WO2022110742A1 - Humanized antibody against novel coronavirus-specific antigenic peptides, preparation method and use - Google Patents

Abstract

The present disclosure relates to a humanized antibody against novel coronavirus-specific antigenic peptides, a preparation method and the use. In particular, the present disclosure relates to an anti-SARS-CoV-2 antibody or an antigen-binding fragment thereof, and the use thereof in the diagnosis of diseases, the preparation of a COVID-19 vaccine, and the preparation of a medicament for preventing and treating COVID-19. The anti-SARS-CoV-2 antibody or the antigen-binding fragment thereof of the present disclosure can bind to the RBD domain of the novel coronavirus and block the invasion of cells by the virus, having important clinical significance for the prevention, treatment or detection of the novel coronavirus.

Description

Human antibody of novel coronavirus-specific antigenic peptide, preparation method and use technical field

The present disclosure belongs to the field of biomedicine, and relates to a human antibody bound to a novel coronavirus-specific antigen peptide and uses thereof. Specifically, the present disclosure relates to a monoclonal antibody that specifically binds to the RBD domain of the SARS-CoV-2 virus, which is located in the S protein of the SARS-CoV-2 virus, and the aforementioned antigenic peptide thereof is prepared Use in COVID-19 vaccine, preparation of medicaments for prevention and treatment of COVID-19.

Background technique

Since the outbreak of the novel coronavirus pneumonia, it has spread to more than 210 countries and regions, affecting more than 7 billion people and taking the precious lives of more than 300,000 people. At present, the domestic epidemic has been well controlled, but the new coronavirus is still raging around the world. The development of effective diagnosis, prevention or treatment methods for new coronary pneumonia is an urgent problem to be solved.

The novel coronavirus (SARS-CoV-2) belongs to the genus betacoronavirus, a linear single-stranded RNA (ssRNA) virus. Its genome is about 29903 nucleotides in length and contains 10 genes. Since January 10, 2020, the first SARS-CoV-2 genome sequence data was released, and since then, the genome sequences of multiple new coronaviruses isolated from patients have been released. On January 22, 2020, the Genome Science Data Center officially released the 2019 Novel Coronavirus Resource Library. After data analysis, the 2019 novel coronavirus (SARS-CoV-2) is 80% similar to the genome sequence of the SARS virus that broke out in 2003, which is similar to the Bat SARS-like coronavirus isolated bat collected from domestic bats in February 2017 -SL-CoVZC45 has the highest genome sequence similarity with 88% similarity. As of January 30, 2020, 6 institutions around the world have released 13 novel coronavirus genome sequences on the "Global Shared Influenza Virus Database GISAID".

The novel coronavirus (SARS-CoV-2) is an enveloped positive-strand RNA virus containing a 30kb genome and four structural proteins, namely spike protein (S), envelope protein (E), membrane protein (M). ) and nucleocapsid protein (N). The S protein regulates viral attachment to receptors on target host cells. The function of the E protein is to assemble the virus and act as an ion channel; the M protein, together with the E protein, plays a role in virus assembly and participates in the biosynthesis of new virus particles; the N protein forms a ribonucleoprotein complex with viral RNA. The surface spike glycoprotein (S protein) of the novel coronavirus is responsible for attachment to host cells through interactions with host cell surface receptors (ACE2). The S protein exists in the form of homotrimers, each monomer containing more than 1200 amino acids. In the S protein of SARS-CoV-2, a small domain containing residues 306-575 was identified as the receptor-binding domain (RBD), of which residues 439-508 were termed the receptor-binding motif (RBM) The base directly mediates the interaction with ACE2. The entry of coronaviruses into cells depends on the binding of viral spike proteins to cellular receptors and the initiation of S protein by host cell proteases. Elucidating which cytokines are utilized by 2019-nCoV may provide new ideas for the spread of the virus and the discovery of therapeutic targets. SARS-CoV-2 Spike protein consists of S1 domain and S2 domain. S1 contains a receptor binding domain (RBD) that can specifically bind to the receptor on target cells, angiotensin-converting enzyme 2 (ACE2), which is the most critical step in its infection process. Therefore, it is generally believed that SARS-CoV-2 Spike Protein (RBD) has potential value in the diagnosis of the virus. Recombinant RBD protein vaccine is one of the important new crown vaccine options.

Phage display technology was originally developed by the British Medical Research Council (Medical Research Council) in 1990 by preparing a human antibody library (library) and expressing it on the surface of phage in the form of antibody fragments (Fab, ScFv), thereby Antibody cloning techniques for screening specific antigens. It has been proposed that almost all recombinant human monoclonal antibodies that react specifically with antigens can be screened from the single-pot antibody library system. Therefore, when phage-displayed antibody technology is used, it is possible to obtain in vivo diagnostic or therapeutic applications. Various antibody fragments (Fab or ScFv). In the present invention, a phage human antibody library is constructed from the PBMC of COVID-19 patients, and the antibody cloning technology for screening specific antigens by specifically binding to the RBD domain of the spike protein.

SUMMARY OF THE INVENTION

Invention to solve problem

In view of the problems existing in the existing technology, such as the need for effective diagnostic and therapeutic means for the new coronavirus. To this end, the present disclosure provides an anti-SARS-CoV-2 antibody or an antigen-binding fragment thereof that can specifically bind to the RBD domain of the SARS-CoV-2 virus. The RBD domain is one of the key factors for the SARS-CoV-2 virus to invade cells. By specifically binding to RBD, it can block the invasion of the new coronavirus to cells, and realize the treatment, prevention or diagnosis of the new coronavirus.

solution to the problem

(1) an anti-SARS-CoV-2 antibody or an antigen-binding fragment thereof, the antibody specifically binds to the SARS-CoV-2 epitope, wherein the SARS-CoV-2 epitope comprises as shown in SEQ ID NO: Sequence shown in 1.

(2) The antibody or antigen-binding fragment thereof according to (1), comprising a heavy chain variable region, wherein the sequence encoding the heavy chain variable region comprises as described in any one of SEQ ID NOs: 39-41 the sequence shown.

(3) The antibody or antigen-binding fragment thereof according to any one of (1) to (2), which comprises a light chain variable region, wherein the sequence encoding the light chain variable region comprises the following sequences one or more of:

(a ₁ ) the sequence shown in any one of SEQ ID NOs: 42-44;

(a ₂ ) a sequence as shown in any one of SEQ ID NOs: 45-47;

(a ₃ ) a sequence as shown in any one of SEQ ID NOs: 48-50;

(a ₄ ) a sequence as shown in any one of SEQ ID NOs: 51-53;

( _a5 ) the sequence shown in any one of SEQ ID NOs: 54-56;

(a ₆ ) The sequence shown in any one of SEQ ID NOs: 57-59.

(4) The antibody or antigen-binding fragment thereof according to any one of (1)-(3), comprising a linker, wherein the sequence encoding the linker comprises the sequence shown in SEQ ID NO:60.

(5) The antibody or antigen-binding fragment thereof according to (1), comprising a heavy chain variable region (VH) and a light chain variable region (VL), the VH comprising a VH complementarity determining region (CDR) 1, VH complementarity determining region (CDR) 2 and VH complementarity determining region (CDR) 3, and said VL comprises VLCDR1, VLCDR2 and VLCDR3, wherein,

The VH is encoded by the following amino acids: VHCDR1 comprises the amino acid sequence shown in SEQ ID NO:39, VHCDR2 comprises the amino acid sequence shown in SEQ ID NO:40, and VHCDR3 comprises the amino acid sequence shown in SEQ ID NO:41 ;and

The VL is encoded by the following amino acids: VLCDR1 comprises as described in any one of SEQ ID NO:42, SEQ ID NO:45, SEQ ID NO:48, SEQ ID NO:51, SEQ ID NO:54 or SEQ ID NO:57 The amino acid sequence shown, VLCDR2 comprises the amino acid shown in any one of SEQ ID NO:43, SEQ ID NO:46, SEQ ID NO:49, SEQ ID NO:52, SEQ ID NO:55 or SEQ ID NO:58 sequence, and VLCDR3 comprises the amino acid sequence set forth in any one of SEQ ID NO:44, SEQ ID NO:47, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:56, or SEQ ID NO:59.

(6) The antibody or antigen-binding fragment thereof according to (5), wherein the antibody or antigen-binding fragment thereof encoding the antibody comprises one or more of the following sequences:

(b ₁ ) VH comprises the amino acid sequence set forth in SEQ ID NO: 15, and VL comprises the amino acid sequence set forth in SEQ ID NO: 17;

(b2 ₎ VH comprises the amino acid sequence set forth in SEQ ID NO: 19, and VL comprises the amino acid sequence set forth in SEQ ID NO: 21;

(b3 ₎ VH comprises the amino acid sequence set forth in SEQ ID NO:23, and VL comprises the amino acid sequence set forth in SEQ ID NO:25;

( _b4 ) VH comprises the amino acid sequence set forth in SEQ ID NO:27, and VL comprises the amino acid sequence set forth in SEQ ID NO:29;

( _b5 ) VH comprises the amino acid sequence set forth in SEQ ID NO:31, and VL comprises the amino acid sequence set forth in SEQ ID NO:33;

( _b6 ) VH comprises the amino acid sequence set forth in SEQ ID NO:35, and VL comprises the amino acid sequence set forth in SEQ ID NO:37;

(b ₇ ) the amino acid sequence shown in SEQ ID NO: 3, 5, 7, 9, 11 or 13.

(7) A polynucleotide, wherein the polynucleotide is selected from any one of (a)-(d):

(a) comprising, for example, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: : 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36 or SEQ ID NO: 38 The nucleotide sequence shown in any sequence or any combination thereof;

(b) comprising, for example, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: : 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36 or SEQ ID NO: 38 The nucleotide sequence of the reverse complement of the nucleotide sequence shown in any sequence or any combination thereof ;

(c) the reverse complement of a sequence capable of hybridizing to the nucleotide sequence shown in any one of (a)-(b) under high stringency hybridization conditions or very high stringency hybridization conditions;

(d) The nucleotide sequence shown in any one of (a)-(c) has at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% sequences of sequence identity.

(8) The polynucleotide according to (7), wherein the polynucleotide is selected from any one of (e)-(h):

(e) comprising the nucleotide sequence set forth in SEQ ID NO: 16 and SEQ ID NO: 18, comprising the nucleotide sequence set forth in SEQ ID NO: 20 and SEQ ID NO: 22, comprising the nucleotide sequence set forth in SEQ ID NO: 22 : 24 and the nucleotide sequence shown in SEQ ID NO: 26, comprising the nucleotide sequence shown in SEQ ID NO: 28 and SEQ ID NO: 30, comprising the nucleotide sequence shown in SEQ ID NO: 32 and SEQ ID NO: 34 the nucleotide sequence shown, or comprising the nucleotide sequence shown in SEQ ID NO: 36 and SEQ ID NO: 38;

(f) a nucleotide sequence comprising the reverse complement of the nucleotide sequence shown in (e);

(g) the reverse complement of a sequence capable of hybridizing to the nucleotide sequence shown in any one of (e)-(f) under high stringency hybridization conditions or very high stringency hybridization conditions;

(h) The nucleotide sequence shown in any one of (e)-(g) has at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% sequences of sequence identity.

(9) The polynucleotide according to (8), wherein the polynucleotide is selected from any one of (i)-(1):

(i) comprising the nucleotide sequence shown in any of SEQ ID NO: 4, 6, 8, 10, 12 or 14;

(j) a nucleotide sequence comprising the reverse complement of the sequence shown in any of SEQ ID NO: 4, 6, 8, 10, 12 or 14;

(k) the reverse complement of a sequence capable of hybridizing to the nucleotide sequence shown in any one of (i)-(j) under high stringency hybridization conditions or very high stringency hybridization conditions;

(l) The nucleotide sequence shown in any one of (i)-(k) has at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% sequences of sequence identity.

(10) A vector, wherein the vector comprises the polynucleotide according to any one of (7)-(9).

(11) An isolated host cell, wherein the host cell comprises the vector of (10).

(12) A method for preparing a host cell stably expressing a target protein, wherein the method comprises the vector described in (10), the step of transforming an initial host cell; optionally, the host cell is a Chinese hamster ovary cell .

(13) A method for producing a target protein, comprising using the host cell described in (11) or by the method described in (12), producing the target protein.

(14) An antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof is prepared by the method described in (13).

(15) A kit comprising the antibody or antigen-binding fragment thereof according to any one of (1)-(6) or (14).

(16) Application of the kit described in (15) in preparing a kit for detecting COVID-19.

(17) A pharmaceutical composition or vaccine, wherein the pharmaceutical composition or vaccine contains the antibody or antigen-binding fragment thereof according to any one of (1)-(6) or (14).

(18) The antibody or antigen-binding fragment thereof described in any one of (1)-(6) or (14), or the pharmaceutical composition or vaccine described in (17) is prepared for the treatment or prevention of COVID-19 application of drugs.

(19) A method for treating or preventing COVID-19, wherein the antibody or antigen-binding fragment thereof described in any one of (1)-(6) or (14), or the drug described in (17) is combined animals or vaccines.

effect of invention

In one embodiment, the present disclosure provides a human antibody that can specifically bind to the novel coronavirus. By binding to the RBD domain of the novel coronavirus, the antibody can block the invasion of the novel coronavirus into cells, thereby realizing the protection against the novel coronavirus. Prevention or treatment of viruses. On the other hand, through the specific combination with the new coronavirus, the detection of the virus can also be realized for the clinical diagnosis of patients with new coronary pneumonia.

In one embodiment, the present disclosure provides a polynucleotide encoding a human antibody that can specifically bind to a novel coronavirus, a vector comprising the polynucleotide, a host cell, and the like, which can realize the expression and preparation of monoclonal antibodies.

In one embodiment, the present disclosure provides methods for making human antibodies capable of specifically binding to the novel coronavirus.

Description of drawings

Description of reference numerals

Figure 1 shows the PCR agarose gel electrophoresis image when constructing the VL and VH-VL libraries. The library includes PBMCs of new crown patients and normal human PBMCs as a control group.

Figure 2 shows the quality report of the sequencing of the phage-displayed library, including the library constructed from PBMCs of patients with COVID-19 and normal human PBMCs.

Figure 3 shows the results of the recombinant plasmid RBD-PATX2 agarose gel electrophoresis verification, and the purified RBD SDS-PAGE electrophoresis to verify the purity, and the purity is greater than 90%.

Figure 4 shows the ELISA results at different dilution concentrations of the antibody.

Figures 5A-5H show the results of antibody neutralization experiments, and Figure 5A shows the inhibition rate of the screened antibody sequences against SARS-CoV-2 pseudovirus; Figures 5B-5H show the antibodies RBD-R3P1-A12, RBD -R3P2-A2, RBD-R3P2-B5, RBD-R3P1-B6, RBD-R3P1-E4 and R3P2-G1 against SARS-CoV-2 euvirus (Figures 5B-5H: SARS-CoV2-NP or SARS-CoV -2-NP) inhibition rate test results.

Detailed ways

definition

In the claims and/or specification of the present disclosure, the words "a" or "an" or "the" may mean "an", but may also mean "one or more", "At least one" and "one or more than one".

As used in the claims and specification, the words "comprising", "having", "including" or "comprising" are meant to be inclusive or open ended and do not exclude additional, unrecited elements or methods step. At the same time, "comprising", "having", "including" or "comprising" may also mean closed-ended, excluding additional, unrecited elements or method steps.

Throughout this application, the term "about" means that a value includes the standard deviation of the error of the device or method used to determine the value.

Although the disclosure supports the definition of the term "or" as only an alternative and "and/or", the term "or" in the claims means that unless expressly stated to be only an alternative or mutually exclusive between alternatives "and / or".

As used in this disclosure, the term "SARS-CoV-2", also known as "2019-nCoV", means the 2019 novel coronavirus.

As used in this disclosure, the term "COVID-19" means Corona Virus Disease 2019, referred to as "COVID-19", which refers to pneumonia caused by 2019 novel coronavirus (SARS-CoV-2) infection .

"Sequence identity" and "percent identity" in the present disclosure refer to the percentage of nucleotides or amino acids that are identical (ie, identical) between two or more polynucleotides or polypeptides. Sequence identity between two or more polynucleotides or polypeptides can be determined by aligning the nucleotide or amino acid sequences of the polynucleotides or polypeptides and The number of positions containing the same nucleotide or amino acid residue is scored and compared to the number of positions containing different nucleotide or amino acid residues in the aligned polynucleotides or polypeptides. Polynucleotides can differ at a position, eg, by containing different nucleotides (ie, substitutions or mutations) or deletions of nucleotides (ie, insertions of nucleotides or deletions of nucleotides in one or both polynucleotides). Polypeptides can differ at one position, for example, by containing different amino acids (ie, substitutions or mutations) or missing amino acids (ie, amino acid insertions or amino acid deletions in one or both polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in a polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of nucleotides or amino acid residues in the polynucleotide or polypeptide and multiplying by 100.

The term "phage display technology" in the present disclosure refers to inserting the DNA sequence of exogenous protein or polypeptide into the appropriate position of the phage coat protein structural gene, so that the exogenous gene is expressed along with the expression of the coat protein. Biotechnology for the reassembly of phages for display on the surface of phages.

The term "antibody" in this disclosure refers to immunoglobulins or fragments thereof or derivatives thereof, and includes any polypeptide that contains an antigen binding site, whether produced in vitro or in vivo. The term includes, but is not limited to, polyclonal, monoclonal, monospecific, multispecific, nonspecific, humanized, single-stranded, chimeric, synthetic, recombinant, hybrid, Mutated, grafted antibodies. The term "antibody" also includes antibody fragments such as Fab, F(ab')2, Fv, scFv, Fd, dAb and other antibody fragments that retain antigen binding function. Typically, such fragments will include antigen-binding fragments.

The term "single-chain antibody" (scFv) in the present disclosure is an antibody formed by linking the variable region of the heavy chain and the variable region of the light chain by a short peptide (also known as a linker) of limited amino acids. .

The term "peripheral blood mononuclear cells" (PBMC) in the present disclosure are cells in peripheral blood that have a single nucleus, including lymphocytes and monocytes.

The term "RBD" in the present disclosure refers to the receptor binding domain (RBD) of the coronavirus S protein that binds to angiotensin-converting enzyme 2 (ACE2) on the surface of the virus and host cells. , play an important role in the process of entering host cells. RBD has good accuracy and specificity for the new coronavirus, and can be used for the detection of SARS-CoV-2; at the same time, RBD plays a role in the process of SARS-CoV-2 invading cells, recognizing and specifically binding to RBD Can be used for the treatment of diseases caused by SARS-CoV-2.

The term "IMGT numbering scheme" in this disclosure is the result of Lefranc et al. introducing a new standardized numbering system for all protein sequences of the immunoglobulin superfamily, including variable domains from antibody light and heavy chains and from different species T cell receptor chain. The IMGT numbering method continuously counts residues based on a germ-line V sequence (germ-line V) alignment.

In the technical solutions described in the present disclosure, unless otherwise specified, the antibody numbering scheme adopted for antibodies in the present disclosure is the IMGT numbering scheme.

In some embodiments, the present disclosure relates to the stringency of hybridization conditions used to define the degree of complementarity of two polynucleotides. Alternatively, the aforementioned polynucleotides may be selected from DNA. "Stringency" as used in this disclosure refers to temperature and ionic strength conditions and the presence or absence of certain organic solvents during hybridization. The higher the stringency, the higher the degree of complementarity between the target nucleotide sequence and the labeled polynucleotide sequence. "Stringent conditions" refer to temperature and ionic conditions under which only nucleotide sequences having a high frequency of complementary bases will hybridize. As used herein, the term "hybridize under conditions of high or very high stringency" describes the conditions used for hybridization and washing. Guidance for performing hybridization reactions can be found in Current Protocols in MolecμLar Biology, John Wiley and Sons, N.Y. (1989), 6.3.1-6.3.6. The specific hybridization conditions referred to in this disclosure are as follows: 1) High stringency hybridization conditions: in 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by washing with 0.2X SSC, 0.1% SDS at 65°C One or more times; 2) Very high stringency hybridization conditions: 0.5M sodium phosphate, 7% SDS at 65°C, followed by one or more washes with 0.2X SSC, 1% SDS at 65°C.

Anti-SARS-CoV-2 antibodies or antigen-binding fragments thereof

The SARS-CoV-2 Spike protein consists of the S1 domain and the S2 domain, and is one of the keys for the new coronavirus to infect and invade cells. S1 contains a receptor binding domain (RBD) that can specifically bind to the receptor angiotensin-converting enzyme 2 (ACE2) on target cells, which is the most critical step in its infection process. Therefore, it is generally believed that SARS-CoV-2 Spike Protein (RBD) has potential value in the diagnosis of the virus. Recombinant RBD protein vaccine is one of the important new crown vaccine options.

In some embodiments, the amino acid sequence of RBD is shown in SEQ ID NO: 1, and the N-terminal of RBD contains the signal peptide sequence of "MPLLLLLPLLWAGALA", which can effectively improve the expression of RBD protein. After the RBD protein is expressed and undergoes post-translational modification, the signal peptide will be cleaved, which does not affect the screening of anti-SARS-CoV-2 antibodies. The gene sequence of RBD is shown in SEQ ID NO:2. The gene sequence of RBD was artificially synthesized, and the RBD gene was recombined into the expression vector PATX2 to obtain the RBD-PATX2 expression vector, and the cloning site was EcoR1/Not1.

In some embodiments, the RBD-PATX2 expression vector is transfected into HEK293F cell line for culture, and the supernatant is collected for nickel column purification to obtain RBD protein.

In some embodiments, antibodies or antigen-binding fragments with high affinity to RBD proteins are screened using phage display technology. Exemplary, antibodies or antigen-binding fragments with high affinity to RBD proteins include polyclonal, monoclonal, monospecific, multispecific, nonspecific, humanized, single chain, chimeric, synthetic , recombinant, hybrid, mutated, grafted antibodies, or fragments of antibodies such as Fab, F(ab')2, Fv, scFv, Fd, dAb and others that retain antigen binding function.

Specifically, the present disclosure takes the PBMCs of patients with COVID-19, constructs a phage display library containing the variable heavy chain (VH) and the variable light chain (VL), and conducts biopanning with the RBD protein to screen A human antibody that can specifically bind to the new coronavirus has arrived.

For the molecular biology methods used in this disclosure, please refer to "Compendium of the latest molecular biology experimental methods (Current Protocols in Molecular Biology, published by Wiley)", "Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory" Published)" and other corresponding methods described in public publications.

Example

Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and specific examples, while indicating specific embodiments of the present disclosure, are given for illustrative purposes only, since after reading this detailed description, Various changes and modifications will become apparent to those skilled in the art.

All reagents used in the examples, unless otherwise noted, are commercially available.

Example 1 Construction method of human ScFv phage display library

Table 1 Main reagents used in this example

reagent	Numbering	manufacturer
Phanta Max Ultra-Fidelity DNA Polymerase Kit	P505-d1-AA		Vazyme
2×T5 Super PCR Mix(Colony)	TSE005	TSINGKE

FastPure Gel DNA Extraction Mini Kit	DC301	Vazyme
FastPure Plasmid Mini Kit	PM0201-200	TSINGKE
TG1 electrocompetent cells	60502	Lucigen
T4 DNA Ligase	NEB	M0202S
FastDigest NcoI	FD0575	Thermo Scientific
FastDigest XhoI	FD0694	Thermo Scientific
FastDigest NheI	FD0973	Thermo Scientific
FastDigest NotI	FD0595	Thermo Scientific
FastDigest sfiI	FD1824	Thermo Scientific
pATA-scFv-2 Vector	-	ProteoGenix
PATX2	-	ProteoGenix
M13KO7 helper phage	N0315S	NEB

1. Library Construction

1.1 Assembly of variable heavy (VH) and variable light (VL) domains

Table 2 PCR reaction conditions and steps

Among them, the three steps of denaturation, annealing and extension (1) were repeated 30 times.

Primer sequence:

Forward(F):

5'L-VH1: ACAGGTGCCCACTCCCAGGTGCAG (SEQ ID NO: 61)

5'L-VH3: AAGGTGTCCAGTGTGARGTGCAG (SEQ ID NO: 62)

5'L-VH 4/6: CCCAGATGGGTCCTGTCCCAGGTGCAG (SEQ ID NO: 63)

5'L-VH 5/7: CAAGGAGTCTGTTCCGAGGTGCAG (SEQ ID NO: 64)

5'L Vκ1/2: ATGAGGSTCCCYGCTCAGCTGCTGG (SEQ ID NO: 65)

5'L Vκ3: CTCTTCCTCCTGCTACTCTGGCTCCCAG (SEQ ID NO: 66)

5'L Vκ4/5: ATTTCTCTGTTGCTCTGGATCTCTG (SEQ ID NO: 67)

5'L Vλ1: GGTCCTGGGCCCAGTCTGTGCTG (SEQ ID NO: 68)

5'L Vλ2: GGTCCTGGGCCCAGTCTGCCCCTG (SEQ ID NO: 69)

5'L Vλ3: GCTCTGTGACCTCCTATGAGCTG (SEQ ID NO: 70)

5'L Vλ4/5: GGTCTCTCTCSCAGCYTGTGCTG (SEQ ID NO: 71)

5'L Vλ6: GTTCTTGGGCCAATTTTATGCTG (SEQ ID NO: 72)

5'L Vλ7: GGTCCAATTCYCAGGCTGTGGTG (SEQ ID NO: 73)

5'L Vλ8/9/10: GAGTGGATTCTCAGACTGTGGTG (SEQ ID NO: 74)

Reverse(R):

3'Cκ: TGCTGTCCTTGCTGTCCTGCT (SEQ ID NO: 75)

3'Cλ: CACCAGTGTGGCCTTGTTGGCTTG (SEQ ID NO: 76)

The results of agarose gel electrophoresis detection after PCR are shown in Figure 1.

1.2 Construction of light chain variable region phage display library

1.2.1 Prepare pATA-scFv-2 vector for library cloning

1.2.2 Digestion of vectors and PCR products

Table 3 Reaction system for digesting vector and PCR product

	pATA-scFv-2 vector	Heavy chain/light chain variable region PCR product
Vector or PCR product	25μg	10μg
Fast Digest NheI	5μl	2μl
Fast Digest NotI	5μl	2μl
10×Fast Digest Buffer	25μl	10μl
ddH 2 O	A total of 250 μL was added to the reaction system	A total of 100 μL was added to the reaction system

1.2.3 Connection

Table 4 ligation reaction system

T4 DNA Ligase(Thermo)	8μl
10×T4 DNA Ligase buffer	15μl
Vector(NheI/NotI)	1.5μg
VL fragment(NheI/NotI)	0.5μg
H 2 O	A total of 150 μl was added to the reaction system

Incubate at 16°C for 15h and heat at 65°C for 10min.

1.2.4 Electric transfer

1) Preparation of TG1 competent cells.

2) Pre-warm 2 ml of SOC medium (Sigma, S1797) at 37°C. Place electroporation tubes (0.2 cm gap) on ice (one tube per transformation reaction).

3) Remove the electroactive cells from the -80°C freezer and place on wet ice until they are completely thawed (5-10 minutes). After the cells are thawed, gently tap to mix.

4) Carefully pipette 50 μL of DNA mixture into a cold electroporation tube without introducing foam. Quickly flick the beaker down with your wrist to pellet the cells to the bottom of the well.

5) Electroporation at 600Ω, 10μF and 2.5kV. Immediately add 2 mL of pre-warmed SOC medium to each tube within 10 seconds of the pulse. Stir for 1 hour at 37°C, 220 rpm.

6) Collect all the electroconversion medium. Serially dilute 10 μL of product in 100 μL SOC and propagate in LB medium containing Amp/glucose. Place overnight at 37°C. The total number of transformants was calculated by counting the number of colonies, multiplying by the culture volume, and dividing by the plating volume.

1.3 Construction of VL-VH phage display library

1.3.1 Digestion of vectors and PCR products

Table 5 Digestion reaction system

1.3.2 Connection

Table 6 ligation reaction system

T4 DNA Ligase(Thermo)	8μl
10×T4 DNA Ligase buffer	15μl
VL-vector(sfiI/XhoI)	1.5μg
VH(sfiI/XhoI)	0.45μg
H 2 O	A total of 150 μl was added to the reaction system

Incubate at 16°C for 15h and heat at 65°C for 10min.

1.3.3 Electric transfer

The steps are the same as 1.2.4

1.3.4 Library Evaluation

1) Colony PCR

PCR was performed using the constructed library as a template

Table 7 PCR reaction conditions

Among them, the three steps of denaturation, annealing and extension (1) were repeated 30 times.

Template: Here is the constructed antibody library

Primer sequence:

Forward (F): TGCTCGGGGATCCGAATTCT (SEQ ID NO: 77)

Reverse(R): TCGAGTGCGGCCGCAAGCTT (SEQ ID NO: 78)

2) Sequencing

Positive clones were selected and sent to Wuhan Qingke Biotechnology Co., Ltd. for sequencing.

The sequencing quality control results are shown in Figure 2.

1.4 Expression of RBD protein

Synthesize the RBD gene sequence artificially, recombine the RBD gene into the expression vector plasmid PATX2, and obtain the RBD-PATX2 expression vector; the cloning site EcoR1/Not1, the amino acid sequence of RBD is shown in SEQ ID NO: 1, and the gene sequence is shown in SEQ ID NO. : shown in 2;

The RBD-PATX2 expression vector was transfected into HEK293F cell line for culture, and the supernatant was collected for nickel column purification to obtain RBD protein; the purified RBD also needs to be subjected to SDS-PAGE electrophoresis (polyacrylamide gel electrophoresis) to verify its purity .

The recombinant plasmid RBD-PATX2 agarose gel electrophoresis verification results and purity verification agarose gel electrophoresis diagrams are shown in Figure 3. The purified RBD SDS-PAGE electrophoresis verified the purity, and the purity was greater than 90%.

Example 2 Preparation of monoclonal antibodies specifically binding to new coronavirus RBD

Table 8 Main reagents used in this example

reagent	Numbering	manufacturer
96-well plate	42592	Costar
Tween 20	P2287	Sigma
Tris	RES3098T-B7	Sigma
Glycine	G8200	Solarbio
PEG	181986	Sigma
PBS	C10010500BT	Life
BSA	A104912-100g	aladdin
Skim milk	6342932	BD

2.1 First round

2.1.1 Biopanning

(1) Coating: Dilute the RBD recombinant protein to 50 μg/ml with PBS, take 1 ml into an immunotube, and coat overnight at 4°C.

(2) Washing: discard the liquid in the immune tube, and wash the immune tube three times with 5 ml of 0.05% PBST.

(3) Blocking: Add 5 ml of 5% skim milk (dissolved in PBS) to the immune tube, and incubate at 30 degrees for 2 hours.

(4) Washing: discard the liquid in the immune tube, and wash the immune tube three times with 5 ml of 0.05% PBST.

(5) Incubation: Dilute the phage library with 1% skim milk (dissolved in PBS) to a titer of 1*10 ¹² pfu/ml. Add 1m to the immunotube, and incubate with gentle shaking at room temperature for 2 hours.

(6) Washing: discard the liquid in the immune tube, and wash the immune tube three times with 5 ml of 0.05% PBST.

(7) Elution: The phage bound to RBD was eluted with 1 ml of glycine-hydrochloric acid (pH 2.2), and then neutralized to pH 7.0 with Tris-HCl.

2.1.2 Determination of the titer of diluted phage

(1) E. coli TG1 was cultured until OD ₆₀₀ =0.4-0.6.

(2) Mix 10 μL of the diluted post-eluting phage and 190 μL E. coli TG1.

(3) The culture mixture was incubated at 37°C for 30 minutes, and then poured into 2×YT-A (Amp 100 μg/ml) medium. The medium was incubated upside down at 37°C overnight.

2.1.3 Phage library amplification

(1) Add 10 μl of E.coli TG1 to 800 μl of 2YT medium and mix and culture at 37°C until OD ₆₀₀ =0.4-0.6.

(2) Transfer the TG1 cultured to the logarithmic phase into 10 ml of 2YT-G (final concentration of 2% glucose) culture medium, and culture on a shaker at 37° C. to OD ₆₀₀ =0.4-0.6.

(3) Add the eluted product, incubate at 37°C for 30 minutes, and shake at 37°C for 30 minutes.

(4) Add 30 ml of 2YT-AG culture medium (final concentration 0.1% Amp, 2% glucose), and incubate at 37°C for 1 hour on a shaker.

(5) Add M13KO7 (M13KO7:TG1=20:1), incubate at 37°C for 30 minutes, and shake at 37°C for 30 minutes.

(6) The bacterial solution was centrifuged at 5000 rpm for 10 minutes. Resuspend with 40ml 2YT-AK and incubate overnight at 30°C on a shaker.

(7) Centrifuge at 8000rpm for 10 minutes, take out the supernatant, resuspend with 1ml PBS, centrifuge at 12000rpm for 5 minutes, and transfer the supernatant to a new 1.5ml centrifuge tube.

2.1.4 Determination of the titer of the amplified phage library

The steps are the same as 2.1.2

2.2 The second round to the fourth round

2.2.1 Biopanning

Repeat step 2.1 three times in a cycle, and each input phage library uses the eluted phage after the previous round of amplification.

Table 9 Results of biopanning

2.3 Polyclonal Phage ELISA

(1) Coating: Antigen group: Dilute the RBD recombinant protein with PBS to 4 μg/ml, add 100ul per well to the ELISA plate, and coat overnight at 4°C. Control group: 100ul PBS was added to each well of the microtiter plate, and it was coated overnight at 4°C.

(2) Washing: discard the liquid in the ELISA plate, and wash each well three times with 300 μl, 0.05% PBST.

(3) Blocking: Add 300 μl of 5% skim milk (dissolved in PBS) to each well of the ELISA plate, and incubate at 30 degrees for 2 hours.

(4) Washing: discard the liquid in the ELISA plate, and wash each well three times with 300 μl, 0.05% PBST.

(5) Phage incubation: Dilute the eluted phage after each round of amplification to the required titer with 1% skim milk (dissolved in PBS). Add 100 μl per well to the ELISA plate and incubate with gentle shaking at room temperature for 2 hours.

(6) Washing: discard the liquid in the ELISA plate, and wash each well three times with 300 μl, 0.05% PBST.

(7) Secondary antibody incubation: Dilute anti-M13-HRP antibody (1:5000) with 1% skim milk (dissolved in PBS). Add 100 μl to each well and incubate at 37°C for 1 hour.

(8) Washing: discard the liquid in the ELISA plate, and wash each well three times with 300 μl, 0.05% PBST.

(9) Color development: add 100 μL TMB to each well, incubate at room temperature, add 100 μL 2M HCl to each well to stop the reaction, and read the value of OD450nm-OD630nM on a microplate reader.

Table 10 Results of polyclonal phage ELISA

2.4 Monoclonal phage ELISA (select the third round eluate for polycloning according to the polycloning results)

(1) Elution phage infection: take a part of the diluted third round eluted phage and mix with 200ul of E. coli TG1 in log phase. The mixture was incubated at 37°C for 30 minutes and poured onto 2×YT-A (Amp 100 μg/ml) solid medium. Incubate overnight at 37°C.

(2) Monoclonal phage amplification: Pick 196 monoclones from the infected plate, put them into 600ul 2×YT-A (Amp 100μg/ml) liquid medium, and culture them with shaking at 37°C for 2 hours. An appropriate amount of helper phage M13KO7, (M13KO7:TG1=20:1), was incubated at 37°C for 30 minutes, and shaken at 37°C for 30 minutes. The bacterial broth was centrifuged at 4000 rpm for 10 minutes. Resuspend with 600ul 2YT-AK (Amp 100μg/ml, Kan 50μg/ml), and incubate overnight at 30°C on a shaker. The next day, the bacterial solution was centrifuged at 8000 rpm for 10 minutes, and the supernatant was taken out for use.

(3) Coating: Antigen group: Dilute the RBD recombinant protein with PBS to 4 μg/ml, add 100ul of each well to the ELISA plate, and coat overnight at 4°C. Control group: 100ul PBS was added to each well of the microtiter plate, and it was coated overnight at 4°C.

(4) Washing: discard the liquid in the ELISA plate, and wash each well three times with 300 μl, 0.05% PBST.

(5) Blocking: Add 300 μl of 5% skim milk (dissolved in PBS) to each well of the ELISA plate, and incubate at 30 degrees for 2 hours.

(6) Washing: discard the liquid in the ELISA plate, and wash each well three times with 300 μl, 0.05% PBST.

(7) Phage incubation: 100 μl of monoclonal culture supernatant per well was added to the ELISA plate, and incubated with gentle shaking at room temperature for 2 hours.

(8) Washing: discard the liquid in the ELISA plate, and wash each well three times with 300 μl, 0.05% PBST.

(9) Secondary antibody incubation: Dilute anti-M13-HRP antibody (1:5000) with 1% skim milk (dissolved in PBS). Add 100 μl to each well and incubate at 37°C for 1 hour.

(10) Washing: discard the liquid in the ELISA plate, and wash each well three times with 300 μl, 0.05% PBST.

(11) Color development: add 100 μL of TMB to each well, incubate at room temperature, add 100 μL of 2M HCl to each well to stop the reaction, and read the value of OD450nm-OD630nM on a microplate reader.

Table 11 Results of monoclonal phage ELISA

The first plate (R3P1) 96 monoclonal ELISA results

The second plate (R3P2) 96 monoclonal ELISA results

The clones in the antigen group greater than 3 times of the control group were designated as positive clones, and the positive clones were sent for sequencing. After eliminating wrong antibody sequences and repetitive antibody sequences, 6 high-affinity antibody sequences were finally obtained. The sequences of the highly specific antibodies are as follows.

2.5 Sequencing of antibody sequences

The obtained phage-positive clones were screened, and the full sequence was sequenced to obtain the corresponding antibody heavy chain and light chain, and the full sequence was as follows:

The amino acid sequence of the RBD-R3P1-A12 antibody is the sequence shown in SEQ ID NO: 3;

The nucleotide sequence of the RBD-R3P1-A12 antibody is the sequence shown in SEQ ID NO: 4;

The amino acid sequence of the RBD-R3P2-A2 antibody is the sequence shown in SEQ ID NO: 5;

The nucleotide sequence of the RBD-R3P2-A2 antibody is the sequence shown in SEQ ID NO: 6;

The amino acid sequence of the RBD-R3P2-B5 antibody is the sequence shown in SEQ ID NO: 7;

The nucleotide sequence of the RBD-R3P2-B5 antibody is the sequence shown in SEQ ID NO: 8;

The amino acid sequence of the RBD-R3P1-B6 antibody is the sequence shown in SEQ ID NO: 9;

The nucleotide sequence of the RBD-R3P1-B6 antibody is the sequence shown in SEQ ID NO: 10;

The amino acid sequence of the RBD-R3P1-E4 antibody is the sequence shown in SEQ ID NO: 11;

The nucleotide sequence of the RBD-R3P1-E4 antibody is the sequence shown in SEQ ID NO: 12;

The amino acid sequence of the RBD-R3P2-G1 antibody is the sequence shown in SEQ ID NO: 13;

The nucleotide sequence of the RBD-R3P2-G1 antibody is the sequence shown in SEQ ID NO: 14;

The amino acid sequence of the RBD-R3P1-A12 antibody heavy chain is the sequence shown in SEQ ID NO: 15;

The nucleotide sequence of the RBD-R3P1-A12 antibody heavy chain is the sequence shown in SEQ ID NO: 16;

The amino acid sequence of the RBD-R3P1-A12 antibody light chain is the sequence shown in SEQ ID NO: 17;

The nucleotide sequence of the RBD-R3P1-A12 antibody light chain is the sequence shown in SEQ ID NO: 18;

The amino acid sequence of the RBD-R3P2-A2 antibody heavy chain is the sequence shown in SEQ ID NO: 19;

The nucleotide sequence of the RBD-R3P2-A2 antibody heavy chain is the sequence shown in SEQ ID NO: 20;

The amino acid sequence of the RBD-R3P2-A2 antibody light chain is the sequence shown in SEQ ID NO: 21;

The nucleotide sequence of the RBD-R3P2-A2 antibody light chain is the sequence shown in SEQ ID NO: 22;

The amino acid sequence of the RBD-R3P2-B5 antibody heavy chain is the sequence shown in SEQ ID NO: 23;

The nucleotide sequence of the RBD-R3P2-B5 antibody heavy chain is the sequence shown in SEQ ID NO: 24;

The amino acid sequence of the RBD-R3P2-B5 antibody light chain is the sequence shown in SEQ ID NO: 25;

The nucleotide sequence of the RBD-R3P2-B5 antibody light chain is the sequence shown in SEQ ID NO: 26;

The amino acid sequence of the RBD-R3P1-B6 antibody heavy chain is the sequence shown in SEQ ID NO: 27;

The nucleotide sequence of the RBD-R3P1-B6 antibody heavy chain is the sequence shown in SEQ ID NO: 28;

The amino acid sequence of the RBD-R3P1-B6 antibody light chain is the sequence shown in SEQ ID NO: 29;

The nucleotide sequence of the RBD-R3P1-B6 antibody light chain is the sequence shown in SEQ ID NO: 30;

The amino acid sequence of the RBD-R3P1-E4 antibody heavy chain is the sequence shown in SEQ ID NO: 31;

The nucleotide sequence of the RBD-R3P1-E4 antibody heavy chain is the sequence shown in SEQ ID NO: 32;

The amino acid sequence of the RBD-R3P1-E4 antibody light chain is the sequence shown in SEQ ID NO: 33;

The nucleotide sequence of the RBD-R3P1-E4 antibody light chain is the sequence shown in SEQ ID NO: 34;

The amino acid sequence of the RBD-R3P2-G1 antibody heavy chain is the sequence shown in SEQ ID NO: 35;

The nucleotide sequence of the RBD-R3P2-G1 antibody heavy chain is the sequence shown in SEQ ID NO: 36;

The amino acid sequence of the RBD-R3P2-G1 antibody light chain is the sequence shown in SEQ ID NO: 37;

The nucleotide sequence of the RBD-R3P2-G1 antibody light chain is the sequence shown in SEQ ID NO: 38;

The amino acid sequence of CDR1 of the heavy chain of RBD-R3P1-A12, RBD-R3P2-A2, RBD-R3P2-B5, RBD-R3P1-B6, RBD-R3P1-E4 or RBD-R3P2-G1 antibody heavy chain is as shown in SEQ ID NO:39 the sequence shown;

The amino acid sequence of the CDR2 of the heavy chain of the RBD-R3P1-A12, RBD-R3P2-A2, RBD-R3P2-B5, RBD-R3P1-B6, RBD-R3P1-E4 or RBD-R3P2-G1 antibody heavy chain is as shown in SEQ ID NO: 40 the sequence shown;

The amino acid sequence of the CDR3 of the heavy chain of the RBD-R3P1-A12, RBD-R3P2-A2, RBD-R3P2-B5, RBD-R3P1-B6, RBD-R3P1-E4 or RBD-R3P2-G1 antibody heavy chain is as shown in SEQ ID NO: 41 the sequence shown;

The amino acid sequence of the CDR1 of the RBD-R3P1-A12 antibody light chain is the sequence shown in SEQ ID NO: 42;

The amino acid sequence of the CDR2 of the RBD-R3P1-A12 antibody light chain is the sequence shown in SEQ ID NO: 43;

The amino acid sequence of the CDR3 of the RBD-R3P1-A12 antibody light chain is the sequence shown in SEQ ID NO: 44;

The amino acid sequence of CDR1 of the RBD-R3P2-A2 antibody light chain is the sequence shown in SEQ ID NO: 45;

The amino acid sequence of CDR2 of the RBD-R3P2-A2 antibody light chain is the sequence shown in SEQ ID NO: 46;

The amino acid sequence of the CDR3 of the RBD-R3P2-A2 antibody light chain is the sequence shown in SEQ ID NO: 47;

The amino acid sequence of CDR1 of the RBD-R3P2-B5 antibody light chain is the sequence shown in SEQ ID NO: 48;

The amino acid sequence of CDR2 of the RBD-R3P2-B5 antibody light chain is the sequence shown in SEQ ID NO: 49;

The amino acid sequence of the CDR3 of the RBD-R3P2-B5 antibody light chain is the sequence shown in SEQ ID NO: 50;

The amino acid sequence of the CDR1 of the RBD-R3P1-B6 antibody light chain is the sequence shown in SEQ ID NO: 51;

The amino acid sequence of the CDR2 of the RBD-R3P1-B6 antibody light chain is the sequence shown in SEQ ID NO: 52;

The amino acid sequence of the CDR3 of the RBD-R3P1-B6 antibody light chain is the sequence shown in SEQ ID NO: 53;

The amino acid sequence of CDR1 of the RBD-R3P1-E4 antibody light chain is the sequence shown in SEQ ID NO: 54;

The amino acid sequence of the CDR2 of the RBD-R3P1-E4 antibody light chain is the sequence shown in SEQ ID NO: 55;

The amino acid sequence of the CDR3 of the RBD-R3P1-E4 antibody light chain is the sequence shown in SEQ ID NO: 56;

The amino acid sequence of CDR1 of the RBD-R3P2-G1 antibody light chain is the sequence shown in SEQ ID NO: 57;

The amino acid sequence of the CDR2 of the RBD-R3P2-G1 antibody light chain is the sequence shown in SEQ ID NO: 58;

The amino acid sequence of the CDR3 of the RBD-R3P2-G1 antibody light chain is the sequence shown in SEQ ID NO: 59;

The linker amino acid sequence is the sequence shown in SEQ ID NO:60.

Embodiment 3 ELISA detects the OD value of antibody under different dilution concentration conditions

ELISA experimental steps:

1. MES powder (SIGMA, Lot#SLBZ3485) was prepared into MES buffer of 0.1M, pH=6.0 with ddH2O; 2. EDC (C8H17N3, Thermo Scientific, Lot#TB257918) was diluted to 10mg/ml with ddH2O.

2. Dilute the antibody with 0.1M MES buffer to 4μg/ml or according to gradient dilution, calculate EC50.

3. Set up a negative control in the microplate, add 10 μl EDC solution and 50 μl polypeptide solution to each well; add 10 μl EDC solution and 50 μl MES buffer to the remaining wells. Gently shake to mix. The plates were sealed with self-adhesive strips and placed at 4°C overnight or at room temperature for more than two hours.

4. Remove the self-adhesive strip, absorb the liquid in the well, add 300 μl ddH2O to each well, let it stand for 2 minutes, discard the liquid, and pat the plate dry. Repeat the above steps 2 more times.

5. Prepare a blocking solution of 1% BSA with 1X PBST (10X PBST: Solarbio, Cat#P1033-500; BSA: Solarbio, Cat#A8020), add 200 μl of blocking solution to each well, and block at room temperature for 1 hour.

6. Discard the liquid in the well and pat the plate dry. The RBD protein was diluted 1:500 with blocking solution, 100 μl of diluted serum was added to each well, and the reaction was carried out at room temperature for 1 hour.

7. Discard the liquid in the well, add 300 μl 1XPBST to each well, let stand for 2 minutes, discard the liquid, and pat the plate dry. Repeat the above steps 2 more times.

8. Dilute HRP-labeled Goat Anti-Human IgG (Cwbio, Cat#CW0169S) with blocking solution at 1:5000, 100 μl per well, and react at room temperature for 40 minutes.

9. Repeat step 7 and wash the plate 5 times with 1XPBST.

10. Add 100 μl of TMB-ELISA chromogenic solution (Thermo Scientific, Lot#TK2666052) to each well, and react in the dark for 5-15 minutes.

11. Add 50 μl of 2M H2SO4 solution to each well to stop the reaction.

12. Set the microplate reader to a wavelength of 450 nm to measure the OD value of each well, and the value should be read within 30 minutes after the reaction is terminated.

According to the antibody dilution gradient and RBD binding ability, EC50 was calculated, and the results are shown in Figure 4. Compared with the antibodies S309 and CR3022 reported in the literature, our self-produced 6 RBD antibodies showed that the affinity of the self-produced antibodies to RBD was better than that of S309.

Example 4 Neutralization Experiment

4.1 Preparation before experiment

4.1.1 Equilibrium reagents

Remove the reagents (trypsin, DMEM complete medium) stored at 2-8°C and equilibrate to room temperature for more than 30 minutes

4.1.2 Operators

The operation is performed by trained experimental operators. Before the experimental operation, change clothes in the clean area (put on disposable sterile clothing, change work shoes, wear masks, hats, disposable medical latex gloves) before entering the experimental area. Inside, perform experimental operations.

4.2 Experimental operation

4.2.1 Inactivate the serum (or plasma) to be tested in a water bath at 56°C for 30min, centrifuge at 6000g for 3min, and transfer the supernatant to a 1.5ml centrifuge tube for later use.

4.2.2 Take a 96-well plate, add 150 μl/well of DMEM complete medium (1% double antibody, 25mM HEPES, 10% FBS) to the second column (cell control CC, see Table 2), and add 150 μl/well to the third to eleventh column ( The third column is virus control group VV, and the fourth to eleventh columns are sample wells) add 100 μl/well of DMEM complete medium, and then add 42.5 μl/well of DMEM complete medium to wells B4 to B11.

4.2.3 Add plasma sample 1 (7.5 μl) to wells B4 and B5… and so on, add plasma sample 4 (7.5 μl) to wells B10 and B11.

4.2.4 Adjust the multi-channel pipette to 50 μl, gently and repeatedly pipette the liquid in wells B4 to B11 for 6 to 8 times to mix thoroughly, and then transfer 50 μl of the liquid to the corresponding C4 to C11. Refer to Table 12 for sample order and sample addition method.

Table 12 Sample adding sequence and sample adding method

4.2.5 Dilute the pseudovirus to 2*10 ⁴ TCID50/ml with DMEM complete medium (diluted according to the provided dilution factor), add 50 μl to each well in the 3rd to 11th columns, so that the amount of pseudovirus in each well is 1 *10 ³ /hole.

4.2.6 Incubate the above 96-well plate in a cell culture incubator (37°C, 5% CO ₂ ) for 1 hour.

4.2.7 When the incubation time reaches half an hour, take out the prepared Huh-7 cells in the incubator (the confluence rate is 80% to 90%), take the T75 culture flask as an example, aspirate the medium in the flask, and add 5ml Wash the cells with PBS buffer, pour off the PBS, add 3 ml of 0.25% trypsin-EDTA to submerge the cells for 1 minute, remove the trypsin, place them in a cell culture incubator for 5 minutes, and gently tap the side wall of the culture flask To detach the cells, add 10 ml of medium to neutralize trypsin, pipet several times, transfer to a centrifuge tube, centrifuge at 210g for 5 minutes, pour off the supernatant, resuspend the cells with 10 ml of DMEM complete medium, count the cells, and culture them with DMEM. Dilute the cells to 5*10 ⁵ cells/ml.

4.2.8 Incubate for 1 hour, add 100 μl of cells to each well of the 96-well plate to make each well 5*10 ⁴ cells.

4.2.9 Gently shake the 96-well plate back and forth to make the cells evenly dispersed in the wells. Put the 96-well plate in a cell culture incubator and culture at 37°C and 5% CO ₂ for 20 to 28 hours.

4.2.10 After 20-28 hours, take out the 96-well plate from the cell incubator, remove 150 μl of supernatant from each sample well with a multi-channel pipette, then add 100 μl of luciferase detection reagent, and react at room temperature in the dark 2min.

4.2.11 After the reaction is completed, use a multi-channel pipette to repeatedly blow and suck the liquid in the reaction well for 6 to 8 times to fully lyse the cells. Aspirate 150 μl of the liquid from each well and add it to the corresponding 96-well chemiluminescence detection plate. Placed in a chemiluminescence detector to read the luminescence value.

4.2.12 Calculate neutralization inhibition rate: inhibition rate=[1-(mean luminescence intensity of sample group-mean value of blank control CC)/(mean luminescence intensity VC of negative group-mean value of blank control CC)]*100%.

4.2.13 Calculate IC50 by Reed-Muench method according to the results of neutralization inhibition rate. FIG. 5 shows a graph of the results of the neutralization experiment. Among them, Figure 5A shows the inhibition rate of the screened antibody sequences against SARS-CoV-2 pseudovirus; Figures 5B-5H show the antibodies RBD-R3P1-A12 (Figure 5B: A12), RBD-R3P2-A2 ( Figure 5D, 5G: A2), RBD-R3P2-B5 (Figure 5C: B5), RBD-R3P1-B6 (Figure 5E: B6), RBD-R3P1-E4 (Figure 5B, 5H: E4) and R3P2-G1 ( Figure 5F: G1) detection results of the inhibition rate of SARS-CoV-2 true virus (in Figures 5B-5H: SARS-CoV2-NP or SARS-CoV-2-NP), where antibody concentrations -1, -2, - 3 represents the concentration of 63ng, 250ng, and 1ug, respectively. According to the results of the six RBD antibodies SARS-CoV-2 pseudovirus and true virus neutralization experiments, the E4 result was the most obvious and had a significant inhibitory effect on the true virus.

The present disclosure is not intended to be limited in scope by the specifically disclosed embodiments, which are provided by way of example to illustrate various aspects of the present disclosure. Various modifications to the described compositions and methods will become apparent from the descriptions and teachings herein. Such changes may be practiced without departing from the true scope and spirit of the present disclosure, and are intended to be within the scope of the present disclosure.

Claims (19)

1. An anti-SARS-CoV-2 antibody or an antigen-binding fragment thereof, the antibody specifically binds to the SARS-CoV-2 epitope, wherein the SARS-CoV-2 epitope comprises as shown in SEQ ID NO: 1 the sequence shown.
2. The antibody or antigen-binding fragment thereof of claim 1, comprising a heavy chain variable region, wherein the sequence encoding the heavy chain variable region comprises the sequence shown in any one of SEQ ID NOs: 39-41 .
3. The antibody or antigen-binding fragment thereof of any one of claims 1-2, comprising a light chain variable region, wherein the sequence encoding the light chain variable region comprises one or more of the following sequences kind:

   (a ₁ ) the sequence shown in any one of SEQ ID NOs: 42-44;

   (a ₂ ) a sequence as shown in any one of SEQ ID NOs: 45-47;

   (a ₃ ) a sequence as shown in any one of SEQ ID NOs: 48-50;

   (a ₄ ) a sequence as shown in any one of SEQ ID NOs: 51-53;

   ( _a5 ) the sequence shown in any one of SEQ ID NOs: 54-56;

   (a ₆ ) The sequence shown in any one of SEQ ID NOs: 57-59.
4. The antibody or antigen-binding fragment thereof of any one of claims 1-3, comprising a linker, wherein the sequence encoding the linker comprises the sequence shown in SEQ ID NO:60.
5. The antibody or antigen-binding fragment thereof of claim 1, comprising a heavy chain variable region (VH) and a light chain variable region (VL), the VH comprising a VH complementarity determining region (CDR) 1, a VH complementarity determining region region (CDR) 2 and VH complementarity determining region (CDR) 3, and the VL comprises VLCDR1, VLCDR2 and VLCDR3, wherein,

   The VH is encoded by the following amino acids: VHCDR1 comprises the amino acid sequence shown in SEQ ID NO:39, VHCDR2 comprises the amino acid sequence shown in SEQ ID NO:40, and VHCDR3 comprises the amino acid sequence shown in SEQ ID NO:41 ;and

   The VL is encoded by the following amino acids: VLCDR1 comprises as described in any one of SEQ ID NO:42, SEQ ID NO:45, SEQ ID NO:48, SEQ ID NO:51, SEQ ID NO:54 or SEQ ID NO:57 The amino acid sequence shown, VLCDR2 comprises the amino acid shown in any one of SEQ ID NO:43, SEQ ID NO:46, SEQ ID NO:49, SEQ ID NO:52, SEQ ID NO:55 or SEQ ID NO:58 sequence, and VLCDR3 comprises the amino acid sequence set forth in any one of SEQ ID NO:44, SEQ ID NO:47, SEQ ID NO:50, SEQ ID NO:53, SEQ ID NO:56, or SEQ ID NO:59.
6. The antibody or antigen-binding fragment thereof of claim 5, wherein the antibody or antigen-binding fragment thereof encoding comprises one or more of the following sequences:

   (b ₁ ) VH comprises the amino acid sequence set forth in SEQ ID NO: 15, and VL comprises the amino acid sequence set forth in SEQ ID NO: 17;

   (b2 ₎ VH comprises the amino acid sequence set forth in SEQ ID NO: 19, and VL comprises the amino acid sequence set forth in SEQ ID NO: 21;

   (b3 ₎ VH comprises the amino acid sequence set forth in SEQ ID NO:23, and VL comprises the amino acid sequence set forth in SEQ ID NO:25;

   ( _b4 ) VH comprises the amino acid sequence set forth in SEQ ID NO:27, and VL comprises the amino acid sequence set forth in SEQ ID NO:29;

   ( _b5 ) VH comprises the amino acid sequence set forth in SEQ ID NO:31, and VL comprises the amino acid sequence set forth in SEQ ID NO:33;

   ( _b6 ) VH comprises the amino acid sequence set forth in SEQ ID NO:35, and VL comprises the amino acid sequence set forth in SEQ ID NO:37;

   (b ₇ ) the amino acid sequence shown in SEQ ID NO: 3, 5, 7, 9, 11 or 13.
7. A polynucleotide, wherein the polynucleotide is selected from any one of (a)-(d):

   (a) comprising, for example, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: : 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36 or SEQ ID NO: 38 The nucleotide sequence shown in any sequence or any combination thereof;

   (b) comprising, for example, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: : 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36 or SEQ ID NO: 38 The nucleotide sequence of the reverse complement of the nucleotide sequence shown in any sequence or any combination thereof ;

   (c) the reverse complement of a sequence capable of hybridizing to the nucleotide sequence shown in any one of (a)-(b) under high stringency hybridization conditions or very high stringency hybridization conditions;

   (d) The nucleotide sequence shown in any one of (a)-(c) has at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% sequences of sequence identity.
8. The polynucleotide of claim 7, wherein the polynucleotide is selected from any one of (e)-(h):

   (e) comprising the nucleotide sequence set forth in SEQ ID NO: 16 and SEQ ID NO: 18, comprising the nucleotide sequence set forth in SEQ ID NO: 20 and SEQ ID NO: 22, comprising the nucleotide sequence set forth in SEQ ID NO: 22 : 24 and the nucleotide sequence shown in SEQ ID NO: 26, comprising the nucleotide sequence shown in SEQ ID NO: 28 and SEQ ID NO: 30, comprising the nucleotide sequence shown in SEQ ID NO: 32 and SEQ ID NO: 34 the nucleotide sequence shown, or comprising the nucleotide sequence shown in SEQ ID NO: 36 and SEQ ID NO: 38;

   (f) a nucleotide sequence comprising the reverse complement of the nucleotide sequence shown in (e);

   (g) the reverse complement of a sequence capable of hybridizing to the nucleotide sequence shown in any one of (e)-(f) under high stringency hybridization conditions or very high stringency hybridization conditions;

   (h) The nucleotide sequence shown in any one of (e)-(g) has at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% sequences of sequence identity.
9. The polynucleotide of claim 8, wherein the polynucleotide is selected from any one of (i)-(l):

   (i) comprising the nucleotide sequence shown in any of SEQ ID NO: 4, 6, 8, 10, 12 or 14;

   (j) a nucleotide sequence comprising the reverse complement of the sequence shown in any of SEQ ID NO: 4, 6, 8, 10, 12 or 14;

   (k) the reverse complement of a sequence capable of hybridizing to the nucleotide sequence shown in any one of (i)-(j) under high stringency hybridization conditions or very high stringency hybridization conditions;

   (l) The nucleotide sequence shown in any one of (i)-(k) has at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, most preferably at least 99% sequences of sequence identity.
10. A vector, wherein the vector comprises the polynucleotide according to any one of claims 7-9.
11. An isolated host cell, wherein the host cell comprises the vector of claim 10.
12. A method for preparing a host cell stably expressing a target protein, wherein the method comprises the step of transforming an initial host cell using the vector of claim 10; optionally, the host cell is a Chinese hamster ovary cell.
13. A method for preparing a target protein, the method comprising using the host cell of claim 11 or by the method of claim 12 to prepare the target protein.
14. An antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof is prepared by the method of claim 13 .
15. A kit, wherein the kit comprises the antibody or antigen-binding fragment thereof according to any one of claims 1-6 or claim 14.
16. The application of the kit of claim 15 in the preparation of a kit for detecting COVID-19.
17. A pharmaceutical composition or vaccine, wherein the pharmaceutical composition or vaccine contains the antibody or antigen-binding fragment thereof according to any one of claims 1-6 or claim 14.
18. Use of the antibody or antigen-binding fragment thereof of any one of claims 1-6 or claim 14, or the pharmaceutical composition or vaccine of claim 17 in the preparation of a medicament for the treatment or prevention of COVID-19.
19. A method for treating or preventing COVID-19, wherein the antibody or antigen-binding fragment thereof of any one of claims 1-6 or claim 14, or the pharmaceutical composition or vaccine of claim 17 is administered to an animal .

Images