 Preparation of TG1 competent cells.

1.3.3.2 Pre-warm 4mL SOC medium (Sigma, S1797) at 37°C. Place electroporation cuvettes (0.2 cm gap) and microcentrifuge tubes on ice (one cuvette and one microcentrifuge tube per transformation reaction).

1.3.3.3 Take out the Electrocompetent cells from the -80°C freezer and place them on ice until they completely melt (10-15 minutes). After the cells are thawed, mix gently.

1.3.3.4 Carefully add 6 μL of the DNA mixture to the frozen electroporation cuvette without creating air bubbles. Flick the tube down quickly with your wrist to settle the cells to the bottom.

1.3.3.5 Electroporation at 600Ω, 100Ω and 2.5kV. Immediately add 2 mL of pre-warmed SOC medium to each tube within 10 seconds of the pulse. 37°C, shake at 250rpm for 1 hour.

1.3.3.6 Collect all electroporation medium. Serially dilute 10 μL of the culture into 90 μL of SOC medium and spread on LB/Amp/Glucose. Incubate overnight at 37°C. Calculate the total number of transformants by counting the number of colonies, multiplying by the culture volume, and dividing by the plating volume.

1.4 Library evaluation

1.4.1 Colony PCR: Perform PCR using the constructed library as a template.

Table 7 PCR reaction conditions

Among them, the three steps of denaturation, annealing and extension (1) were repeated 30 times.

The primer sequences in Table 7 are as follows:

pATA-scFv-2 vector identification upstream primer (F): AGCGGATAACAATTTCACACAGGA (SEQ ID NO: 35)

pATA-scFv-2 vector identification downstream primer (R): GCCCCCTTATTAGCGTTTGCCATC (SEQ ID NO: 36)

The results of agarose gel electrophoresis after PCR are shown in Figures 1-3.

1.4.2 Sequencing

The positive clones were selected and sent to Wuhan Qingke Biotechnology Co., Ltd. for sequencing. The sequencing quality control results are shown in Figure 4.

1.5 Expression of BP180 protein

The BP180 gene sequence was artificially synthesized, and the BP180 gene was recombined into the expression vector plasmid pGEX-6P-1 to obtain the BP180-pGEX expression vector; the cloning site was BamHI/XhoI.

The amino acid sequence of BP180 is (SEQ ID NO: 35):

The gene sequence is (SEQ ID NO: 36):

Transfect the BP180-pGEX expression vector into BL21(DE3) competent culture, collect the precipitate and perform GST tag affinity chromatography to obtain the BP180 protein; the purified BP180 also needs to be subjected to SDS-PAGE electrophoresis (polyacrylamide gel electrophoresis) To verify its purity, the purified BP180 SDS-PAGE electrophoresis is shown in Figure 5, and the purity is greater than 90%.

Example 2: Preparation of monoclonal antibody specifically binding to BP180

The main reagents used in Example 1 are shown in Table 8.

The main reagent used in the embodiment 2 of table 8

Reagent	serial number	manufacturer
96-well plate	42592	Costar
Tween 20	P2287	Sigma
Tris	RES3098T-B7	Sigma
Glycine	G8200	Solarbio
PEG	181986	Sigma
PBS	C10010500BT	life
BSA	A104912-100g	aladdin
Skim milk	6342932	BD

1. First round

1.1 Biopanning

1.1.1 Coating: Coat the immunotube and incubate overnight at 4°C. Antigen group: 1mL GST-NC16A transfection solution (50μg/mL), control group: 500μL transfection solution (0μg/mL). GST-NC16A is obtained by recombinant expression of the BP180-pGEX expression vector in Example 1.

1.1.2 Washing: Discard the liquid in the immunotube and wash three times with 5mL 0.05% PBST.

1.1.3 Blocking: Add 5mL 5% skimmed milk (dissolved in PBST) to the tube and incubate at 37°C for 2 hours.

1.1.4 Washing: Discard the liquid in the immunotube and wash once with 5mL 0.05% PBST.

1.1.5 Incubation: Dilute the phage library with 1% skimmed milk (dissolved in PBST), take 1 mL into the immunotube, and incubate at 32°C for 2 hours.

1.1.6 Washing: Discard the liquid in the immunotube, wash three times with 5mL 0.05% PBST, and wash twice with PBS.

1.1.7 Elution: Use 1 mL of glycine-hydrochloric acid (pH 2.2) to elute the phage bound to BP180, and then use Tris-HCl to neutralize to pH 7.0.

1.2 Determination of the titer of diluted phage

1.2.1 Cultivate Escherichia coli TG1 until OD600=0.4-0.6.

1.2.2 Mix 10 μL of diluted eluted phage and 190 μL of Escherichia coli TG1.

1.2.3 Incubate the mixture at 37°C for 15 minutes, then pour it into 2×YT-A (Amp 100μg/mL) medium. The medium was grown upside down at 37°C overnight.

1.3 Phage library amplification

1.3.1 Add 10 μL of E.coli TG1 to 800 μL of 2YT culture medium, mix and culture at 37°C until OD600=0.4-0.6.

1.3.2 Transfer TG1 cultured to the logarithmic phase into 10 mL of 2YT-G culture medium (final concentration 2% glucose), and culture it on a shaker at 37°C until OD600=0.4-0.6.

1.3.3 Add the eluted product, incubate at 37°C for 30 minutes, and incubate on a shaker at 37°C for 30 minutes.

1.3.4 Add 30mL 2YT-AG culture solution (final concentration 0.1% Amp, 2% glucose), and incubate at 37°C for 1 hour on a shaker.

1.3.5 Add M13KO7 (M13KO7:TG1=20:1), incubate at 37°C for 30 minutes, and incubate on a shaker at 37°C for 30 minutes.

1.3.6 Centrifuge the bacterial solution at 5000rpm for 5 minutes. Resuspend with 40mL 2YT-AK (final concentration Amp 100μg/mL, Kan 100μg/mL) and incubate overnight on a shaker at 30°C.

1.3.7 Centrifuge at 8000rpm for 10 minutes, remove the supernatant, resuspend in 1mL PBS, centrifuge at 12000rpm for 5 minutes, transfer the supernatant to a new 1.5mL centrifuge tube.

1.4 Determination of the titer of the amplified phage library

The steps are the same as 1.2.

2. The second round to the third round

2.1 Biopanning

Repeat step 1 twice in a cycle, and use the eluted phage after the previous round of amplification for each input phage library.

Table 9 Biopanning Results

3. Polyclonal Phage ELISA

3.1 Coating: Coat the microtiter plate and incubate overnight at 4°C. Antigen group: 100 μL/well GST-NC16A protein (4 μg/mL), control group: 100 μL/well protein dilution (0 μg/mL).

3.2 Washing: Discard the liquid in the ELISA plate, and wash each well three times with 300 μL of 0.05% PBST.

3.3 Blocking: 300 μL of 5% skimmed milk (dissolved in PBS) was added to each well, and blocked at 37° C. for 2 hours.

3.4 Phage Incubation: Add 100 μL of diluted phage to each well, as shown in Table 10, and incubate at 32° C. for 2 hours.

3.5 Washing: Same as step 3.2.

3.6 Secondary antibody incubation: Add 100 μL of anti-M13-HRP antibody (1:9000) diluted with blocking solution to each well, and incubate at 32°C for 1 hour.

3.7 Washing: Same as step 3.2.

3.8 Color development: Add 100 μL TMB to each well, incubate at room temperature, then add 50 μL 2M HCl to each well to terminate the reaction.

3.9 Plate reading: Use a microplate reader to read the value at 450nm-630nm. The plate reading results are shown in Table 10.

Table 10 The result of polyclonal phage ELISA

4. Monoclonal phage ELISA (according to the polyclonal results, select the second round of elution products for monoclonal)

4.1 Select 96 clones from the culture dish, and culture these clones at 37° C. at 250 rpm until OD600nm=0.4-0.6.

4.2 Infect the culture with M13KO7 (MOI=20:1), incubate at 37°C for 30 minutes, and incubate at 37°C on a shaker for 30 minutes. Centrifuge the bacterial solution, resuspend the pellet with an equal volume of 2×YT-AK (final concentration Amp 100 μg/mL, Kan 100 μg/mL), and incubate overnight at 30°C.

4.3 Centrifuge the culture and the supernatant can be used for ELISA.

4.4 Coating: Coat the microtiter plate and incubate overnight at 4°C. Antigen group: 100 μL/well of GST-NC16A protein (4 μg/mL), control group: 100 μL/well of protein dilution (0 μg/mL).

4.5 Washing: Discard the liquid in the ELISA plate, and wash each well three times with 300 μL of 0.05% PBST.

4.6 Blocking: 300 μL of 5% skimmed milk (dissolved in PBS) was added to each well, and blocked at 37° C. for 2 hours.

4.7 Phage Incubation: Add 100 μL of phage supernatant to each well and incubate at 32°C for 2 hours.

4.8 Washing: Same as step 4.5.

4.9 Secondary antibody incubation: Add 100 μL of anti-M13-HRP antibody (1:9000) diluted with blocking solution to each well, and incubate at 32°C for 1 hour.

4.10 Washing: Same as step 4.5.

4.11 Color development: Add 100 μL TMB to each well, incubate at room temperature, then add 50 μL 2M HCl to each well to terminate the reaction.

4.12 Plate reading: Use a microplate reader to read the value at 450nm-630nm, and sequence the highly specific clones. The plate reading results are shown in Table 11 and Table 12.

Table 11 Results of antigen group monoclonal phage ELISA

the	1	2	3	4	5	6	7	8	9	10	11	12
A	0.16	0.04	0.03	0.05	0.02	0.03	0.05	0.28	0.33	0.41	0.33	0.21
B	0.03	0.02	0.02	0.05	0.03	0.03	0.04	0.05	0.04	0.04	0.06	0.06
C	0.03	0.02	0.02	0.04	0.03	0.20	0.19	0.12	0.17	0.03	3.94	0.05
D.	0.03	0.09	0.03	0.03	0.17	0.60	0.03	0.04	0.03	0.03	0.03	0.46
E.	0.03	0.03	0.03	0.04	0.03	0.03	0.18	0.04	0.58	0.03	0.03	0.22
f	0.06	0.11	0.05	0.14	0.03	0.03	0.03	0.19	0.03	0.05	0.04	0.03
G	0.03	0.04	0.19	0.11	0.12	0.03	0.03	0.10	0.05	0.16	0.17	0.04
h	0.05	3.38	0.04	0.16	0.04	0.04	0.18	0.04	0.03	0.17	0.04	1.62

Table 12 The results of the monoclonal phage ELISA in the control group

the	1	2	3	4	5	6	7	8	9	10	11	12
A	0.06	0.02	0.02	0.02	0.02	0.02	0.03	0.05	0.05	0.10	0.07	0.25
B	0.03	0.03	0.02	0.02	0.03	0.02	0.03	0.02	0.02	0.02	0.02	0.04
C	0.02	0.02	0.02	0.02	0.02	0.04	0.04	0.03	0.05	0.02	3.16	0.02
D.	0.02	0.03	0.02	0.02	0.07	0.03	0.02	0.02	0.02	0.02	0.20	0.05
E.	0.03	0.02	0.02	0.02	0.02	0.02	0.06	0.02	0.05	0.03	0.09	0.06
f	0.03	0.04	0.03	0.04	0.02	0.02	0.02	0.07	0.05	0.03	0.02	0.02
G	0.03	0.04	0.05	0.02	0.03	0.16	0.02	0.03	0.03	0.08	0.06	0.04
h	0.06	0.03	0.02	0.04	0.02	0.03	0.05	0.03	0.03	0.04	0.05	0.28

5. Positive clone verification ELISA

5.1 Add 50 μL of positive clones to 2 mL of 2YT-AG medium (final concentration 0.1% Amp, 2% glucose) and culture to OD600=0.4-0.6.

5.2 Infect the culture with M13KO7 (MOI=20:1), incubate at 37°C for 30 minutes, and incubate at 37°C on a shaker for 30 minutes. Centrifuge the bacterial solution, resuspend the pellet with an equal volume of 2×YT-AK (final concentration Amp 100 μg/mL, Kan 100 μg/mL), and incubate overnight at 30°C.

5.3 Centrifuge the culture and the supernatant can be used for ELISA.

5.4 Coating: Coat the microtiter plate and incubate overnight at 4°C. Antigen group: 100 μL/well GST-NC16A protein (4 μg/mL), control group: 100 μL/well protein dilution (0 μg/mL).

5.5 Washing: Discard the liquid in the ELISA plate, and wash each well three times with 300 μL of 0.05% PBST.

5.6 Blocking: 300 μL of 5% skimmed milk (dissolved in PBS) was added to each well, and blocked at 37° C. for 2 hours.

5.7 Phage Incubation: Add 100 μL of phage supernatant to each well and incubate at 32°C for 2 hours.

5.8 Washing: Same as step 4.5.

5.9 Secondary antibody incubation: Add 100 μL of anti-M13-HRP antibody (1:9000) diluted with blocking solution to each well, and incubate at 32°C for 1 hour.

5.10 Washing: Same as step 4.5.

5.11 Color development: Add 100 μL TMB to each well, incubate at room temperature, then add 50 μL 2M HCl to each well to terminate the reaction.

5.12 Plate reading: Use a microplate reader to read the value at 450nm-630nm, and sequence the highly specific clones. The plate reading results are shown in Table 13.

The result of table 13 positive monoclonal phage ELISA

6. Sequencing of antibody sequences

The obtained phage-positive clones were screened and subjected to full sequence sequencing to obtain the corresponding antibody heavy chain light chain, and the full sequence is shown in Table 14.

Table 14 76F-GST-NC16A-R2P1-H2 monoclonal antibody sequence

The base sequence of the heavy chain of the 76F-GST-NC16A-R2P1-H2 antibody is as follows (SEQ ID NO: 15):

The heavy chain amino acid sequence of the 76F-GST-NC16A-R2P1-H2 antibody is as follows (SEQ ID NO: 16):

The base sequence of the light chain of the 76F-GST-NC16A-R2P1-H2 antibody is as follows (SEQ ID NO: 17):

The amino acid sequence of the light chain of the 76F-GST-NC16A-R2P1-H2 antibody is as follows (SEQ ID NO: 18):

Example 3: ELISA detection of OD values under different dilution conditions of antibodies

Enzyme-linked immunosorbent reaction ELISA experimental steps:

1. Coating: 100 μL/well of GST-NC16A protein (4 μg/mL) was used to coat the microtiter plate, and incubated overnight at 4°C.

2. Washing: Discard the liquid in the ELISA plate, and wash each well three times with 300 μL of 0.05% PBST.

3. Blocking: 300 μL of 5% skimmed milk (dissolved in PBS) was added to each well, and blocked at 37° C. for 2 hours.

4. Positive antibody incubation: 76F-GST-NC16A-R2P1-H2 antibody was serially diluted, and 100 μL of the diluted antibody solution was added to each well, and incubated at 37°C for 1 hour.

5. Washing: Same as step 4.5.

6. Secondary antibody incubation: Dilute Goat Anti-Human IgG (H+L) antibody (Jackson, code: 109-035-088) 10,000 times with blocking solution, add 100 μL of diluted secondary antibody to each well, and incubate at 37°C for 30 minutes.

7. Washing: Same as step 4.5.

8. Color development: Add 100 μL TMB to each well, incubate at 37°C for 10 minutes, then add 50 μL 2M HCl to each well to terminate the reaction.

9. Plate reading: Use a microplate reader to read the value at 450nm-630nm, as shown in Figure 6.

From the results in Figure 6, it is proved that 76F-GST-NC16A-R2P1-H2 has a strong ability to specifically bind to BP180.

The present disclosure is not intended to be limited in scope by the particular disclosed embodiments, which are provided, for example, to illustrate various aspects of the present disclosure. Various modifications to the compositions and methods will be apparent from the description and teachings herein. Such changes may be made without departing from the true scope and spirit of the present disclosure, and are intended to be within the scope of the present disclosure.

Claims (15)

1. An isolated anti-BP180 antibody or an antigen-binding fragment thereof comprising a heavy chain variable region, wherein the sequence encoding the heavy chain variable region comprises one or more of the following sequences:

   (a ₁ ) the amino acid sequence shown in SEQ ID NO: 4;

   ( _a2 ) Compared with the sequence shown in SEQ ID NO: 4, there are 1, 2 or 3 amino acid sequences of conservative mutations;

   ( _a3 ) the amino acid sequence shown in SEQ ID NO: 8;

   ( _a4 ) Compared with the sequence shown in SEQ ID NO: 8, there are 1, 2 or 3 amino acid sequences of conservative mutations;

   ( _a5 ) the amino acid sequence shown in SEQ ID NO: 12;

   (a ₆ ) Compared with the sequence shown in SEQ ID NO: 12, there are 1, 2 or 3 amino acid sequences of conservative mutations;

   The heavy chain variable region is encoded according to the analysis method of IMGT.
2. The antibody or antigen-binding fragment thereof according to claim 1, comprising a light chain variable region, wherein the sequence encoding the light chain variable region comprises one or more of the following sequences:

   (b ₁ ) the amino acid sequence shown in SEQ ID NO: 3;

   ( _b2 ) Compared with the sequence shown in SEQ ID NO: 3, there are 1, 2 or 3 amino acid sequences of conservative mutations;

   (b ₃ ) the amino acid sequence shown in SEQ ID NO: 7;

   (b ₄ ) Compared with the sequence shown in SEQ ID NO: 7, there are 1 or 2 amino acid sequences with conservative mutations;

   (b ₅ ) the amino acid sequence shown in SEQ ID NO: 11;

   (b ₆ ) Compared with the sequence shown in SEQ ID NO: 11, there are 1, 2 or 3 amino acid sequences of conservative mutations;

   The light chain variable region is encoded according to the analysis method of IMGT.
3. The antibody or antigen-binding fragment thereof according to claim 1 or 2, comprising a heavy chain variable region (VH) and a light chain variable region (VL), the light chain variable region (VL) comprising a VL complementarity determination Region (CDR) 1, VL complementarity determining region (CDR) 2 and VL complementarity determining region (CDR) 3, the heavy chain variable region (VH) comprises VH complementarity determining region (CDR) 1, VH complementarity determining region (CDR) )2 and VH complementarity determining region (CDR)3; and,

   The VL is encoded by the following amino acids: VLCDR1 contains the amino acid sequence shown in SEQ ID NO: 3, VLCDR2 contains the amino acid sequence shown in SEQ ID NO: 7, and VLCDR3 contains the amino acid sequence shown in SEQ ID NO: 11;

   The VH is encoded by the following amino acids: VHCDR1 contains the amino acid sequence shown in SEQ ID NO: 4, VHCDR2 contains the amino acid sequence shown in SEQ ID NO: 8, and VHCDR3 contains the amino acid sequence shown in SEQ ID NO: 12.
4. The antibody or antigen-binding fragment thereof according to any one of claims 1-3, wherein the encoding of the antibody or antigen-binding fragment thereof comprises one or more of the following sequences:

   (i) VH comprises the amino acid sequence shown in SEQ ID NO: 16, and VL comprises the amino acid sequence shown in SEQ ID NO: 18;

   (ii) Compared with the sequence shown in (i), there is a sequence of conservative mutations.
5. A polynucleotide, wherein the polynucleotide is selected from any one of (a)-(d):

   (a) comprising a nucleotide sequence as shown in any sequence of SEQ ID NO: 15, SEQ ID NO: 17 or a combination thereof;

   (b) a nucleotide sequence comprising the reverse complement of the nucleotide sequence shown in any one of SEQ ID NO: 15, SEQ ID NO: 17 or a combination thereof;

   (c) under high stringency hybridization conditions or very high stringency hybridization conditions, the reverse complement of the sequence capable of hybridizing to the nucleotide sequence shown in any one of (a)-(b);

   (d) has at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% of the nucleotide sequence shown in any one of (a)-(c) sequence of sequence identity.
6. A vector, wherein the vector comprises the polynucleotide according to claim 5.
7. An isolated host cell, wherein the host cell comprises the vector of claim 6.
8. A method for preparing a host cell stably expressing a target protein, wherein the method comprises the step of using the vector according to claim 6 to transform the initial host cell.
9. A method for preparing a target protein, the method comprising using the host cell according to claim 7 or the method according to claim 8 to prepare the target protein.
10. The antibody or binding fragment thereof prepared according to the method of claim 9.
11. A method for detecting an anti-BP180 antibody, wherein the method comprises the step of using the antibody or antigen-binding fragment thereof according to any one of claims 1-4 or claim 10 to detect the sample to be tested;

    Optionally, the method includes the step of quantifying the anti-BP180 antibody in the sample to be tested.
12. A kit, wherein the kit comprises the antibody or antigen-binding fragment thereof according to any one of claims 1-4 or claim 10.
13. A composition, wherein the composition contains the antibody or antigen-binding fragment thereof according to any one of claims 1-4 or claim 10.
14. Use of the antibody or antigen-binding fragment thereof according to any one of claims 1-4 or claim 10, or the composition of claim 14 in at least one of the following (1)-(4):

    (1) Detecting anti-BP180 antibodies, or preparing reagents or kits for detecting anti-BP180 antibodies;

    (2) Preparation of reagents or kits for diagnosing bullous pemphigoid;

    (3) Preparation of reagents or kits for monitoring the progression of bullous pemphigoid;

    (4) Preparation of reagents or kits for studying the pathogenic mechanism of bullous pemphigoid.
15. A method for preventing or treating bullous pemphigoid, wherein the antibody or antigen-binding fragment thereof according to any one of claims 1-4 or claim 10, or the combination according to claim 13 is used administered to the subjects.

Images