CN110885375A

CN110885375A - Single-domain antibody specifically aiming at ZnMc structural domain of MMP9 protein, product and application

Info

Publication number: CN110885375A
Application number: CN201911335828.1A
Authority: CN
Inventors: 苏志鹏; 孟巾果; 赵泽英
Original assignee: Nanjing Rongjikang Biotechnology Co Ltd
Current assignee: Nanjing Rongjikang Biotechnology Co Ltd
Priority date: 2019-12-20
Filing date: 2019-12-20
Publication date: 2020-03-17
Anticipated expiration: 2039-12-20
Also published as: CN110885375B

Abstract

The invention relates to the technical field of biomedicine, and particularly provides a single domain antibody specifically aiming at a ZnMc structural domain of MMP9 protein, a product and application thereof. The single domain antibody provided by the invention comprises Complementarity Determining Regions (CDRs) including CDR1, CDR2 and CDR3, wherein the amino acid sequence of the CDR1 is any one of SEQ ID NO.29-SEQ ID NO. 34; the amino acid sequence of the CDR2 is any one of SEQ ID NO.35-SEQ ID NO. 41; the amino acid sequence of the CDR3 is any one of SEQ ID NO.42-SEQ ID NO. 50. The single-domain antibody has obvious affinity, can replace the traditional monoclonal antibody to quickly express and be used for detecting MMP-9 protein or changing the activity of the MMP-9 protein.

Description

Single-domain antibody specifically aiming at ZnMc structural domain of MMP9 protein, product and application

Technical Field

The invention relates to the technical field of biomedicine, in particular to a single domain antibody specifically aiming at a ZnMc structural domain of MMP9 protein, a product and application thereof.

Background

Matrix Metalloproteinases (MMPs) belong to a family of extracellular enzymes involved in extracellular matrix formation and remodeling. These enzymes contain a conserved catalytic domain in which the zinc atom is coordinated by three histidine residues. Members of this family are organized into groups including collagenases, gelatinases, stromelysins, amelysins and membrane MMPs.

MMP-9 (matrix metalloproteinase-9) belongs to the gelatinase group of matrix metalloproteinases. The MMP-9 gene is located on chromosome 20q 11.1-13.1, 26-27 kbp, and has 13 exons and 9 introns. MMP-9 has a major function in the dynamic equilibrium of degradation and remodelling of the extracellular matrix (extracellular matrix), and the matrix metalloproteinase family comprises a plurality of mechanistic metalloproteinases, respectively responsible for the hydrolysis and equilibrium of different substrates.

MMP-9 is a zinc-dependent endopeptidase, and hydrolysis of matrix proteins is an important role in leukocyte migration. MMP-9 also plays a role in the bone resorption process, hydrolyzing type I and V gelatin, as well as type IV and V collagen. The cofactor for this enzyme is generally Zn²⁺Or Ca²⁺One MMP-9 can bind 2 Zn²⁺Or 3 Ca²⁺MMP-9 can break down structural complexes in the respiratory tract and lung such as ECM and basement membrane, and thus can participate in the remodeling of the respiratory tract and lung, and can also regulate the activity of other proteases and cytokines, degrading α antitrypsin, protecting neutrophil elastase activity, and at the same time, can enhance the collagenolytic activity of collagen cells and MMP-13 in collagen colloid, and MMP-9 can also break down a 62 amino acid peptide from interleukin 8(CXCL8/CL8), increasing its chemotactic activity towards neutrophils 10-fold, but it also inhibits chemokines of other neutrophils. in addition, MMP-9 binds to TGF- β stored in CD44, and in addition, MMP-9 can participate in angiogenesis by releasing Vascular Endothelial Growth Factor (VEGF).

MMP-9 has relevance to many diseases, such as vascular diseases (heart and brain) and respiratory system diseases, and researches show that MMP-9 is abnormally highly expressed in various malignant tumors such as lung cancer and is closely related to invasion and metastasis of cancer cells.

The prior MMP-9 antibodies are all traditional monoclonal antibodies, the traditional monoclonal antibody technology generally refers to a monoclonal antibody which is prepared based on mouse hybridoma cells and aims at target proteins, the technology is mature, the phage display technology is used for respectively displaying heavy chains and light chains of the antibodies or simultaneously displaying Fab fragments of the antibodies to replace the original hybridoma technology, but the finally obtained antibody structure is the same as or similar to the structure of the traditional monoclonal antibody. The specificity and the efficacy of the traditional monoclonal antibody are not completely satisfactory, and in addition, the immune heterogeneity is higher and the modification space is small.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The first object of the present invention is to provide a single domain antibody specific for the ZnMc domain of the MMP9 protein.

The second purpose of the invention is to provide a biological material related to the single domain antibody provided by the invention.

The third objective of the invention is to provide a derivative antibody of the single domain antibody of the invention.

The fourth object of the present invention is to provide a method for producing a single domain antibody.

The fifth purpose of the invention is the application of the product provided by the invention.

In order to achieve the above purpose of the present invention, the following technical solutions are adopted:

a single domain antibody specific for the ZnMc domain of the MMP9 protein, comprising complementarity determining regions CDRs comprising CDR1, CDR2 and CDR 3;

the amino acid sequence of the CDR1 is any one of SEQ ID NO.29-SEQ ID NO. 34;

the amino acid sequence of the CDR2 is any one of SEQ ID NO.35-SEQ ID NO. 41;

the amino acid sequence of CDR3 is any one of SEQ ID NO.42-SEQ ID NO. 50.

In a preferred embodiment, the complementarity determining regions CDRs of the single domain antibody are as follows:

CDR1 shown in SEQ ID NO.29, CDR2 shown in SEQ ID NO.35 and CDR3 shown in SEQ ID NO. 42;

or, the CDR1 shown in SEQ ID NO.29, the CDR2 shown in SEQ ID NO.35 and the CDR3 shown in SEQ ID NO. 43;

or, the CDR1 shown in SEQ ID NO.30, the CDR2 shown in SEQ ID NO.36 and the CDR3 shown in SEQ ID NO. 44;

or, the CDR1 shown in SEQ ID NO.31, the CDR2 shown in SEQ ID NO.37 and the CDR3 shown in SEQ ID NO. 45;

or, the CDR1 shown in SEQ ID NO.32, the CDR2 shown in SEQ ID NO.38 and the CDR3 shown in SEQ ID NO. 46;

or, the CDR1 shown in SEQ ID NO.33, the CDR2 shown in SEQ ID NO.39 and the CDR3 shown in SEQ ID NO. 47;

or, the CDR1 shown in SEQ ID NO.34, the CDR2 shown in SEQ ID NO.40 and the CDR3 shown in SEQ ID NO. 48;

or, CDR1 shown in SEQ ID NO.34, CDR2 shown in SEQ ID NO.41 and CDR3 shown in SEQ ID NO. 49;

or, the CDR1 shown in SEQ ID NO.34, the CDR2 shown in SEQ ID NO.41 and the CDR3 shown in SEQ ID NO. 50.

In the present invention, the single domain antibody is composed of the complementarity determining region CDR and the framework region FR.

In a preferred embodiment, the framework regions FR comprise FR1, FR2, FR3 and FR4, wherein the amino acid sequence of FR1 is any one of SEQ ID No.51 to SEQ ID No. 59; the amino acid sequence of FR2 is any one of SEQ ID NO.60-SEQ ID NO. 65; the amino acid sequence of FR3 is any one of SEQ ID NO.66-SEQ ID NO. 72; the amino acid sequence of FR4 is SEQ ID NO. 73.

In a preferred embodiment, the framework regions FR are as follows:

FR1 shown in SEQ ID NO.51, FR2 shown in SEQ ID NO.60, FR3 shown in SEQ ID NO.66 and FR4 shown in SEQ ID NO. 73;

or, FR1 shown in SEQ ID NO.52, FR2 shown in SEQ ID NO.60, FR3 shown in SEQ ID NO.66 and FR4 shown in SEQ ID NO. 73;

or, FR1 shown by SEQ ID NO.53, FR2 shown by SEQ ID NO.61, FR3 shown by SEQ ID NO.67 and FR4 shown by SEQ ID NO. 73;

or, FR1 shown in SEQ ID NO.54, FR2 shown in SEQ ID NO.62, FR3 shown in SEQ ID NO.68 and FR4 shown in SEQ ID NO. 73;

or, FR1 shown by SEQ ID NO.55, FR2 shown by SEQ ID NO.62, FR3 shown by SEQ ID NO.68 and FR4 shown by SEQ ID NO. 73;

or, FR1 shown in SEQ ID NO.56, FR2 shown in SEQ ID NO.63, FR3 shown in SEQ ID NO.69 and FR4 shown in SEQ ID NO. 73;

or, FR1 shown by SEQ ID NO.57, FR2 shown by SEQ ID NO.64, FR3 shown by SEQ ID NO.70 and FR4 shown by SEQ ID NO. 73;

or, FR1 shown in SEQ ID NO.56, FR2 shown in SEQ ID NO.64, FR3 shown in SEQ ID NO.71 and FR4 shown in SEQ ID NO. 73;

or FR1 shown in SEQ ID NO.57, FR2 shown in SEQ ID NO.65, FR3 shown in SEQ ID NO.72 and FR4 shown in SEQ ID NO. 73;

or FR1 shown in SEQ ID NO.58, FR2 shown in SEQ ID NO.65, FR3 shown in SEQ ID NO.72 and FR4 shown in SEQ ID NO. 73;

or FR1 shown by SEQ ID NO.59, FR2 shown by SEQ ID NO.65, FR3 shown by SEQ ID NO.72 and FR4 shown by SEQ ID NO. 73.

The amino acid sequence of the single domain antibody provided by the invention is any one of SEQ ID NO.1-SEQ ID NO. 14.

The single domain antibody of the invention can be artificially synthesized, or can be obtained by synthesizing the coding gene and then performing biological expression. For example, the single domain antibody is obtained by performing biological expression using a biological material related to the single domain antibody, and preferably, the biological material is any one of the following:

(a) a nucleic acid molecule encoding a single domain antibody provided by the invention;

(b) an expression cassette comprising the nucleic acid molecule of (a);

(c) a recombinant vector comprising the nucleic acid molecule of (a) or the expression cassette of (b);

(d) a recombinant eukaryotic cell comprising the nucleic acid molecule of (a), the expression cassette of (b), or the recombinant vector of (c);

(e) a recombinant prokaryotic cell comprising the nucleic acid molecule of (a), the expression cassette of (b), or the recombinant vector of (c).

A "nucleotide molecule" may be DNA, such as cDNA or recombinant DNA, or RNA, such as mRNA or hnRNA, etc.

An "expression cassette" comprises a polynucleotide sequence encoding the polypeptide to be expressed (single domain antibody) and sequences controlling its expression such as a promoter and optionally enhancer sequences, including any combination of cis-acting transcriptional control units. Sequences that control the expression of a gene (i.e., its transcription and translation of the transcription product) are often referred to as regulatory units. Most of the regulatory units are located upstream of and operably linked to the coding sequence of the gene. The expression cassette may also contain a downstream 3' untranslated region comprising a polyadenylation site.

The vector of the "recombinant vector" may be a plasmid, a phage or a virus.

The host cell of the "recombinant eukaryotic cell" may be a yeast or mammalian cell, etc.

The host cell of the "recombinant prokaryotic cell" may be a bacterium, an alga or the like.

In preferred embodiments, the nucleotide sequence of the nucleic acid molecule is any one of SEQ ID No.15 to SEQ ID No. 28; alternatively, the nucleotide sequence obtained by deleting one or several amino acid residues from the above-mentioned DNA sequence and/or by carrying out missense mutation of one or several base pairs is a nucleotide sequence derived from and identical to the nucleotide sequence of the present invention as long as the nucleotide sequence encodes and has the activity of the single domain antibody provided by the present invention. Preferably, the nucleic acid molecule is a DNA having more than 75% identity with any one of SEQ ID No.15-SEQ ID No.28 and encoding a single domain antibody provided by the present invention. As used herein, "identity" refers to sequence similarity to a native nucleic acid sequence, and specifically refers to a nucleotide sequence that has 75% or greater, or 85% or greater, or 90% or greater, or 95% or greater identity to a nucleotide sequence of any one of SEQ ID No.15 to SEQ ID No. 28.

The derivative antibody of the single-domain antibody provided by the invention is any one of the following (a) to (e):

(a) single-chain antibodies, comprising the single-domain antibodies provided by the invention;

(b) a fusion antibody comprising a single chain antibody of (a) or a single domain antibody provided by the invention;

(c) fab, containing the single domain antibody provided by the invention;

(d) heavy chain antibodies comprising a single domain antibody provided herein;

(e) an intact antibody comprising a single domain antibody provided by the invention.

The preparation method of the single domain antibody provided by the invention is characterized in that a nucleic acid molecule for encoding the single domain antibody provided by the invention is introduced into a receptor cell to obtain a transgenic cell, and the transgenic cell is cultured to obtain the single domain antibody.

In a preferred embodiment, the recipient cell is a microbial cell or a mammalian cell. Such as E.coli, phage or CHO cells, etc.

The invention also protects the application of any one of the following (a) to (h):

(a) the single domain antibody provided by the invention is applied to the preparation of tumor inhibitors, tumor cell inhibitors, inflammatory disease drugs or autoimmune drugs;

(b) the biological material provided by the invention is applied to the preparation of tumor inhibitors, tumor cell inhibitors, inflammatory disease drugs or autoimmune drugs;

(c) the derivative antibody provided by the invention is applied to the preparation of tumor inhibitors, tumor cell inhibitors, inflammatory disease drugs or autoimmune drugs;

(d) the preparation method provided by the invention is applied to preparing tumor inhibitors, tumor cell inhibitors, inflammatory disease drugs or autoimmune drugs;

(e) the invention provides the application of the single domain antibody in preparing products for inhibiting MMP-9 activity or combining with MMP-9;

(f) the application of the biological material provided by the invention in preparing products for inhibiting the activity of MMP-9 or combining with MMP-9;

(g) the derivative antibody provided by the invention is applied to the preparation of products for inhibiting the activity of MMP-9 or combining with MMP-9;

(h) the preparation method provided by the invention is applied to preparing products for inhibiting the activity of MMP-9 or combining with MMP-9.

The above product can be medicine, etc.; tumors such as primary rectal cancer, gastric cancer, colon cancer, hepatocellular carcinoma and related adenocarcinoma; inflammatory and autoimmune diseases, such as rheumatoid arthritis, crohn's disease and other diseases associated with inflammation.

The primer pair for amplifying the nucleic acid molecule encoding the single-domain antibody provided by the invention also belongs to the protection scope of the invention.

Compared with the prior art, the invention has the beneficial effects that:

the invention uses biological genetic engineering technology to immunize inner Mongolia Alalashan bactrian camel, obtains a single domain antibody with specificity aiming at MMP-9 protein ZnMc structural domain by screening, limits the CDR sequence of the specific complementarity determining region of the single domain antibody, and simultaneously provides a gene sequence for coding the single domain antibody and a host cell capable of expressing the single domain antibody. The single-domain antibody has obvious affinity, has good binding activity through prokaryotic expression, and can replace the traditional monoclonal antibody to quickly express and be used for detecting related proteins.

The method has the following advantages:

(1) the expression system suitable for the single domain antibody is flexible to select, can be expressed in a prokaryotic system and also can be expressed in a eukaryotic system of a yeast cell or a mammalian cell, and the expression cost of the single domain antibody in the prokaryotic expression system is low, so that the later-stage production cost can be reduced.

(2) The single domain antibody is a single domain antibody, so that the multi-combination form of the antibody is simpler to modify, a multivalent and multi-specific antibody can be obtained by simply connecting the single domain antibody in series in a genetic engineering mode, the immune heterogeneity is very low, and stronger immune response can not be generated under the condition of not carrying out humanized modification.

(3) The single domain antibody has a wider affinity range, and before affinity maturation is carried out, the affinity range of the single domain antibody can be from a nM level to a pM level, so that multiple choices are provided for later antibodies with different purposes.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is an SDS-PAGE analysis picture of purified MMP9 protein and ZnMc protein expressed by the same company by itself in example 1 of the present invention;

FIG. 2 is a graph showing the results of fragment insertion rate analysis of the constructed nanobody library in example 1 of the present invention;

FIG. 3 is the data of target-specific panning of quality control-compliant libraries in example 2 of the present invention;

FIG. 4 is a SDS-PAGE analysis graph of the purification after expression of nanobody specific to MMP9 protein in example 4 of the present invention;

FIG. 5 shows the result of preliminary antigen affinity identification of the nanobody after obtaining the purified nanobody in example 9 of the present invention;

FIG. 6 is a diagram showing the multiple cloning sites of the fusion antibody expression vector in example 10 of the present invention.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer.

Unless otherwise defined, technical and scientific terms used herein have the same meaning as is familiar to those skilled in the art. In addition, any methods or materials similar or equivalent to those described herein can also be used in the present invention.

The invention is further illustrated by the following specific examples, which, however, are to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever.

Example 1: construction of a single domain antibody library against the MMP-9 protein:

(1) mixing 1mg protein ZnMc of MMP-9 zinc ion binding domain with equal volume of Freund's complete adjuvant (the purity detection result of the protein for immunization is shown in figure 1), immunizing one inner Mongolia Alaran bactrian camel, after the first immunization, mixing the protein ZnMc with equal volume of Freund's incomplete adjuvant for immunization, immunizing once per week, continuously immunizing for 4 times again, and continuously immunizing for 5 times in total; then, animals are immunized 6 th and 7 th times by mixing 1mg of MMP-9 full-length protein with equal volume of Freund's incomplete adjuvant, the immunization process is to intensively stimulate camels to generate antibodies aiming at a ZnMc structural domain, the structural domain can activate the metalloprotease activity of MMP-9 after being combined with Zn, and the obtained antibodies can block the binding of MMP-9 and Zn, namely, the protease activity of the antibodies can be blocked, so that the downstream signal path is influenced.

(2) After animal immunization is finished, extracting 150mL of camel peripheral blood lymphocytes and RNA of the cells, synthesizing cDNA by using the extracted total RNA, amplifying VHH (heavy chain antibody variable region) by using the cDNA as a template through nested PCR reaction, respectively carrying out enzyme digestion on a pMECS vector and a VHH fragment by using restriction enzymes, and then linking the enzyme digested fragment with the vector to obtain a recombinant vector.

(3) The ligated fragments were spotted into competent cells TG1, a phage display library of MMP-9 protein was constructed and the library size was determined to be about 1X 10⁹Meanwhile, the correct insertion rate of the library in the target fragment is tested by colony PCR identification, the result is shown in FIG. 2, the data in the figure is the result of PCR identification of 30 randomly selected clones in the library by using phage vector specific primers in the library after the library construction is completed, and the purpose is to test the correct insertion rate of the library in order to detectThe insertion rate of the correct fragment size of the phage vector in the library is measured, the positive result band size is about 600bp, no band exists, and the band is>750bp or<All 400bp were considered as negative clones. In this figure, Negative Control is a PCR reaction performed without the addition of a template; VHH1-30 was a PCR reaction performed with 30 randomly selected clones shaken and then with the bacterial solution as template. As can be seen from the figure, the correct insertion rate reaches 96.7%.

Example 2: screening of single domain antibodies against the MMP-9 protein:

(1) culturing 200 μ L of recombinant TG1 cells in 2 × TY culture medium, adding 40 μ L of helper phage VCSM13 to infect TG1 cells, culturing overnight to amplify phage, precipitating phage with PEG/NaCl the next day, centrifuging, and collecting amplified phage;

(2) NaHCO diluted at 100mM pH 8.3₃500 mu g of ZnMc protein in the reagent is coupled on an enzyme label plate, is placed at 4 ℃ overnight, and is simultaneously provided with a negative control hole;

(3) adding 200 μ L of 3% skimmed milk the next day, sealing at room temperature for 2 hr;

(4) after the end of blocking, 100. mu.l of the amplified phage library (approx.2X 10) was added¹¹Individual phage particles), and reacting for 1h at room temperature;

(5) after 1 hour of action, wash 5 times with PBS + 0.05% Tween-20 to wash away unbound phage;

(6) the phage specifically combined with the ZnMc structural domain protein is dissociated by trypsin with the final concentration of 25mg/mL, escherichia coli TG1 cells in the logarithmic growth phase are infected, the cells are cultured for 1h at 37 ℃, the phage are generated and collected for the next round of screening, the same screening process is repeated for 1 round to gradually obtain enrichment, when the enrichment multiple reaches more than 10 times, MMP9 full-length protein is adopted for the third round to enrich until the enrichment multiple reaches more than 10 times, the enrichment effect is shown in figure 3, the figure is the result of enriching the target protein of the library in a biological panning mode on the basis of phage display technology after the correct size fragment insertion rate of the library is qualified (generally > 85%). In the figure, 1-3Round means that three rounds of panning are performed, and each Round of panning generates two enrichment parameters, namely P/N and I/E, wherein P/N refers to the ratio of the number of monoclonals which can grow after the phage eluted from the positive hole and the negative hole infect escherichia coli, I/E refers to the ratio of the phage added to the number of eluted phage in each Round of panning, P/N should become larger after enrichment occurs, and I/E should gradually approach 1 after enrichment occurs.

Example 3: screening of specific positive clones for MMP-9 by phage enzyme-linked immunosorbent assay (ELISA):

(1) carrying out 3 rounds of screening on MMP-9 protein according to the single domain antibody screening method, after screening is finished, aiming at that the phage enrichment factor of the MMP-9 protein reaches more than 10 (about 10000), selecting 400 single colonies from positive clones obtained by screening, respectively inoculating the single colonies into a 96 deep-well plate of a TB culture medium containing 100 mu g/mL ampicillin, setting a blank control, culturing at 37 ℃ until the logarithmic phase, adding IPTG (isopropyl thiogalactoside) with the final concentration of 1mM, and culturing at 28 ℃ overnight;

(2) obtaining a crude antibody by using a permeation cracking method; the MMP-9 full-length protein and ZnMc protein were diluted separately to 100mM NaHCO pH 8.3₃Neutralizing and coating 100 ug protein in enzyme label plate at 4 deg.C overnight;

(3) transferring 100 mu L of the crude antibody extract obtained in the step to an ELISA plate added with an antigen, and incubating for 1h at room temperature;

(4) unbound antibody was washed away with PBST, 100. mu.l of Mouse anti-HA tagatoside (Mouse anti-HA antibody, Thermo Fisher) diluted at 1:2000 was added, and incubated at room temperature for 1 h;

(5) unbound antibody was washed away with PBST, 100. mu.l of Anti-Rabbit HRPconugate (goat Anti-Rabbit horseradish peroxidase labeled antibody, purchased from Thermo Fisher) diluted at 1:20000 was added, and incubated at room temperature for 1 h;

(6) washing away unbound antibodies by PBST, adding horseradish peroxidase developing solution, reacting at 37 ℃ for 15min, adding a stop solution, and reading an absorption value at a wavelength of 450nm on an enzyme-labeling instrument;

(7) when the OD value of the sample hole is more than 5 times of that of the control hole, judging the sample hole as a positive cloning hole;

(8) the positive colony well was transferred to LB medium containing 100. mu.g/. mu.l ampicillin to extract plasmids and sequence;

(9) the gene sequences of the individual clones were analyzed according to the sequence alignment software VectorNTI, and the strains having the same CDR1, CDR2, and CDR3 sequences were regarded as the same clone, while the strains having different sequences were regarded as different clones, and finally single domain antibodies specific for MMP-9 protein were obtained (the amino acid sequence of the single domain antibody was any one of SEQ ID No.1 to SEQ ID No.14, one clone for each sequence). The amino acid sequence of the antibody is in a structure of FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4, and the whole VHH is formed. The obtained single domain antibody recombinant plasmid can be expressed in a prokaryotic system, and finally single domain antibody protein is obtained.

Example 4: purification and expression of a specific single domain antibody of MMP-9 protein in host bacteria Escherichia coli:

(1) the plasmids (pMECS-VHH) of the different clones obtained by the above sequencing analysis were electrically transformed into E.coli HB2151, spread on LB + amp + glucose, i.e., a culture plate containing ampicillin and glucose, and cultured overnight at 37 ℃;

(2) selecting a single colony to be inoculated in 5mL LB culture solution containing shore penicillin, and carrying out shake culture at 37 ℃ overnight;

(3) inoculating 1mL of overnight cultured strain to 330mL of TB culture medium, shake culturing at 37 deg.C, and culturing to OD_600nmAdding 1M IPTG when the value reaches 0.6-0.9, and carrying out shake culture at 28 ℃ overnight;

(4) centrifuging, collecting Escherichia coli, and obtaining crude antibody extractive solution by use of osmotic bursting method;

(5) the antibody was purified by nickel column affinity chromatography, and the purified single domain antibody was shown in FIG. 4.

Example 5: construction of an Fc fusion antibody eukaryotic expression vector of a specific single domain antibody of MMP9 protein:

(1) the target sequence obtained in example 3 was subcloned into eukaryotic expression vectors: the antibody screened out in the example 3 is subjected to Sanger sequencing to obtain a nucleotide sequence;

(2) the nucleotide sequence after codon optimization is synthesized into a carrier RJK-V4-hFC designed and modified by the company by a sequence synthesis mode, and the modification method of the carrier is as described in example 10; the single domain antibody is connected to an expression vector by a double enzyme cutting mode of Xba I/EcoR I on the basis of the RJK-V4-hFc vector described in example 10;

(3) transforming a recombinant eukaryotic expression vector constructed by a company into DH5 α escherichia coli, culturing, carrying out plasmid macro-extraction, and removing endotoxin;

(4) carrying out sequencing identification on the greatly extracted plasmid;

(5) and preparing the recombinant vector which is determined to be error-free for subsequent eukaryotic cell transfection expression.

Example 6: fc fusion antibodies of specific single domain antibodies of the MMP-9 protein were expressed in suspension ExpicHO-S cells:

(1) 3 days before transfection at 2.5X 10⁵/ml cell passage and expanded culture ExpCHO-S^TMCells, calculated required cell volume transferred to ExpCHO filled with fresh preheated 120ml (final volume)^TMIn a 500ml shake flask of expression medium; to achieve a cell concentration of about 4X 10⁶-6×10⁶Viable cells/mL;

(2) one day before transfection, ExpicHO-S^TMCell dilution to 3.5X 10⁶Viable cells/mL, cells were cultured overnight;

(3) on the day of transfection, cell density and percentage of viable cells were determined. The cell density before transfection should reach about 7X 10⁶-10×10⁶Viable cells/mL;

(4) with fresh ExpiCHO preheated to 37 ℃^TMExpression media cells were diluted to 6X 10⁶Viable cells/mL. The calculated required cell volume was transferred to ExpicHO containing fresh preheated 100ml (final volume)^TMIn a 500ml shake flask of expression medium;

(5) expifeacmine was mixed by gentle inversion^TMCHO reagent, 3.7ml OptiPRO^TMDilution of Expifeacylamine in culture Medium^TMCHO reagent, swirling or mixing;

(6) with refrigerated 4ml OptiPRO^TMDiluting plasmid DNA with a culture medium, and mixing uniformly;

(7) incubating the Expifactamine CHO/plasmid DNA complex for 1-5 minutes at room temperature, then gently adding the Expifactamine CHO/plasmid DNA complex into the prepared cell suspension, and gently swirling the shake flask in the adding process;

(8) cells were incubated at 37 ℃ with 8% CO₂Carrying out shake culture in humidified air;

(9) day 1 post transfection (18-22 hours later) 600ul Expifeacylamine was added^TMCHO Enhancer and 24ml ExpicCHO feed.

(10) Supernatants were collected approximately 8 days after transfection (cell viability below 70%).

Example 7: expression of Fc fusion antibodies of specific single domain antibodies of MMP-9 protein in 293F cells in suspension:

recombinant single domain antibody expression experimental protocol (taking 500ml shake flask as an example):

(1) 3 days before transfection at 2.5X 10⁵The 293F cells were passaged and expanded in culture and the calculated required cell volume was transferred to a 500ml shake flask containing fresh pre-warmed 120ml (final volume) OPM-293CD05 Medium. The cell concentration is about 2X 10⁶-3×10⁶Viable cells/mL.

(2) On the day of transfection, cell density and percentage of viable cells were determined. The cell density before transfection should reach about 2X 10⁶-3×10⁶Viable cells/mL.

(3) Cells were diluted to 1X 10 with pre-warmed OPM-293CD05 Medium⁶Viable cells/mL. The required cell volume was calculated and transferred to a 500ml shake flask containing fresh pre-warmed 100ml (final volume) of medium.

(4) Diluting PEI (1mg/ml) reagent with 4ml of Opti-MEM medium, and swirling or blowing to mix evenly; the plasmid DNA was diluted with 4ml Opt-MEM medium, vortexed, mixed well, and filtered through a 0.22um filter tip. Incubate at room temperature for 5 min.

(5) Diluted PEI reagent was added to the diluted DNA and mixed by inversion. The PEI/plasmid DNA complex was incubated for 15-20 minutes at room temperature and then gently added to the prepared cell suspension, with gentle swirling of the flask during the addition.

(6) Cells were incubated at 37 ℃ with 5% CO₂120rpm oscillationAnd (5) culturing.

(7) 5ml OPM-CHO PFF05 feed was added at 24h, 72h post transfection.

(8) Supernatants were collected approximately 7 days after transfection (cell viability below 70%).

Example 8: purification of human Fc recombinant Single Domain antibodies

(1) Filtering the protein expression supernatant obtained in example 6 or 7 with a 0.45 μm disposable filter to remove insoluble impurities;

(2) performing affinity chromatography purification on the filtrate by using a Protein purifier, and purifying by using agarose filler coupled with Protein A by utilizing the binding capacity of human-derived Fc and Protein A;

(3) passing the filtrate through a Protein A pre-packed column at a flow rate of 1 mL/min, wherein the target Protein in the filtrate is bound to the packing;

(4) washing the impurity protein bound on the column by low-salt and high-salt buffer solutions;

(5) performing a system of target proteins bound to the column with a low pH buffer;

(6) adding the eluent into Tris-HCl solution with pH9.0 rapidly for neutralization;

(7) dialyzing the neutralized protein solution, performing SDS-PAGE analysis to determine that the protein has a purity of 95% or more and a concentration of 0.5mg/mL or more, and storing at low temperature for later use.

Example 9: ELISA detection of the affinity of recombinant single domain antibodies specific for the MMP9 protein to MMP9

(1) The affinity of the recombinant antibody obtained by purification in example 4 or 8 to MMP9 is preliminarily detected;

(2) the procedure for determining the affinity of the recombinant single domain antibody to MMP9 using the quantified protein was as follows;

(3) coating 100ng/100 μ L of standard BSA sample on ELISA plate;

(4) sealing the coated plate by using skimmed milk powder;

(5) adding the recombinant single domain antibody against BSA obtained in example 4 or 8;

(6) adding a detection antibody (HRP mark) specific to HA label protein or human Fc;

(7) adding a chromogenic substrate TMB;

(8) adding a stop solution to terminate the reaction;

(9) measuring OD₄₅₀As shown in FIG. 5, 14 antibodies were involved in the experiment, and after ELISA detection, the antibodies all had good binding activity with the antigen target, and the P/N Value (P Value/NValue) of clone No. 91 with the lowest binding effect also reached 9.

Example 10: construction of nano antibody eukaryotic expression vector RJK-V4-hFc

The target vector RJK-V4-hFC for the general use of the nano-antibody is modified by fusing an Fc segment in a heavy chain coding sequence (NCBI Accession No.: AB776838.1) of human IgG to an invitrogen commercial vector pCDNA3.4 (vector data link: https:// Assets. thermofisher. com/TFS-Assets/LSG/vitamins/pcdna 3-4 _ topo _ ta _ cl _ kit _ man. pdf), namely the vector comprises a Hinge region (Hinge) CH2 and a CH3 region of IgG heavy chain. The specific modification scheme is as follows:

(1) selecting restriction sites XbaI and AgeI on pcDNA3.4;

(2) introducing a Multiple Cloning Site (MCS) and a 6 XHis tag at the 5 'end and the 3' end of the Fc fragment coding sequence, respectively, by means of overlapping PCR, as shown in FIG. 6;

(3) amplifying the fragment by using a pair of primers with XbaI and AgeI enzyme cutting sites respectively in a PCR mode;

(4) the recombinant DNA fragments in pcDNA3.4 and (3) are digested with restriction enzymes XbaI and AgeI respectively;

(5) and (3) connecting the vector and the insert after enzyme digestion under the action of T4 ligase, then transforming the connection product into escherichia coli, amplifying, sequencing and verifying to obtain the recombinant plasmid.

While particular embodiments of the present invention have been illustrated and described, it would be obvious that various other changes and modifications can be made without departing from the spirit and scope of the invention. It is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention.

SEQUENCE LISTING

<110> Nanjing Congjiekang Biotech Co., Ltd

<120> single domain antibody specifically aiming at ZnMc structural domain of MMP9 protein, product and application

<160>73

<170>PatentIn version 3.5

<210>1

<211>126

<212>PRT

<213> Artificial sequence

<400>1

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Ala Val Ser Gly Tyr Asp Leu Ser

20 25 30

Ser Tyr Cys Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Ala Arg Glu

35 40 45

Gly Val Ala Ala Ile Glu Lys Phe Gly Val Pro Ile Tyr Ala Asp Ser

50 55 60

Val Lys Gly Arg Phe Ala Ala Ser Lys Asp Tyr Ala Lys Asn Thr Val

65 70 75 80

Tyr Leu Gln Met Asn Gly Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr

85 90 95

Cys Ala Ala Asp Arg Tyr Cys Gly Ala Gly Pro Leu Glu Pro Leu Arg

100 105 110

Tyr Arg Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120 125

<210>2

<211>126

<212>PRT

<213> Artificial sequence

<400>2

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala

1 5 10 15

Gly Gly Ser Leu Lys Leu Ser Cys Ala Val Ser Gly Tyr Asp Leu Ser

20 25 30

Ser Tyr Cys Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Ala Arg Glu

35 40 45

Gly Val Ala Ala Ile Glu Lys Phe Gly Val Pro Ile Tyr Ala Asp Ser

50 55 60

Val Lys Gly Arg Phe Ala Ala Ser Lys Asp Tyr Ala Lys Asn Thr Val

65 70 75 80

Tyr Leu Gln Met Asn Gly Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr

85 90 95

Cys Ala Ala Asp Arg Tyr Cys Gly Ala Gly Pro Leu Glu Pro Leu Arg

100 105 110

Tyr Arg Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120 125

<210>3

<211>126

<212>PRT

<213> Artificial sequence

<400>3

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Ala Val Ser Gly Tyr Asp Leu Ser

20 25 30

Ser Tyr Cys Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Ala Arg Glu

35 40 45

Gly Val Ala Ala Ile Glu Lys Phe Gly Val Pro Ile Tyr Ala Asp Ser

50 55 60

Val Lys Gly Arg Phe Ala Ala Ser Lys Asp Tyr Ala Lys Asn Thr Val

6570 75 80

Tyr Leu Gln Met Asn Gly Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr

85 90 95

Cys Ala Ala Asp Arg Tyr Cys Gly Val Gly Pro Leu Glu Pro Leu Arg

100 105 110

Tyr Arg Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120 125

<210>4

<211>128

<212>PRT

<213> Artificial sequence

<400>4

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Thr

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Ser Tyr Thr Phe Ser

20 25 30

Thr Ser Cys Val Ala Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu

35 40 45

Gly Val Ala Gly Ile Leu Phe Asn Gly Leu Thr Ser Tyr Thr Asp Ser

50 55 60

Val Lys Gly Arg Phe Thr Val Ser Lys Asp Asn Ala Lys Asn Thr Leu

65 70 75 80

Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp ThrAla Met Tyr Tyr

85 90 95

Cys Ala Ala Val Ser Ser Pro Ala Gly Cys Leu Ala Pro Leu Arg Ala

100 105 110

Asp Ser Tyr Thr Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120 125

<210>5

<211>126

<212>PRT

<213> Artificial sequence

<400>5

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Pro

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe Ser

20 25 30

Asn Tyr Ala Met Lys Trp Val Arg Gln Ala Pro Gly Lys Glu Leu Glu

35 40 45

Trp Val Ser Ser Ile Asp Asn Gly Gly Ser Gly Thr Ser Tyr Ala Ala

50 55 60

Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr

65 70 75 80

Leu Tyr Leu Gln Leu Asn Ser Leu Lys Thr Glu Asp Thr Ala Met Tyr

85 90 95

Tyr Cys Ala Lys Asp Pro Ala Arg Ser Pro Leu Trp Ala Gly Asn Met

100 105 110

Ala Pro Ala Arg Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120 125

<210>6

<211>126

<212>PRT

<213> Artificial sequence

<400>6

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Pro

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser

20 25 30

Ser Val Ala Met Lys Trp Val Arg Gln Ala Pro Gly Lys Glu Leu Glu

35 40 45

Trp Val Ser Ser Ile Asn Asn Asp Gly Ser Ser Thr Ser Tyr Ala Ala

50 55 60

Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr

65 70 75 80

Leu Tyr Leu Gln Leu Asn Ser Leu Lys Thr Glu Asp Thr Ala Met Tyr

85 90 95

Tyr Cys Ala Lys Asp Pro Ala Arg Ser Pro Leu Trp Ala Gly Asn Val

100 105 110

Thr Pro Ala Arg Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120 125

<210>7

<211>126

<212>PRT

<213> Artificial sequence

<400>7

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Phe Thr Phe Ser

20 25 30

Ser Val Ala Met Lys Trp Val Arg Gln Ala Pro Gly Lys Glu Leu Glu

35 40 45

Trp Val Ser Ser Ile Asn Asn Asp Gly Ser Ser Thr Ser Tyr Ala Ala

50 55 60

Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr

65 70 75 80

Leu Tyr Leu Gln Leu Asn Ser Leu Lys Thr Glu Asp Thr Ala Met Tyr

85 90 95

Tyr Cys Ala Lys Asp Pro Ala Arg Ser Pro Leu Trp Ala Gly Asn Val

100 105 110

Thr Pro Ala Arg Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120 125

<210>8

<211>125

<212>PRT

<213> Artificial sequence

<400>8

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Thr Ala Ser Gly Tyr

20 25 30

Ser Asp Cys Arg Tyr Arg Met Ser Trp Tyr Arg Arg Ala Pro Gly Lys

35 40 45

Glu Arg Glu Phe Val Ser Ser Ile Trp Ser Asp Gly Ser Ile Arg Tyr

50 55 60

Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Gln Asp Asn Ala Lys

65 70 75 80

Asn Thr Met Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala

85 90 95

Met Tyr Phe Cys Lys Ala Asp Leu Ser Ile Trp Ser Gly Arg Cys Pro

100 105 110

Asn Thr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120 125

<210>9

<211>125

<212>PRT

<213> Artificial sequence

<400>9

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Tyr Thr Tyr Cys

20 25 30

Gly Tyr Arg Met Ser Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu

35 40 45

Phe Val Ser Ser Met Arg Ala Asp Gly Ser Thr Ser Tyr Ala Asp Ser

50 55 60

Val Lys Gly Arg Phe Thr Ile Ser Gln Asp Asn Ala Lys Asn Thr Met

65 70 75 80

Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr

85 90 95

Cys Lys Ala Asp Leu Ser Thr Arg Tyr Ser Thr Tyr Ala Asp Cys Pro

100 105 110

Asn Lys Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120 125

<210>10

<211>125

<212>PRT

<213> Artificial sequence

<400>10

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Thr Tyr Cys

20 25 30

Gly Tyr Arg Met Ser Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu

35 40 45

Phe Val Ser Ser Met Arg Ala Asp Gly Ser Thr Ser Tyr Ala Asp Ser

50 55 60

Val Lys Gly Arg Phe Thr Ile Ser Gln Asp Asn Ala Lys Asn Ile Leu

65 70 75 80

Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr

85 90 95

Cys Lys Ala Asp Leu Ser Thr Arg Tyr Ser Thr Tyr Ala Asp Cys Pro

100 105 110

Asn Lys Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120 125

<210>11

<211>124

<212>PRT

<213> Artificial sequence

<400>11

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Tyr Thr Tyr Cys

20 25 30

Gly Tyr Arg Met Ser Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu

35 40 45

Phe Val Ser Ala Ile Arg Gly Asp Gly Ser Thr Ser Tyr Ala Asp Ser

50 55 60

Val Lys Gly Arg Phe Thr Ile Ser Gln Asp Asn Ala Lys Asn Thr Val

65 70 75 80

Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr

85 90 95

Cys Lys Ala Asp His Ser Trp Asp Phe Thr Pro Arg Cys Pro Thr Gln

100 105 110

Ile Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120

<210>12

<211>124

<212>PRT

<213> Artificial sequence

<400>12

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala

15 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Tyr Thr Tyr Cys

20 25 30

Gly Tyr Arg Met Ser Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu

35 40 45

Phe Val Ser Ala Ile Arg Gly Asp Gly Ser Thr Ser Tyr Ala Asp Ser

50 55 60

Val Lys Gly Arg Phe Thr Ile Ser Gln Asp Asn Ala Lys Asn Thr Val

65 70 75 80

Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr

85 90 95

Cys Lys Ala Asp His Ser Trp Asp Phe Thr Pro Arg Cys Pro Thr Ser

100 105 110

Ile Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120

<210>13

<211>124

<212>PRT

<213> Artificial sequence

<400>13

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala

1 5 10 15

Gly Glu Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Tyr Thr Tyr Cys

20 25 30

Gly Tyr Arg Met Ser Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu

35 40 45

Phe Val Ser Ala Ile Arg Gly Asp Gly Ser Thr Ser Tyr Ala Asp Ser

50 55 60

Val Lys Gly Arg Phe Thr Ile Ser Gln Asp Asn Ala Lys Asn Thr Val

65 70 75 80

Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr

85 90 95

Cys Lys Ala Asp His Ser Trp Asp Phe Thr Pro Arg Cys Pro Thr Ser

100 105 110

Ile Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120

<210>14

<211>124

<212>PRT

<213> Artificial sequence

<400>14

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ser

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Tyr Thr Tyr Cys

20 25 30

Gly Tyr Arg Met Ser Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu

35 40 45

Phe Val Ser Ala Ile Arg Gly Asp Gly Ser Thr Ser Tyr Ala Asp Ser

50 55 60

Val Lys Gly Arg Phe Thr Ile Ser Gln Asp Asn Ala Lys Asn Thr Val

65 70 75 80

Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr

85 90 95

Cys Lys Ala Asp His Ser Trp Asp Phe Thr Pro Arg Cys Pro Thr Ser

100 105 110

Ile Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser

115 120

<210>15

<211>378

<212>DNA

<213> Artificial sequence

<400>15

atggcccagg tgcagctgca ggagtctggg ggaggctcgg tgcaggctgg agggtctctg 60

agactctcct gtgcagtctc tggatacgac ctcagtagct actgcatggg ctggttccgc 120

caggctccag ggaaggcgcg cgagggggtc gcggctatag agaaatttgg cgtcccaata 180

tacgctgact ccgtgaaggg ccgattcgcc gcctccaaag actacgccaa gaacacggtg 240

tatctgcaaa tgaacggcct gaaacctgag gacactgcca tgtactactg tgcggcagat 300

cgttactgcg gggcgggccc gctggagccc ctgcggtatc gctactgggg ccaggggacc 360

caggtcaccg tctcctca 378

<210>16

<211>378

<212>DNA

<213> Artificial sequence

<400>16

atggcccagg tgcagctgca ggagtctgga ggaggctcgg tgcaggctgg agggtctctg 60

aaactctcct gtgcagtctc tggatacgac ctcagtagct actgcatggg ctggttccgc 120

caggctccag ggaaggcgcg cgagggggtc gcggctatag agaaatttgg cgtcccaata 180

tacgctgact ccgtgaaggg ccgattcgcc gcctccaaag actacgccaa gaacacggtg 240

tatctgcaaa tgaacggcct gaaacctgag gacactgcca tgtactactg tgcggcagat 300

cgttactgcg gggcgggccc gctggagccc ctgcggtatc gctactgggg ccaggggacc 360

caggtcaccg tctcctca 378

<210>17

<211>378

<212>DNA

<213> Artificial sequence

<400>17

atggcccagg tgcagctgca ggagtctggg ggaggctcgg tgcaggctgg agggtctctg 60

agactctcct gtgcagtctc tggatacgac ctcagtagct actgcatggg ctggttccgc 120

caggctccag ggaaggcgcg cgagggggtc gcggctatag agaaatttgg cgtcccaata 180

tacgctgact ccgtgaaggg ccgattcgcc gcctccaaag actacgccaa gaacacggtg 240

tatctgcaaa tgaacggcct gaaacctgag gacactgcca tgtactactg tgcggcagat 300

cgttactgcg gggtgggcccgctggagccc ctgcggtatc gctactgggg ccaggggacc 360

caggtcaccg tctcctca 378

<210>18

<211>384

<212>DNA

<213> Artificial sequence

<400>18

atggcccagg tgcagctgca ggagtctgga ggaggctcgg tgcagactgg agggtctctg 60

agactctcct gtgcagcctc ttcatacacc ttcagtacta gctgcgtggc ctggttccgc 120

caggctccag ggaaggagcg cgagggggtc gcaggtattc ttttcaatgg tctcacgagc 180

tacacagact ccgtgaaggg ccgattcacc gtctccaaag acaacgccaa gaacactctg 240

tatctgcaaa tgaacagcct gaaacctgag gacactgcca tgtactactg tgcggctgtt 300

tcgtcccccg cagggtgctt agcgccacta agggcggact cgtatacgta ctggggccag 360

gggacccagg tcaccgtctc ctca 384

<210>19

<211>378

<212>DNA

<213> Artificial sequence

<400>19

atggcccagg tgcagctgca ggagtctgga ggaggcttgg tgcagcctgg ggggtctctg 60

agactctcct gcgcagcgtc tggattctcc ttcagtaact atgctatgaa gtgggtccgc 120

caggctccag ggaaggaact cgagtgggtc tcgtctatag ataatggtgg tagtggcaca 180

tcttatgcag cctccgtgaa gggccgattc accatctcca gagacaacgc caagaacacg 240

ctgtatctgc aattgaacag cctgaaaact gaggacacgg ctatgtatta ctgtgcaaaa 300

gacccggcaa ggagtcccct atgggccgga aacatggccc ccgcgagggg ccaggggacc 360

caggtcaccg tctcctca 378

<210>20

<211>378

<212>DNA

<213> Artificial sequence

<400>20

atggcccagg tgcagctgca ggagtctggg ggaggcttgg tgcagcctgg ggggtctctg 60

agactctcct gtgcagcgtc tggattcacc ttcagtagcg ttgctatgaa gtgggtccgc 120

caggctccag ggaaggaact cgagtgggtc tcgtctatta ataatgatgg tagtagtaca 180

tcgtatgcag cctccgtgaa gggccgattc accatctcca gagacaacgc caagaacacg 240

ctgtatctgc aattgaacag cctgaaaact gaggacacgg ccatgtatta ctgtgcaaaa 300

gacccggcaa ggagtcccct atgggctgga aacgtgaccc ccgcgagggg ccaggggacc 360

caggtcaccg tctcctca 378

<210>21

<211>378

<212>DNA

<213> Artificial sequence

<400>21

atggcccagg tgcagctgca ggagtctggg ggaggcttgg tgcaggcagg ggggtctctg 60

agactctcct gtacagcgtc tggattcacc ttcagtagcg ttgctatgaa gtgggtccgc 120

caggctccag ggaaggaact cgagtgggtc tcgtctatta ataatgatgg tagtagtaca 180

tcgtatgcag cctccgtgaa gggccgattc accatctcca gagacaacgc caagaacacg 240

ctgtatctgc aattgaacag cctgaaaact gaggacacgg ccatgtatta ctgtgcaaaa 300

gacccggcaa ggagtcccct atgggctgga aacgtgaccc ccgcgagggg ccaggggacc 360

caggtcaccg tctcctca 378

<210>22

<211>375

<212>DNA

<213> Artificial sequence

<400>22

atggcccagg tgcagctgca ggagtctggg ggaggctcgg tgcaggctgg agggtctctg 60

agactctcct gtgcagcctc taccgcctct ggatatagcg actgtaggta ccgcatgagc 120

tggtaccgcc gggctccagg gaaggagcgc gagttcgtct cctccatatg gagtgatggt 180

agcataaggt acgcagactc cgtgaagggc cgattcacca tctcccaaga caacgccaag 240

aacacaatgt atctgcaaat gaacagcctg aaacctgagg acacggccat gtatttctgt 300

aaagcagatc tcagcatttg gagtggtagg tgccctaata cctggggcca ggggacccag 360

gtcaccgtct cctca 375

<210>23

<211>375

<212>DNA

<213> Artificial sequence

<400>23

atggcccagg tgcagctgca ggagtctggg ggaggctcgg tgcaggctgg agggtctctg 60

agactctcct gtgtagcctc tggatacacc tactgtgggt accgcatgag ctggtaccgc 120

caggctccag ggaaggagcg cgagttcgtc tcgtctatgc gtgccgatgg ctccacaagc 180

tacgcagact ccgtgaaggg ccgattcacc atctcccaag acaacgccaa gaacacaatg 240

tatctgcaaa tgaacagcct gaaacctgag gacacggcca tgtattactg taaagctgat 300

ctcagcaccc ggtacagtac ttatgcggac tgccctaaca agtggggcca ggggacccag 360

gtcaccgtct cctca 375

<210>24

<211>375

<212>DNA

<213> Artificial sequence

<400>24

atggcccagg tgcagctgca ggagtctggg ggaggctcgg tgcaggctgg agggtctctg 60

agactctcct gtgcagcctc tggatacacc tactgtgggt accgcatgag ctggtaccgc 120

caggctccag ggaaggagcg cgagttcgtc tcgtctatgc gtgccgatgg ctccacaagc 180

tacgcagact ccgtgaaggg ccgattcacc atctcccaag acaacgccaa gaacatcctg 240

tatctgcaaa tgaacagcct gaaacctgag gacacggcca tgtattactg taaagcagat 300

ctcagcaccc ggtacagtac ttatgcggac tgccctaaca agtggggcca ggggacccag 360

gtcaccgtct cctca 375

<210>25

<211>372

<212>DNA

<213> Artificial sequence

<400>25

atggcccagg tgcagctgca ggagtctgga ggaggctcgg tgcaggctgg agggtctctg 60

agactctcct gtgtagcctc tggatacacc tactgtggct accgcatgag ctggtaccgc 120

caggctccag ggaaggagcg cgagttcgtc tcagctattc gtggtgatgg tagtacaagt 180

tacgcagact ccgtgaaggg ccgattcacc atctcccaag acaacgccaa gaacacggtg 240

tacctgcaaa tgaacagcct gaaacctgag gacacggcca tgtattactgtaaagcagac 300

cactcatggg acttcacgcc aaggtgccct actcaaatct ggggccaggg gacccaggtc 360

accgtctcct ca 372

<210>26

<211>372

<212>DNA

<213> Artificial sequence

<400>26

atggcccagg tgcagctgca ggagtctggg ggaggctcgg tgcaggctgg agggtctctg 60

agactctcct gtgtagcctc tggatacacc tactgtggct accgcatgag ctggtaccgc 120

caggctccag ggaaggagcg cgagttcgtc tcagctattc gtggtgatgg tagtacaagt 180

tacgcagact ccgtgaaggg ccgattcacc atctcccaag acaacgccaa gaacacggtg 240

tacctgcaaa tgaacagcct gaaacctgag gacacggcca tgtattactg taaagcagac 300

cactcatggg acttcacgcc aaggtgccct acttcgatct ggggccaggg gacccaggtc 360

accgtctcct ca 372

<210>27

<211>372

<212>DNA

<213> Artificial sequence

<400>27

atggcccagg tgcagctgca ggagtctggg ggaggctcgg tgcaggctgg ggagtctctg 60

agactctcct gtgtagcctc tggatacacc tactgtggct accgcatgag ctggtaccgc 120

caggctccag ggaaggagcg cgagttcgtc tcagctattc gtggtgatgg tagtacaagt 180

tacgcagact ccgtgaaggg ccgattcacc atctcccaag acaacgccaa gaacacggtg 240

tacctgcaaa tgaacagcct gaaacctgag gacacggcca tgtattactg taaagcagac 300

cactcatggg acttcacgcc aaggtgccct acttcgatct ggggccaggg gacccaggtc 360

accgtctcct ca 372

<210>28

<211>372

<212>DNA

<213> Artificial sequence

<400>28

atggcccagg tgcagctgca ggagtctggg ggaggctcgg tgcagtctgg agggtctctg 60

agactctcct gtgtagcctc tggatacacc tactgtggct accgcatgag ctggtaccgc 120

caggctccag ggaaggagcg cgagttcgtc tcagctattc gtggtgatgg tagtacaagt 180

tacgcagact ccgtgaaggg ccgattcacc atctcccaag acaacgccaa gaacacggtg 240

tacctgcaaa tgaacagcct gaaacctgag gacacggcca tgtattactg taaagcagac 300

cactcatggg acttcacgcc aaggtgccct acttcgatct ggggccaggg gacccaggtc 360

accgtctcct ca 372

<210>29

<211>8

<212>PRT

<213> Artificial sequence

<400>29

Gly Tyr Asp Leu Ser Ser Tyr Cys

1 5

<210>30

<211>8

<212>PRT

<213> Artificial sequence

<400>30

Ser Tyr Thr Phe Ser Thr Ser Cys

1 5

<210>31

<211>8

<212>PRT

<213> Artificial sequence

<400>31

Gly Phe Ser Phe Ser Asn Tyr Ala

1 5

<210>32

<211>8

<212>PRT

<213> Artificial sequence

<400>32

Gly Phe Thr Phe Ser Ser Val Ala

1 5

<210>33

<211>11

<212>PRT

<213> Artificial sequence

<400>33

Thr Ala Ser Gly Tyr Ser Asp Cys Arg Tyr Arg

1 5 10

<210>34

<211>8

<212>PRT

<213> Artificial sequence

<400>34

Gly Tyr Thr Tyr Cys Gly Tyr Arg

1 5

<210>35

<211>7

<212>PRT

<213> Artificial sequence

<400>35

Ile Glu Lys Phe Gly Val Pro

1 5

<210>36

<211>7

<212>PRT

<213> Artificial sequence

<400>36

Ile Leu Phe Asn Gly Leu Thr

1 5

<210>37

<211>8

<212>PRT

<213> Artificial sequence

<400>37

Ile Asp Asn Gly Gly Ser Gly Thr

1 5

<210>38

<211>8

<212>PRT

<213> Artificial sequence

<400>38

Ile Asn Asn Asp Gly Ser Ser Thr

1 5

<210>39

<211>7

<212>PRT

<213> Artificial sequence

<400>39

Ile Trp Ser Asp Gly Ser Ile

1 5

<210>40

<211>7

<212>PRT

<213> Artificial sequence

<400>40

Met Arg Ala Asp Gly Ser Thr

1 5

<210>41

<211>7

<212>PRT

<213> Artificial sequence

<400>41

Ile Arg Gly Asp Gly Ser Thr

1 5

<210>42

<211>19

<212>PRT

<213> Artificial sequence

<400>42

Ala Ala Asp Arg Tyr Cys Gly Ala Gly Pro Leu Glu Pro Leu Arg Tyr

1 5 10 15

Arg Tyr Trp

<210>43

<211>19

<212>PRT

<213> Artificial sequence

<400>43

Ala Ala Asp Arg Tyr Cys Gly Val Gly Pro Leu Glu Pro Leu Arg Tyr

1 5 10 15

Arg Tyr Trp

<210>44

<211>21

<212>PRT

<213> Artificial sequence

<400>44

Ala Ala Val Ser Ser Pro Ala Gly Cys Leu Ala Pro Leu Arg Ala Asp

1 5 10 15

Ser Tyr Thr Tyr Trp

20

<210>45

<211>18

<212>PRT

<213> Artificial sequence

<400>45

Ala Lys Asp Pro Ala Arg Ser Pro Leu Trp Ala Gly Asn Met Ala Pro

1 5 10 15

Ala Arg

<210>46

<211>18

<212>PRT

<213> Artificial sequence

<400>46

Ala Lys Asp Pro Ala Arg Ser Pro Leu Trp Ala Gly Asn Val Thr Pro

1 5 10 15

Ala Arg

<210>47

<211>25

<212>PRT

<213> Artificial sequence

<400>47

Lys Ala Asp Leu Ser Ile Trp Ser Gly Arg Cys Pro Asn Thr Trp Gly

1 5 10 15

Gln Gly Thr Gln Val Thr Val Ser Ser

20 25

<210>48

<211>18

<212>PRT

<213> Artificial sequence

<400>48

Lys Ala Asp Leu Ser Thr Arg Tyr Ser Thr Tyr Ala Asp Cys Pro Asn

1 5 10 15

Lys Trp

<210>49

<211>17

<212>PRT

<213> Artificial sequence

<400>49

Lys Ala Asp His Ser Trp Asp Phe Thr Pro Arg Cys Pro Thr Gln Ile

1 5 10 15

Trp

<210>50

<211>17

<212>PRT

<213> Artificial sequence

<400>50

Lys Ala Asp His Ser Trp Asp Phe Thr Pro Arg Cys Pro Thr Ser Ile

1 5 10 15

Trp

<210>51

<211>27

<212>PRT

<213> Artificial sequence

<400>51

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Ala Val Ser

20 25

<210>52

<211>27

<212>PRT

<213> Artificial sequence

<400>52

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala

1 5 10 15

Gly Gly Ser Leu Lys Leu Ser Cys Ala Val Ser

20 25

<210>53

<211>27

<212>PRT

<213> Artificial sequence

<400>53

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Thr

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser

20 25

<210>54

<211>27

<212>PRT

<213> Artificial sequence

<400>54

Met Ala Gln Val Gln Leu Gln GluSer Gly Gly Gly Leu Val Gln Pro

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser

20 25

<210>55

<211>27

<212>PRT

<213> Artificial sequence

<400>55

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Thr Ala Ser

20 25

<210>56

<211>27

<212>PRT

<213> Artificial sequence

<400>56

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser

20 25

<210>57

<211>27

<212>PRT

<213> Artificial sequence

<400>57

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Val Ala Ser

20 25

<210>58

<211>27

<212>PRT

<213> Artificial sequence

<400>58

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala

1 5 10 15

Gly Glu Ser Leu Arg Leu Ser Cys Val Ala Ser

20 25

<210>59

<211>27

<212>PRT

<213> Artificial sequence

<400>59

Met Ala Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ser

1 5 10 15

Gly Gly Ser Leu Arg Leu Ser Cys Val Ala Ser

20 25

<210>60

<211>17

<212>PRT

<213> Artificial sequence

<400>60

Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Ala Arg Glu Gly Val Ala

1 510 15

Ala

<210>61

<211>17

<212>PRT

<213> Artificial sequence

<400>61

Val Ala Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val Ala

1 5 10 15

Gly

<210>62

<211>17

<212>PRT

<213> Artificial sequence

<400>62

Met Lys Trp Val Arg Gln Ala Pro Gly Lys Glu Leu Glu Trp Val Ser

1 5 10 15

Ser

<210>63

<211>17

<212>PRT

<213> Artificial sequence

<400>63

Met Ser Trp Tyr Arg Arg Ala Pro Gly Lys Glu Arg Glu Phe Val Ser

1 5 10 15

Ser

<210>64

<211>17

<212>PRT

<213> Artificial sequence

<400>64

Met Ser Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val Ser

1 5 10 15

Ser

<210>65

<211>17

<212>PRT

<213> Artificial sequence

<400>65

Met Ser Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val Ser

1 5 10 15

Ala

<210>66

<211>38

<212>PRT

<213> Artificial sequence

<400>66

Ile Tyr Ala Asp Ser Val Lys Gly Arg Phe Ala Ala Ser Lys Asp Tyr

1 5 10 15

Ala Lys Asn Thr Val Tyr Leu Gln Met Asn Gly Leu Lys Pro Glu Asp

20 25 30

Thr Ala Met Tyr Tyr Cys

35

<210>67

<211>38

<212>PRT

<213> Artificial sequence

<400>67

Ser Tyr Thr Asp Ser Val Lys Gly Arg Phe Thr Val Ser Lys Asp Asn

15 10 15

Ala Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp

20 25 30

Thr Ala Met Tyr Tyr Cys

35

<210>68

<211>38

<212>PRT

<213> Artificial sequence

<400>68

Ser Tyr Ala Ala Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn

1 5 10 15

Ala Lys Asn Thr Leu Tyr Leu Gln Leu Asn Ser Leu Lys Thr Glu Asp

20 25 30

Thr Ala Met Tyr Tyr Cys

35

<210>69

<211>38

<212>PRT

<213> Artificial sequence

<400>69

Arg Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Gln Asp Asn

1 5 10 15

Ala Lys Asn Thr Met Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp

20 25 30

Thr Ala Met Tyr Phe Cys

35

<210>70

<211>38

<212>PRT

<213> Artificial sequence

<400>70

Ser Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Gln Asp Asn

1 5 10 15

Ala Lys Asn Thr Met Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp

20 25 30

Thr Ala Met Tyr Tyr Cys

35

<210>71

<211>38

<212>PRT

<213> Artificial sequence

<400>71

Ser Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Gln Asp Asn

1 5 10 15

Ala Lys Asn Ile Leu Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp

20 25 30

Thr Ala Met Tyr Tyr Cys

35

<210>72

<211>38

<212>PRT

<213> Artificial sequence

<400>72

Ser Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Gln Asp Asn

1 5 10 15

Ala Lys Asn Thr Val Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp

20 25 30

Thr Ala Met Tyr Tyr Cys

35

<210>73

<211>10

<212>PRT

<213> Artificial sequence

<400>73

Gly Gln Gly Thr Gln Val Thr Val Ser Ser

1 5 10

Claims

1. A single domain antibody specific for the ZnMc domain of the MMP9 protein, characterized in that it comprises complementarity determining region CDRs comprising CDR1, CDR2 and CDR 3;

the amino acid sequence of the CDR1 is any one of SEQ ID NO.29-SEQ ID NO. 34;

the amino acid sequence of the CDR2 is any one of SEQ ID NO.35-SEQ ID NO. 41;

the amino acid sequence of the CDR3 is any one of SEQ ID NO.42-SEQ ID NO. 50.

2. The single domain antibody of claim 1, wherein the CDR of the single domain antibody is as follows:

or, CDR1 shown in SEQ ID NO.30, CDR2 shown in SEQ ID NO.36 and CDR3 shown in SEQ ID NO. 44;

3. The single domain antibody of claim 2, further comprising a framework region FR;

preferably, the framework regions FR include FR1, FR2, FR3 and FR 4;

the amino acid sequence of FR1 is any one of SEQ ID NO.51-SEQ ID NO. 59;

the amino acid sequence of FR2 is any one of SEQ ID NO.60-SEQ ID NO. 65;

the amino acid sequence of FR3 is any one of SEQ ID NO.66-SEQ ID NO. 72;

the amino acid sequence of FR4 is SEQ ID NO. 73;

preferably, the framework regions FR are as follows:

or FR1 shown in SEQ ID NO.52, FR2 shown in SEQ ID NO.60, FR3 shown in SEQ ID NO.66 and FR4 shown in SEQ ID NO. 73;

or FR1 shown in SEQ ID NO.53, FR2 shown in SEQ ID NO.61, FR3 shown in SEQ ID NO.67 and FR4 shown in SEQ ID NO. 73;

or FR1 shown in SEQ ID NO.54, FR2 shown in SEQ ID NO.62, FR3 shown in SEQ ID NO.68 and FR4 shown in SEQ ID NO. 73;

or FR1 shown in SEQ ID NO.55, FR2 shown in SEQ ID NO.62, FR3 shown in SEQ ID NO.68 and FR4 shown in SEQ ID NO. 73;

or FR1 shown in SEQ ID NO.56, FR2 shown in SEQ ID NO.63, FR3 shown in SEQ ID NO.69 and FR4 shown in SEQ ID NO. 73;

or FR1 shown in SEQ ID NO.57, FR2 shown in SEQ ID NO.64, FR3 shown in SEQ ID NO.70 and FR4 shown in SEQ ID NO. 73;

or FR1 shown in SEQ ID NO.56, FR2 shown in SEQ ID NO.64, FR3 shown in SEQ ID NO.71 and FR4 shown in SEQ ID NO. 73;

or FR1 shown in SEQ ID NO.59, FR2 shown in SEQ ID NO.65, FR3 shown in SEQ ID NO.72 and FR4 shown in SEQ ID NO. 73.

4. The single domain antibody of any one of claims 1 to 3, characterized in that the amino acid sequence of said single domain antibody is any one of SEQ ID No.1 to SEQ ID No. 14.

5. A biological material associated with the single domain antibody of any one of claims 1 to 4, wherein the biological material is any one of:

(a) a nucleic acid molecule encoding the single domain antibody of any one of claims 1-4;

(b) an expression cassette comprising the nucleic acid molecule of (a);

6. A biomaterial according to claim 5, wherein the nucleic acid molecule is as defined in (a) or (b):

(a) the nucleotide sequence is any one of SEQ ID NO.15-SEQ ID NO. 28;

(b) DNA having 75% or more identity to the nucleotide sequence defined in (a) and encoding the single domain antibody of any one of claims 1 to 4.

7. The derivative antibody of the single domain antibody of any one of claims 1 to 4, wherein said derivative antibody is any one of (a) to (e) below:

(a) a single chain antibody comprising the single domain antibody of any one of claims 1-4;

(b) a fusion antibody comprising a single chain antibody of (a) or a single domain antibody of any one of claims 1-4;

(c) a Fab comprising the single domain antibody of any one of claims 1-4;

(d) a heavy chain antibody comprising a single domain antibody of any one of claims 1-4;

(e) a whole antibody comprising a single domain antibody according to any one of claims 1 to 4.

8. The method for producing a single domain antibody according to any one of claims 1 to 4, wherein a nucleic acid molecule encoding the single domain antibody according to any one of claims 1 to 4 is introduced into a recipient cell to obtain a transgenic cell, and the transgenic cell is cultured to obtain the single domain antibody.

9. The method according to claim 8, wherein the recipient cell is a microbial cell or a mammalian cell.

10. The use of any one of the following (a) to (h):

(a) use of a single domain antibody according to any one of claims 1 to 4 in the manufacture of a tumor suppressor, a tumor cell suppressor, an agent for inflammatory diseases or an agent for autoimmune diseases;

(b) use of the biomaterial of claim 5 or 6 in the preparation of a tumor suppressor, a tumor cell suppressor, a medicament for inflammatory diseases or a medicament for autoimmune diseases;

(c) use of the derivatized antibody of claim 7 for the preparation of a tumor suppressor, a tumor cell suppressor, a drug for inflammatory diseases, or a drug for autoimmune diseases;

(d) the use of the process according to claim 8 or 9 for the preparation of a tumor suppressor, a tumor cell suppressor, a medicament for inflammatory diseases or a medicament for autoimmune diseases;

(e) use of a single domain antibody according to any one of claims 1 to 4 in the manufacture of a product for inhibiting MMP-9 activity or binding to MMP-9;

(f) use of a biomaterial according to claim 5 or 6 in the manufacture of a product for inhibiting MMP-9 activity or binding to MMP-9;

(g) use of a derivatized antibody according to claim 7 for the preparation of a product inhibiting MMP-9 activity or binding to MMP-9;

(h) use of the process of claim 8 or 9 for the preparation of a product for inhibiting MMP-9 activity or binding to MMP-9.