WO2023075766A1 - Compositions d'oligonucléotides et leurs méthodes d'utilisation - Google Patents

Compositions d'oligonucléotides et leurs méthodes d'utilisation Download PDF

Info

Publication number
WO2023075766A1
WO2023075766A1 PCT/US2021/056900 US2021056900W WO2023075766A1 WO 2023075766 A1 WO2023075766 A1 WO 2023075766A1 US 2021056900 W US2021056900 W US 2021056900W WO 2023075766 A1 WO2023075766 A1 WO 2023075766A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide
rho
oligonucleotides
linkage
sequence
Prior art date
Application number
PCT/US2021/056900
Other languages
English (en)
Inventor
Michael John Byrne
Vinod VATHIPADIEKAL
Naoki Iwamoto
Chandra Vargeese
Lankai GUO
Andrew Guzior HOSS
Original Assignee
Wave Life Sciences Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wave Life Sciences Ltd. filed Critical Wave Life Sciences Ltd.
Priority to PCT/US2021/056900 priority Critical patent/WO2023075766A1/fr
Priority to AU2021471586A priority patent/AU2021471586A1/en
Priority to CA3236136A priority patent/CA3236136A1/fr
Publication of WO2023075766A1 publication Critical patent/WO2023075766A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===

Definitions

  • Oligonucleotides are useful in various applications, e.g., therapeutic, diagnostic, and/or research applications. For example, oligonucleotides targeting various genes can be useful for treatment of conditions, disorders or diseases related to such target genes.
  • the present disclosure provides useful patterns of internucleotidic linkages [e.g., types, modifications, and/or configuration (Rp or Sp) of chiral linkage phosphorus, etc.] which, when combined with one or more other structural elements described herein, e.g., nucleobase modifications (and patterns thereof), sugar modifications (and patterns thereof), additional chemical moieties (and patterns thereof), etc., can provide oligonucleotides and compositions with high activities and/or various desired properties, e.g., high selectivity, low toxicity, etc.
  • useful patterns of internucleotidic linkages e.g., types, modifications, and/or configuration (Rp or Sp) of chiral linkage phosphorus, etc.
  • compositions of oligonucleotides wherein stereochemistry of one or more chiral internucleotidic linkages are not controlled can be particularly challenging to manufacture. Due to the existence of non-chirally controlled chiral internucleotidic linkages whose linkage phosphorus exists in both Rp and Sp in a composition, such compositions contain multiple stereoisomers: if there are n non- chirally controlled linkage phosphorus, there can be up to 2 n stereoisomers in a composition.
  • stereoisomers typically diastereomers as there are other chiral elements in oligonucleotides, may elute as a broad peak or several peaks during chromatographic purification (e.g., HPLC, UPLC, etc.).
  • oligonucleotide compositions can be very challenging to purify, and can lead to low purity products, low overall yields, high manufacturing costs, low consistency among batches, etc.
  • the present disclosure provides completely chirally controlled technologies (e.g., oligonucleotides, compositions, etc.) that address these challenges while maintaining and/or improving various properties and/or activities of oligonucleotides.
  • the present disclosure provides oligonucleotides whose chiral internucleotidic linkages are each independently controlled. In some embodiments, the present disclosure provides chirally controlled compositions of oligonucleotides wherein each chiral internucleotidic linkage of the oligonucleotides is independently chirally controlled (completely chirally controlled oligonucleotide compositions).
  • stereoselective oligonucleotide preparation technologies provide higher yield and/or purity compared to non-stereoselective technologies (e.g., in some cases for n001), which contribute to higher overall yield, higher product purity, lower costs, etc.
  • completely chirally controlled oligonucleotide compositions provide one or more comparable and/or better properties and/or activities compared to reference oligonucleotide compositions comprising non-chirally controlled chiral internucleotidic linkages.
  • the present disclosure provides completely chirally controlled oligonucleotide compositions (e.g., WV- 39023 and WV-48182) that can provide comparable or better properties and/or activities, and can be manufactured using simplified purification and/or quality control processes and/or with higher purity, higher yield, lower cost, and/or higher consistency, compared to reference oligonucleotide compositions wherein one or more chiral linkage phosphorus are not chirally controlled (e.g., WV-34326 and WV- 34327).
  • WV- 39023 and WV-48182 completely chirally controlled oligonucleotide compositions that can provide comparable or better properties and/or activities, and can be manufactured using simplified purification and/or quality control processes and/or with higher purity, higher yield, lower cost, and/or higher consistency, compared to reference oligonucleotide compositions wherein one or more chiral linkage phosphorus are not chirally controlled (e.g., WV-34326
  • nX stereorandom linkages such as those in WV-34326 and WV-34327
  • nR such as those in WV-39023 and WV-48182
  • technologies e.g., oligonucleotides, compositions, methods, etc. herein modulate levels of RHO (Rhodopsin) gene products (e.g., transcripts, proteins, etc.).
  • RHO Radopsin
  • provided technologies can provide various advantages, such as high selectivity (e.g., less off-target effects), high allele-specificity (e.g., selectively reducing transcripts containing disease-associated mutation(s) and/or products encoded thereby over transcripts containing no or fewer disease-associated mutation(s) and/or products encoded thereby) and/or high activities (e.g., effectively reducing levels and/or activities of target gene products at low concentrations).
  • a target nucleic acid is a transcript of one allele of a gene and a reference nucleic acid is a transcript of a different allele of the same gene.
  • a target nucleic acid is a transcript of a wild-type nucleic acid sequence (e.g., a wild-type RHO gene), and a reference nucleic acid is a transcript of a mutant nucleic acid sequence (e.g., a mutant RHO gene (e.g., comprising a P23H mutation).
  • a target nucleic acid is associated with a condition, disorder or disease, and a reference nucleic acid is less or is not associated with the condition, disorder or disease.
  • provided technologies selectively reduce levels, expression, and/or activities of target nucleic acids and/or products encoded thereby over those of reference nucleic acids and/or products encoded thereby.
  • sequences of reference nucleic acids when aligned with sequences of oligonucleotides of the present disclosure (or a portion thereof, e.g., a core region), sequences of reference nucleic acids contain one or more mismatches than those of target nucleic acids.
  • a target nucleic acid is fully complementary to the base sequence of an oligonucleotide (or a portion thereof, e.g., a core region) while a reference nucleic acid comprises one or more mismatches.
  • a target nucleic acid sequence and a reference nucleic acid sequence differs at one or more sites, e.g., a mutation site, a single-nucleotide polymorphism (SNP) site, etc.
  • a target nucleic acid sequence and a reference nucleic acid sequence comprise a difference at a SNP site.
  • a site in a target nucleic acid is fully complementary to a site in an oligonucleotide of the present disclosure while the corresponding site in a reference nucleic acid is not.
  • a target nucleic acid sequence and a reference nucleic acid sequence comprise a difference at a point mutation site.
  • a point mutation site in a target nucleic acid is fully complementary to a site in an oligonucleotide of the present disclosure while the corresponding point mutation site in a reference nucleic acid is not.
  • a point mutation site is RHO P23H mutation ([CCC] > H [CAC]).
  • a SNP is any SNP disclosed herein (e.g., in Table S2).
  • a SNP is SNP rs104893768.
  • the mutant allele of this SNP yields the missense variant P [CCC] > H [CAC], also known as P23H or RHO P23H mutation.
  • the RHO P23H mutation can be a dominant negative and a toxic gain-of-function mutation.
  • ER-retention of a Rhodopsin mutant with the P23H mutation can induce the unfolded protein response (UPR), aggregation of the misfolded mutant protein, and later apoptosis of rod and cone cells, and retinal degeneration, also known as retinitis pigmentosa.
  • URR unfolded protein response
  • Wild-type Rhodopsin protein reportedly forms aggregates upon cellular accumulation. Some mutations of rhodopsin such as the point mutation P23H result in greater aggregation, forming aggresomes. These aggregates reportedly cause progressive degeneration of retinal cells, leading to blindness in RP.
  • methods and compositions described herein provide for treating or delaying the onset or progression of diseases of the eye, e.g., a disorder that affects retinal cells, e.g., photoreceptor cells, including but not limited to a retinopathy or retinitis.
  • methods and compositions discussed herein provide for treating or delaying the onset or progression of a disease associating with RHO mutation (e.g., P23H) (e.g., a RHO-related disease, disorder or condition), e.g., by a RHO oligonucleotide.
  • RHO mutation e.g., P23H
  • RHO-related disease, disorder or condition e.g., by a RHO oligonucleotide.
  • provided RHO oligonucleotides are oligonucleotides targeting RHO, and can reduce levels of mutant RHO transcripts and/or one or more products encoded thereby.
  • a RHO oligonucleotide is useful for preventing, treating and delaying the onset or progression of a RHO-related condition, disorder and/or disease, including retinopathy (e.g., retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.).
  • retinopathy e.g., retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.
  • a target nucleic acid is a wild-type or mutant RHO transcript which comprises a SNP (e.g., a SNP listed in Table S2).
  • the present disclosure pertains to a method of knocking down a pathogenic or disease-associated mutant (e.g., a mutant allele) of RHO in a cell or in a patient (e.g., a patient in need thereof), wherein the cell is heterozygous at a particular position (e.g., a SNP), and the method comprises the step of introducing into the cell or administering to the patient a RHO oligonucleotide which targets a particular allele of the particular position which is in phase with the pathogenic or disease- associated mutation.
  • a pathogenic or disease-associated mutant e.g., a mutant allele
  • the genome of a patient may be heterozygous wild type/mutant, wherein the mutation is deleterious; for example, a patient may be heterozygous wild type/P23H; and at a second position, the patient is also heterozygous, wherein the second position is not necessarily linked to a RHO-related disease, disorder or condition; but one allele (e.g., allele 1 of position 2) for the second position is in phase with the wild-type variant of the first position, and a second allele (e.g., allele 2 of position 2) is in phase with the deleterious mutation in position 1; and a RHO oligonucleotide can target allele 2 of position 2 and be capable of allele-specific knockdown of allele 2 of position 2, thereby also decreasing the expression, level and/or activity of a RHO gene transcript having the deleterious mutation.
  • a RHO oligonucleotide can target allele 2 of position 2 and be capable of allele-specific knockdown of allele 2 of position 2, thereby
  • any variant of any SNP listed therein can be an allele 1 or 2 of position 2.
  • the genome of a patient suffering from a susceptible to a RHO- related disease, disorder or condition can be heterozygous at position SNP rs104893768, wherein an A allele is associated with a deleterious mutation (P23H), but a C allele is considered wild-type (non- pathogenic).
  • the same patient may be heterozygous at another position, e.g., SNP rs2269736, which might be G, A, or C, all of which are reportedly considered benign.
  • the C allele of rs2269736 is in phase with (e.g., on the same chromosome as) the mutant allele of rs104893768; and if the A allele of rs2269736 is in phase with the wild-type allele of rs104893768, then a RHO oligonucleotide which targets the C allele of rs2269736 (and also knocks down this allele), would also knock down (e.g., decrease the expression, level and/or activity of) the mutant allele.
  • a RHO oligonucleotide has a base sequence which is complementary to and hybridizes with a sequence of a RHO gene target comprising a first variant of a SNP, wherein the RHO oligonucleotide is capable of mediating knock down of the allele of RHO comprising the first variant of the SNP, and wherein the first variant of the SNP is in phase with a deleterious mutation in RHO, and wherein hybridization and knockdown occur in a cell, tissue, organ or patient which is heterozygous at the SNP.
  • a target nucleic acid is a transcript (e.g., a mutant RHO mRNA) that comprises SNP rs104893768, has an A at this SNP position, and is associated with a condition, disorder or disease [e.g., retinopathy (e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.)].
  • retinopathy e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.
  • a reference nucleic acid is a transcript (e.g., a wide-type RHO mRNA) that comprises SNP rs104893768, has an C at this SNP position, and is less, or is not, associated with a condition, disorder or disease [e.g., retinopathy (e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.)].
  • retinopathy e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.
  • a target nucleic acid is a RHO mRNA that comprises the P23H mutation.
  • a reference nuclic acid is a RHO mRNA that does not contain the P23H mutation.
  • the base sequence of a RHO oligonucleotide which targets SNP rs104893768 (e.g., as those skilled in the art will appreciate, whose base sequence is complementary to a base sequence that comprises the SNP site and its characteristic surrounding sequences in the mRNA), or P23H mutation, is, comprises, or comprises at least 10 contiguous bases (e.g., 10-15, 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) of the sequence of: GGTACTCGAAGTGGCT, GGTACTCGAAGTGGCTG, GGTACTCGAAGTGGCTGC, GGTACTCGAAGTGGCTGCG, GGTACTCGAAGTGGCTGCGT, GTACTCGAAGTGGCTGCGT, TACTCGAAGTGGCTGCGT, ACTCGAAGTGGCTGCGT, GGTACTCGAAGTGGCUGCGU, or GGUACTCG
  • the base sequence of such an oligonucleotide is or comprises , GGTACTCGAAGTGGCTGCGT, or GGTACTCGAAGTGGCUGCGU, wherein each T can be independently substituted with U and vice versa.
  • rs104893768 Allele: A (allele ID: 28052) is associated with RCV000013887.17, Retinitis pigmentosa 4, Pathogenic; and RCV000490234.1, Pathogenic.
  • a RHO oligonucleotide which targets rs104893768 e.g., as those skilled in the art will appreciate, whose base sequence is complementary to a base sequence that comprises the SNP site and its characteristic surrounding sequences in the mRNA
  • a target nucleic acid sequence is a RHO mRNA which comprises SNP rs104893768 and which is A in the mutant mRNA at this SNP position (and T in the corresponding RHO oligonucleotide), and its allele is associated with retinopathy (e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, or autosomal dominant retinitis pigmentosa, etc.).
  • a RHO gene, gene transcript, protein or other gene product comprises the mutant variant of SNP rs104893768 and has the mutation P23H.
  • a mutant RHO (or a RHO variant) comprises a disease-associated mutation.
  • a disease-associated mutation is a mutation which is associated with a particular disease, disorder or condition (in the present disclosure, for example, a RHO-related disease, disorder or condition).
  • a disease-associated mutation may be found in the genome of a patient suffering from or susceptible to a particular disease, disorder or condition (in the present disclosure, for example, a RHO-related disease, disorder or condition), but is either absent or more rarely found in the genome of a patient who is not suffering from or susceptible to the disease, disorder or condition.
  • a mutant RHO comprises a mutant allele of one or more SNP (the allele on the same DNA strand or chromosome as the disease-associated mutations). In some embodiments, a mutant RHO comprises both a disease-associated mutation and a mutant allele of a particular SNP on the same chromosomal strand.
  • a RHO oligonucleotide which targets SNP rs104893768 has a base sequence which comprises at least 10 contiguous bases of the mutant or wild-type sequence of: GGTACTCGAAGTGGCUGCGU, and GGUACTCGAAGTGGCTGCGT, wherein each T can be independently substituted with U and vice versa.
  • the base sequence of a RHO oligonucleotide which targets P23H is or comprises at least 10 (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20) contiguous bases of GGTACTCGAAGTGGCUGCGU, wherein each T can be independently substituted with U and vice versa.
  • the base sequence of a RHO oligonucleotide which targets P23H is or comprises GGTACTCGAAGTGGCUGCGU, wherein each T can be independently substituted with U and vice versa.
  • the base sequence of a RHO oligonucleotide which targets P23H is or comprises GGTACTCGAAGTGGCUGCGU.
  • the base sequence of a RHO oligonucleotide which targets P23H is GGTACTCGAAGTGGCUGCGU.
  • the sequence of a provided RHO oligonucleotide is fully complementary to a target nucleic acid sequence at a particular site, e.g., a SNP site (e.g., the sequence of the RHO oligonucleotide is complementary to the mutant isoform of the SNP), a mutation site (e.g., P23H mutation), etc., and is not complementary to a reference nucleic acid sequence at the site (e.g., the sequence of the RHO oligonucleotide is not complementary to the wild-type isoform of the SNP/mutation site).
  • a RHO oligonucleotide is allele-specific, wherein the oligonucleotide preferentially decreases the expression, level and/or activity of a mutant RHO target nucleic acid compared to a wild-type or reference RHO nucleic acid.
  • selectivity is assessed using IC50 under a condition (e.g., as shown in the Examples, if IC50 for a mutant transcript is about 0.5 uM and for a wild-type transcript is about 30 uM, the selectivity about 60 fold).
  • selectivity is at least 3 fold. In some embodiments, for an allele-specific oligonucleotide, selectivity is at least 4 fold. In some embodiments, for an allele-specific oligonucleotide, selectivity is at least 5 fold. In some embodiments, for an allele-specific oligonucleotide, selectivity is at least 10 fold.
  • a useful technology is or comprises a reporter assay as described in the Examples.
  • an allele-specific RHO oligonucleotide can reduce the expression, level and/or activity of a mutant RHO target nucleic acid by at least 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% compared to absence of the oligonucleotide (or presence of a reference oligonucleotide) at a concentration (e.g., those described in the Examples, e.g., about 0.04, 0.12, 0.37, 1.11, 3.33 or 10 uM, etc.).
  • a reduction is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. In some embodiments, the reduction is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%.
  • an allele-specific RHO oligonucleotide reduces the expression, level and/or activity of a wild-type or reference RHO target nucleic acid by no more than 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% compared to absence of the oligonucleotide (or presence of a reference oligonucleotide) at a concentration (e.g., those described in the Examples, e.g., about 0.04, 0.12, 0.37, 1.11, 3.33 or 10 uM, etc.). In some embodiments, the percentage is no more than 20%, 25%, 30%, 40%, 45%, or 50%.
  • a RHO oligonucleotide targets a RHO target nucleic acid, but outside a region known to comprise a SNP or mutation. In some embodiments, such a RHO oligonucleotide can decrease the expression, level and/or activity of both the mutant and wild-type alleles of the RHO target nucleic acid. In some embodiments, such a RHO oligonucleotide is pan-specific and can effectively reduce the expression, level and/or activity of both mutant and wild-type RHO target nucleic acids.
  • selectivity of a pan-specific oligonucleotide is no more than 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2 fold.
  • a pan-specific oligonucleotide can reduce the expression, level and/or activity of a mutant and a wild-type RHO target nucleic acid by at least 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% compared to absence of the oligonucleotide (or presence of a reference oligonucleotide) at a concentration (e.g., those described in the Examples, e.g., about 0.04, 0.12, 0.37, 1.11, 3.33 or 10 uM, etc.).
  • a pan-specific oligonucleotide can reduce the expression, level and/or activity of a mutant and a wild-type RHO target nucleic acid by at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% compared to absence of the oligonucleotide (or presence of a reference oligonucleotide).
  • the base sequence of a RHO oligonucleotide is or comprises, or comprises a span of at least 10 contiguous bases of the sequence GGTACTCGAAGTGGCT, GGTACTCGAAGTGGCTG, GGTACTCGAAGTGGCTGC, GGTACTCGAAGTGGCTGCG, GGTACTCGAAGTGGCTGCGT, GGTACTCGAAGTGGCUGCGU, GTACTCGAAGTGGCTGCGT, TACTCGAAGTGGCTGCGT, ACTCGAAGTGGCTGCGT, or CTCGAAGTGGCTGCGT, or a span thereof (e.g., 10 contiguous bases), and which does not comprise a SNP in its base sequence, and wherein each T can be independently substituted with U and vice versa.
  • a span thereof e.g. 10 contiguous bases
  • provided oligonucleotides and compositions are useful for preventing and/or treating various conditions, disorders or diseases, particularly RHO-related conditions, disorders or diseases, including retinopathy (e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.).
  • retinopathy e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.
  • provided oligonucleotides and compositions reduce levels of RHO transcripts (e.g., mRNA) and/or products encoded thereby.
  • provided oligonucleotides and compositions selectively reduce levels of RHO transcripts and/or products encoded thereby that are associated with retinopathy (e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.).
  • provided oligonucleotides and compositions selectively reduce levels of RHO transcripts comprising disease-associated mutation(s) (e.g., 36 or more) and/or products encoded thereby.
  • the present disclosure provides RHO oligonucleotides (e.g., oligonucleotides that can target a RHO gene) and compositions thereof that can reduce levels of RHO transcripts (or products thereof).
  • RHO oligonucleotides comprise a sequence that is identical with or complementary to a portion (e.g., a span of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or more contiguous bases) of a RHO gene or a product encoded thereby (e.g., a RHO mRNA).
  • RHO oligonucleotides and compositions thereof selectively reduce levels of RHO transcripts (or products thereof) that are associated with a condition, disorder or disease, e.g., retinopathy (e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.).
  • retinopathy e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.
  • the present disclosure encompasses the recognition that controlling structural elements of oligonucleotides can have a significant impact on oligonucleotide properties and/or activities, including knockdown (e.g., a decrease in the activity, expression and/or level) of a RHO target gene (or a product thereof).
  • knockdown e.g., a decrease in the activity, expression and/or level
  • retinopathy e.g., retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.
  • mutant RHO which comprises a disease-associated mutation(s).
  • knockdown is allele-specific (wherein the mutant allele of RHO is preferentially knocked down relative to the wild-type). In some embodiments, the knockdown is pan-specific (wherein both the mutant and wild-type alleles of RHO are significantly knocked down). In some embodiments, knockdown of a RHO target gene is mediated by RNase H and/or steric hindrance affecting translation. In some embodiments, knockdown of a RHO target gene is mediated by a mechanism involving RNA interference.
  • controlled structural elements of RHO oligonucleotides include but are not limited to: base sequence, chemical modifications (e.g., modifications of a sugar, base and/or internucleotidic linkage) or patterns thereof, alterations in stereochemistry (e.g., stereochemistry of a backbone chiral internucleotidic linkage) or patterns thereof, structure of a first or second wing or core, and/or conjugation with an additional chemical moiety (e.g., a carbohydrate moiety, a targeting moiety, etc.).
  • the present disclosure demonstrates that control of stereochemistry of backbone chiral centers (stereochemistry of linkage phosphorus), optionally with controlling other aspects of oligonucleotide design and/or incorporation of carbohydrate moieties, can greatly improve properties and/or activities of RHO oligonucleotides.
  • the present disclosure pertains to any RHO oligonucleotide which operates through any mechanism, and which comprises any sequence, structure or format (or portion thereof) described herein, wherein the oligonucleotide comprises at least one non-naturally-occurring modification of a base, sugar or internucleotidic linkage.
  • the present disclosure provides an oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides comprise at least one (e.g., 1-100, 1-50, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,41, 42, 43, 44, 45, or more) chirally controlled internucleotidic linkage [an internucleotidic linkage whose linkage phosphorus is in or is enriched for the Rp or Sp configuration (e.g., 80-100%, 85%-100%, 90%-100%, 95%-100%, or 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of all oligonucleotides of the same constitution in the composition share the same stereochemistry at the link
  • the number of chirally controlled internucleotidic linkages is 1-100, 1-50, 1-40, 1-35, 1-30, 1-25, 1-20, 5-100, 5-50, 5-40, 5-35, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.
  • at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or 100% of all chiral internucleotidic linkages are chirally controlled internucleotidic linkages.
  • At least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or 100% of all internucleotidic linkages are chirally controlled internucleotidic linkages. In some embodiments, at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or 100% of all chiral internucleotidic linkages are chirally controlled internucleotidic linkages and are Sp.
  • At least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, or 100% of all internucleotidic linkages are chirally controlled internucleotidic linkages and are Sp.
  • at least 1 internucleotidic linkage is chirally controlled internucleotidic linkage and is Rp.
  • at least 2 internucleotidic linkages are chirally controlled internucleotidic linkage and are Rp.
  • At least 3 internucleotidic linkages are chirally controlled internucleotidic linkage and are Rp. In some embodiments, at least 4 internucleotidic linkages are chirally controlled internucleotidic linkage and are Rp. In some embodiments, at least 5 internucleotidic linkages are chirally controlled internucleotidic linkage and are Rp. In some embodiments, pattern of backbone chiral centers of an oligonucleotide or a portion thereof (e.g., a core) is or comprises Rp(Sp) 2 .
  • pattern of backbone chiral centers of an oligonucleotide or a portion thereof is or comprises SpRp(Sp) 2 .
  • pattern of backbone chiral centers of an oligonucleotide or a portion thereof is or comprises (Rp) 2 .
  • pattern of backbone chiral centers of an oligonucleotide or a portion thereof is or comprises Sp(Rp) 2 .
  • pattern of backbone chiral centers of an oligonucleotide or a portion thereof is or comprises (Sp)m(Rp) 2 .
  • pattern of backbone chiral centers of an oligonucleotide or a portion thereof is or comprises (Np)t[(Rp)n(Sp)m]y, wherein each of t, n, m, and y is independently as described herein.
  • oligonucleotides comprising an Rp chirally controlled internucleotidic linkage at certain positions, e.g., -3, -2, ⁇ 1, +1, +2, or +3 position, relative to a differentiating position (a position whose base or whose complementary base can differentiate one nucleic acid from other nucleic acid(s) (e.g., a target nucleic acid and a reference nucleic acid, one allele from the other(s)), such as a point mutation site, a SNP site, etc.) can provide high activities and/or selectivities and, in some embodiments, can be particularly useful for reducing levels of disease- associated transcripts and/or products encoded thereby.
  • a differentiating position a position whose base or whose complementary base can differentiate one nucleic acid from other nucleic acid(s) (e.g., a target nucleic acid and a reference nucleic acid, one allele from the other(s)), such as a point mutation site,
  • ⁇ “ is counting from the nucleoside at a differentiating position toward the 5’-end of an oligonucleotide with the internucleotidic linkage at the ⁇ 1 position being the internucleotidic linkage bonded to the 5’-carbon of the nucleoside at the differentiating position
  • +“ is counting from the nucleoside at a differentiating position toward the 3’-end of an oligonucleotide with the internucleotidic linkage at the +1 position being the internucleotidic linkage bonded to the 3’-carbon of the nucleoside at the differentiating position.
  • Rp at ⁇ 3 position provided increased activity and/or selectivity. In some embodiments, Rp at ⁇ 2 position provided increased activity and/or selectivity. In some embodiments, Rp at ⁇ 1 position provided increased activity and/or selectivity. In some embodiments, Rp at +1 position provided increased activity and/or selectivity. In some embodiments, Rp at +2 position provided increased activity and/or selectivity. In some embodiments, Rp at +3 position provided increased activity and/or selectivity.
  • a RHO oligonucleotide composition the RHO oligonucleotides comprise at least one chiral internucleotidic linkage which is not chirally controlled (e.g., the RHO oligonucleotide comprises a phosphorothioate internucleotidic linkage which is not chirally controlled).
  • oligonucleotides comprise one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) non-negatively charged internucleotidic linkages.
  • oligonucleotides comprise one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) neutral internucleotidic linkages.
  • a RHO oligonucleotide comprises a non-negatively charged or neutral internucleotidic linkage.
  • the present disclosure provides an oligonucleotide, wherein the base sequence of the oligonucleotide comprises at least 10 contiguous bases of a base sequence that is identical to or complementary to a base sequence of a RHO gene or a transcript thereof, wherein the oligonucleotide comprises at least one internucleotidic linkage comprising a stereodefined linkage phosphorus, and wherein the oligonucleotide is capable of decreasing the level, expression and/or activity of a RHO target gene or a gene product thereof.
  • an additional chemical moiety is selected from: GalNAc, glucose, GluNAc (N-acetyl amine glucosamine) and anisamide moieties and derivatives thereof, or any additional chemical moiety described herein and/or known in the art.
  • an oligonucleotide can comprise two or more additional chemical moieties, wherein the additional chemical moieties are identical or non-identical, or are of the same category (e.g., carbohydrate moiety, sugar moiety, targeting moiety, etc.) or not of the same category.
  • certain additional chemical moieties facilitate delivery of oligonucleotides to desired cells, tissues and/or organs.
  • certain additional chemical moieties facilitate internalization of oligonucleotides.
  • certain additional chemical moieties increase oligonucleotide stability.
  • the present disclosure provides a chirally controlled RHO oligonucleotide composition
  • a chirally controlled RHO oligonucleotide composition comprising a plurality of RHO oligonucleotides which share: 1) a common base sequence; 2) a common pattern of backbone linkages; and 3) a common pattern of backbone chiral centers, which composition is a substantially pure preparation of a single oligonucleotide in that a non-random or controlled level of the oligonucleotides in the composition have the common base sequence, the common pattern of backbone linkages, and the common pattern of backbone chiral centers.
  • an oligonucleotide composition is a chirally controlled oligonucleotide composition comprising a plurality of RHO oligonucleotides of a particular oligonucleotide type, which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence, for oligonucleotides of the particular oligonucleotide type.
  • the present disclosure provides a chirally controlled oligonucleotide composition
  • a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides capable of directing RHO knockdown, wherein oligonucleotides of the plurality are of a particular oligonucleotide type, which composition is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence, for oligonucleotides of the particular oligonucleotide type.
  • the present disclosure provides a chirally controlled oligonucleotide composition
  • a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides capable of directing RHO knockdown, wherein oligonucleotides of the plurality are of a particular oligonucleotide type, which composition is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence, for oligonucleotides of the particular oligonucleotide type.
  • the present disclosure provides a chirally controlled oligonucleotide composition of an oligonucleotide, wherein the composition is enriched for the oligonucleotide relative to any other stereoisomers of the oligonucleotide.
  • an enrichment is about or at least about 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 fold.
  • an oligonucleotide is a pharmaceutically acceptable salt.
  • a provided RHO oligonucleotide comprises one or more blocks.
  • a block comprises one or more consecutive nucleosides, and/or nucleotides, and/or sugars, or bases, and/or internucleotidic linkages which share a common chemistry (e.g., at least one common modification of sugar, base or internucleotidic linkage, or combination or pattern thereof, or pattern of stereochemistry) which is not present in an adjacent block, or vice versa.
  • a RHO oligonucleotide comprises three or more blocks, wherein the blocks on either end are not identical and the oligonucleotide is thus asymmetric.
  • a block is a wing or a core.
  • an oligonucleotide comprises at least one wing and at least one core, wherein a wing differs structurally from a core in that a wing of an oligonucleotide comprises a structure [e.g., stereochemistry, or chemical modification at a sugar, base or internucleotidic linkage (or pattern thereof), etc.] not present in the core, or vice versa.
  • the structure of an oligonucleotide comprises a wing-core-wing structure.
  • the structure of an oligonucleotide comprises a wing-core, core-wing, or wing-core-wing structure, wherein one wing differs in structure [e.g., stereochemistry, additional chemical moiety, or chemical modification at a sugar, base or internucleotidic linkage (or pattern thereof)] from the other wing and the core (for example, an asymmetrical oligonucleotide).
  • the structure of an oligonucleotide has or comprises a wing-core, core-wing, or wing-core-wing structure, and a block is a wing or core.
  • a core is also referenced to as a gap.
  • a wing comprises a sugar modification or a pattern thereof that is absent from a core. In some embodiments, a wing comprises a sugar modification that is absent from a core. In some embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) sugars of a wing is/are independently modified. In some embodiments, each wing sugar is independently modified. In some embodiments, each sugar in a wing is the same. In some embodiments, at least one sugar in a wing is different from another sugar in the wing.
  • one or more sugar modifications and/or patterns of sugar modifications in a first wing of an oligonucleotide is/are different from one or more sugar modifications and/or patterns of sugar modifications in a second wing of the oligonucleotide (e.g., a 3’-wing).
  • a modification is a 2’-OR modification, wherein R is as described herein.
  • R is optionally substituted C 1-4 alkyl.
  • a modification is 2’-OMe.
  • a modification is a 2’-MOE.
  • a modified sugar is a high-affinity sugar, e.g., a bicyclic sugar (e.g., a LNA sugar), 2’-MOE, etc.
  • a sugar of a 3’-wing is a high-affinity sugar.
  • a 3’-wing comprises one or more, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more high-affinity sugars.
  • each sugar of a 3’-wing is independently a high-affinity sugar.
  • a high-affinity sugar is a 2’-MOE sugar.
  • each sugar of a 3’-wing independently comprises 2’-MOE.
  • a high-affinity sugar is bonded to a non-negatively charged internucleotidic linkage. In some embodiments, a high-affinity sugar is bonded to a neutral internucleotidic linkage. In some embodiments, a high-affinity sugar is bonded to two non-negatively charged internucleotidic linkages. In some embodiments, a high-affinity sugar is bonded to two neutral internucleotidic linkages. In some embodiments, a 5’-wing comprises 2-OMe modifications. In some embodiments, each 5’-wing sugar is 2’- OMe modified.
  • a wing comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) natural phosphate linkages. In some embodiments, a wing comprises one or more consecutive (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) natural phosphate linkages.
  • each internucleotidic linkage linking two wing sugars is independently a natural phosphate linkage, except the internucleotidic linkage linking the first and second wing sugar from the 5’-end of the 5’-wing (which can be a modified internucleotidic linkage, optionally chirally controlled (e.g., a Rp phosphorothioate internucleotidic linkage, a Sp phosphorothioate internucleotidic linkage, etc.)).
  • each internucleotidic linkage linking two wing sugars is independently a natural phosphate linkage, except the internucleotidic linkage linking the first and second wing sugar from the 3’-end of the 3’-wing (which can be a modified internucleotidic linkage, optionally chirally controlled (e.g., a Rp phosphorothioate internucleotidic linkage, a Sp phosphorothioate internucleotidic linkage, etc.)).
  • each wing sugar linked by a natural phosphate linkage independently comprises a 2’-OR modification.
  • R is optionally substituted methyl.
  • R is substituted methyl.
  • 2’-OR is 2’-MOE.
  • each internucleotidic linkage linking two wing sugars is independently a modified internucleotidic linkage, optionally chirally controlled.
  • each internucleotidic linkage linking two wing sugars is independently chirally controlled phosphorothioate internucleotidic linkage.
  • in a wing each internucleotidic linkage linking two wing sugars is independently chirally controlled Sp phosphorothioate internucleotidic linkage.
  • a wing comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) non-negatively charged internucleotidic linkages.
  • a 5’-wing comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) consecutive non-negatively charged internucleotidic linkages.
  • a 5’-wing comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) non-negatively charged internucleotidic linkages.
  • a 3’-wing comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) consecutive non-negatively charged internucleotidic linkages. In some embodiments, a 3’-wing comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) non-negatively charged internucleotidic linkages. In some embodiments, a wing comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) consecutive non- negatively charged internucleotidic linkages.
  • each internucleotidic linkage of a wing is independently a non-negatively charged internucleotidic linkage except the last internucleotidic linkage if the wing is a 3’-wing, or the first internucleotidic linkage if the wing is a 5’-wing.
  • a non-negatively charged internucleotidic linkage is a neutral internucleotidic linkage.
  • each non-negatively charged internucleotidic linkage is independently a neutral internucleotidic linkage.
  • oligonucleotides that comprise wings comprising non-negatively charged internucleotidic linkages can deliver high activities and/or selectivities.
  • internucleotidic linkages and patterns thereof including stereochemical patterns
  • internucleotidic linkages linking a wing nucleoside and a core nucleoside is considered part of the core.
  • an internucleotidic linkage connecting a 5’-wing nucleoside and a core nucleoside is chirally controlled and is Rp.
  • an internucleotidic linkage connecting a 5’-wing nucleoside and a core nucleoside is chirally controlled and is Sp. In some embodiments, an internucleotidic linkage connecting a 3’-wing nucleoside and a core nucleoside is chirally controlled and is Rp. In some embodiments, an internucleotidic linkage connecting a 3’-wing nucleoside and a core nucleoside is chirally controlled and is Sp.
  • a core sugar is a natural DNA sugar which comprises no substitution at the 2’ position (two ⁇ H at 2’-carbon).
  • each core sugar is a natural DNA sugar which comprises no substitution at the 2’ position (two ⁇ H at 2’-carbon).
  • a differentiating position may be located at various locations of an oligonucleotide as demonstrated herein to provide activity and/or selectivity.
  • a differentiating position of a provided oligonucleotide is complementary to a characteristic sequence element (e.g., SNP, mutation, etc.) which differentiates a target nucleic acid sequence from other sequences (e.g., reference nucleic acid sequences, other allele(s) of a target nucleic acid sequence, etc.) (such differentiating position may be referred to as a SNP or mutation location/site of a provided oligonucleotide).
  • a SNP is any RHO SNP listed in Table S2.
  • a differentiating position (e.g., a SNP location or mutation which differentiates a wild-type target sequence from a disease-associated or mutant sequence) is position 4, 5, 6, 7, 8, 9, etc.., from the 5’-end of a core region.
  • the 4 th , 5 th , 6 th , 7 th , or 8 th nucleobase of a core region is characteristic of a sequence and differentiates a sequence from another sequence (e.g., a SNP, a mutation, etc.).
  • a differentiating position is position 4 from the 5’-end of a core region.
  • a differentiating position is position 5 from the 5’-end of a core region. In some embodiments, a differentiating position is position 6 from the 5’-end of a core region. In some embodiments, a differentiating position is position 7 from the 5’- end of a core region. In some embodiments, a differentiating position is position 8 from the 5’-end of a core region. In some embodiments, a differentiating position is position 9, 10, 11, 12, etc. from the 5’-end of an oligonucleotide. In some embodiments, a differentiating position is position 9 from the 5’-end of an oligonucleotide.
  • a differentiating position is position 10 from the 5’-end of an oligonucleotide. In some embodiments, a differentiating position is position 11 from the 5’-end of an oligonucleotide. In some embodiments, a differentiating position is position 12 from the 5’-end of an oligonucleotide. [0053] In some embodiments, an oligonucleotide or oligonucleotide composition is useful for preventing or treating a condition, disorder or disease.
  • a RHO oligonucleotide or RHO oligonucleotide composition is useful for a method of treatment of a RHO-related condition, disorder or disease, such as retinopathy (e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.), in a subject in need thereof.
  • retinopathy e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.
  • an oligonucleotide or oligonucleotide composition is useful for the manufacture of a medicament for treatment of a condition, disorder or disease, such as retinopathy (e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.), in a subject in need thereof.
  • retinopathy e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.
  • a RHO oligonucleotide or RHO oligonucleotide composition is useful for the manufacture of a medicament for treatment of a RHO-related condition, disorder or disease, such as retinopathy (e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.), in a subject in need thereof.
  • retinopathy e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.
  • the present disclosure provides a pharmaceutical composition comprising a therapeutically effective amount of a provided oligonucleotide, which is optionally in a salt form.
  • an oligonucleotide is provided as its sodium salt form.
  • a pharmaceutical composition further comprises a pharmaceutically acceptable carrier.
  • the present disclosure provides methods for preventing, delaying the onset and/or development of, and/or treating a condition, disorder or disease, comprising administering to a subject susceptible thereto or suffering therefrom an effective amount of a provided oligonucleotide or a composition thereof.
  • a condition, disorder or disease is associated with a RHO mutation.
  • a condition, disorder or disease is associated with a RHO P23H mutation.
  • a condition, disorder or disease is retinopathy (e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.).
  • an administered oligonucleotide can provide reduction of levels of RHO transcripts and/or products encoded thereby (e.g., proteins).
  • a subject has a RHO mutation (e.g., P23H; can be homozygous or heterozygous).
  • an administered oligonucleotide can provide selective reduction of levels of RHO transcripts and/or products encoded thereby (e.g., proteins) that are associated with the condition, disorder or disease (e.g., those containing P23H) over those that are less associated or not associated with the condition, disorder or disease.
  • RHO transcripts and/or products encoded thereby e.g., proteins
  • e.g., proteins e.g., proteins
  • the term “a” or “an” may be understood to mean “at least one”; (ii) the term “or” may be understood to mean “and/or”; (iii) the terms “comprising”, “comprise”, “including” (whether used with “not limited to” or not), and “include” (whether used with “not limited to” or not) may be understood to encompass itemized components or steps whether presented by themselves or together with one or more additional components or steps; (iv) the term “another” may be understood to mean at least an additional/second one or more; (v) the terms “about” and “approximately” may be understood to permit standard variation as would be understood by those of ordinary skill in the art; and (vi) where ranges are provided, endpoints are included.
  • oligonucleotides and elements thereof e.g., base sequence, sugar modifications, internucleotidic linkages, linkage phosphorus stereochemistry, etc.
  • description of oligonucleotides and elements thereof is from 5’ to 3’.
  • oligonucleotides described herein may be provided and/or utilized in a salt form, particularly a pharmaceutically acceptable salt form.
  • oligonucleotides may be in various forms, e.g., acid, base or salt forms.
  • individual oligonucleotides within a composition may be considered to be of the same constitution and/or structure even though, within such composition (e.g., a liquid composition), particular such oligonucleotides might be in different salt form(s) (and may be dissolved and the oligonucleotide chain may exist as an anion form when, e.g., in a liquid composition) at a particular moment in time.
  • a composition e.g., a liquid composition
  • particular such oligonucleotides might be in different salt form(s) (and may be dissolved and the oligonucleotide chain may exist as an anion form when, e.g., in a liquid composition) at a particular moment in time.
  • individual internucleotidic linkages along an oligonucleotide chain may be in an acid (H) form, or in one of a plurality of possible salt forms (e.g., a sodium salt, or a salt of a different cation, depending on which ions might be present in the preparation or composition), and will understand that, so long as their acid forms (e.g., replacing all cations, if any, with H + ) are of the same constitution and/or structure, such individual oligonucleotides may properly be considered to be of the same constitution and/or structure.
  • H acid
  • Aliphatic means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation, or a substituted or unsubstituted monocyclic, bicyclic, or polycyclic hydrocarbon ring that is completely saturated or that contains one or more units of unsaturation (but not aromatic), or combinations thereof.
  • aliphatic groups contain 1-50 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-20 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-10 aliphatic carbon atoms.
  • aliphatic groups contain 1-9 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-8 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-7 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-6 aliphatic carbon atoms. In still other embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1, 2, 3, or 4 aliphatic carbon atoms.
  • Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl.
  • Alkenyl As used herein, the term “alkenyl” refers to an aliphatic group, as defined herein, having one or more double bonds.
  • Alkyl As used herein, the term “alkyl” is given its ordinary meaning in the art and may include saturated aliphatic groups, including straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl substituted cycloalkyl groups, and cycloalkyl substituted alkyl groups. In some embodiments, alkyl has 1-100 carbon atoms. In certain embodiments, a straight chain or branched chain alkyl has about 1-20 carbon atoms in its backbone (e.g., C 1 -C 20 for straight chain, C 2 -C 20 for branched chain), and alternatively, about 1-10.
  • cycloalkyl rings have from about 3-10 carbon atoms in their ring structure where such rings are monocyclic, bicyclic, or polycyclic, and alternatively about 5, 6 or 7 carbons in the ring structure.
  • an alkyl group may be a lower alkyl group, wherein a lower alkyl group comprises 1-4 carbon atoms (e.g., C 1 -C 4 for straight chain lower alkyls).
  • Alkynyl As used herein, the term “alkynyl” refers to an aliphatic group, as defined herein, having one or more triple bonds.
  • Analog includes any chemical moiety which differs structurally from a reference chemical moiety or class of moieties, but which is capable of performing at least one function of such a reference chemical moiety or class of moieties.
  • a nucleotide analog differs structurally from a nucleotide but performs at least one function of a nucleotide
  • a nucleobase analog differs structurally from a nucleobase but performs at least one function of a nucleobase; etc.
  • Animal refers to any member of the animal kingdom. In some embodiments, “animal” refers to humans, at any stage of development.
  • animal refers to non-human animals, at any stage of development.
  • the non- human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate and/or a pig).
  • animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish and/or worms.
  • an animal may be a transgenic animal, a genetically-engineered animal and/or a clone.
  • Antisense refers to a characteristic of an oligonucleotide or other nucleic acid having a base sequence complementary or substantially complementary to a target nucleic acid to which it is capable of hybridizing.
  • a target nucleic acid is a target gene mRNA.
  • hybridization is required for or results in at one activity, e.g., a decrease in the level, expression or activity of the target nucleic acid or a gene product thereof.
  • antisense oligonucleotide refers to an oligonucleotide complementary to a target nucleic acid.
  • an antisense oligonucleotide is capable of directing a decrease in the level, expression or activity of a target nucleic acid or a product thereof. In some embodiments, an antisense oligonucleotide is capable of directing a decrease in the level, expression or activity of the target nucleic acid or a product thereof, via a mechanism that involves RNase H, steric hindrance and/or RNA interference.
  • Aryl refers to monocyclic, bicyclic or polycyclic ring systems having a total of five to thirty ring members, wherein at least one ring in the system is aromatic.
  • an aryl group is a monocyclic, bicyclic or polycyclic ring system having a total of five to fourteen ring members, wherein at least one ring in the system is aromatic, and wherein each ring in the system contains 3 to 7 ring members.
  • an aryl group is a biaryl group.
  • aryl may be used interchangeably with the term “aryl ring.”
  • aryl refers to an aromatic ring system which includes, but is not limited to, phenyl, biphenyl, naphthyl, binaphthyl, anthracyl and the like, which may bear one or more substituents.
  • aryl is a group in which an aromatic ring is fused to one or more non–aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenanthridinyl, or tetrahydronaphthyl, and the like.
  • Chiral control refers to control of the stereochemical designation of the chiral linkage phosphorus in a chiral internucleotidic linkage within an oligonucleotide.
  • a chiral internucleotidic linkage is an internucleotidic linkage whose linkage phosphorus is chiral.
  • a control is achieved through a chiral element that is absent from the sugar and base moieties of an oligonucleotide, for example, in some embodiments, a control is achieved through use of one or more chiral auxiliaries during oligonucleotide preparation as described in the present disclosure, which chiral auxiliaries often are part of chiral phosphoramidites used during oligonucleotide preparation.
  • a person having ordinary skill in the art appreciates that conventional oligonucleotide synthesis which does not use chiral auxiliaries cannot control stereochemistry at a chiral internucleotidic linkage if such conventional oligonucleotide synthesis is used to form the chiral internucleotidic linkage.
  • the stereochemical designation of each chiral linkage phosphorus in each chiral internucleotidic linkage within an oligonucleotide is controlled.
  • Chirally controlled oligonucleotide composition refers to a composition that comprises a plurality of oligonucleotides (or nucleic acids) which share 1) a common base sequence, 2) a common pattern of backbone linkages, and 3) a common pattern of backbone phosphorus modifications, wherein the plurality of oligonucleotides (or nucleic acids) share the same linkage phosphorus stereochemistry at one or more chiral internucleotidic linkages (chirally controlled or stereodefined internucleotidic linkages, whose chiral linkage phosphorus is Rp or Sp in the composition (“stereodefined”), not a random Rp and Sp mixture as non-chirally controlled internucleotidic linkages).
  • chiral internucleotidic linkages chirally controlled or stereodefined internucleotidic linkages, whose chiral linkage phosphorus is Rp or Sp in the composition (“stereodefined”), not a random Rp and Sp
  • Level of the plurality of oligonucleotides (or nucleic acids) in a chirally controlled oligonucleotide composition is pre-determined/controlled (e.g., through chirally controlled oligonucleotide preparation to stereoselectively form one or more chiral internucleotidic linkages).
  • about 1%- 100%, (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a chirally controlled oligonucleotide composition are oligonucleotides of the plurality.
  • about 1%-100% (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%- 100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a chirally controlled oligonucleotide composition that share the common base sequence, the common pattern of backbone linkages, and the common pattern of backbone phosphorus modifications are oligonucleotides of the plurality.
  • a level is about 1%-100%, (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%- 100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a composition, or of all oligonucleotides in a composition that share a common base sequence (e.g., of a plurality of oligonucleotide or an oligonucleotide type), or of
  • the plurality of oligonucleotides share the same stereochemistry at about 1-50 (e.g., about 1-10, 1-20, 5-10, 5-20, 10-15, 10-20, 10-25, 10- 30, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) chiral internucleotidic linkages.
  • the plurality of oligonucleotides share the same stereochemistry at about 1%-100% (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90- 100%, 95-100%, 50%-90%, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%) of chiral internucleotidic linkages.
  • 1%-100% e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90- 100%, 95-10
  • oligonucleotides (or nucleic acids) of a plurality are of the same constitution.
  • level of the oligonucleotides (or nucleic acids) of the plurality is about 1%-100%, (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides (or nucleic acids) in a composition
  • each chiral internucleotidic linkage is a chiral controlled internucleotidic linkage, and the composition is a completely chirally controlled oligonucleotide composition.
  • oligonucleotides (or nucleic acids) of a plurality are structurally identical.
  • a chirally controlled internucleotidic linkage has a diastereopurity of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, typically at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%.
  • a chirally controlled internucleotidic linkage has a diastereopurity of at least 95%.
  • a chirally controlled internucleotidic linkage has a diastereopurity of at least 96%.
  • a chirally controlled internucleotidic linkage has a diastereopurity of at least 97%. In some embodiments, a chirally controlled internucleotidic linkage has a diastereopurity of at least 98%. In some embodiments, a chirally controlled internucleotidic linkage has a diastereopurity of at least 99%.
  • a percentage of a level is or is at least (DS) nc , wherein DS is a diastereopurity as described in the present disclosure (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or more) and nc is the number of chirally controlled internucleotidic linkages as described in the present disclosure (e.g., 1-50, 1-40, 1-30, 1-25, 1- 20, 5-50, 5-40, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more).
  • DS is a diastereopurity as described in the present disclosure (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or more)
  • nc is the number of chirally controlled internucleotidic linkages as described
  • level of a plurality of oligonucleotides in a composition is represented as the product of the diastereopurity of each chirally controlled internucleotidic linkage in the oligonucleotides.
  • diastereopurity of an internucleotidic linkage connecting two nucleosides in an oligonucleotide (or nucleic acid) is represented by the diastereopurity of an internucleotidic linkage of a dimer connecting the same two nucleosides, wherein the dimer is prepared using comparable conditions, in some instances, identical synthetic cycle conditions (e.g., for the linkage between Nx and Ny in an oligonucleotide ....NxNy unlike, the dimer is NxNy).
  • not all chiral internucleotidic linkages are chiral controlled internucleotidic linkages, and the composition is a partially chirally controlled oligonucleotide composition.
  • a non-chirally controlled internucleotidic linkage has a diastereopurity of less than about 80%, 75%, 70%, 65%, 60%, 55%, or of about 50%, as typically observed in stereorandom oligonucleotide compositions (e.g., as appreciated by those skilled in the art, from traditional oligonucleotide synthesis, e.g., the phosphoramidite method).
  • oligonucleotides (or nucleic acids) of a plurality are of the same type.
  • a chirally controlled oligonucleotide composition comprises non-random or controlled levels of individual oligonucleotide or nucleic acids types. For instance, in some embodiments a chirally controlled oligonucleotide composition comprises one and no more than one oligonucleotide type. In some embodiments, a chirally controlled oligonucleotide composition comprises more than one oligonucleotide type. In some embodiments, a chirally controlled oligonucleotide composition comprises multiple oligonucleotide types.
  • a chirally controlled oligonucleotide composition is a composition of oligonucleotides of an oligonucleotide type, which composition comprises a non-random or controlled level of a plurality of oligonucleotides of the oligonucleotide type.
  • Comparable is used herein to describe two (or more) sets of conditions or circumstances that are sufficiently similar to one another to permit comparison of results obtained or phenomena observed.
  • comparable sets of conditions or circumstances are characterized by a plurality of substantially identical features and one or a small number of varied features.
  • Cycloaliphatic The term “cycloaliphatic,” “carbocycle,” “carbocyclyl,” “carbocyclic radical,” and “carbocyclic ring,” are used interchangeably, and as used herein, refer to saturated or partially unsaturated, but non-aromatic, cyclic aliphatic monocyclic, bicyclic, or polycyclic ring systems, as described herein, having, unless otherwise specified, from 3 to 30 ring members.
  • Cycloaliphatic groups include, without limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, norbornyl, adamantyl, and cyclooctadienyl.
  • a cycloaliphatic group has 3–6 carbons.
  • a cycloaliphatic group is saturated and is cycloalkyl.
  • cycloaliphatic may also include aliphatic rings that are fused to one or more aromatic or nonaromatic rings, such as decahydronaphthyl or tetrahydronaphthyl.
  • a cycloaliphatic group is bicyclic.
  • a cycloaliphatic group is tricyclic.
  • a cycloaliphatic group is polycyclic.
  • cycloaliphatic refers to C 3 -C 6 monocyclic hydrocarbon, or C 8 -C 10 bicyclic or polycyclic hydrocarbon, that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule, or a C 9 -C 16 polycyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule.
  • Dosing regimen refers to a set of unit doses (typically more than one) that are administered individually to a subject, typically separated by periods of time.
  • a given therapeutic agent has a recommended dosing regimen, which may involve one or more doses.
  • a dosing regimen comprises a plurality of doses each of which are separated from one another by a time period of the same length; in some embodiments, a dosing regimen comprises a plurality of doses and at least two different time periods separating individual doses. In some embodiments, all doses within a dosing regimen are of the same unit dose amount.
  • a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount different from the first dose amount. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount same as the first dose amount.
  • Gapmer refers to an oligonucleotide characterized in that it comprises a core flanked by a 5’ and a 3’ wing.
  • a gapmer in a gapmer, at least one internucleotidic phosphorus linkage of the oligonucleotide is a natural phosphate linkage. In some embodiments, more than one internucleotidic phosphorus linkage of the oligonucleotide strand is a natural phosphate linkage.
  • a gapmer is a sugar modification gapmer, wherein each wing sugar independently comprises a sugar modification, and no core sugar comprises a sugar modification found in a wing sugar. In some embodiments, each core sugar comprises no modification and are 2’- unsubstituted (as in natural DNA). In some embodiments, each wing sugar is independently a 2’-modified sugar.
  • At least one wing sugar is a bicyclic sugar.
  • sugar units in each wing have the same sugar modification (e.g., 2’-OMe (a 2’-OMe wing), 2’-MOE (a 2’-MOE wing), etc.).
  • each wing sugar has the same modification.
  • Core and wing can have various lengths.
  • a wing is 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleosides (in many embodiments, 3, 4, 5, or 6 or more) in length
  • a core is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleosides (in many embodiments, 8, 9, 10, 11, 12, or more) in length.
  • an oligonucleotide comprises or consists of a wing-core-wing structure of 2-9-6, 3-9-3, 3-9-4, 3-9-5, 4-7-4, 4- 9-4, 4-9-5, 4-10-5, 4-11-4, 4-11-5, 5-7-5, 5-8-6, 5-9-3, 5-9-5, 5-10-4, 5-10-5, 6-7-6, 6-8-5, or 6-9-2.
  • an oligonucleotide is a gapmer.
  • Heteroaliphatic The term “heteroaliphatic”, as used herein, is given its ordinary meaning in the art and refers to aliphatic groups as described herein in which one or more carbon atoms are independently replaced with one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, and the like). In some embodiments, one or more units selected from C, CH, CH 2 , and CH 3 are independently replaced by one or more heteroatoms (including oxidized and/or substituted forms thereof). In some embodiments, a heteroaliphatic group is heteroalkyl. In some embodiments, a heteroaliphatic group is heteroalkenyl.
  • Heteroalkyl The term “heteroalkyl”, as used herein, is given its ordinary meaning in the art and refers to alkyl groups as described herein in which one or more carbon atoms are independently replaced with one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, and the like).
  • heteroalkyl groups include, but are not limited to, alkoxy, poly(ethylene glycol)-, alkyl- substituted amino, tetrahydrofuranyl, piperidinyl, morpholinyl, etc.
  • Heteroaryl refers to monocyclic, bicyclic or polycyclic ring systems having a total of five to thirty ring members, wherein at least one ring in the system is aromatic and at least one aromatic ring atom is a heteroatom.
  • a heteroaryl group is a group having 5 to 10 ring atoms (i.e., monocyclic, bicyclic or polycyclic), in some embodiments 5, 6, 9, or 10 ring atoms.
  • a heteroaryl group has 6, 10, or 14 ⁇ electrons shared in a cyclic array; and having, in addition to carbon atoms, from one to five heteroatoms.
  • Heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl.
  • a heteroaryl is a heterobiaryl group, such as bipyridyl and the like.
  • heteroaryl and heteroheteroar— also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings, where the radical or point of attachment is on the heteroaromatic ring.
  • Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H–quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3– b]–1,4–oxazin–3(4H)–one.
  • heteroaryl group may be monocyclic, bicyclic or polycyclic.
  • heteroaryl may be used interchangeably with the terms “heteroaryl ring,” “heteroaryl group,” or “heteroaromatic,” any of which terms include rings that are optionally substituted.
  • heteroarylkyl refers to an alkyl group substituted by a heteroaryl group, wherein the alkyl and heteroaryl portions independently are optionally substituted.
  • a heteroatom is boron, oxygen, sulfur, nitrogen, phosphorus, or silicon (including oxidized forms of nitrogen, sulfur, phosphorus, or silicon; charged forms of nitrogen (e.g., quaternized forms, forms as in iminium groups, etc.), phosphorus, sulfur, oxygen; etc.).
  • a heteroatom is oxygen, sulfur or nitrogen.
  • Heterocycle As used herein, the terms “heterocycle,” “heterocyclyl,” “heterocyclic radical,” and “heterocyclic ring”, as used herein, are used interchangeably and refer to a monocyclic, bicyclic or polycyclic ring moiety (e.g., 3-30 membered) that is saturated or partially unsaturated and has one or more heteroatom ring atoms.
  • a heterocyclyl group is a stable 5– to 7– membered monocyclic or 7– to 10–membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated, and having, in addition to carbon atoms, one or more, preferably one to four, heteroatoms, as defined above.
  • nitrogen includes substituted nitrogen.
  • the nitrogen may be N (as in 3,4–dihydro–2H– pyrrolyl), NH (as in pyrrolidinyl), or + NR (as in N–substituted pyrrolidinyl).
  • a heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure and any of the ring atoms can be optionally substituted.
  • saturated or partially unsaturated heterocyclic radicals include, without limitation, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl.
  • heterocycle used interchangeably herein, and also include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or cycloaliphatic rings, such as indolinyl, 3H–indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl.
  • a heterocyclyl group may be monocyclic, bicyclic or polycyclic.
  • heterocyclylalkyl refers to an alkyl group substituted by a heterocyclyl, wherein the alkyl and heterocyclyl portions independently are optionally substituted.
  • Homology “Homology” or “identity” or “similarity” refers to sequence similarity between two nucleic acid molecules. Homology and identity can each be determined by comparing a position in each sequence which can be aligned for purposes of comparison.
  • the molecules are identical at that position; when the equivalent site occupied by the same or a similar nucleic acid residue (e.g., similar in steric and/or electronic nature), then the molecules can be referred to as homologous (similar) at that position.
  • Expression as a percentage of homology/similarity or identity refers to a function of the number of identical or similar nucleic acids at positions shared by the compared sequences.
  • a sequence which is “unrelated” or “non-homologous” shares less than 40% identity, less than 35% identity, less than 30% identity, or less than 25% identity with a sequence described herein.
  • polymeric molecules e.g., oligonucleotides, nucleic acids, proteins, etc. are considered to be “homologous” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical.
  • polymeric molecules are considered to be “homologous” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% similar.
  • the term “homology” describes a mathematically based comparison of sequence similarities which is used to identify genes with similar functions or motifs.
  • the nucleic acid sequences described herein can be used as a “query sequence” to perform a search against public databases, for example, to identify other family members, related sequences or homologs. In some embodiments, such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al.
  • Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res.25(17):3389-3402.
  • the default parameters of the respective programs e.g., XBLAST and BLAST
  • XBLAST and BLAST See www.ncbi.nlm.nih.gov).
  • Identity refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., oligonucleotides, DNA, RNA, etc.) and/or between polypeptide molecules.
  • polymeric molecules are considered to be “substantially identical” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical.
  • Calculation of the percent identity of two nucleic acid or polypeptide sequences can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes).
  • the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of a reference sequence. The nucleotides at corresponding positions are then compared.
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences.
  • the comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4: 11-17), which has been incorporated into the ALIGN program (version 2.0).
  • nucleic acid sequence comparisons made with the ALIGN program use a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
  • the percent identity between two nucleotide sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix.
  • Internucleotidic linkage refers generally to a linkage linking nucleoside units of an oligonucleotide or a nucleic acid.
  • an internucleotidic linkage is a modified internucleotidic linkage (not a natural phosphate linkage).
  • an internucleotidic linkage is a “modified internucleotidic linkage” wherein at least one oxygen atom or ⁇ OH of a phosphodiester linkage is replaced by a different organic or inorganic moiety.
  • a modified internucleotidic linkage is a phosphorothioate linkage.
  • an internucleotidic linkage is one of, e.g., PNA (peptide nucleic acid) or PMO (phosphorodiamidate Morpholino oligomer) linkage.
  • a modified internucleotidic linkage is a non-negatively charged internucleotidic linkage.
  • a modified internucleotidic linkage is a neutral internucleotidic linkage (e.g., n001 in certain provided oligonucleotides).
  • a modified internucleotidic linkages is a modified internucleotidic linkages designated as s, s1, s2, s3, s4, s5, s6, s7, s8, s9, s10, s11, s12, s13, s14, s15, s16, s17 and s18 as described in WO 2017/210647.
  • in vitro refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within an organism (e.g., animal, plant and/or microbe).
  • in vivo refers to events that occur within an organism (e.g., animal, plant and/or microbe).
  • Linkage phosphorus as defined herein, the phrase “linkage phosphorus” is used to indicate that the particular phosphorus atom being referred to is the phosphorus atom present in the internucleotidic linkage, which phosphorus atom corresponds to the phosphorus atom of a phosphodiester internucleotidic linkage as occurs in naturally occurring DNA and RNA.
  • a linkage phosphorus atom is in a modified internucleotidic linkage, wherein each oxygen atom of a phosphodiester linkage is optionally and independently replaced by an organic or inorganic moiety.
  • a linkage phosphorus atom is the P of Formula I as defined herein.
  • a linkage phosphorus atom is chiral. In some embodiments, a linkage phosphorus atom is achiral (e.g., as in natural phosphate linkages).
  • Linker The terms “linker”, “linking moiety” and the like refer to any chemical moiety which connects one chemical moiety to another. As appreciated by those skilled in the art, a linker can be bivalent or trivalent or more, depending on the number of chemical moieties the linker connects. In some embodiments, a linker is a moiety which connects one oligonucleotide to another oligonucleotide in a multimer.
  • a linker is a moiety optionally positioned between the terminal nucleoside and the solid support or between the terminal nucleoside and another nucleoside, nucleotide, or nucleic acid.
  • a linker connects a chemical moiety (e.g., a targeting moiety, a lipid moiety, a carbohydrate moiety, etc.) with an oligonucleotide chain (e.g., through its 5’-end, 3’-end, nucleobase, sugar, internucleotidic linkage, etc.)
  • a chemical moiety e.g., a targeting moiety, a lipid moiety, a carbohydrate moiety, etc.
  • an oligonucleotide chain e.g., through its 5’-end, 3’-end, nucleobase, sugar, internucleotidic linkage, etc.
  • Example lower alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl.
  • Lower haloalkyl The term “lower haloalkyl” refers to a C 1-4 straight or branched alkyl group that is substituted with one or more halogen atoms.
  • Modified nucleobase The terms "modified nucleobase”, “modified base” and the like refer to a chemical moiety which is chemically distinct from a nucleobase, but which is capable of performing at least one function of a nucleobase.
  • a modified nucleobase is a nucleobase which comprises a modification.
  • a modified nucleobase is capable of at least one function of a nucleobase, e.g., forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases.
  • a modified nucleobase is substituted A, T, C, G, or U, or a substituted tautomer of A, T, C, G, or U.
  • a modified nucleobase in the context of oligonucleotides refer to a nucleobase that is not A, T, C, G or U.
  • Modified nucleoside refers to a moiety derived from or chemically similar to a natural nucleoside, but which comprises a chemical modification which differentiates it from a natural nucleoside.
  • modified nucleosides include those which comprise a modification at the base and/or the sugar.
  • modified nucleosides include those with a 2’ modification at a sugar.
  • modified nucleosides also include abasic nucleosides (which lack a nucleobase).
  • a modified nucleoside is capable of at least one function of a nucleoside, e.g., forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases.
  • Modified nucleotide includes any chemical moiety which differs structurally from a natural nucleotide but is capable of performing at least one function of a natural nucleotide.
  • a modified nucleotide comprises a modification at a sugar, base and/or internucleotidic linkage.
  • a modified nucleotide comprises a modified sugar, modified nucleobase and/or modified internucleotidic linkage.
  • a modified nucleotide is capable of at least one function of a nucleotide, e.g., forming a subunit in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases.
  • Modified sugar refers to a moiety that can replace a sugar.
  • a modified sugar mimics the spatial arrangement, electronic properties, or some other physicochemical property of a sugar.
  • a modified sugar is substituted ribose or deoxyribose.
  • a modified sugar comprises a 2’-modification. Examples of useful 2’-modification are widely utilized in the art and described herein.
  • a 2’-modification is 2’-OR, wherein R is optionally substituted C 1-10 aliphatic.
  • a 2’-modification is 2’-OMe.
  • a 2’-modification is 2’-MOE.
  • a modified sugar is a bicyclic sugar (e.g., a sugar used in LNA, BNA, etc.).
  • a modified sugar is a sugar that is not ribose or deoxyribose as typically found in natural RNA or DNA.
  • Nucleic acid includes any nucleotides and polymers thereof.
  • polynucleotide refers to a polymeric form of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA) or a combination thereof. These terms refer to the primary structure of the molecules and, thus, include double- and single-stranded DNA, and double- and single-stranded RNA.
  • RNA or DNA comprising modified nucleotides and/or modified polynucleotides, such as, though not limited to, methylated, protected and/or capped nucleotides or polynucleotides.
  • the terms encompass poly- or oligo- ribonucleotides (RNA) and poly- or oligo-deoxyribonucleotides (DNA); RNA or DNA derived from N- glycosides or C-glycosides of nucleobases and/or modified nucleobases; nucleic acids derived from sugars and/or modified sugars; and nucleic acids derived from phosphate bridges and/or modified internucleotidic linkages.
  • RNA poly- or oligo- ribonucleotides
  • DNA poly- or oligo-deoxyribonucleotides
  • RNA or DNA derived from N- glycosides or C-glycosides of nucleobases and/or modified nucleobases
  • nucleic acids containing any combinations of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges or modified internucleotidic linkages examples include, and are not limited to, nucleic acids containing ribose moieties, nucleic acids containing deoxy- ribose moieties, nucleic acids containing both ribose and deoxyribose moieties, nucleic acids containing ribose and modified ribose moieties.
  • nucleobase refers to the parts of nucleic acids that are involved in the hydrogen-bonding that binds one nucleic acid strand to another complementary strand in a sequence specific manner. The most common naturally-occurring nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T).
  • a naturally-occurring nucleobases are modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a naturally-occurring nucleobases are methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a nucleobase comprises a heteroaryl ring wherein a ring atom is nitrogen, and when in a nucleoside, the nitrogen is bonded to a sugar moiety.
  • a nucleobase comprises a heterocyclic ring wherein a ring atom is nitrogen, and when in a nucleoside, the nitrogen is bonded to a sugar moiety.
  • a nucleobase is a “modified nucleobase,” a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T).
  • a modified nucleobase is substituted A, T, C, G or U.
  • a modified nucleobase is a substituted tautomer of A, T, C, G, or U.
  • a modified nucleobases is methylated adenine, guanine, uracil, cytosine, or thymine.
  • a modified nucleobase mimics the spatial arrangement, electronic properties, or some other physicochemical property of the nucleobase and retains the property of hydrogen-bonding that binds one nucleic acid strand to another in a sequence specific manner.
  • a modified nucleobase can pair with all of the five naturally occurring bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting the melting behavior, recognition by intracellular enzymes or activity of the oligonucleotide duplex.
  • nucleobase also encompasses structural analogs used in lieu of natural or naturally-occurring nucleotides, such as modified nucleobases and nucleobase analogs.
  • a nucleobase is optionally substituted A, T, C, G, or U, or an optionally substituted tautomer of A, T, C, G, or U.
  • a “nucleobase” refers to a nucleobase unit in an oligonucleotide or a nucleic acid (e.g., A, T, C, G or U as in an oligonucleotide or a nucleic acid).
  • nucleoside refers to a moiety wherein a nucleobase or a modified nucleobase is covalently bound to a sugar or a modified sugar.
  • a nucleoside is a natural nucleoside, e.g., adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, or deoxycytidine.
  • a nucleoside is a modified nucleoside, e.g., a substituted natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine.
  • a nucleoside is a modified nucleoside, e.g., a substituted tautomer of a natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine.
  • a “nucleoside” refers to a nucleoside unit in an oligonucleotide or a nucleic acid.
  • Nucleoside analog refers to a chemical moiety which is chemically distinct from a natural nucleoside, but which is capable of performing at least one function of a nucleoside.
  • a nucleoside analog comprises an analog of a sugar and/or an analog of a nucleobase.
  • a modified nucleoside is capable of at least one function of a nucleoside, e.g., forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising a complementary sequence of bases.
  • Nucleotide refers to a monomeric unit of a polynucleotide that consists of a nucleobase, a sugar, and one or more internucleotidic linkages (e.g., phosphate linkages in natural DNA and RNA).
  • the naturally occurring bases [guanine, (G), adenine, (A), cytosine, (C), thymine, (T), and uracil (U)] are derivatives of purine or pyrimidine, though it should be understood that naturally and non-naturally occurring base analogs are also included.
  • the naturally occurring sugar is the pentose (five-carbon sugar) deoxyribose (which forms DNA) or ribose (which forms RNA), though it should be understood that naturally and non-naturally occurring sugar analogs are also included. Nucleotides are linked via internucleotidic linkages to form nucleic acids, or polynucleotides.
  • a natural nucleotide comprises a naturally occurring base, sugar and internucleotidic linkage.
  • nucleotide also encompasses structural analogs used in lieu of natural or naturally-occurring nucleotides, such as modified nucleotides and nucleotide analogs.
  • a “nucleotide” refers to a nucleotide unit in an oligonucleotide or a nucleic acid.
  • Oligonucleotide refers to a polymer or oligomer of nucleotides, and may contain any combination of natural and non-natural nucleobases, sugars, and internucleotidic linkages.
  • Oligonucleotides can be single-stranded or double-stranded.
  • a single-stranded oligonucleotide can have double-stranded regions (formed by two portions of the single-stranded oligonucleotide) and a double-stranded oligonucleotide, which comprises two oligonucleotide chains, can have single-stranded regions for example, at regions where the two oligonucleotide chains are not complementary to each other.
  • Example oligonucleotides include, but are not limited to structural genes, genes including control and termination regions, self-replicating systems such as viral or plasmid DNA, single-stranded and double-stranded RNAi agents and other RNA interference reagents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, ribozymes, microRNAs, microRNA mimics, supermirs, aptamers, antimirs, antagomirs, Ul adaptors, triplex-forming oligonucleotides, G-quadruplex oligonucleotides, RNA activators, immuno-stimulatory oligonucleotides, and decoy oligonucleotides.
  • RNAi agents or iRNA agents RNA interference reagents
  • shRNA antisense oligonucleotides
  • ribozymes microRNAs
  • microRNA mimics supermirs
  • aptamers antimirs
  • Oligonucleotides of the present disclosure can be of various lengths. In particular embodiments, oligonucleotides can range from about 2 to about 200 nucleosides in length. In various related embodiments, oligonucleotides, single-stranded, double-stranded, or triple-stranded, can range in length from about 4 to about 10 nucleosides, from about 10 to about 50 nucleosides, from about 20 to about 50 nucleosides, from about 15 to about 30 nucleosides, from about 20 to about 30 nucleosides in length. In some embodiments, the oligonucleotide is from about 9 to about 39 nucleosides in length.
  • the oligonucleotide is at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleosides in length. In some embodiments, the oligonucleotide is at least 4 nucleosides in length. In some embodiments, the oligonucleotide is at least 5 nucleosides in length. In some embodiments, the oligonucleotide is at least 6 nucleosides in length. In some embodiments, the oligonucleotide is at least 7 nucleosides in length. In some embodiments, the oligonucleotide is at least 8 nucleosides in length.
  • the oligonucleotide is at least 9 nucleosides in length. In some embodiments, the oligonucleotide is at least 10 nucleosides in length. In some embodiments, the oligonucleotide is at least 11 nucleosides in length. In some embodiments, the oligonucleotide is at least 12 nucleosides in length. In some embodiments, the oligonucleotide is at least 15 nucleosides in length. In some embodiments, the oligonucleotide is at least 15 nucleosides in length. In some embodiments, the oligonucleotide is at least 16 nucleosides in length.
  • the oligonucleotide is at least 17 nucleosides in length. In some embodiments, the oligonucleotide is at least 18 nucleosides in length. In some embodiments, the oligonucleotide is at least 19 nucleosides in length. In some embodiments, the oligonucleotide is at least 20 nucleosides in length. In some embodiments, the oligonucleotide is at least 25 nucleosides in length. In some embodiments, the oligonucleotide is at least 30 nucleosides in length. In some embodiments, the oligonucleotide is a duplex of complementary strands of at least 18 nucleosides in length.
  • the oligonucleotide is a duplex of complementary strands of at least 21 nucleosides in length.
  • each nucleoside counted in an oligonucleotide length independently comprises A, T, C, G, or U, or optionally substituted A, T, C, G, or U, or an optionally substituted tautomer of A, T, C, G or U.
  • Oligonucleotide type is used to define an oligonucleotide that has a particular base sequence, pattern of backbone linkages (i.e., pattern of internucleotidic linkage types, for example, phosphate, phosphorothioate, phosphorothioate triester, etc.), pattern of backbone chiral centers [i.e., pattern of linkage phosphorus stereochemistry (Rp/Sp)], and pattern of backbone phosphorus modifications (e.g., pattern of “ ⁇ XLR 1 ” groups in Formula I as defined herein).
  • backbone linkages i.e., pattern of internucleotidic linkage types, for example, phosphate, phosphorothioate, phosphorothioate triester, etc.
  • pattern of backbone chiral centers i.e., pattern of linkage phosphorus stereochemistry (Rp/Sp)
  • pattern of backbone phosphorus modifications e.g., pattern of “ ⁇ XLR
  • oligonucleotides of a common designated “type” are structurally identical to one another.
  • synthetic methods of the present disclosure provide for a degree of control during the synthesis of an oligonucleotide strand such that each nucleotide unit of the oligonucleotide strand can be designed and/or selected in advance to have a particular stereochemistry at the linkage phosphorus and/or a particular modification at the linkage phosphorus, and/or a particular base, and/or a particular sugar.
  • an oligonucleotide strand is designed and/or selected in advance to have a particular combination of stereocenters at the linkage phosphorus.
  • an oligonucleotide strand is designed and/or determined to have a particular combination of modifications at the linkage phosphorus. In some embodiments, an oligonucleotide strand is designed and/or selected to have a particular combination of bases. In some embodiments, an oligonucleotide strand is designed and/or selected to have a particular combination of one or more of the above structural characteristics. In some embodiments, the present disclosure provides compositions comprising or consisting of a plurality of oligonucleotide molecules (e.g., chirally controlled oligonucleotide compositions). In some embodiments, all such molecules are of the same type (i.e., are structurally identical to one another).
  • compositions comprise a plurality of oligonucleotides of different types, typically in pre-determined relative amounts.
  • oligonucleotides of the disclosure may contain optionally substituted and/or substituted moieties.
  • substituted whether preceded by the term “optionally” or not, means that one or more hydrogens of the designated moiety are replaced with a suitable substituent.
  • an “optionally substituted” group may have a suitable substituent at each substitutable position of the group, and when more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituent may be either the same or different at every position.
  • an optionally substituted group is unsubstituted.
  • Combinations of substituents envisioned by this disclosure are preferably those that result in the formation of stable or chemically feasible compounds.
  • stable refers to compounds that are not substantially altered when subjected to conditions to allow for their production, detection, and, in certain embodiments, their recovery, purification, and use for one or more of the purposes disclosed herein. Certain substituents are described below.
  • Suitable monovalent substituents on R ⁇ are independently halogen, —(CH 2 ) 0–2 R ⁇ , – (haloR ⁇ ), –(CH 2 ) 0–2 OH, –(CH 2 ) 0–2 OR ⁇ , –(CH 2 ) 0–2 CH(OR ⁇ ) 2 ; ⁇ O(haloR ⁇ ), –CN, –N 3 , –(CH 2 ) 0–2 C(O)R ⁇ , – (CH 2 ) 0–2 C(O)OH, –(CH 2 ) 0–2 C(O)OR ⁇ , –(CH 2 ) 0–2 SR ⁇ , –(CH 2 ) 0–2 SH, –(CH 2 ) 0–2 NH 2 , –(CH 2 )
  • Suitable divalent substituents that are bound to vicinal substitutable carbons of an “optionally substituted” group include: –O(CR * 2) 2–3 O–, wherein each independent occurrence of R * is selected from hydrogen, C 1–6 aliphatic which may be substituted as defined below, and an unsubstituted 5–6–membered saturated, partially unsaturated, and aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • Suitable substituents on the aliphatic group of R * are independently halogen, ⁇ R ⁇ , -(haloR ⁇ ), –OH, –OR ⁇ , –O(haloR ⁇ ), –CN, –C(O)OH, –C(O)OR ⁇ , –NH 2 , –NHR ⁇ , –NR ⁇ 2 , or –NO 2 , wherein each R ⁇ is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently C 1–4 aliphatic, –CH 2 Ph, –O(CH 2 ) 0–1 Ph, or a 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • suitable substituents on a substitutable nitrogen are independently –R ⁇ , –NR ⁇ 2, –C(O)R ⁇ , –C(O)OR ⁇ , –C(O)C(O)R ⁇ , –C(O)CH 2 C(O)R ⁇ , –S(O) 2 R ⁇ , ⁇ S(O) 2 NR ⁇ 2, –C(S)NR ⁇ 2, – C(NH)NR ⁇ 2, or –N(R ⁇ )S(O) 2 R ⁇ ; wherein each R ⁇ is independently hydrogen, C 1–6 aliphatic which may be substituted as defined below, unsubstituted –OPh, or an unsubstituted 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or, notwithstanding the definition above, two independent occurrences of R ⁇
  • Suitable substituents on the aliphatic group of R ⁇ are independently halogen, ⁇ R ⁇ , -(haloR ⁇ ), –OH, –OR ⁇ , –O(haloR ⁇ ), –CN, –C(O)OH, –C(O)OR ⁇ , –NH 2 , –NHR ⁇ , –NR ⁇ 2 , or –NO 2 , wherein each R ⁇ is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently C 1–4 aliphatic, –CH 2 Ph, –O(CH 2 ) 0–1 Ph, or a 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.
  • P-modification refers to any modification at the linkage phosphorus other than a stereochemical modification.
  • a P-modification comprises addition, substitution, or removal of a pendant moiety covalently attached to a linkage phosphorus.
  • Parenteral The phrases “parenteral administration” and “administered parenterally” as used herein have their art-understood meaning referring to modes of administration other than enteral and topical administration, usually by injection, and include, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticulare, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion.
  • Partially unsaturated As used herein, the term “partially unsaturated” refers to a ring moiety that includes at least one double or triple bond.
  • composition refers to an active agent, formulated together with one or more pharmaceutically acceptable carriers.
  • an active agent is present in unit dose amount appropriate for administration in a therapeutic regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population.
  • compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream, or foam; sublingually; ocularly; transdermally; or nasally, pulmonary, and to other mucosal surfaces.
  • oral administration for example, drenches (aqueous or non-aqueous solutions or suspension
  • compositions or vehicles which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • pharmaceutically acceptable carrier means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.
  • Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient.
  • materials which can serve as pharmaceutically- acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide
  • compositions that are appropriate for use in pharmaceutical contexts, i.e., salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio.
  • Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge, et al. describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977).
  • pharmaceutically acceptable salt include, but are not limited to, nontoxic acid addition salts, which are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange.
  • nontoxic acid addition salts which are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange.
  • pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate
  • a provided compound comprises one or more acidic groups, e.g., an oligonucleotide, and a pharmaceutically acceptable salt is an alkali, alkaline earth metal, or ammonium (e.g., an ammonium salt of N(R) 3 , wherein each R is independently defined and described in the present disclosure) salt.
  • Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like.
  • a pharmaceutically acceptable salt is a sodium salt.
  • a pharmaceutically acceptable salt is a potassium salt.
  • a pharmaceutically acceptable salt is a calcium salt.
  • pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, alkyl having from 1 to 6 carbon atoms, sulfonate and aryl sulfonate.
  • a provided compound comprises more than one acid groups, for example, an oligonucleotide may comprise two or more acidic groups (e.g., in natural phosphate linkages and/or modified internucleotidic linkages).
  • a pharmaceutically acceptable salt, or generally a salt, of such a compound comprises two or more cations, which can be the same or different.
  • all ionizable hydrogen e.g., in an aqueous solution with a pKa no more than about 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2; in some embodiments, no more than about 7; in some embodiments, no more than about 6; in some embodiments, no more than about 5; in some embodiments, no more than about 4; in some embodiments, no more than about 3 in the acidic groups are replaced with cations.
  • each phosphorothioate and phosphate group independently exists in its salt form (e.g., if sodium salt, ⁇ O ⁇ P(O)(SNa) ⁇ O ⁇ and ⁇ O ⁇ P(O)(ONa) ⁇ O ⁇ , respectively).
  • each phosphorothioate and phosphate internucleotidic linkage independently exists in its salt form (e.g., if sodium salt, ⁇ O ⁇ P(O)(SNa) ⁇ O ⁇ and ⁇ O ⁇ P(O)(ONa) ⁇ O ⁇ , respectively).
  • a pharmaceutically acceptable salt is a sodium salt of an oligonucleotide.
  • a pharmaceutically acceptable salt is a sodium salt of an oligonucleotide, wherein each acidic phosphate and modified phosphate group (e.g., phosphorothioate, phosphate, etc.), if any, exists as a salt form (all sodium salt).
  • Protecting group The term “protecting group,” as used herein, is well known in the art and includes those described in detail in Protecting Groups in Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3 rd edition, John Wiley & Sons, 1999, the entirety of which is incorporated herein by reference.
  • Suitable amino–protecting groups include methyl carbamate, ethyl carbamante, 9–fluorenylmethyl carbamate (Fmoc), 9–(2–sulfo)fluorenylmethyl carbamate, 9–(2,7–dibromo)fluoroenylmethyl carbamate, 2,7–di–t–butyl–[9–(10,10–dioxo–10,10,10,10– tetrahydrothioxanthyl)]methyl carbamate (DBD–Tmoc), 4–methoxyphenacyl carbamate (Phenoc), 2,2,2– trichloroethyl carbamate (Troc), 2–trimethylsilylethyl carbamate (Teoc), 2–phenylethyl carbamate (hZ), 1– (1–adamantyl)–1–methylethyl carbamate (Adpoc), 1,1–dimethyl–2–haloeth
  • Suitably protected carboxylic acids further include, but are not limited to, silyl–, alkyl–, alkenyl–, aryl–, and arylalkyl–protected carboxylic acids.
  • suitable silyl groups include trimethylsilyl, triethylsilyl, t–butyldimethylsilyl, t–butyldiphenylsilyl, triisopropylsilyl, and the like.
  • suitable alkyl groups include methyl, benzyl, p–methoxybenzyl, 3,4–dimethoxybenzyl, trityl, t–butyl, tetrahydropyran–2–yl.
  • suitable alkenyl groups include allyl.
  • suitable aryl groups include optionally substituted phenyl, biphenyl, or naphthyl.
  • suitable arylalkyl groups include optionally substituted benzyl (e.g., p–methoxybenzyl (MPM), 3,4–dimethoxybenzyl, O– nitrobenzyl, p–nitrobenzyl, p–halobenzyl, 2,6–dichlorobenzyl, p–cyanobenzyl), and 2– and 4–picolyl.
  • Suitable hydroxyl protecting groups include methyl, methoxylmethyl (MOM), methylthiomethyl (MTM), t–butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p–methoxybenzyloxymethyl (PMBM), (4–methoxyphenoxy)methyl (p–AOM), guaiacolmethyl (GUM), t–butoxymethyl, 4–pentenyloxymethyl (POM), siloxymethyl, 2– methoxyethoxymethyl (MEM), 2,2,2–trichloroethoxymethyl, bis(2–chloroethoxy)methyl, 2– (trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3–bromotetrahydropyranyl, tetrahydrothiopyranyl, 1–methoxycyclohexyl, 4–methoxytetrahydropyrany
  • the protecting groups include methylene acetal, ethylidene acetal, 1–t– butylethylidene ketal, 1–phenylethylidene ketal, (4–methoxyphenyl)ethylidene acetal, 2,2,2– trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, p–methoxybenzylidene acetal, 2,4–dimethoxybenzylidene ketal, 3,4– dimethoxybenzylidene acetal, 2–nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene ortho ester, 1–methoxyethy
  • a hydroxyl protecting group is acetyl, t-butyl, tbutoxymethyl, methoxymethyl, tetrahydropyranyl, 1 -ethoxyethyl, 1 -(2-chloroethoxy)ethyl, 2- trimethylsilylethyl, p- chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6- dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl (trityl), 4,4'-dimethoxytrityl, trimethylsilyl, triethylsilyl, t- butyldimethylsilyl, t-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoylformate, chloroacetyl, trichlor
  • each of the hydroxyl protecting groups is, independently selected from acetyl, benzyl, t- butyldimethylsilyl, t-butyldiphenylsilyl and 4,4'- dimethoxytrityl.
  • the hydroxyl protecting group is selected from the group consisting of trityl, monomethoxytrityl and 4,4'-dimethoxytrityl group.
  • a phosphorous linkage protecting group is a group attached to the phosphorous linkage (e.g., an internucleotidic linkage) throughout oligonucleotide synthesis.
  • a protecting group is attached to a sulfur atom of an phosphorothioate group. In some embodiments, a protecting group is attached to an oxygen atom of an internucleotide phosphorothioate linkage. In some embodiments, a protecting group is attached to an oxygen atom of the internucleotide phosphate linkage.
  • a protecting group is 2- cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylcarboxamido)-1-propyl, 4-oxopentyl, 4-methylthio-l-butyl, 2-cyano-1,1-dimethylethyl, 4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl, 2-[N- methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl,N-methyl)aminoethyl, or 4-[N-methyl-N-(2,2,2- trifluoroacetyl)amino]butyl.
  • Subject refers to any organism to which a provided compound (e.g., a provided oligonucleotide) or composition is administered in accordance with the present disclosure e.g., for experimental, diagnostic, prophylactic and/or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.) and plants. In some embodiments, a subject is a human. In some embodiments, a subject may be suffering from and/or susceptible to a disease, disorder and/or condition.
  • a provided compound e.g., a provided oligonucleotide
  • composition e.g., for experimental, diagnostic, prophylactic and/or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.) and plants.
  • a subject is a human.
  • a subject may be suffering from and/or susceptible
  • the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest.
  • a base sequence which is substantially complementary to a second sequence is not identical to the second sequence, but is mostly or nearly identical to the second sequence.
  • one of ordinary skill in the biological and/or chemical arts will understand that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and/or chemical phenomena.
  • sugar refers to a monosaccharide or polysaccharide in closed and/or open form. In some embodiments, sugars are monosaccharides. In some embodiments, sugars are polysaccharides. Sugars include, but are not limited to, ribose, deoxyribose, pentofuranose, pentopyranose, and hexopyranose moieties. As used herein, the term “sugar” also encompasses structural analogs used in lieu of conventional sugar molecules, such as glycol, polymer of which forms the backbone of the nucleic acid analog, glycol nucleic acid (“GNA”), etc.
  • GUA glycol nucleic acid
  • a sugar also encompasses structural analogs used in lieu of natural or naturally-occurring nucleotides, such as modified sugars and nucleotide sugars.
  • a sugar is a RNA or DNA sugar (ribose or deoxyribose).
  • a sugar is a modified ribose or deoxyribose sugar, e.g., 2’-modified, 5’-modified, etc.
  • modified sugars when used in oligonucleotides and/or nucleic acids, modified sugars may provide one or more desired properties, activities, etc.
  • a sugar is optionally substituted ribose or deoxyribose.
  • a “sugar” refers to a sugar unit in an oligonucleotide or a nucleic acid.
  • Susceptible to An individual who is “susceptible to” a disease, disorder and/or condition is one who has a higher risk of developing the disease, disorder and/or condition than does a member of the general public. In some embodiments, an individual who is susceptible to a disease, disorder and/or condition is predisposed to have that disease, disorder and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder and/or condition may not have been diagnosed with the disease, disorder and/or condition.
  • an individual who is susceptible to a disease, disorder and/or condition may exhibit symptoms of the disease, disorder and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder and/or condition may not exhibit symptoms of the disease, disorder and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will develop the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will not develop the disease, disorder, and/or condition.
  • therapeutic agent in general refers to any agent that elicits a desired effect (e.g., a desired biological, clinical, or pharmacological effect) when administered to a subject.
  • a desired effect e.g., a desired biological, clinical, or pharmacological effect
  • an agent is considered to be a therapeutic agent if it demonstrates a statistically significant effect across an appropriate population.
  • an appropriate population is a population of subjects suffering from and/or susceptible to a disease, disorder or condition.
  • an appropriate population is a population of model organisms.
  • an appropriate population may be defined by one or more criterion such as age group, gender, genetic background, preexisting clinical conditions, prior exposure to therapy.
  • a therapeutic agent is a substance that alleviates, ameliorates, relieves, inhibits, prevents, delays onset of, reduces severity of, and/or reduces incidence of one or more symptoms or features of a disease, disorder, and/or condition in a subject when administered to the subject in an effective amount.
  • a “therapeutic agent” is an agent that has been or is required to be approved by a government agency before it can be marketed for administration to humans.
  • a “therapeutic agent” is an agent for which a medical prescription is required for administration to humans.
  • a therapeutic agent is a provided compound, e.g., a provided oligonucleotide.
  • therapeutically effective amount means an amount of a substance (e.g., a therapeutic agent, composition, and/or formulation) that elicits a desired biological response when administered as part of a therapeutic regimen.
  • a therapeutically effective amount of a substance is an amount that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and/or condition, to treat, diagnose, prevent, and/or delay the onset of the disease, disorder, and/or condition.
  • the effective amount of a substance may vary depending on such factors as the desired biological endpoint, the substance to be delivered, the target cell or tissue, etc.
  • the effective amount of compound in a formulation to treat a disease, disorder, and/or condition is the amount that alleviates, ameliorates, relieves, inhibits, prevents, delays onset of, reduces severity of and/or reduces incidence of one or more symptoms or features of the disease, disorder, and/or condition.
  • a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.
  • Treat refers to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of, and/or reduce incidence of one or more symptoms or features of a disease, disorder, and/or condition.
  • Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and/or condition.
  • treatment may be administered to a subject who exhibits only early signs of the disease, disorder, and/or condition, for example for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition.
  • Unit dose refers to an amount administered as a single dose and/or in a physically discrete unit of a pharmaceutical composition.
  • a unit dose contains a predetermined quantity of an active agent.
  • a unit dose contains an entire single dose of the agent.
  • more than one unit dose is administered to achieve a total single dose.
  • administration of multiple unit doses is required, or expected to be required, in order to achieve an intended effect.
  • a unit dose may be, for example, a volume of liquid (e.g., an acceptable carrier) containing a predetermined quantity of one or more therapeutic agents, a predetermined amount of one or more therapeutic agents in solid form, a sustained release formulation or drug delivery device containing a predetermined amount of one or more therapeutic agents, etc. It will be appreciated that a unit dose may be present in a formulation that includes any of a variety of components in addition to the therapeutic agent(s). For example, acceptable carriers (e.g., pharmaceutically acceptable carriers), diluents, stabilizers, buffers, preservatives, etc., may be included as described infra.
  • acceptable carriers e.g., pharmaceutically acceptable carriers
  • diluents e.g., diluents, stabilizers, buffers, preservatives, etc.
  • a total appropriate daily dosage of a particular therapeutic agent may comprise a portion, or a plurality, of unit doses, and may be decided, for example, by the attending physician within the scope of sound medical judgment.
  • the specific effective dose level for any particular subject or organism may depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of specific active compound employed; specific composition employed; age, body weight, general health, sex and diet of the subject; time of administration, and rate of excretion of the specific active compound employed; duration of the treatment; drugs and/or additional therapies used in combination or coincidental with specific compound(s) employed, and like factors well known in the medical arts.
  • Unsaturated means that a moiety has one or more units of unsaturation.
  • Wild-type As used herein, the term “wild-type” has its art-understood meaning that refers to an entity having a structure and/or activity as found in nature in a “normal” (as contrasted with mutant, diseased, altered, etc.) state or context. Those of ordinary skill in the art will appreciate that wild type genes and polypeptides often exist in multiple different forms (e.g., alleles).
  • Oligonucleotides are useful tools for a wide variety of applications.
  • RHO oligonucleotides are useful in therapeutic, diagnostic, and research applications, including the treatment of a variety of RHO-related conditions, disorders, and diseases, including retinopathy (e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.).
  • retinopathy e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.
  • nucleic acids e.g., unmodified DNA or RNA
  • various synthetic counterparts have been developed to circumvent these shortcomings and/or to further improve various properties and activities.
  • synthetic oligonucleotides that contain chemical modifications, e.g., base modifications, sugar modifications, backbone modifications, etc., which, among other things, render these molecules less susceptible to degradation and improve other properties and/or activities.
  • modifications to internucleotidic linkages can introduce chirality, and certain properties may be affected by configurations of linkage phosphorus atoms of oligonucleotides.
  • binding affinity, sequence specific binding to complementary RNA, stability to nucleases, cleavage of target nucleic acids, delivery, pharmacokinetics, etc. can be affected by, inter alia, chirality of backbone linkage phosphorus atoms.
  • the present disclosure provides technologies for controlling and/or utilizing various structural elements, e.g., sugar modifications and patterns thereof, nucleobase modifications and patterns thereof, modified internucleotidic linkages and patterns thereof, linkage phosphorus stereochemistry and patterns thereof, additional chemical moieties (moieties that are not typically in an oligonucleotide chain) and patterns thereof, etc., and various combinations of one or more or all of such structural elements, in oligonucleotides.
  • oligonucleotides comprising various structural features for assessing, optimizing, and/or improving properties and/or activities of oligonucleotides for various applications, e.g., as therapeutic agents, probes, etc.
  • provided oligonucleotides and compositions thereof are particularly powerful for reducing levels of transcripts (and products (e.g., proteins) encoded thereby) associated with various conditions, disorders or diseases.
  • provided oligonucleotides are oligonucleotides targeting RHO, and can reduce levels of RHO transcripts and/or one or more products encoded thereby.
  • oligonucleotides are particularly useful for preventing and/or treating RHO-related conditions, disorders and/or diseases, including retinopathy (e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.).
  • retinopathy e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.
  • base sequences of RHO oligonucleotides are identical or complementary to bases sequences of RHO nucleic acids (e.g., RHO genes or transcripts (e.g., mRNA (e.g., pre-mRNA or spliced RNA)) thereof.
  • RHO nucleic acids e.g., RHO genes or transcripts (e.g.,
  • identity or complementarity is at least 85%, 90%, or 95%, and in many instances, 100% (when aligned for maximum homology/complementarity, there are no differences/mismatches between base sequences of RHO oligonucleotides and corresponding same- length portions of RHO nucleic acids (e.g., RHO genes, transcripts thereof, etc.)).
  • a RHO oligonucleotide comprises a sequence that is identical to or is completely or substantially complementary to 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, typically 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more, contiguous bases of a RHO genomic sequence or a transcript therefrom (e.g., pre-mRNA, mRNA, etc.).
  • a RHO oligonucleotide comprises a sequence that is completely complementary to 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more, typically 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more, contiguous bases of a RHO transcript.
  • an oligonucleotide that targets RHO can hybridize with a RHO transcript (e.g., pre-mRNA, RNA, etc.) and can reduce the level of the RHO transcript and/or a protein encoded by the RHO transcript.
  • a “RHO oligonucleotide” may have a nucleotide sequence that is identical (or substantially identical) or complementary (or substantially complementary) to a RHO base sequence (e.g., a genomic sequence, a transcript sequence, a mRNA sequence, etc.) or a portion thereof.
  • a RHO oligonucleotide comprises a sequence that is identical to or is completely complementary to 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, typically 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more, contiguous bases of a RHO genomic sequence or a transcript therefrom.
  • a RHO oligonucleotide comprises a sequence that is completely complementary to 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more, typically 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more, contiguous bases of a RHO transcript.
  • matches are Watson-Crick base pairs.
  • the present disclosure provides an oligonucleotide, e.g., a RHO oligonucleotide, wherein the oligonucleotide has a base sequence which is or comprises at least 10 contiguous bases of a RHO sequence (e.g., a sequence of a RHO gene, transcript, etc.) disclosed herein, or of a sequence that is complementary to a RHO sequence disclosed herein, and wherein each T can be independently substituted with U and vice versa.
  • a RHO oligonucleotide as disclosed herein, e.g., in a Table.
  • the present disclosure provides a RHO oligonucleotide having a base sequence disclosed herein, e.g., in a Table, or a portion thereof comprising at least 10 contiguous bases, wherein the RHO oligonucleotide is stereorandom or not chirally controlled, and wherein each T can be independently substituted with U and vice versa.
  • internucleotidic linkages of an oligonucleotide comprise or consist of 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 1-40, 1-50, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more chirally controlled internucleotidic linkages.
  • two or more chirally controlled internucleotidic linkages are consecutive.
  • an oligonucleotide composition of the present disclosure comprises oligonucleotides of the same constitution, wherein one or more (e.g., 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 1-40, 1-50, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) internucleotidic linkages are chirally controlled and one or more (e.g., 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 1-40, 1-50, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) internucleotidic linkages are stereorandom (not chirally controlled).
  • one or more internucleotidic linkages are chirally controlled and one or more (e.g., 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 1-40, 1-50, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or
  • the present disclosure provides a RHO oligonucleotide composition wherein the RHO oligonucleotides comprise at least one chirally controlled internucleotidic linkage. In some embodiments, the present disclosure provides a RHO oligonucleotide composition wherein the RHO oligonucleotides are stereorandom or not chirally controlled. In some embodiments, in a plurality of RHO oligonucleotide, at least one internucleotidic linkage is stereorandom and at least one internucleotidic linkage is chirally controlled.
  • internucleotidic linkages of an oligonucleotide comprise or consist of one or more (e.g., 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 1-40, 1-50, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) negatively charged internucleotidic linkages (e.g., phosphorothioate internucleotidic linkages, natural phosphate linkages, etc.).
  • negatively charged internucleotidic linkages e.g., phosphorothioate internucleotidic linkages, natural phosphate linkages, etc.
  • internucleotidic linkages of an oligonucleotide comprise or consist of one or more (e.g., 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 1-40, 1- 50, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) negatively charged chiral internucleotidic linkages (e.g., phosphorothioate internucleotidic linkages).
  • internucleotidic linkages of an oligonucleotide comprise or consist of one or more (e.g., 1-5, 1-10, 1-15, 1- 20, 1-25, 1-30, 1-40, 1-50, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) non- negatively charged internucleotidic linkages.
  • internucleotidic linkages of an oligonucleotide comprise or consist of one or more (e.g., 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 1-40, 1-50, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) neutral chiral internucleotidic linkages.
  • the present disclosure pertains to a RHO oligonucleotide which comprises at least one neutral or non-negatively charged internucleotidic linkage as described in the present disclosure.
  • provided oligonucleotides comprise one or more natural phosphate linkages, one or more modified negatively charged internucleotidic linkages (e.g., phosphorothioate internucleotidic linkages), and one or more non-negatively charged internucleotidic linkages (e.g., neutral internucleotidic linkages such as n001).
  • provided oligonucleotides comprises one or more natural phosphate linkages, one or more phosphorothioate internucleotidic linkages and one or more non-negatively charged internucleotidic linkages (e.g., neutral internucleotidic linkages such as n001).
  • each internucleotidic linkage of an oligonucleotide is independently a natural phosphate linkage, a phosphorothioate internucleotidic linkage, and a non-negatively charged internucleotidic linkage.
  • each internucleotidic linkage of an oligonucleotide is independently a natural phosphate linkage, a phosphorothioate internucleotidic linkage, and n001.
  • each phosphorothioate internucleotidic linkage is independently chirally controlled.
  • one or more non-negatively charged internucleotidic linkages are not chirally controlled.
  • each chiral internucleotidic linkage is independently chirally controlled.
  • RHO refers to a gene or a gene product thereof (including but not limited to, a nucleic acid, including but not limited to a DNA or RNA, or a wild-type or mutant protein encoded thereby), from any species, and which may be known as: Rho or Rhodopsin or visual purple.
  • RHO is a human or mouse RHO, which is wild- type or mutant.
  • a mutation e.g., a disease-associated mutation(s)
  • RHO-related diseases and disorders such as retinopathy (e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.).
  • RHO is also referenced, known or identified as: Rhodopsin, RHO, Rho, rho, CSNBAD1, OPN2, RP4, visual purple; External IDs: OMIM: 180380; MGI: 97914; HomoloGene: 68068; GeneCards: RHO; Orthologs: Species: Human: Entrez 6010; Ensembl ENSG00000163914; UniProt P08100; RefSeq (mRNA) NM_000539; RefSeq (protein) NP_000530; Location (UCSC) Chr 3: 129.53 – 129.54 Mb; Species: Mouse: Entrez 212541; Ensembl ENSMUSG00000030324; UniProt P15409; RefSeq (mRNA) NM_145383; RefSeq (protein) NP_663358; Location (UCSC) Chr 6: 115.93 – 115.94 Mb
  • Rhodopsin is described as an opsin.
  • RHO also known as visual purple
  • RHO is reportedly a light-sensitive receptor protein involved in visual phototransduction.
  • RHO is reportedly a biological pigment found in the rods of the retina and is a G-protein-coupled receptor (GPCR). It reportedly belongs to opsins.
  • GPCR G-protein-coupled receptor
  • RHO is reportedly extremely sensitive to light, and thus enables vision in low-light conditions. When rhodopsin is exposed to light, it reportedly immediately photobleaches. In humans, it is reportedly regenerated fully in about 30 minutes, after which rods are more sensitive.
  • RHO reportedly can comprise two components, a protein molecule also called scotopsin and a covalently-bound cofactor called retinal.
  • Scotopsin is reportedly an opsin, a light-sensitive G protein coupled receptor that embeds in the lipid bilayer of cell membranes using seven protein transmembrane domains. These domains reportedly form a pocket where the photoreactive chromophore, retinal, lies horizontally to the cell membrane, linked to a lysine residue in the seventh transmembrane domain of the protein.
  • Thousands of rhodopsin molecules are reportedly found in each outer segment disc of the host rod cell. Retinal is reportedly produced in the retina from vitamin A, from dietary beta-carotene.
  • Humans reportedly have eight other opsins besides rhodopsin, as well as cryptochrome (light-sensitive, but not an opsin).
  • the photopsins are reportedly found in the cone cells of the retina and are the basis of color vision. They have absorption maxima for yellowish-green (photopsin I), green (photopsin II), and bluish- violet (photopsin III) light.
  • the remaining opsin, melanopsin is reportedly found in photosensitive ganglion cells and absorbs blue light most strongly.
  • rhodopsin the aldehyde group of retinal is reportedly covalently linked to the amino group of a lysine residue on the protein in a protonated Schiff base.
  • its retinal cofactor When rhodopsin absorbs light, its retinal cofactor reportedly isomerizes from the 11-cis to the all-trans configuration, and the protein subsequently undergoes a series of relaxations to accommodate the altered shape of the isomerized cofactor.
  • the intermediates formed during this process were reportedly first investigated in the laboratory of George Wald, who received the Nobel prize for this research in 1967.
  • the photoisomerization dynamics has reportedly been subsequently investigated with time-resolved IR spectroscopy and UV/Vis spectroscopy.
  • a first photoproduct called photorhodopsin reportedly forms within 200 femtoseconds after irradiation, followed within picoseconds by a second one called bathorhodopsin with distorted all-trans bonds.
  • This intermediate can be trapped and studied at cryogenic temperatures, and was initially referred to as prelumirhodopsin.
  • lumirhodopsin and metarhodopsin I the Schiff's base linkage to all-trans retinal reportedly remains protonated, and the protein retains its reddish color.
  • the critical change that initiates the neuronal excitation reportedly involves the conversion of metarhodopsin I to metarhodopsin II, which is associated with deprotonation of the Schiff's base and change in color from red to yellow.
  • the structure of rhodopsin has reportedly been studied in detail via x-ray crystallography on rhodopsin crystals.
  • Several models e.g., the bicycle-pedal mechanism, hula-twist mechanism
  • Mutation of the rhodopsin gene is reportedly a major contributor to various retinopathies such as retinitis pigmentosa.
  • the disease-causing protein reportedly aggregates with ubiquitin in inclusion bodies, disrupts the intermediate filament network, and impairs the ability of the cell to degrade non-functioning proteins, which leads to photoreceptor apoptosis.
  • Other mutations on rhodopsin reportedly lead to X-linked congenital stationary night blindness, mainly due to constitutive activation, when the mutations occur around the chromophore binding pocket of rhodopsin.
  • RHO proteins and homologs and isoforms thereof in various species include: RHO, RHO isoforms, including but not limited to variably or multiply-phosphorylated isoforms, including two forms of monophosphorylated and two diphosphorylated species of rhodopsin, and other species, containing up to five phosphates.
  • spliced RHO transcript variants encoding different isoforms have been reported for this gene; in some embodiments, the present disclosure pertains to the use of a RHO oligonucleotide in decreasing the expression, level and/or activity of any isoform or alternatively spliced transcript or variant of a RHO gene or a gene product thereof.
  • a mutant RHO is designated mRho, muRho, m RHO, mu RHO, MU RHO, or the like, wherein m or mu indicate mutant.
  • a wild type RHO is designated wild-type RHO, wtRho, wt RHO, WT RHO, WTRho, or the like, wherein wt indicates wild-type.
  • a mutant RHO comprises a deleterious or pathogenic mutation.
  • a mutant RHO comprises a P23H mutation.
  • a human RHO is designated hRho or hRHO or hrho.
  • a mutant human RHO is designated mRho or mRho or mRHO or mRho or mrho.
  • a mouse RHO when a mouse is utilized, a mouse RHO may be referred to as mRho or muRho or mRHO or muRHO or murho, as those skilled in the art will appreciate in view of the context.
  • a RHO oligonucleotide is complementary to a portion of a RHO nucleic acid sequence, e.g., a RHO gene sequence, a RHO transcript, a RHO mRNA sequence, etc.
  • a portion is or comprises 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, typically 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more contiguous nucleobases. In some embodiments, a portion is or comprises at least 15 contiguous nucleobases. In some embodiments, a portion is or comprises at least 16 contiguous nucleobases.
  • a portion is or comprises at least 17 contiguous nucleobases. In some embodiments, a portion is or comprises at least 18 contiguous nucleobases. In some embodiments, a portion is or comprises at least 19 contiguous nucleobases. In some embodiments, a portion is or comprises at least 20 contiguous nucleobases. In some embodiments, the base sequence of such a portion is characteristic of RHO in that no other genomic or transcript sequences have the same sequence as the portion.
  • a portion of a nucleic acid e.g., a gene, a transcript, an RNA (pre- mRNA, spliced mRNA, etc.), that is complimentary to an oligonucleotide is referred to as the target sequence of the oligonucleotide.
  • a RHO gene sequence (or a portion thereof, e.g., complementary to a RHO oligonucleotide) is a RHO gene sequence (or a portion thereof) known in the art or reported in the literature.
  • nucleotide and amino acid sequences of a human RHO can be found in public sources, for example, one or more publicly available databases, e.g., GenBank, UniProt, OMEVI, etc. Those skilled in the art will appreciate that, for example, where a described nucleic acid sequence may be or include a genomic sequence, transcripts, splicing products, and/or encoded proteins, etc., may readily be appreciated from such genomic sequence.
  • a RHO gene, mRNA or protein variant or isoform comprises a mutation.
  • a RHO gene, mRNA or protein is or a transcription or translation product of an alternatively spliced variant or isoform.
  • a RHO splicing variant is generated by an alternative splicing event not normally performed by a wild-type cell on a wild-type RHO gene.
  • a RHO variant or isoform comprises one or more fewer or extra or different exons compared to a wild-type RHO.
  • a RHO variant or isoform comprises a frameshift mutation, leading to a premature stop codon.
  • a variant or isoform of RHO is incapable of performing at least one function, or has a decreased ability to perform at least one function, compared to a wild-type RHO.
  • a variant or isoform of RHO is incapable of performing at least one function, or has a decreased ability to perform at least one function, compared to a wild-type RHO, wherein the function is any of: photoreceptor activity, signal transducer activity, metal ion binding, protein binding, G-protein coupled receptor activity, 11-cis retinal binding activity, or G-protein coupled photoreceptor activity, or a role in retina development in camera-type eye, sensory perception of light stimulus, signal transduction, response to stimulus, detection of light stimulus, absorption of visible light, cellular response to light stimulus, protein phosphorylation, response to light stimulus, regulation of rhodopsin mediated signaling pathway, retinoid metabolic process, phototransduction, phototransduction of visible light, phtoreceptor cell maintenance, visual perception, protein-chromophore linkage, G-protein coupled receptor signaling pathway, or rhodopsin-mediated signaling pathway, a component in double membrane discs in the out segments
  • a RHO gene (or a portion thereof with a sequence complementary to a RHO oligonucleotide) includes a single nucleotide polymorphism or SNP.
  • RHO SNPs have been reported and may be found at, for example, NCBI dbSNP (see, e.g., www.ncbi.nlm.nih.gov/snp).
  • Non- limiting examples of SNPs within the RHO gene may be found at, NCBI dbSNP Accession, and include, for example, those described herein.
  • a RHO oligonucleotide targets a SNP allele which is on the same chromosome as the disease-associated mutation(s) and not present on the wild-type allele (which does not comprise the disease-associated mutation(s)).
  • Various RHO SNPs include: Table S2. RHO SNPs.
  • rsID SNP Position Alleles rsID Position Alleles number
  • base sequences of RHO oligonucleotides are identical or complementary (e.g., with no more than 1, 2, or 3 differences/mismatches, and often with no differences/mismatches when aligned) to base sequences comprising SNPs.
  • compositions of the present disclosure can selectively reduce levels, activities, etc. of transcripts of alleles associated with various conditions, disorders or diseases (in many instances, SNP alleles on the same chromosome as elements associated with conditions, disorders or diseases (e.g., SNPs, mutations, other sequence varations, etc.
  • provided technologies can modulate one or more of RHO functions, e.g., through modulating expression, level and/or activity of a RHO transcript or a product thereof.
  • a RHO oligonucleotide is capable of decreasing the expression, level and/or activity of a RHO transcript or a gene product thereof, wherein an activity is an ability of RHO to perform any known function, including but not limited to those described herein or known in the art.
  • wild-type RHO may have at least one function which is not yet reported in the scientific literature.
  • a RHO oligonucleotide is capable of decreasing the expression, level and/or activity of RHO, wherein an activity of RHO is a reported function of RHO.
  • RHO is reportedly expressed in several tissues including the retina and other tissues.
  • the present disclosure pertains to the use of a RHO oligonucleotide to decrease the expression, level and/or activity of a RHO gene or a gene product thereof in any of these tissues, or in a cell derived from any of these tissues.
  • RHO is reportedly distributed in various tissues, icnluding but not limited to: Blood; Whole Blood; Monocytes; Myeloid; NK Cells; T cells; Dentritic Cells; B Cells; B lymphoblasts; Endothelial; Cerebellum Peduncles; Cerebellum; Globus Pallidus Pons; Subthalamic Nucleus; Temporal Lobe; Occipital Lobe; Cingulate Cortex; Medulla Oblongata; Parietal lobe; Caudate nucleus; Thalamus; Fetal brain; Hypothalamus; Spinal cord; Prefrontal Cortex; Amygdala; brain; Whole brain; Skeletal Muscle; Tongue; Superior Cervical Ganglion; Trigeminal Ganglion; Skin; Atrioventricular Node; Ciliary Ganglion; Dorsal Root Ganglion; Ovary; Appendix; Uterus corpus; Heart; Liver; Early Erythroid; Placenta; Lung; Prostate; T
  • the present disclosure pertains to the use of a RHO oligonucleotide in decreasing the expression, level, and/or activity of a RHO gene or a gene product thereof, in any of these tissues.
  • a RHO oligonucleotide further comprises an additional chemical moiety which increases delivery to and/or entrance into a particular cell type or tissue or organ.
  • the present disclosure pertains to the use of a RHO oligonucleotide in decreasing the expression, level, and/or activity of a RHO gene or a gene product thereof, in any of these tissues in a human patient in need thereof (e.g., a human patient suffering from or susceptible to a RHO-related disease, disorder or condition).
  • the present disclosure pertains to a method of treatment or amelioration of a RHO-related disease, disorder or condition, comprising the step of decreasing the expression, level or activity of a RHO gene or a gene product thereof, in any of these tissues in a human patient in need thereof.
  • a RHO gene or gene product thereof is a mutant or comprises a mutation, including but not limited to a P23H mutation.
  • the present disclosure pertains to a method of administration of an USH2A oligonucleotide to a subject/patient suffering from or susceptible to an USH2A-related disease, disorder, or condition, wherein the disease, disorder or condition manifests (e.g., is characterized by at least one symptom in) (A) the eye; and (B) another tissue in the body that expresses USH2A.
  • the present disclosure pertains to a method of administration of an USH2A oligonucleotide to a subject/patient suffering from or susceptible to an USH2A-related disease, disorder, or condition, wherein the disease, disorder or condition manifests (e.g., is characterized by at least one symptom in) (A) the eye; and (B) another tissue in the body that expresses USH2A, wherein the USH2A oligonucleotide is administered to (A) the eye; and (B) the another tissue in the body that expresses USH2A.
  • the disease, disorder or condition manifests (e.g., is characterized by at least one symptom in) (A) the eye; and (B) another tissue in the body that expresses USH2A, wherein the USH2A oligonucleotide is administered to (A) the eye; and (B) the another tissue in the body that expresses USH2A.
  • the present disclosure pertains to a method of administration of an USH2A oligonucleotide to a subject/patient suffering from or susceptible to an USH2A-related disease, disorder, or condition, wherein the disease, disorder or condition manifests (e.g., is characterized by at least one symptom in) (A) the eye; and (B) another tissue in the body that expresses USH2A, wherein the USH2A oligonucleotide is administered to (A) the eye; and (B) the another tissue in the body that expresses USH2A, wherein a first USH2A oligonucleotide administered to (A) the eye is in a formulation and/or delivered via a method and/or comprises an additional chemical moiety suitable for administration to the eye; and a second USH2A oligonucleotide administered to (B) the another tissue in the body that expresses USH2A is in a formulation and/or delivered via a method and/or comprises an
  • RHO and related retinopathies are provided in the scientific literature, including but not limited to: al-Maghtheh M, Gregory C, Inglehearn C, Hardcastle A, Bhattacharya S (1993). "Rhodopsin mutations in autosomal dominant retinitis pigmentosa”. Human Mutation. 2 (4): 249–55. doi:10.1002/humu.1380020403.; Andréasson S, Ehinger B, Abrahamson M, Fex G (September 1992).
  • Arch Ophthalmol.109 (10): 1387–1393; Fishman GA, Stone EM, Gilbert LD, Sheffield VC; Stone; Gilbert; Sheffield (1992). "Ocular findings associated with a RHO gene codon 106 mutation: glycine-to-arginine change in autosomal dominant retinitis pigmentosa”.
  • Arch Ophthalmol. 110 (5): 646– 653; Fishman GA, Stone EM, Sheffield VC, Gilbert LD, Kimura AE; Stone; Sheffield; Gilbert; Kimura (1992).
  • Arch Ophthalmol.109 10: 1387–1393; Fishman GA, Stone EM, Gilbert LD, Sheffield VC; Stone; Gilbert; Sheffield (1992).
  • an additional therapeutic agent or method includes but is not limited to any treatment described in any of these documents; and a tool, technique, a cell or animal model useful for the evaluation of an oligonucleotide can include but is not limited to a tool, technique, cell or animal model described in any of these documents.
  • a RHO-related disease, disorder or condition is any of various conditions, disorders or diseases are associated with a mutation(s) in RHO; or, any disease, disorder or condition wherein at least one symptom is ameliorated by or the delayed in onset by a decrease in the expression, level and/or activity of a mutant HO gene or a gene product thereof; such a disease, disorder or condition includes retinopathy.
  • provided technologies are useful for treating or preventing a RHO-related-disorder or -disease, including but not limited to, a retinopathy or retinitis pigmentosa.
  • two events or entities are “associated” with one another if the presence, level and/or form of one (e.g., a RHO mutation) is correlated with that of the other (e.g., a condition, disorder or disease).
  • a particular entity e.g., polypeptide, genetic signature, metabolite, microbe, etc
  • a particular disease, disorder, or condition if its presence, level and/or form correlates with incidence of and/or susceptibility to the disease, disorder, or condition (e.g., across a relevant population).
  • a retinopathy is retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa (RP), or autosomal dominant retinitis pigmentosa (adRP).
  • adRP is also referenced as Retinitis pigmentosa 4 (RP4) or Retinitis pigmentosa, RHO-related.
  • Retinal degeneration is a retinopathy which reportedly relates to the deterioration of the retina caused by the progressive death of its cells.
  • retinitis pigmentosa There are reportedly several reasons for and/or symptoms of retinal degeneration or retinitis pigmentosa, including artery or vein occlusion, diabetic retinopathy, R.L.F. / R.O.P. (retrolental fibroplasia / retinopathy of prematurity), or disease (usually hereditary). Reportedly, these may present in many different ways such as impaired vision, night blindness, retinal detachment, light sensitivity, tunnel vision, and loss of peripheral vision to total loss of vision. retinitis pigmentosa (RP) is an important example of a retinal degenerative disease.
  • RP retinitis pigmentosa
  • Retinitis pigmentosa reportedly comprises a heterogeneous group of inherited neurodegenerative retinal disorders characterized by progressive peripheral vision loss and night vision difficulties, subsequently leading to central vision impairment. More than 100 different mutations in the rhodopsin-encoding gene (RHO) are reportedly associated with RP, together accounting for 30% to 40% of autosomal dominant cases. The P23H mutation in this gene is reportedly one of the most prevalent causes of RP. Most RP-causing mutations in the RHO gene, including P23H (RHO P23H), reportedly can cause misfolding and retention of rhodopsin in the endoplasmic reticulum of transfected cultured cells.
  • RHO P23H rhodopsin-encoding gene
  • Inherited retinal degenerative disorders in humans reportedly exhibit genetic and phenotypic heterogeneity in their underlying causes and clinical outcomes. Reportedly, a wide variety of causes have been attributed to retinal degeneration, such as disruption of genes that are involved in phototransduction, biosynthesis and folding of the RHO molecule, and the structural support of the retina. Mutations in the RHO gene reportedly account for a significant minority of all cases of autosomal dominant retinitis pigmentosa (adRP) in North America.
  • adRP autosomal dominant retinitis pigmentosa
  • Retinitis pigmentosa is reportedly a progressive neurodegenerative disorder.
  • Autosomal dominant RP reportedly accounts for approximately 15% of these cases.
  • Autosomal dominant retinitis pigmentosa (ADRP) is a genetically heterogeneous group of inherited retinal degenerations that cause blindness in humans.
  • RP reportedly begins with death of rod photoreceptor cells, which are the only cells in the retina to express RHO and which express it as their most abundant protein. Eventually, loss of rod cells reportedly leads to loss of cone cells (cone photoreceptors), the mainstay of human vision.
  • Symptoms of RP reportedly include loss of sensitivity to dim light, abnormal visual function, and characteristic bone spicule deposits of pigment in the retina. Affected individuals reportedly progressively lose visual field and visual acuity, and photoreceptor cell death can ultimately lead to blindness. A prominent early clinical feature of retinitis pigmentosa is reportedly the loss of night vision as a result of death of rod photoreceptor cells. Proper expression of the wild-type RHO gene is reportedly essential for the development and sustained function of photoreceptor cells.
  • administration of a RHO oligonucleotide improves, preserves, or prevents worsening of visual function; visual field; photoreceptor cell function; electroretinogram (ERG) response such as full field ERG measuring retina wide function, dark adapted ERG measuring scotopic rod function, or light adapted ERG measuring photopic cone function; visual acuity; and/or vision-related quality of life.
  • administration of a RHO oligonucleotide inhibits, prevents, or delays progression of photoreceptor cell loss and/or deterioration of the retina outer nuclear layer (ONL).
  • ONL retina outer nuclear layer
  • Symptoms of retinopathy that can be ameliorated, abated or delayed in onset by a RHO oligonucleotide include any symptom of retinopathy described herein or known in the art.
  • a RHO oligonucleotide when administered to a patient suffering from or susceptible to retinopathy, is capable of reducing at least one symptom of retinopathy and/or capable of delaying or preventing the onset, worsening, and/or reducing the rate and/or degree of worsening of at least one symptom of retinopathy.
  • a symptom of a RHO-related disease, disorder or condition is any symptom described herein, including but not limited to: blindness, night blindness (nyctalopia), photopsia, loss of peripheral vision, progressive visual loss, retinitis pigmentosa, onset of night blindness, onset of visual field loss, decline in or loss of visual field, decline in or loss of visual acuity, abnormal eye fundus, increase in death of photoreceptors, loss of mid-peripheral visual field, anatomical abnormalities in the central retina, visual hallucinations, animated visual hallucinations, Charles Bonnet syndrome, photophobia, chromatopsia, aggregation of wild-type and/or mutant Rho protein, loss of rod cells, loss of cone cells, retinal degeneration, increase in mTor levels, accumulation of Rhod
  • the symptoms of a patient suffering from or susceptible to a USH2A-related disease, disorder or condition can be evaluated using any method known in the art, including but not limited to: functional acuity score (FAS); functional field score (FFS); and functional vision score (FVS); Snellen visual acuity; Goldmann visual field area (V4c white test light), and 30-Hz (cone) full-field electroretinogram amplitude, electroretinogram (ERG), analysis of tissue samples, and light and/or immunofluorescence microscopy, immunofluorescence microscopy, immunohistochemistry and confocal microscopy, and terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay, and optical coherence tomography (OCT).
  • FES functional acuity score
  • FFS functional field score
  • FVS functional vision score
  • Snellen visual acuity Snellen visual acuity
  • Goldmann visual field area V4c
  • the present disclosure pertains to a method of administering a therapeutic amount of a RHO oligonucleotide to a patient suffering from or susceptible to retinopathy.
  • a patient is heterozygous, comprising both a mutant and a wild-type RHO allele.
  • a subject comprises a SNP, wherein at least one allele of the SNP is on the same copy of a chromosome, gene and/or transcript that is associated with a condition, disorder or disease (e.g., comprising a mutation such as P23H).
  • one allele of the SNP is on the same copy of a chromosome, gene and/or transcript that is less or is not associated with a condition, disorder or disease (e.g., does not contain P23H).
  • provided technologies can selectively reduce levels of transcripts (and/or products encoded thereby such as proteins) from an allele that is associated with a condition, disorder or disease (e.g., in transcripts comprising P23H) over an allele that is not or is less associated with a condition, disorder or disease.
  • selectivity is at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1000, 2000, 5000, or fold, e.g., as measured by IC50-1/IC50-2 using an available technology (e.g., luciferase assay, cell lines, etc. as described herein), wherein IC50-1 is an IC50 for an allele that is not or is less associated with a condition, disorder or disease (e.g., no P23H), and IC50-2 is an IC50 for an allele that is associated with a condition, disorder or disease (e.g., comprising P23H).
  • an available technology e.g., luciferase assay, cell lines, etc. as described herein
  • IC50-1 is an IC50 for an allele that is not or is less associated with a condition, disorder or disease (e.g., no P23H)
  • IC50-2 is an IC50 for an allele that is associated with a condition, disorder
  • a SNP is SNP rs104893768.
  • an A allele of rs104893768 is associated with a condition, disorder or disease. Those skilled in the art reading the present disclosure will appreciate that many other alleles of various SNPs can also be targeted.
  • a patient is homozygous, wherein both RHO alleles are mutant.
  • a patient has two alleles of RHO which are both mutant but different from each other.
  • a RHO oligonucleotide capable of decreasing the level, activity and/or expression of a RHO gene is useful in a method of preventing or treating a RHO-related condition, disorder or disease, e.g., retinopathy.
  • the present disclosure provides methods for preventing or treating a RHO-related condition, disorder or disease, by administering to a subject suffering from or susceptible to such a condition, disorder or disease a therapeutically effective amount of a provided RHO oligonucleotide or a composition thereof.
  • an oligonucleotide is a chirally controlled oligonucleotide. In some embodiments, an oligonucleotide is a chirally pure oligonucleotide. In some embodiments, a composition is a chirally controlled oligonucleotide composition. In some embodiments, a composition is a pharmaceutical composition. In some embodiments, in a composition oligonucleotides are independently in salt forms (e.g., sodium salts). [00191] In some embodiments, the present disclosure pertains to a method of decreasing the expression, level and/or activity of a mutant RHO gene or a gene product thereof in a body cell, tissue or organ affected by a RHO-related disorder.
  • a body cell, tissue or organ affected by a RHO-related disorder does not exhibit normal function in an organism comprising a mutant RHO gene.
  • the present disclosure encompasses a method of decreasing the level, expression and/or activity of a mutant RHO in a body cell, tissue or organ affected by a RHO-related disorder.
  • the present disclosure pertains to the use of a RHO oligonucleotide in the treatment of any RHO-related disorder, disease or condition.
  • oligonucleotides of various designs, which may comprises various nucleobases and patterns thereof, sugars and patterns thereof, internucleotidic linkages and patterns thereof, and/or additional chemical moieties and patterns thereof as described in the present disclosure.
  • provided oligonucleotides are RHO oligonucleotides.
  • provided RHO oligonucleotides can direct a decrease in the expression, level and/or activity of a RHO gene and/or one or more of its products (e.g., transcripts, mRNA, proteins, etc.).
  • provided RHO oligonucleotides can direct a decrease in the expression, level and/or activity of a RHO gene and/or one or more of its products in any cell of a subject or patient.
  • a cell is a any cell that normally expresses RHO or produces RHO protein.
  • provided RHO oligonucleotides can direct a decrease in the expression, level and/or activity of a RHO target gene or a gene product and has a base sequence which consists of, comprises, or comprises a portion (e.g., a span of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or more contiguous bases) of the base sequence of a RHO oligonucleotide disclosed herein, wherein each T can be independently substituted with U and vice versa, and the oligonucleotide comprises at least one non-naturally-occurring modification of a base, sugar and/or internucleotidic linkage.
  • a provided oligonucleotide e.g., a RHO oligonucleotide
  • a provided oligonucleotide e.g., a RHO oligonucleotide
  • a provided oligonucleotide e.g., a RHO oligonucleotide
  • comprises one or more targeting moieties Non-limiting examples of such additional chemical moieties which can be conjugated to an oligonucleotide chain are described herein.
  • provided oligonucleotides can direct a decrease in the expression, level and/or activity of a target gene, e.g., a RHO target gene, or a product thereof.
  • a target gene e.g., a RHO target gene
  • provided oligonucleotides can direct a decrease in the expression, level and/or activity of a RHO target gene or a product thereof via RNase H-mediated knockdown.
  • provided oligonucleotides can direct a decrease in the expression, level and/or activity of a RHO target gene or a product thereof by sterically blocking translation after binding to a RHO target gene mRNA, and/or by altering or interfering with mRNA splicing.
  • the present disclosure is not limited to any particular mechanism.
  • the present disclosure provides oligonucleotides, compositions, methods, etc., capable of operating via double-stranded RNA interference, single-stranded RNA interference, RNase H-mediated knock-down, steric hindrance of translation, or a combination of two or more such mechanisms.
  • a RHO oligonucleotide is capable of mediating a decrease in the expression, level and/or activity of a mutant RHO.
  • a RHO oligonucleotide is allele-specific and is capable of mediating allele-specific knockdown of RHO, for example, a decrease in the expression, level and/or activity of a mutant RHO (e.g., P23H), to a greater extent than a wild-type RHO (e.g., without P23H).
  • a RHO oligonucleotide is allele-specific and is capable of mediating allele-specific knockdown of RHO, for example, a decrease in the expression, level and/or activity of P23H RHO, to a greater extent than RHO that does not contain P23H.
  • a RHO oligonucleotide is allele-specific and is capable of mediating a decrease in the expression, level and/or activity of a mutant RHO, to a greater extent than a wild-type RHO, in an in vivo assay.
  • a RHO oligonucleotide is allele-specific and is capable of mediating a decrease in the expression, level and/or activity of a mutant RHO, to a greater extent than a wild-type RHO, at a concentration of about 10 nM in an in vivo assay.
  • a RHO oligonucleotide is allele-specific and is capable of mediating a decrease in the expression, level and/or activity of a mutant RHO, to a greater extent than a wild-type RHO, at a concentration of at any concentration betwen about 1 nM and about 10 nM (inclusive) in an in vivo assay.
  • a RHO oligonucleotide capable of allele-specific knockdown (e.g., a decrease in the expression, level, and/or activity) of RHO e.g., a greater knockdown of a mutant allele of RHO compared to knockdown of a wild-type allele of RHO at a particular concentration (e.g., in vitro)].
  • a RHO oligonucleotide capable of knocking down (decreasing) the expression, level and/or activity of a wild-type and/or mutant RHO has any structure (or a portion thereof) illustrated in Figure 23 ( Figure 23A, B, C or D).
  • a RHO oligonucleotide capable of allele-specific knockdown of RHO.
  • Non-limiting examples of such a RHO oligonucleotide include but are not limited to: WV-39023, and WV-48182.
  • a RHO oligonucleotide is capable of mediating a decrease in the expression, level and/or activity of a mutant RHO via a mechanism involving mRNA degradation and/or steric hindrance of translation of a mutant RHO mRNA.
  • provided oligonucleotides are antisense oligonucleotides (ASOs); they have a base sequence which is antisense to the target nucleic acid sequence.
  • provided oligonucleotides e.g., RHO oligonucleotides
  • provided oligonucleotides e.g., RHO oligonucleotides, are single-stranded siRNAs.
  • a RHO oligonucleotide described herein or a variant thereof can be combined with (e.g., annealed to) a complementary (or at least partially complementary) oligonucleotide to create a siRNA; in some embodiments, the siRNA can comprise a double-stranded region and zero, one or two overhangs (e.g, 3’ overhangs and/or 5’ overhangs).
  • a complementary (or at least partially complementary) oligonucleotide to create a siRNA; in some embodiments, the siRNA can comprise a double-stranded region and zero, one or two overhangs (e.g, 3’ overhangs and/or 5’ overhangs).
  • Provided oligonucleotides and compositions thereof may be utilized for many purposes.
  • RHO oligonucleotides can be co-administered or be used as part of a treatment regimen along with one or more treatment for retinopathy or a symptom thereof, including but not limited to: aptamers, lncRNAs, lncRNA inhibitors, antibodies, peptides, small molecules, other oligonucleotides to RHO or other targets, and/or other agents capable of inhibiting the expression of a RHO transcript, reducing the level and/or activity of a RHO gene product, and/or inhibiting the expression of a gene or reducing a gene product thereof which increases the expression, activity and/or level of a RHO transcript or a RHO gene product, or a gene or gene product which is associated with a RHO-related disorder.
  • an oligonucleotide e.g., a RHO oligonucleotide
  • a structural element or a portion thereof described herein e.g., in a text, a Table or Figure, etc.
  • an oligonucleotide e.g., a RHO oligonucleotide
  • an oligonucleotide e.g., a RHO oligonucleotide
  • such oligonucleotides, e.g., RHO oligonucleotides reduce expression, level and/or activity of a gene, e.g., a RHO gene, or a gene product thereof.
  • oligonucleotides may hybridize to their target nucleic acids (e.g., pre-mRNA, mature mRNA, etc.).
  • a RHO oligonucleotide can hybridize to a RHO nucleic acid derived from a DNA strand (either strand of the RHO gene).
  • a RHO oligonucleotide can hybridize to a RHO transcript.
  • a RHO oligonucleotide can hybridize to a RHO nucleic acid in any stage of RNA processing, including but not limited to a pre-mRNA or a mature mRNA.
  • a RHO oligonucleotide can hybridize to any element of a RHO nucleic acid or its complement, including but not limited to: a promoter region, an enhancer region, a transcriptional stop region, a translational start signal, a translation stop signal, a coding region, a non-coding region, an exon, an intron, an intron/exon or exon/intron junction, the 5' UTR, or the 3' UTR.
  • an oligonucleotide hybridizes to two or more variants of transcripts derived from a sense strand.
  • a RHO oligonucleotide hybridizes to two or more variants of RHO derived from the sense strand. In some embodiments, a RHO oligonucleotide hybridizes to all variants of RHO derived from the sense strand.
  • a RHO target of a RHO oligonucleotide is a RHO RNA which is not a mRNA.
  • provided oligonucleotides, e.g., RHO oligonucleotides contain increased levels of one or more isotopes.
  • provided oligonucleotides are labeled, e.g., by one or more isotopes of one or more elements, e.g., hydrogen, carbon, nitrogen, etc.
  • provided oligonucleotides in provided compositions e.g., oligonucleotides of a plurality of a composition, comprise base modifications, sugar modifications, and/or internucleotidic linkage modifications, wherein the oligonucleotides contain an enriched level of deuterium.
  • provided oligonucleotides are labeled with deuterium (replacing ⁇ 1 H with ⁇ 2 H) at one or more positions.
  • one or more 1 H of an oligonucleotide chain or any moiety conjugated to the oligonucleotide chain is substituted with 2 H.
  • Such oligonucleotides can be used in compositions and methods described herein.
  • the present disclosure provides an oligonucleotide composition comprising a plurality of oligonucleotides which: 1) have a common base sequence complementary to a target sequence (e.g., a RHO target sequence) in a transcript; and 2) comprise one or more modified sugar moieties and/or modified internucleotidic linkages.
  • oligonucleotides having a common base sequence may have the same pattern of nucleoside modifications, e.g. ⁇ sugar modifications, base modifications, etc.
  • a pattern of nucleoside modifications may be represented by a combination of locations and modifications.
  • a pattern of backbone linkages comprises locations and types (e.g., phosphate, phosphorothioate, substituted phosphorothioate, etc.) of each internucleotidic linkage.
  • Oligonucleotides of the present disclosure can comprise various modified internucleotidic linkages.
  • an internucleotidic linkage has the structure of formula I, I-a, I-b, I-c, I- n-1, I-n-2, I-n-3, I-n-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, or II-d-2, or a salt form thereof, as described in US 9394333, US 9744183, US 9605019, US 9598458, US 9982257, US 10160969, US 10479995, US 2020/0056173, US 2018/0216107, US 2019/0127733, US 10450568, US 2019/0077817, US 2019/0249173, US 2019/0375774, WO 2018/223056, WO 2018/223073, WO 2018/223081, WO 2018/237194, WO 2019/032607, WO 2019/055951, WO 2019/075357, WO 2019/200185
  • oligonucleotides of a plurality are of the same oligonucleotide type.
  • oligonucleotides of an oligonucleotide type have a common pattern of sugar modifications.
  • oligonucleotides of an oligonucleotide type have a common pattern of base modifications.
  • oligonucleotides of an oligonucleotide type have a common pattern of nucleoside modifications.
  • oligonucleotides of an oligonucleotide type have the same constitution.
  • oligonucleotides of an oligonucleotide type are identical. In some embodiments, oligonucleotides of a plurality are identical. In some embodiments, oligonucleotides of a plurality share the same constitution. [00216] In some embodiments, as exemplified herein, oligonucleotides, e.g., RHO oligonucleotides, are chiral controlled, comprising one or more chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides are stereochemically pure. In some embodiments, provided oligonucleotides are substantially separated from other stereoisomers.
  • oligonucleotides comprise one or more modified nucleobases, one or more modified sugars, and/or one or more modified internucleotidic linkages.
  • oligonucleotides e.g., RHO oligonucleotides
  • oligonucleotides of the present disclosure comprise one or more modified nucleobases.
  • modifications can be introduced to a sugar and/or nucleobase in accordance with the present disclosure. For example, in some embodiments, a modification is a modification described in US 9006198.
  • a modification is a modification described in US 9394333, US 9744183, US 9605019, US 9982257, US 20170037399, US 20180216108, US 20180216107, US 9598458, WO 2017/062862, WO 2018/067973, WO 2017/160741, WO 2017/192679, WO 2017/210647, or WO 2018/098264, the sugar, base, and internucleotidic linkage modifications of each of which are independently incorporated herein by reference.
  • “one or more” is 1-200, 1-150, 1- 100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.
  • “one or more” is one. In some embodiments, “one or more” is two. In some embodiments, “one or more” is three. In some embodiments, “one or more” is four. In some embodiments, “one or more” is five. In some embodiments, “one or more” is six. In some embodiments, “one or more” is seven. In some embodiments, “one or more” is eight.
  • “one or more” is nine. In some embodiments, “one or more” is ten. In some embodiments, “one or more” is at least one. In some embodiments, “one or more” is at least two. In some embodiments, “one or more” is at least three. In some embodiments, “one or more” is at least four. In some embodiments, “one or more” is at least five. In some embodiments, “one or more” is at least six. In some embodiments, “one or more” is at least seven. In some embodiments, “one or more” is at least eight. In some embodiments, “one or more” is at least nine. In some embodiments, “one or more” is at least ten.
  • “at least one” is 1-200, 1-150, 1- 100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.
  • “at least one” is one. In some embodiments, “at least one” is two. In some embodiments, “at least one” is three. In some embodiments, “at least one” is four. In some embodiments, “at least one” is five. In some embodiments, “at least one” is six. In some embodiments, “at least one” is seven. In some embodiments, “at least one” is eight.
  • a RHO oligonucleotide is or comprises a RHO oligonucleotide described in a Table or Figure.
  • a provided oligonucleotide e.g., a RHO oligonucleotide
  • a RHO oligonucleotide is characterized in that, when it is contacted with the transcript in a knockdown system, knockdown of its target (e.g., a RHO transcript for a RHO oligonucleotide, a mutant RHO transcript comprising disease-associated mutation(s), etc.) is improved relative to that observed under reference conditions (e.g., selected from the group consisting of absence of the composition, presence of a reference composition, and combinations thereof).
  • reference conditions e.g., selected from the group consisting of absence of the composition, presence of a reference composition, and combinations thereof.
  • knockdown is increased 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 fold or more.
  • oligonucleotides are provided as salt forms.
  • oligonucleotides are provided as salts comprising negatively-charged internucleotidic linkages (e.g., phosphorothioate internucleotidic linkages, natural phosphate linkages, etc.) existing as their salt forms.
  • oligonucleotides are provided as pharmaceutically acceptable salts.
  • oligonucleotides are provided as metal salts.
  • oligonucleotides are provided as sodium salts.
  • oligonucleotides are provided as metal salts, e.g., sodium salts, wherein each negatively-charged internucleotidic linkage is independently in a salt form (e.g., for sodium salts, ⁇ O ⁇ P(O)(SNa) ⁇ O ⁇ for a phosphorothioate internucleotidic linkage, ⁇ O ⁇ P(O)(ONa) ⁇ O ⁇ for a natural phosphate linkage, etc.).
  • metal salts e.g., sodium salts
  • each negatively-charged internucleotidic linkage is independently in a salt form (e.g., for sodium salts, ⁇ O ⁇ P(O)(SNa) ⁇ O ⁇ for a phosphorothioate internucleotidic linkage, ⁇ O ⁇ P(O)(ONa) ⁇ O ⁇ for a natural phosphate linkage, etc.).
  • an oligonucleotide e.g., a RHO oligonucleotide
  • a base sequence described herein or a portion e.g., a span of 5-50, 5-40, 5-30, 5-20, or 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or at least 10, at least 15, contiguous nucleobases
  • 0-5 e.g., 0, 1, 2, 3, 4 or 5
  • an oligonucleotide e.g., a RHO oligonucleotide
  • provided oligonucleotides comprise a base sequence described herein, or a portion thereof, wherein a portion is a span of at least 10 contiguous nucleobases, or a span of at least 10 contiguous nucleobases with 1-5 mismatches, wherein each T can be independently substituted with U and vice versa.
  • base sequences of oligonucleotides comprise or consists of 10-50 (e.g., about or at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45; in some embodiments, at least 15; in some embodiments, at least 16; in some embodiments, at least 17; in some embodiments, at least 18; in some embodiments, at least 19; in some embodiments, at least 20; in some embodiments, at least 21; in some embodiments, at least 22; in some embodiments, at least 23; in some embodiments, at least 24; in some embodiments, at least 25) contiguous bases of a base sequence that is identical to or complementary to a base sequence of a RHO gene or a transcript (e.g., mRNA) thereof.
  • 10-50 e.g., about or at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45
  • the base sequence of an oligonucleotide is or comprises a sequence that is complementary to a target sequence in a RHO gene or a transcript thereof.
  • the complementary sequence is 10.11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 or more nucleobases in length.
  • the target sequence is a characteristic sequence of a nucleic acid sequence (e.g., of a RHO gene or a transcript thereof) in that it defines the nucleic acid sequence over others in a relevant organism; for example, the characteristic sequence is not in other genomic nucleic acid sequences (e.g., genes) or transcripts thereof in a relevant organism (e.g., for human RHO, its characteristic sequence not in other human nucleic acid sequences or transcripts thereof).
  • a characteristic sequence of a transcript defines that transcript over other transcripts in a relevant organism; for example, in some embodiments, the characteristic sequence is not in transcripts that are transcribed from a different nucleic acid sequence (e.g., a different gene).
  • transcript variants from a nucleic acid sequence may share a common characteristic sequence that defines them from, e.g., transcripts of other genes.
  • a characteristic sequence in a transcript defines the transcript from other transcript(s) of the same nucleic acid sequence (e.g., a gene) and/or other alleles of the nucleic acid sequence.
  • a characteristic sequence defines a particular allele (and/or transcripts thereof) over other allele(s) (and/or transcripts thereof) as described herein.
  • a SNP may define a disease-associated allele over another allele which is not, or is less, associated with the disease.
  • a characteristic sequence may be of various lengths; for example, in some embodiments, it comprises 10. 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 or more nucleobases.
  • a RHO oligonucleotide comprises a sequence that is identical or complementary to a characteristic sequence of a RHO gene or a transcript thereof.
  • a base sequence of a RHO oligonucleotide is at least about 50%, about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99%, or 100% complementary to a target nucleic acid sequence (e.g., a RNA sequence).
  • a target nucleic acid sequence e.g., a RNA sequence.
  • a base sequence of a RHO oligonucleotide is complementary to an allele of a SNP (e.g., one associated with a condition, disorder or disease).
  • a base sequence of RHO oligonucleotide is complementary to one allele of a SNP (e.g., one associated with a condition, disorder or disease) and not the other alleles (e.g., those less or not associated with a condition, disorder or disease).
  • transcripts comprising a SNP allele that is associated with a condition, disorder or disease comprises a mutation associated with a condition, disorder or disease.
  • a mutation is P23H (e.g., P [CCC] > H [CAC]).
  • a SNP is rs104893768.
  • a base sequence of an oligonucleotide is complementary to an A allele (having a corresponding T in the base sequence) and not the other alleles of rs104893768 (e.g., a C allele).
  • a base sequence is complementary to a target nucleic acid (e.g., a transcript) at a mutation site encoding a P23H mutation (H [CAC]) and is not complementary to the wild type (P [CCC]).
  • a provided oligonucleotide comprises a mismatch (e.g., a G:U mismatch) when aligned with its target nucleic acid sequence, e.g., as described in the examples below.
  • a mismatch e.g., a G:U mismatch
  • such oligonucleotide can still effectively reduce levels of transcripts of its target nucleic acid sequence (and/or products encoded thereby), but have significantly reduced undesired reduction of levels of transcripts of non-target nucleic acid sequences (and/or products encoded thereby).
  • such a mismatch is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleobases away from a nucleobase that is complementary to the nucleobase of a characteristic sequence element, e.g., a SNP, a point mutation, etc.; in some embodiments, such a mismatch is 1 nucleobase away (next to the nucleobase that is complementary to the nucleobase of a characteristic sequence element, e.g., a SNP, a point mutation, etc.); in some embodiments, such a mismatch is at least 2 nucleobases away; in some embodiments, such a mismatch is at least 3 nucleobases away; in some embodiments, such a mismatch is at least 4 nucleobases away; in some embodiments, such a mismatch is at least 5 nucleobases away.
  • the present disclosure pertains to an oligonucleotide that targets a first gene target and knocks down the first gene target (e.g., decreases the expression, level and/or activity of the gene target or a gene product thereof); in some embodiments, the first target is RHO.
  • the present disclosure pertains to: an oligonucleotide capable of knocking down a first gene target, wherein the ability of the oligonucleotide to knock down a second gene target is decreased by replacing one or more bases in the oligonucleotide with a base that would participate in G:U basepairing with the second gene target.
  • the present disclosure pertains to a method related to an oligonucleotide that targets and knocks down a first gene target, wherein the method pertains to reducing the ability of the oligonucleotide to target and knock down to a second gene target, wherein knocking down the second gene target is not desirable, and wherein reduction of the ability of the oligonucleotide to knock down the second gene target is mediated by replacement of one or more bases in the oligonucleotide with a base that would participate in G:U basepairing with a particular position in the second target.
  • the present disclosure pertains to a method of reducing the ability of an oligonucleotide targeting a first gene target to knock down a second gene target, comprising the step of replacing one or more bases in the oligonucleotide with a base that would participate in G:U basepairing with the second target.
  • an oligonucleotide can be designed to knock down RHO, where the oligonucleotide has zero mismatches to the target RHO sequence, but also, for example, 2 mismatches from a second gene sequence (e.g., an off-target gene sequence).
  • the oligonucleotide hybridizing to and knocking down the off-target gene sequence can be undesirable if the off-target gene is necessary or beneficial for the proper functioning of a particular cell, tissue or organ.
  • the oligonucleotide comprises a base which bonds via Watson-Crick basepairing to a corresponding base in the desired RHO target sequence, that base can be replaced by a base which would participate in G:U base-pairing with the desired RHO target sequence.
  • G:U basepairing is reportedly weaker than Watson-Crick basepairing, but the decrease in the strength of one base pair should still allow hybridization of the oligonucleotide to the target sequence, thereby mediating knockdown of the RHO target.
  • the replacement of the base with a base that participates in G:U basepairing would also decrease the ability of the oligonucleotide to hybridize to the off-target gene sequence, which already (in this example) has 2 mismatches from the oligonucleotide.
  • an example mutant RHO target sequence has one mismatch (bold, underlined) from the wild-type sequence and two mismatches from the sequence of an off-target gene, IRF2BPL. Knocking down IRF2BPL in at least some cases may be undesirable.
  • Genomic sequence Number of mismatches Mutant RHO 5’-ACGCAGCCACTTCGAGTACC-3 0 WT RHO 5’-ACGCAGCCCCTTCGAGTACC-3 1 IRF2BPL 5’-GCGCAGCCGCTTCGAGTACC-3 2
  • a RHO oligonucleotide (1) is designed with perfect complementarity (0 mismatches) to the mutant RHO sequence, 1 mismatch from the wild-type RHO sequence, and 2 mismatches from the off-target IRF2BPL sequence.
  • oligonucleotide 1 is replaced by a base capable of mediating G:U (wobble) basepairing with a corresponding base in the mutant RHO sequence (which is the same in the wt RHO and IRF2BPL.
  • introducing the G:U basepair (underlined, not bold) into the oligonucleotide decreases its ability to hybridize to the mutant RHO, the wt RHO and the off-target gene.
  • a single G:U basepair does not substantially decrease the ability of the oligonucleotide to hybridize to and knock down the mutant RHO gene target.
  • the single G:U basepair will further decrease the ability of the oligonucleotide to hybridize to and knock down the wt RHO or the off-target gene, thus mitigating an off-target effect.
  • the replacement of two bases with bases capable of mediating G:U basepairing with the mutant RHO target can also substantially decrease the ability of the oligonucleotide to hybridize to and knockdown the wt RHO and off-target gene, without preventing the oligonucleotide from knocking down the mutant RHO.
  • oligonucleotide 1 are replaced by bases which can participate in G:U basepairing with the target sequence: OLIGONUCLEOTIDE 3 (2 G:U): Number of mismatches 3’-TGUGTCGGTGAAGUTCATGG-5’ Mutant RHO 5’-ACGCAGCCACTTCGAGTACC-3 0 + 2 G:U WT RHO 5’-ACGCAGCCCCTTCGAGTACC-3 1 + 2 G:U IRF2BPL 5’-GCGCAGCCGCTTCGAGTACC-3 2 + 2 G:U [00239]
  • two bases in oligonucleotide 1 are replaced by bases which can participate in G:U basepairing with the target sequence: OLIGONUCLEOTIDE 3 (1 G:U)(1 A:U): Number of mismatches 3’-UGCGUCGGTGAAGCTCATGG-5’ Mutant RHO 5’-ACGCAGCCACTTCGAGTACC-3 0 + 2 G:U WT RHO
  • a mismatch is in a wing.
  • when an oligonucleotide is aligned with its target sequence there is a wobble basepairing.
  • when an oligonucleotide is aligned with its target sequence there is a G:U pairing.
  • a RHO oligonucleotide capable of knocking down mutant RHO has a number of mismatches from the off-target gene CHST6.
  • a RHO oligonucleotide has 2 mismatches from the off-target gene CHST6.
  • a RHO oligonucleotide has 2 mismatches from the off-target gene CHST6, and one or more bases of the RHO oligonucleotide are replaced with a base capable of mediating G:U basepairing with the mutant RHO and the off-target gene.
  • the present disclosure pertains to a RHO oligonucleotide, wherein the RHO oligonucleotide is capable of mediating an allele-specific decrease in the expression, level and/or activity of a mutant RHO gene target or a gene product thereof.
  • the present disclosure pertains to a RHO oligonucleotide, wherein the RHO oligonucleotide is capable of mediating an allele-specific decrease in the expression, level and/or activity of a mutant RHO gene target or a gene product thereof, wherein base sequence of the oligonucleotide is, comprises, or comprises at least 15 contiguous bases of, the base sequence of any RHO oligonucleotide disclosed herein, except that at least one base in the oligonucleotide is replaced by a base capable of mediating G:U basepairing with the mutant RHO target sequence.
  • the present disclosure pertains to a RHO oligonucleotide, wherein the RHO oligonucleotide is capable of mediating an allele-specific decrease in the expression, level and/or activity of a mutant RHO gene target or a gene product thereof, wherein base sequence of the oligonucleotide is, comprises, or comprises at least 15 contiguous bases of, the base sequence of any RHO oligonucleotide disclosed herein, except that one base in the oligonucleotide is replaced by a base capable of mediating G:U basepairing with the mutant RHO target sequence.
  • the present disclosure pertains to a RHO oligonucleotide, wherein the RHO oligonucleotide is capable of mediating an allele-specific decrease in the expression, level and/or activity of a mutant RHO gene target or a gene product thereof, wherein base sequence of the oligonucleotide is, comprises, or comprises at least 15 contiguous bases of, the base sequence of any RHO oligonucleotide disclosed herein, except that two bases in the oligonucleotide are replaced by a base capable of mediating G:U basepairing with the mutant RHO target sequence.
  • the present disclosure pertains to a RHO oligonucleotide, wherein the RHO oligonucleotide is capable of mediating an allele-specific decrease in the expression, level and/or activity of a mutant RHO gene target or a gene product thereof, wherein base sequence of the oligonucleotide is, comprises, or comprises at least 15 contiguous bases of, the base sequence of any RHO oligonucleotide disclosed herein, except that three bases in the oligonucleotide are replaced by a base capable of mediating G:U basepairing with the mutant RHO target sequence.
  • Base sequences of provided oligonucleotides typically have sufficient length and complementarity to their targets, e.g., RNA transcripts (e.g., pre- mRNA, mature mRNA, etc.) to mediate target-specific knockdown.
  • the base sequence of a RHO oligonucleotide has a sufficient length and identity to a RHO transcript target to mediate target-specific knockdown.
  • a RHO oligonucleotide is complementary to a portion of a RHO transcript (an RHO transcript target sequence).
  • the base sequence of a RHO oligonucleotide has 90% or more identity with the base sequence of an oligonucleotide disclosed in a Table, wherein each T can be independently substituted with U and vice versa. In some embodiments, the base sequence of a RHO oligonucleotide has 95% or more identity with the base sequence of an oligonucleotide disclosed in a Table, wherein each T can be independently substituted with U and vice versa.
  • the base sequence of a RHO oligonucleotide comprises a continuous span of 15 or more bases of an oligonucleotide disclosed in a Table, wherein each T can be independently substituted with U and vice versa, except that one or more bases within the span are abasic (e.g., a nucleobase is absent from a nucleotide).
  • the base sequence of a RHO oligonucleotide comprises a continuous span of 19 or more bases of a RHO oligonucleotide disclosed herein, except that one or more bases within the span are abasic (e.g., a nucleobase is absent from a nucleotide).
  • the base sequence of a RHO oligonucleotide comprises a continuous span of 19 or more bases of an oligonucleotide disclosed herein, wherein each T can be independently substituted with U and vice versa, except for a difference in the 1 or 2 bases at the 5’ end and/or 3’ end of the base sequences.
  • a base sequence of an oligonucleotide is, comprises, or comprises 10-20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous bases of GGTACTCGAAGTGGCUGCGU, wherein each T may be independently replaced with U and vice versa.
  • a base sequence of an oligonucleotide is, comprises, or comprises 10-20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous bases of GGTACTCGAAGTGGCUGCGU, wherein each T may be independently replaced with U and vice versa.
  • a base sequence comprises one of these sequence.
  • a base sequence is one of these sequence.
  • the present disclosure pertains to an oligonucleotide having a base sequence which comprises the base sequence of any oligonucleotide disclosed herein, wherein each T may be independently replaced with U and vice versa.
  • the present disclosure pertains to an oligonucleotide having a base sequence which is the base sequence of any oligonucleotide disclosed herein, wherein each T may be independently replaced with U and vice versa.
  • the present disclosure pertains to an oligonucleotide having a base sequence which comprises at least 15 contiguous bases of the base sequence of any oligonucleotide disclosed herein, wherein each T may be independently replaced with U and vice versa.
  • the present disclosure pertains to an oligonucleotide having a base sequence which is at least 90% identical to the base sequence of any oligonucleotide disclosed herein, wherein each T may be independently replaced with U and vice versa. In some embodiments, the present disclosure pertains to an oligonucleotide having a base sequence which is at least 90% identical to GGTACTCGAAGTGGCUGCGU, wherein each T may be independently replaced with U and vice versa. In some embodiments, the present disclosure pertains to an oligonucleotide having a base sequence which is at least 90% identical to GGTACTCGAAGTGGCUGCGU.
  • the present disclosure pertains to an oligonucleotide having a base sequence which is at least 95% identical to the base sequence of any oligonucleotide disclosed herein, wherein each T may be independently replaced with U and vice versa. In some embodiments, the present disclosure pertains to an oligonucleotide having a base sequence which is at least 95% identical to GGTACTCGAAGTGGCUGCGU, wherein each T may be independently replaced with U and vice versa. In some embodiments, the present disclosure pertains to an oligonucleotide having a base sequence which is at least 95% identical to GGTACTCGAAGTGGCUGCGU.
  • a base sequence of an oligonucleotide is, comprises, or comprises 10-20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous bases of the base sequence of any oligonucleotide described herein, wherein each T may be independently replaced with U and vice versa.
  • a RHO oligonucleotide is any RHO oligonucleotide provided herein.
  • an oligonucleotide is WV-39023. In some embodiments, an oligonucleotide is WV-48182.
  • the base sequence of a RHO oligonucleotide is complementary to that of a RHO transcript or a portion thereof.
  • a RHO target gene is an allele of the RHO gene.
  • a RHO oligonucleotide is allele-specific and is designed to target a specific allele of RHO (e.g., an allele associated with a RHO-associated condition, disorder or disease).
  • Wild-type RHO performs many functions, some of which may not yet be identified.
  • a RHO oligonucleotide can mediate allele-specific knockdown, wherein the RHO oligonucleotide decreases the expression, activity and/or level of a mutant RHO gene or a gene product thereof to a greater extent as described herein relative to a wild-type RHO gene or a gene product thereof.
  • the present disclosure provides allele-specific technologies that can selectively reduce decreases the expression, activity and/or level of a mutant RHO gene or a gene product thereof relative to a wild-type RHO gene (or a RHO gene that is not, or is less, associated with a condition, disorder or disease) or a gene product thereof.
  • the base sequence of an oligonucleotide fully complements the sequence of a RHO transcript (or a portion thereof) from an allele associated with a condition, disorder or disease and is not fully complement the sequence of a RHO transcript (or a portion thereof) less or not associated with a condition, disorder or disease.
  • a disorder-associated allele of RHO comprises a SNP, mutation or other sequence variation and the RHO oligonucleotide is designed to complement this sequence.
  • a RHO SNP is any SNP listed in Table S2.
  • base sequence of an oligonucleotide complement one allele of a SNP and not the others.
  • base sequence of an oligonucleotide complement one allele of a SNP, which allele is on the same DNA strand of disease-associated mutation(s).
  • the base sequence of an oligonucleotide is fully complementary to the sequence of a RHO transcript (or a portion thereof) from an allele comprising disease-associated mutation(s) and is not fully complementary to the sequence of a RHO transcript (or a portion thereof) from an allele comprising a corresponding wild-type (or not disease- associated) sequence.
  • a RHO oligonucleotide is pan-specific and designed to target all alleles of RHO (e.g., all or most known alleles of RHO comprise the same sequence, or a sequence complementary thereto, within the span of bases recognized by the RHO oligonucleotide).
  • an oligonucleotide reduces expressions, levels and/or activities of both wild-type RHO and mutant RHO, and/or transcripts and/or products thereof.
  • a RHO oligonucleotide comprises a base sequence or portion (e.g., a portion comprising 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases) thereof described in the Tables, wherein each T may be independently replaced with U and vice versa, and/or a sugar, nucleobase, and/or internucleotidic linkage modification and/or a pattern thereof described in the Tables, and/or an additional chemical moiety (in addition to an oligonucleotide chain, e.g., a target moiety, a lipid moiety, a carbohydrate moiety, etc.) described in the Tables.
  • a base sequence or portion e.g., a portion comprising 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases
  • each T may be independently replaced with U and vice versa, and/or a sugar, nucleobase, and/or internucleotidic linkage modification and/or a pattern thereof described in the Table
  • the terms “complementary,” “fully complementary” and “substantially complementary” may be used with respect to the base matching between an oligonucleotide (e.g., a RHO oligonucleotide) and a target sequence (e.g., a RHO target sequence), as will be understood by those skilled in the art from the context of their use.
  • a target sequence has, for example, a base sequence of 5’-GUGCUAGUAGCCAACCCCC-3’
  • an oligonucleotide with a base sequence of 5’-GGGGGTTGGCTACTAGCAC-3’ is complementary (fully complementary) to such a target sequence.
  • an oligonucleotide that is “substantially complementary” to a target sequence is largely or mostly complementary but not 100% complementary.
  • a sequence e.g., a RHO oligonucleotide
  • a RHO oligonucleotide has 1, 2, 3, 4 or 5 mismatches when aligned to its target sequence.
  • a RHO oligonucleotide has a base sequence which is substantially complementary to a RHO target sequence.
  • a RHO oligonucleotide has a base sequence which is substantially complementary to the complement of the sequence of a RHO oligonucleotide disclosed herein.
  • sequences of oligonucleotides need not be 100% complementary to their targets for the oligonucleotides to perform their functions (e.g., knockdown of target nucleic acids.
  • homology, sequence identity or complementarity is 60%-100%, e.g., about or at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 100%.
  • a provided oligonucleotide has 75%-100% (e.g., about or at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 100%) sequence complementarity to a target region (e.g., a target sequence) within its target nucleic acid.
  • the percentage is about 80% or more. In some embodiments, the percentage is about 85% or more. In some embodiments, the percentage is about 90% or more. In some embodiments, the percentage is about 95% or more.
  • a provided oligonucleotide which is 20 nucleobases long will have 90 percent complementarity if 18 of its 20 nucleobases are complementary.
  • a and T or U are complementary nucleobases and C and G are complementary nucleobases.
  • the present disclosure provides a RHO oligonucleotide comprising a sequence found in an oligonucleotide described in a Table.
  • the present disclosure provides a RHO oligonucleotide comprising a sequence found in an oligonucleotide described in a Table, wherein one or more U is independently and optionally replaced with T or vice versa.
  • a RHO oligonucleotide can comprise at least one T and/or at least one U.
  • the present disclosure provides a RHO oligonucleotide comprising a sequence found in an oligonucleotide described in a Table, wherein the said sequence has over 50% identity with the sequence of the oligonucleotide described in the Table.
  • the present disclosure provides a RHO oligonucleotide comprising a sequence found in an oligonucleotide described in a Table, wherein the said sequence has over 60% identity with the sequence of the oligonucleotide described in the Table.
  • the present disclosure provides a RHO oligonucleotide comprising a sequence found in an oligonucleotide described in a Table, wherein the said sequence has over 70% identity with the sequence of the oligonucleotide described in the Table. In some embodiments, the present disclosure provides a RHO oligonucleotide comprising a sequence found in an oligonucleotide described in a Table, wherein the said sequence has over 80% identity with the sequence of the oligonucleotide described in the Table.
  • the present disclosure provides a RHO oligonucleotide comprising a sequence found in an oligonucleotide described in a Table, wherein the said sequence has over 90% identity with the sequence of the oligonucleotide described in the Table. In some embodiments, the present disclosure provides a RHO oligonucleotide comprising a sequence found in an oligonucleotide described in a Table, wherein the said sequence has over 95% identity with the sequence of the oligonucleotide described in the Table. In some embodiments, the present disclosure provides a RHO oligonucleotide comprising the sequence of an oligonucleotide disclosed in a Table.
  • the present disclosure provides a RHO oligonucleotide whose base sequence is the sequence of an oligonucleotide disclosed in a Table, wherein each T may be independently replaced with U and vice versa.
  • the present disclosure provides a RHO oligonucleotide comprising a sequence found in an oligonucleotide in a Table, wherein the oligonucleotides have a pattern of backbone linkages, pattern of backbone chiral centers, and/or pattern of backbone phosphorus modifications of the same oligonucleotide or another oligonucleotide in a Table herein.
  • the present disclosure presents, in Table A1, and elsewhere, various oligonucleotides and/or compositions thereof, each of which has a defined base sequence.
  • the present disclosure provides an oligonucleotide whose base sequence which is, comprises, or comprises a portion of the base sequence of an oligonucleotide disclosed herein, e.g., in a Table, e.g., Table A1 herein, wherein each T may be independently replaced with U and vice versa.
  • the disclosure provides an oligonucleotide having a base sequence which is, comprises, or comprises a portion of the base sequence of an oligonucleotide disclosed herein, e.g., in a Table, wherein each T may be independently replaced with U and vice versa, wherein the oligonucleotide further comprises a chemical modification, stereochemistry, format, an additional chemical moiety described herein (e.g., a targeting moiety, lipid moiety, carbohydrate moiety, etc.), and/or another structural feature.
  • a chemical modification, stereochemistry, format, an additional chemical moiety described herein e.g., a targeting moiety, lipid moiety, carbohydrate moiety, etc.
  • a “portion” (e.g., of a base sequence or a pattern of modifications) is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 monomeric units long (e.g., for a base sequence, at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 bases long).
  • a “portion” of a base sequence is at least 5 bases long.
  • a “portion” of a base sequence is at least 10 bases long.
  • a “portion” of a base sequence is at least 15 bases long.
  • a “portion” of a base sequence is at least 20 bases long.
  • a portion of a base sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or more contiguous (consecutive) bases. In some embodiments, a portion of a base sequence is 15 or more contiguous (consecutive) bases.
  • the present disclosure provides an oligonucleotide (e.g., a RHO oligonucleotide) whose base sequence is a base sequence of an oligonucleotide in a Table or a portion thereof, wherein each T may be independently replaced with U and vice versa.
  • the present disclosure provides a RHO oligonucleotide of a sequence of an oligonucleotide in a Table, wherein the oligonucleotide is capable of directing a decrease in the expression, level and/or activity of a RHO gene or a gene product thereof.
  • each U may be optionally and independently replaced by T or vice versa, and a sequence can comprise a mixture of U and T.
  • C may be optionally and independently replaced with 5mC.
  • a portion is a span of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 total nucleotides.
  • a portion is a span of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 total nucleotides with 0-3 mismatches. In some embodiments, a portion is a span of at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 total nucleotides with 0-3 mismatches, wherein a span with 0 mismatches is complementary and a span with 1 or more mismatches is a non-limiting example of substantial complementarity.
  • a base comprises a portion characteristic of a nucleic acid (e.g., a gene) in that the portion is identical or complementary to a portion of the nucleic acid or a transcript thereof, and is not identical or complementary to a portion of any other nucleic acid (e.g., a gene) or a transcript thereof in the same genome.
  • a portion is characteristic of human RHO.
  • a portion is characteristic of human mRho.
  • a provided oligonucleotide e.g., a RHO oligonucleotide
  • the sequence recited herein starts with a U or T at the 5’-end, the U can be deleted and/or replaced by another base.
  • an oligonucleotide has a base sequence which is or comprises or comprises a portion of the base sequence of an oligonucleotide in a Table, wherein each T may be independently replaced with U and vice versa, which has a format or a portion of a format disclosed herein.
  • oligonucleotides e.g., RHO oligonucleotides are stereorandom. In some embodiments, oligonucleotides, e.g., RHO oligonucleotides, are chirally controlled.
  • an oligonucleotide e.g., a RHO oligonucleotide
  • is chirally pure or “stereopure”, “stereochemically pure”
  • the oligonucleotide exists as a single stereoisomeric form (in many cases a single diastereoisomeric (or “diastereomeric”) form as multiple chiral centers may exist in an oligonucleotide, e.g., at linkage phosphorus, sugar carbon, etc.).
  • a chirally pure oligonucleotide is separated from its other stereoisomeric forms (to the extent that some impurities may exist as chemical and biological processes, selectivities and/or purifications etc. rarely, if ever, go to absolute completeness).
  • each chiral center is independently defined with respect to its configuration (for a chirally pure oligonucleotide, each internucleotidic linkage is independently stereodefined or chirally controlled).
  • oligonucleotides comprising chiral linkage phosphorus
  • racemic or “stereorandom”, “non- chirally controlled”
  • oligonucleotides comprising chiral linkage phosphorus
  • oligonucleotides comprising chiral linkage phosphorus
  • oligonucleotides comprising chiral linkage phosphorus
  • oligonucleotide synthesis without stereochemical control during coupling steps in combination with traditional sulfurization (creating stereorandom phosphorothioate internucleotidic linkages
  • diastereoisomers or “diastereomers” as there are multiple chiral centers in an oligonucleotide; e.g., from traditional oligonucleotide preparation using reagents containing no chiral elements other than those in nucleosides and linkage phosphorus).
  • a chirally pure oligonucleotide e.g., A *S A *S A
  • a Rp phosphorothioate is rendered as *S or * S.
  • a Rp phosphorothioate is rendered as *R or * R.
  • oligonucleotides e.g., RHO oligonucleotides
  • RHO oligonucleotides comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more stereorandom internucleotidic linkages (mixture of Rp and Sp linkage phosphorus at the internucleotidic linkage, e.g., from traditional non-chirally controlled oligonucleotide synthesis).
  • oligonucleotides e.g., RHO oligonucleotides
  • comprise one or more e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more
  • chirally controlled internucleotidic linkages Ros or Sp linkage phosphorus at the internucleotidic linkage, e.g., from chirally controlled oligonucleotide synthesis.
  • an internucleotidic linkage is a phosphorothioate internucleotidic linkage.
  • an internucleotidic linkage is a stereorandom phosphorothioate internucleotidic linkage. In some embodiments, an internucleotidic linkage is a chirally controlled phosphorothioate internucleotidic linkage. [00273] Among other things, the present disclosure provides technologies for preparing chirally controlled (in some embodiments, stereochemically pure) oligonucleotides. In some embodiments, oligonucleotides are stereochemically pure.
  • oligonucleotides of the present disclosure are about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, pure.
  • internucleotidic linkages of oligonucleotides comprise or consist of one or more (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 5-50, 5-40, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more) chirally controlled chiral internucleotidic linkages, each of which independently has a diastereopurity of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, typically at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%.
  • a chiral internucleotidic linkage has a diastereopurity of at least 95%. In some embodiments, a chiral internucleotidic linkage has a diastereopurity of at least 96%. In some embodiments, a chiral internucleotidic linkage has a diastereopurity of at least 97%. In some embodiments, a chiral internucleotidic linkage has a diastereopurity of at least 98%. In some embodiments, a chiral internucleotidic linkage has a diastereopurity of at least 99%.
  • oligonucleotides of the present disclosure e.g., RHO oligonucleotides
  • a diastereopurity of (DS) CIL wherein DS is a diastereopurity as described in the present disclosure (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or more) and CIL is the number of chirally controlled internucleotidic linkages (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 5-50, 5-40, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more).
  • DS diastereopurity of (DS) CIL
  • DS is a diastereopurity as described in the present disclosure (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%
  • each phosphorothioate internucleotidic linkage is independently chirally controlled. In some embodiments, each internucleotidic linkage is independently chirally controlled. In some embodiments, one or more chiral internucleotidic linkages, e.g., one or more neutral internucleotidic linkages (e.g., n001) is not chirally controlled.
  • internucleotidic linkages of oligonucleotides comprise or consist of one or more (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 5-50, 5-40, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more) chirally controlled chiral internucleotidic linkages, each of which independently comprises a linkage phosphorus chiral center with de (diastereomeric excess) of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, typically at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%.
  • de is at least 90%. In some embodiments, de is at least 95%. In some embodiments, de is at least 96%. In some embodiments, de is at least 97%. In some embodiments, de is at least 98%. In some embodiments, de is at least 99%.
  • oligonucleotides of the present disclosure e.g., RHO oligonucleotides
  • a diastereopurity of (DS) CIL wherein DS is a diastereopurity as described in the present disclosure (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or more) and CIL is the number of chirally controlled internucleotidic linkages (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 5-50, 5-40, 5-30, 5-25, 5- 20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more).
  • DS diastereopurity of (DS) CIL
  • DS is a diastereopurity as described in the present disclosure (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
  • oligonucleotides of the present disclosure e.g., RHO oligonucleotides
  • a diastereopurity of (DS) CIL wherein DS is 90%-100% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or more) and CIL is the number of chirally controlled internucleotidic linkages (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 5-50, 5-40, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more).
  • oligonucleotides of the present disclosure e.g., RHO oligonucleotides
  • a diastereopurity of (DS) CIL wherein DS is a diastereopurity as described in the present disclosure (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or more) and CIL is the number of chiral internucleotidic linkages (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 5-50, 5-40, 5- 30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more).
  • DS diastereopurity of (DS) CIL
  • DS is a diastereopurity as described in the present disclosure (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
  • oligonucleotides of the present disclosure e.g., RHO oligonucleotides
  • a diastereopurity of (DS) CIL wherein DS is 90%-100% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or more) and CIL is the number of chiral internucleotidic linkages (e.g., 1-50, 1-40, 1- 30, 1-25, 1-20, 5-50, 5-40, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more).
  • DS is 95%-100%.
  • each phosphorothioate internucleotidic linkage is independently chirally controlled. In some embodiments, each internucleotidic linkage is independently chirally controlled. In some embodiments, one or more chiral internucleotidic linkages, e.g., one or more neutral internucleotidic linkages (e.g., n001) is not chirally controlled.
  • RHO oligonucleotides comprising certain example base sequences, nucleobase modifications and patterns thereof, sugar modifications and patterns thereof, internucleotidic linkages and patterns thereof, linkage phosphorus stereochemistry and patterns thereof, linkers, and/or additional chemical moieties, and compositions thereof, are presented in Tables A1, below.
  • these oligonucleotides and compositions may be utilized to target a RHO transcript, e.g., to reduce the level of a RHO transcript and/or a product thereof, and may be utilized to treat a condition, disorder or disease associated with RHO (e.g., one associated with P23H mutation).
  • a condition, disorder or disease is retinitis pigmentosa.
  • Table A1 Example Oligonucleotides/Compositions. Oligo- D escript Stereochemistry / n ucleotide ion Base Sequence Linka e o es: Spaces in Table A1 are utilized for formatting and readability, e.g., S nX nX nX R SSSSS SSRSSSSOS illustrates the same Stereochemistry / Linkage as SnXOnXSSSSSSSSRSSSSSnX ; * S and *S both indicate a phosphorothioate internucleotidic linkage wherein the linkage phosphorus has Sp configuration (S); etc.
  • Base Sequence and Stereochemistry/Linkage due to their length, may be divided into multiple lines in Table A1. Unless otherwise specified, all oligonucleotides in Table A1 are single- stranded. As appreciated by those skilled in the art, nucleoside units are unmodified and contain unmodified nucleobases and 2’-deoxy sugars unless otherwise indicated with modifications (e.g., modified with m, m5, eo, etc.); linkages, unless otherwise indicated, are natural phosphate linkages; and acidic/basic groups may independently exist in their salt forms.
  • Moieties and modifications in oligonucleotides (or other compounds, e.g., those useful for preparing provided oligonucleotides comprising these moieties or modifications): m: 2’-OMe; m5 (or m5C): methyl at 5-position of C (nucleobase is 5-methylcytosine); m5Ceo: 5-methyl 2’-O-methoxyethyl C; eo: 2’-MOE (2’ ⁇ OCH 2 CH 2 OCH 3 ); O, PO: phosphodiester (phosphate).
  • It can be an end group (or a component thereof), or a linkage, e.g., a linkage between a linker and an oligonucleotide chain, an internucleotidic linkage (a natural phosphate linkage), etc.
  • Phosphodiesters are typically indicated with “O” in the Stereochemistry/Linkage column and are typically not marked in the Description column (if it is an end group, e.g., a 5’-end group, it is indicated in the Description and typically not in Stereochemistry/Linkage); if no linkage is indicated in the Description column, it is typically a phosphodiester unless otherwise indicated.
  • a phosphate linkage between a linker (e.g., L001) and an oligonucleotide chain may not be marked in the Description column, and may not be indicated with “O” in the Stereochemistry/Linkage column; *, PS: Phosphorothioate.
  • It can be an end group (if it is an end group, e.g., a 5’-end group, it is indicated in the Description and typically not in Stereochemistry/Linkage), or a linkage, e.g., a linkage between linker (e.g., L001) and an oligonucleotide chain, an internucleotidic linkage (a phosphorothioate internucleotidic linkage), etc.; * (as opposed to * R or * S) indicates a phosphorothioate which is not chirally controlled; R, Rp: Phosphorothioate in the Rp configuration.
  • oligonucleotides can be of various lengths to provide desired properties and/or activities for various uses.
  • oligonucleotides are of suitable lengths to hybridize with their targets and reduce levels of their targets and/or an encoded product thereof.
  • an oligonucleotide is long enough to recognize a target nucleic acid (e.g., a RHO mRNA).
  • an oligonucleotide is sufficiently long to distinguish between a target nucleic acid and other nucleic acids (e.g., a nucleic acid having a base sequence which is not RHO) to reduce off-target effects.
  • an oligonucleotide e.g., a RHO oligonucleotide
  • the base sequence of an oligonucleotide is about 10-500 nucleobases in length. In some embodiments, a base sequence is about 10-500 nucleobases in length. In some embodiments, a base sequence is about 10-50 nucleobases in length. In some embodiments, a base sequence is about 15-50 nucleobases in length. In some embodiments, a base sequence is from about 15 to about 30 nucleobases in length.
  • a base sequence is from about 10 to about 25 nucleobases in length. In some embodiments, a base sequence is from about 15 to about 22 nucleobases in length. In some embodiments, a base sequence is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobases in length. In some embodiments, a base sequence is at least 12 nucleobases in length. In some embodiments, a base sequence is at least 13 nucleobases in length. In some embodiments, a base sequence is at least 14 nucleobases in length. In some embodiments, a base sequence is at least 15 nucleobases in length. In some embodiments, a base sequence is at least 16 nucleobases in length.
  • a base sequence is at least 17 nucleobases in length. In some embodiments, a base sequence is at least 18 nucleobases in length. In some embodiments, a base sequence is at least 19 nucleobases in length. In some embodiments, a base sequence is at least 20 nucleobases in length. In some embodiments, a base sequence is at least 21 nucleobases in length. In some embodiments, a base sequence is at least 22 nucleobases in length. In some embodiments, a base sequence is at least 23 nucleobases in length. In some embodiments, a base sequence is at least 24 nucleobases in length. In some embodiments, a base sequence is at least 25 nucleobases in length.
  • a base sequence is 15 nucleobases in length. In some embodiments, a base sequence is 16 nucleobases in length. In some embodiments, a base sequence is 17 nucleobases in length. In some embodiments, a base sequence is 18 nucleobases in length. In some embodiments, a base sequence is 19 nucleobases in length. In some embodiments, a base sequence is 20 nucleobases in length. In some embodiments, a base sequence is 21 nucleobases in length. In some embodiments, a base sequence is 22 nucleobases in length. In some embodiments, a base sequence is 23 nucleobases in length. In some embodiments, a base sequence is 24 nucleobases in length.
  • a base sequence is 25 nucleobases in length. In some other embodiments, a base sequence is at least 30 nucleobases in length. In some other embodiments, a base sequence is a duplex of complementary strands of at least 18 nucleobases in length. In some other embodiments, a base sequence is a duplex of complementary strands of at least 21 nucleobases in length. In some embodiments, each nucleobase independently comprises an optionally substituted monocyclic, bicyclic or polycyclic ring wherein at least one ring atom is nitrogen.
  • each nucleobase is independently optionally substituted adenine, cytosine, guanosine, thymine, or uracil, or an optionally substituted tautomer of adenine, cytosine, guanosine, thymine, or uracil.
  • an oligonucleotide e.g., a RHO oligonucleotide, comprises several regions, each of which independently comprises one or more consecutive nucleosides and optionally one or more internucleotidic linkages.
  • a region differs from its neighboring region(s) in that it contains one or more structural feature that are different from those corresponding structural features of its neighboring region(s).
  • Example structural features include nucleobase modifications and patterns thereof, sugar modifications and patterns thereof, internucleotidic linkages and patterns thereof (which can be internucleotidic linkage types (e.g., phosphate, phosphorothioate, phosphorothioate triester, neutral internucleotidic linkage, etc.) and patterns thereof, linkage phosphorus modifications (backbone phosphorus modifications) and patterns thereof (e.g., pattern of ⁇ XLR 1 if internucleotidic linkages having the structure of formula I), backbone chiral center (linkage phosphorus) stereochemistry and patterns thereof [e.g., combination of Rp and/or Sp of chirally controlled internucleotidic linkages (sequentially from 5’ to 3’), optionally with non-chirally controlled internucleo
  • a region comprises a chemical modification (e.g., a sugar modification, base modification, internucleotidic linkage, or stereochemistry of internucleotidic linkage) not present in its neighboring region(s). In some embodiments, a region lacks a chemical modification present in its neighboring regions(s).
  • an oligonucleotide e.g., a RHO oligonucleotide, comprises or consists of two or more regions. In some embodiments, an oligonucleotide comprises or consists of three or more regions.
  • an oligonucleotide comprises or consists of two neighboring regions, wherein one region is designated as a wing region and the other a core region.
  • the structure of such an oligonucleotide comprises or consists of a wing-core or core-wing structure.
  • an oligonucleotide comprises or consists of three neighboring regions, wherein one region is flanked by two neighboring regions.
  • the middle region is designated as the core region, and each of the flanking region a wing region (a 5’-wing if connected to the 5’-end of the core, a 3’-wing if connected to the 3’-end of the core).
  • a first region e.g., a wing
  • a second region e.g., a core
  • a first (e.g., wing) region comprises a sugar modification absent from a second (e.g., core) region.
  • a sugar modification is a 2’-modification.
  • a 2’-modification is 2’-OR, wherein R is optionally substituted C 1-6 aliphatic.
  • a 2’- modification is 2’-OR, wherein R is optionally substituted C 1-6 alkyl.
  • a 2’- modification is 2’-MOE.
  • a 2’-modification is 2’-OMe.
  • a modified sugar is a bicyclic sugar, e.g., a LNA sugar.
  • each sugar in a region is independently modified.
  • each sugar of a region e.g., a wing
  • each sugar of a region (e.g., a wing) comprises the same modification, e.g., 2’-modification as described in the present disclosure.
  • sugars of a region (e.g., a core) are not modified.
  • each sugar of a region (e.g., a core) is a non-modified DNA sugar (with two ⁇ H at the 2’- position).
  • the structure of a provided oligonucleotide comprises or consists of a wing-core, core-wing, or wing-core-wing structure, wherein each wing independently comprises one or more sugar modifications, and each sugar in the core is a natural DNA sugar (with two ⁇ H at the 2’- position).
  • a first region e.g., a wing
  • a region e.g., a wing
  • a region (e.g., a core) comprises no consecutive natural phosphate linkages.
  • the structure of a provided oligonucleotide comprises or consists of a wing-core, core-wing, or wing-core-wing structure, wherein at least one wing independently comprises two or more consecutive natural phosphate linkages, and the core comprises no consecutive natural phosphate linkages.
  • each wing independently comprises two or more consecutive internucleotidic linkages.
  • internucleotidic linkages connecting a core with a wing are included in the core (e.g., see above).
  • a region is a 5’-wing, a 3’-wing, or a core.
  • the 5’-wing is to the 5’ end of the oligonucleotide
  • the 3’-wing is to the 3’-end of the oligonucleotide and the core is between the 5’-wing and the 3’-wing
  • the oligonucleotide comprises or consists of a wing- core-wing structure or format.
  • a core comprises a span of contiguous natural DNA sugars (2’-deoxyribose).
  • a core comprises a span of at least 5 contiguous natural DNA sugars (2’-deoxyribose).
  • a core comprises a span of at least 10 contiguous natural DNA sugars (2’-deoxyribose).
  • a core is referenced as a gap.
  • an oligonucleotide which comprises or consists of a wing-core-wing structure is described as a gapmer.
  • the structure of a provided oligonucleotide comprises or consists of a wing-core structure.
  • the structure of a provided oligonucleotide comprises or consists of a core-wing structure.
  • Non-limiting examples of oligonucleotides having a core-wing structure include WV-39023, and WV-48182.
  • the structure of an oligonucleotide comprises or consists of an oligonucleotide chain which comprises or consists of wing-core-wing, wing-core, or wing- core, wherein the oligonucleotide chain is conjugated to an additional chemical moiety optionally through a linker as described in the present disclosure.
  • the present disclosure provides oligonucleotides that target RHO and have a structure that comprises one or two wings and a core, and comprise or consist of a wing-core-wing, core-wing, or wing-core structure.
  • Ribonuclease H (RNase H, e.g., RNase H1, RNase H2, etc.) reportedly recognizes a structure comprising a hybrid of RNA and DNA (e.g., a heteroduplex), and cleaves the RNA.
  • an oligonucleotide comprising a span of contiguous natural DNA sugars (2’-deoxyribose, e.g., in a core region) is capable of annealing to a RNA such as a mRNA to form a heteroduplex; and this heteroduplex structure is capable of being recognized by RNase H and the RNA cleaved by RNase H.
  • a core of a provide oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more contiguous natural DNA sugars, and the core is capable of annealing specifically to a target transcript [e.g., a RHO transcript (e.g., pre-mRNA, mature mRNA, etc.)]; and the formed structure is capable of being recognized by RNase H and the transcript cleaved by RNase H.
  • a core of a provided oligonucleotide comprises 5 or more contiguous DNA sugars.
  • Regions e.g., wings, cores, etc., can be of various suitable lengths.
  • a region (e.g., a wing, a core, etc.) contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleobases.
  • each nucleobase independently comprises an optionally substituted monocyclic, bicyclic or polycyclic ring, which ring has at least one nitrogen ring atom; in some embodiments, each nucleobase is independently optionally substituted A, T, C, G or U, or a substituted tautomer of A, T, C, G or U.
  • the number is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 for a wing.
  • the number is 1 for a wing. In some embodiments, the number is 2 for a wing. In some embodiments, the number is 3 for a wing. In some embodiments, the number is 4 for a wing. In some embodiments, the number is 5 for a wing. In some embodiments, the number is 6 for a wing. In some embodiments, the number is 7 for a wing. In some embodiments, the number is 8 for a wing. In some embodiments, the number is 9 for a wing. In some embodiments, the number is 10 for a wing. In some embodiments, each wing of a wing-core-wing structure independently has a length as described in the present disclosure.
  • the two wings are of the same length. In some embodiments, the two wings are of different length. In some embodiments, the number is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more for a core. In some embodiments, the number is 1 for a core. In some embodiments, the number is 2 for a core. In some embodiments, the number is 3 for a core. In some embodiments, the number is 4 for a core. In some embodiments, the number is 5 for a core. In some embodiments, the number is 6 for a core. In some embodiments, the number is 7 for a core. In some embodiments, the number is 8 for a core. In some embodiments, the number is 9 for a core.
  • the number is 10 for a core. In some embodiments, the number is 11 for a core. In some embodiments, the number is 12 for a core. In some embodiments, the number is 13 for a core. In some embodiments, the number is 14 for a core. In some embodiments, the number is 15 for a core. [00285] In some embodiments, a wing-core-wing is described as "X-Y-Z", where "X" represents the length of the 5' wing (as number of nucleobases), “Y” represents the length of the core (as number of nucleobases), and “Z” represents the length of the 3' wing (as number of nucleobases).
  • Example embodiments of X, Y, and Z include those lengths described as numbers (e.g., above) and exemplified in oligonucleotide species (e.g., in Table A1).
  • the two wings are of the same or different lengths and/or have the same or different modifications or patterns of modifications.
  • Y is between 8 and 15.
  • X, Y or Z can each independently be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more.
  • each of X, Y and Z is independently 1-30.
  • X-Z-Z is 5-10-5, 5-10-4, 4-10-4, 4-10- 3, 3-10-3, 2-10-2, 5-9-5, 5-9-4, 4-9-5, 5-8-5, 5-8-4, 4-8-5, 5-7- 5, 4-7-5, 5-7-4, or 4-7-4.
  • the structure of a provided oligonucleotide comprises or is a wing-core or core-wing structure of, for example, 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, 5-13, 5-8, or 6-8.
  • a wing or a core is a block
  • a wing-core, core-wing, or wing-core-wing structure is a blockmer comprising two or three blocks.
  • the structure of a provided oligonucleotide comprises or is a wing- core-wing-structure, wherein the length (in nucleobases) of the first wing is represented by X, the length of the core is represented by Y and the length of the second wing is represented by Z, wherein X-Y-Z is 1-5- 1, 1-6-1, 1-7-1, 1-8-1, 1-9-1, 1-10-1, 1-11-1, 1-12-1, 1-13-1, 1-14-1, 1-15-1, 1-16-1, 1-17-1, 1-18-1, 1-19- 1, 1-20-1, 1-5-2, 1-6-2, 1-7-2, 1-8-2, 1-9-2, 1-10-2, 1-11-2, 1-12-2, 1-13-2, 1-14-2, 1-15-2, 1-16-2, 1-17
  • a wing comprises one or more sugar modifications.
  • each sugar in a wing is independently modified.
  • each wing sugar in an oligonucleotide is independently modified.
  • each modified sugar independently comprises a 2’-modification (e.g., 2’-OR wherein R is optionally substituted C 1-6 aliphatic, a LNA sugar, etc.).
  • a first wing comprises a sugar modification that is absent from a second wing (in some embodiments, a first wing is a 5’-wing and a second wing is a 3’-wing; in some embodiments, a first wing is a 3’-wing and a second wing is a 5’-wing).
  • each sugar modification in a wing is the same.
  • a wing comprises different sugar modifications, e.g., different 2’-modifications.
  • a wing comprises different 2’-OR modifications, wherein each R is independently optionally substituted C 1-6 aliphatic. In some embodiments, 2’-OR is 2’-OMe.
  • each sugar in a wing is a 2’-MOE modified sugar (e.g., 5’-wings in certain oligonucleotides in the Tables).
  • each sugar in a wing is a 2’-OMe modified sugar.
  • a wing comprises one or more 2’-OMe modified sugars and one or more 2’-MOE modified sugars.
  • a wing is a 5’-wing.
  • a wing is a 3’-wing.
  • the two wings of a wing-core-wing structure comprise different sugar modifications (and the oligonucleotide has or comprises an “asymmetric” format).
  • sugar modifications provide improved stability and/or annealing properties compared to absence of sugar modifications.
  • certain sugar modifications e.g., 2’-MOE
  • a wing comprises 2’-MOE modifications.
  • each nucleoside unit of a wing comprising a pyrimidine base (e.g., C, U, T, etc.) comprises a 2’-MOE modification.
  • each sugar unit of a wing comprises a 2’-MOE modification.
  • each nucleoside unit of a wing comprising a purine base e.g., A, G, etc.
  • each nucleoside unit of a wing comprising a purine base comprises no 2’-MOE modification (e.g., each such nucleoside unit comprises 2’-OMe, or no 2’-modification, etc.).
  • each nucleoside unit of a wing comprising a purine base comprises a 2’-OMe modification.
  • each internucleotidic linkage at the 3’-position of a sugar unit comprising a 2’-MOE modification is a natural phosphate linkage.
  • a wing comprises no 2’-MOE modifications. In some embodiments, a wing comprises 2’-OMe modifications. In some embodiments, each nucleoside unit of a wing independently comprises a 2’-OMe modification. [00291] In some embodiments, the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein one wing comprises a 2’-OMe sugar modification and the other wing comprises a bicyclic sugar.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein one wing comprises 2’-OMe and the other wing comprises a bicyclic sugar, and the majority of the sugars in the core are natural DNA sugars (with no substitution at the 2’-position).
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise 2’-OMe and the majority of the sugars in the other wing are independently bicyclic sugars.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise 2’-OMe and the majority of the sugars in the other wing are independently bicyclic sugars, and the majority of the sugars in the core are natural DNA sugars.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise 2’-OMe and, in the other wing, at least one sugar is a bicyclic sugar and at least one sugar comprises 2’-OMe.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise 2’-OMe and, in the other wing, at least one sugar is a bicyclic sugar and at least one sugar comprises 2’-OMe, and the majority of the sugars in the core are natural DNA sugars.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing are bicyclic sugars and, in the other wing, at least one sugar is a bicyclic sugar and at least one sugar comprises 2’-OMe.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing are independently bicyclic sugars and, in the other wing, at least one sugar is a bicyclic sugar and at least one sugar comprises 2’-OMe, and the majority of the sugars in the core are natural DNA sugars.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein each sugar in one wing comprises 2’-OMe and each sugar in the other wing is independently a bicyclic sugar.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein each sugar in one wing comprises 2’-OMe and each sugar in the other wing is independently a bicyclic sugar, and the majority of the sugars in the core are natural DNA sugars.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein each sugar in one wing is independently a bicyclic sugar, each sugar in the other wing comprises 2’-OMe, and each sugar in the core is a natural DNA sugar.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein one wing comprises a bicyclic sugar and the other wing comprises 2’-MOE.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein one wing comprises a bicyclic sugar and the other wing comprises 2’-MOE, and the majority of the sugars in the core are natural DNA sugars.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing are independently bicyclic sugars and the majority of the sugars in the other wing comprise 2’-MOE.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise are independently bicyclic sugars and the majority of the sugars in the other wing comprise 2’- MOE, and the majority of the sugars in the core are natural DNA sugars.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing are independently bicyclic sugars and, in the other wing, at least one sugar comprises 2’-MOE and at least one sugar is a bicyclic sugar.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing are independently bicyclic sugars and, in the other wing, at least one sugar comprises 2’-MOE and at least one sugar is a bicyclic sugar, and the majority of the sugars in the core are natural DNA sugars.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise 2’-MOE and, in the other wing, at least one sugar comprises 2’-MOE and at least one sugar is a bicyclic sugar.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein the majority of the sugars in one wing comprise 2’-MOE and, in the other wing, at least one sugar comprises 2’-MOE and at least one sugar is a bicyclic sugar, and the majority of the sugars in the core are natural DNA sugars.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein each sugar in one wing is independently a bicyclic sugar and each sugar in the other wing independently comprises 2’-MOE.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein each sugar in one wing is independently a bicyclic sugar and each sugar in the other wing of the oligonucleotide comprises 2’-MOE, and the majority of the sugars in the core are natural DNA sugars.
  • the structure of a RHO oligonucleotide comprises a wing-core-wing structure, wherein each sugar in one wing comprises 2’-MOE, each sugar in the other wing is independently a bicyclic sugar, and each sugar in the core is a natural DNA sugar.
  • a bicyclic sugar is a LNA, a cEt or a BNA sugar.
  • an oligonucleotide e.g., a RHO oligonucleotide, has a wing-core- wing structure.
  • a core comprises 1 or more natural DNA sugars.
  • a core comprises 5 or more consecutive natural DNA sugars. In some embodiments, the core comprises 5-10, 5-15, 5-20, 5-25, 5-30, or 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more natural DNA sugars which are optionally consecutive. In some embodiments, the core comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more consecutive natural DNA sugars. In some embodiments, a core comprises 10 or more natural DNA sugars. In some embodiments, a core comprises 10 or more consecutive natural DNA sugars. In some embodiments, the core is able to hybridize to a target mRNA, forming a duplex structure recognizable by RNase H, such that RNase H is able to cleave the mRNA.
  • an oligonucleotide e.g., a RHO oligonucleotide
  • one wing differs from another in the sugar modifications or pattern thereof, or the backbone internucleotidic linkages or pattern thereof, or the backbone chiral centers or pattern thereof.
  • an oligonucleotide e.g., a RHO oligonucleotide, has an asymmetrical format in that one wing comprises a different sugar modification than the other wing.
  • an oligonucleotide e.g., a RHO oligonucleotide
  • a mixmer is an oligonucleotide wherein the various sugars of the oligonucleotide comprise at least two different types of sugars, wherein the regions comprising one type of sugar are not readily divided by sugar type into two or three distinct regions (e.g., a wing-core or wing- core-wing), as the types of sugars are mixed.
  • an oligonucleotide e.g., a RHO oligonucleotide
  • a mixmer e.g., a RHO oligonucleotide
  • an oligonucleotide comprising at least one chirally controlled internucleotidic linkage is a mixmer.
  • the pattern of sugars in an oligonucleotide is or comprises a sequence of: DDDD, DDDD, DDDD, DDDD, DDDD, DDDD, DDDD, DDDD, DDDD, DDDD, DDDD, DDDD, DDDD, DDDD, DDDD, DDDD, DDDD, DDDD, DDDD, DDDDD, DDDDDD, DDDDDDDDD, DDDDDDDDD, DDDDDDDD, DDDDDDDDDDD, DDDDDDDD, DD, DDDDDDDDDDDDD, DD, DDDDDDDDD, DDDDDDDD, DDDDDDDDDDD, DDDDDDDD, DDDDDDDDDDD, DDDDDDDDDDD, DDDDDDDDDDD, DDDDDDDDDDD, DDDDDDDDDDD, DDDDDDDDDDD, DDDDDDDDDDD, DDDDDDDDDDD, DDDDDDDDDDD, DDDDDDDDDDD, DDDDDDDDDDD
  • the pattern of sugars in an oligonucleotide is or comprises a sequence of: DLDL, DLLD, DDDL, DDLD, DLDD, LDDD, LDDL, LLDD, LDLD, DLDL, DDDD, LLLL, DDLD, DDLL, DLLL, LDLL, LLDL, LLLD, LLDL, LLDLD, LLDLDD, LLDLDDL, LLDLDDLD, LLDLDDLDL, LLDLDDLDLD, LLDLDDLDLDD, LLDLDDLDLDDL, LL, DLL, DDLL, LDDLL, DLDDLL, DLDLDDLL, DDLDLDDLL, DDLDLDDLL, DDLDLDDLL, DLDDLDLDDLL, DLDDLDLDDLL, LDLDDLDLDDLL, LLDLDDLDLDDLL, LLDLDDLDLDDLL, LLDLDDLDLDLDDLL, LLDLDDLDLDLDD, LLDLDDLDLDD, LL
  • 2’-modifications and/or modified internucleotidic linkages can be utilized either individually or in combination to fine-tune properties, e.g., stability, and/or activities of oligonucleotides.
  • modified (non-natural) internucleotidic linkages which are not natural phosphate linkage or salt forms thereof, such as phosphorothioate linkages (phosphorothioate diester linkages), can be utilized to improve properties, e.g., stability (e.g., by using Sp phosphorothioate linkages), of an oligonucleotide.
  • a particular modified internucleotidic linkage can be used in combination with a particular sugar to achieve desired properties and/or activities.
  • a wing comprises no 2’-MOE modifications, and each internucleotidic linkage between nucleoside units of the wing is a modified internucleotidic linkage.
  • a wing comprises no 2’-MOE modifications, each nucleoside unit of the wing comprise a 2’-OMe modification, and each internucleotidic linkage between nucleoside units of the wing is a modified internucleotidic linkage.
  • a modified internucleotidic linkage is a phosphorothioate linage.
  • a modified internucleotidic linkage is a chirally controlled internucleotidic linkage.
  • a modified internucleotidic linkage is a chirally controlled internucleotidic linkage wherein the linkage phosphorus is of Sp configuration.
  • a modified internucleotidic linkage is a chirally controlled internucleotidic linkage wherein the linkage phosphorus is of Rp configuration.
  • a modified internucleotidic linkage is a Sp phosphorothioate linkage.
  • a modified internucleotidic linkage is a Rp phosphorothioate linkage.
  • such a wing is a 5’-wing. In some embodiments, such a wing is a 3’-wing.
  • a region, e.g., a wing, of an oligonucleotide, e.g., a RHO oligonucleotide comprises one or more, e.g., 1, 2, 3, 4, 5, 6 or more, natural phosphate linkages.
  • a wing comprises one or more, e.g., 1, 2, 3, 4, 5, 6 or more, consecutive natural phosphate linkages.
  • the number of natural phosphate linkage is 1.
  • the number of natural phosphate linkages is 2.
  • the number of natural phosphate linkages is 3.
  • the number of natural phosphate linkages is 4.
  • the number of natural phosphate linkages is 5. In some embodiments, the number of natural phosphate linkages is 6. In some embodiments, 2 natural phosphate linkages are consecutive. In some embodiments, 3 natural phosphate linkages are consecutive. In some embodiments, 4 natural phosphate linkages are consecutive. In some embodiments, 5 natural phosphate linkages are consecutive. In some embodiments, 6 natural phosphate linkages are consecutive. In some embodiments, all natural phosphate linkages in a wing are consecutive. In some embodiments, a wing comprises one or more natural phosphate linkages (in some embodiments, one or more consecutive natural phosphate linkages as described herein) and one or more modified internucleotidic linkages.
  • the first internucleotidic linkage and/or the last internucleotidic linkage of a wing is a modified internucleotidic linkage.
  • the first internucleotidic linkage (counting from 5’ to 3’) of a 5’ wing (to the 5’-end of a core) is a modified internucleotidic linkage.
  • the last internucleotidic linkage (counting from 5’ to 3’) of a 3’ wing (to the 3’-end of a core) is a modified internucleotidic linkage.
  • a wing contains one and no more than one modified internucleotidic linkage (all the other internucleotidic linkages are natural phosphate linkages).
  • the single modified internucleotidic linkage is the first internucleotidic linkage of a wing if the wing is a 5’-wing, or the last internucleotidic linkage of the wing if the wing is a 3’-wing.
  • the single modified internucleotidic linkage of a wing is the first internucleotidic linkage of the oligonucleotide if the wing is a 5’-wing, and/or the last internucleotidic linkage of the oligonucleotide if the wing is a 3’-wing.
  • the last internucleotidic linkage of a 5’-wing is a natural phosphate linkage
  • the first internucleotidic linkage of a 3’-wing is a natural phosphate linkage.
  • a modified internucleotidic linkage is Sp.
  • a modified internucleotidic linkage is Rp. In some embodiments, a modified internucleotidic linkage is a phosphorothioate linkage. In some embodiments, a modified internucleotidic linkage is a Sp phosphorothioate linkage. In some embodiments, a modified internucleotidic linkage is a Rp phosphorothioate linkage. In some embodiments, a natural phosphate linkage is bonded to at least one sugar which is a bicyclic sugar or a sugar comprising 2’-MOE.
  • a natural phosphate linkage is bonded to two sugars each of which is independently a bicyclic sugar or a sugar comprising 2’- MOE.
  • one or both sugars bonded to a natural phosphate linkage are independently bicyclic sugars.
  • one or both sugars bonded to a natural phosphate linkage independently comprise 2’-MOE.
  • a wing comprises one and only one modified internucleotidic linkages, and each other internucleotidic linkages linking two wing nucleosides in independently a natural phosphate linkage.
  • the first internucleotidic linkage from the 5’-end is a modified internucleotidic linkage.
  • the first internucleotidic linkage from the 3’-end is a modified internucleotidic linkage.
  • a modified internucleotidic linkage is chirally controlled and is Sp.
  • a modified internucleotidic linkage is chirally controlled and is Rp.
  • a modified internucleotidic linkage is a chirally controlled Sp phosphorothioate internucleotidic linkage. In some embodiments, a modified internucleotidic linkage is a chirally controlled Rp phosphorothioate internucleotidic linkage.
  • Rp internucleotidic linkages can be utilized as the 5’-end and/or the 3’-end internucleotidic linkages despite that in some cases they are less stable than corresponding Sp internucleotidic linkages, e.g., toward nuclease activities.
  • each internucleotidic linkage linking two sugars comprising 2’- OR’, wherein R’ is optionally substituted alkyl is independently a natural phosphate linkage, except the 5’-end and the 3’-end internucleotidic linkages, which are independently optionally chirally controlled modified internucleotidic linkages (e.g., in some embodiments, chirally controlled phosphorothioate internucleotidic linkages).
  • each wing sugar modification if any, is independently 2’-OR’, wherein R’ is optionally C 1-6 substituted alkyl.
  • each wing sugar independently comprises a 2’-OR’ modification, wherein R’ is optionally C 1-6 substituted alkyl.
  • each sugar comprising a 2’-OR’ modification, wherein R’ is optionally C 1-6 substituted alkyl is a sugar in a wing.
  • each modified sugar of an oligonucleotide independently comprises a 2’-OR’ modification, wherein R’ is optionally C 1-6 substituted alkyl.
  • R’ is methyl.
  • a wing comprises one or more modified internucleotidic linkages.
  • a wing comprises one or more modified internucleotidic linkages in addition to one or more natural phosphate linkages.
  • 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more, or 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more, or all internucleotidic linkages that are bonded to two wing sugars are independently modified internucleotidic linkages.
  • a modified internucleotidic linkage is a phosphorothioate internucleotidic linkage.
  • a wing comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate internucleotidic linkages.
  • a modified internucleotidic linkage is a non-negatively charged internucleotidic linkage as described herein.
  • a wing comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more non-negatively charged internucleotidic linkages.
  • a wing comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate internucleotidic linkages and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more non-negatively charged internucleotidic linkages.
  • each internucleotidic linkage bonded to two wing sugars is independently selected from a phosphorothioate internucleotidic linkage, a non-negatively charged internucleotidic linkage and a natural phosphate linkage.
  • each internucleotidic linkage bonded to two wing sugars is independently selected from a phosphorothioate internucleotidic linkage and a non-negatively charged internucleotidic linkage.
  • a non-negatively charged internucleotidic linkage is a neutral internucleotidic linkage.
  • a non-negatively charged internucleotidic linkage is n001.
  • each phosphorothioate internucleotidic linkage is independently chirally controlled.
  • one or more or all non-negatively charged internucleotidic linkages are not chirally controlled.
  • the first internucleotidic linkage of a 5’-wing is a phosphorothioate internucleotidic linkage.
  • the first internucleotidic linkage of a 5’-wing is a phosphorothioate internucleotidic linkage which is chirally controlled and is Sp.
  • an internucleotidic linkage between two internal 5’-wing nucleosides is a non- negatively charged internucleotidic linkage.
  • an internucleotidic linkage between two internal 5’-wing nucleosides is a natural phosphate linkage.
  • each 5’-wing internucleotidic linkage is independently selected from a phosphorothioate internucleotidic linkage, a non-negatively charged internucleotidic linkage (e.g., n001) and a natural phosphate linkage.
  • the first internucleotidic linkage is the only phosphorothioate internucleotidic linkage in a 5’-wing. In some embodiments, it is Sp. In some embodiments, the last internucleotidic linkage of a 3’-wing is a phosphorothioate internucleotidic linkage. In some embodiments, the last internucleotidic linkage of a 3’-wing is a phosphorothioate internucleotidic linkage which is chirally controlled and is Sp.
  • the last internucleotidic linkage of a 3’-wing is a non- negatively charged internucleotidic linkage, e.g., n001.
  • a wing comprises one or more Sp chirally controlled modified internucleotidic linkages. In some embodiments, at least 50%, 60%, 70%, 80%, or 90%, or all chirally controlled phosphorothioate internucleotidic linkages are Sp. In some embodiments, at least 50%, 60%, 70%, 80%, or 90%, or all phosphorothioate internucleotidic linkages are chirally controlled and are Sp.
  • a wing comprises one or more Rp chirally controlled phosphorothioate internucleotidic linkages.
  • at least 50%, 60%, 70%, 80%, or 90%, or all chirally controlled non- negatively charged internucleotidic linkages, e.g., n001, are Rp.
  • at least 50%, 60%, 70%, 80%, or 90%, or all non-negatively charged internucleotidic linkages, e.g., n001 are chirally controlled and are Rp.
  • an internucleotidic linkage bonded to a modified sugar and a natural DNA sugar is a modified internucleotidic linkage as described herein.
  • an internucleotidic linkage bonded to a wing sugar and a core sugar is a modified internucleotidic linkage as described herein.
  • a modified internucleotidic linkage is a phosphorothioate internucleotidic linkage.
  • an internucleotidic linkage bonded to a 5’-wing sugar and a core sugar is chirally controlled and is Rp. In some embodiments, an internucleotidic linkage bonded to a 5’-wing sugar and a core sugar is chirally controlled and is Sp. In some embodiments, an internucleotidic linkage bonded to a 3’-wing sugar and a core sugar is chirally controlled and is Rp. In some embodiments, an internucleotidic linkage bonded to a 3’-wing sugar and a core sugar is chirally controlled and is Sp.
  • an internucleotidic linkage bonded to a wing sugar and a core sugar is included in a pattern of backbone chiral centers (linkage phosphorus) of a core.
  • a core is differentiated from a first or second wing by the modification(s) of sugar(s) or combination(s) or pattern(s) thereof.
  • an internucleotidic linkage bonded to a wing nucleoside and a core nucleoside is considered one of the core internucleotidic linkages, for example, when describing types, modifications, numbers, and/or patterns of core internucleotidic linkages.
  • each internucleotidic linkage bonded to a wing nucleoside and a core nucleoside is considered one of the core internucleotidic linkages, for example, when describing types, modifications, numbers, and/or patterns of core internucleotidic linkages.
  • a wing comprises no natural phosphate linkages, and each internucleotidic linkage of the wing is independently a modified internucleotidic linkage.
  • a modified internucleotidic linkage is chiral and chirally controlled.
  • a modified internucleotidic linkage is a phosphorothioate linkage.
  • a modified internucleotidic linkage is a phosphorothioate linkage. In some embodiments, each internucleotidic linkage in a wing is a modified internucleotidic linkage. In some embodiments, each internucleotidic linkage in a wing is a phosphorothioate linkage. In some embodiments, each internucleotidic linkage in a wing is a Sp phosphorothioate internucleotidic linkage. In some embodiments, a modified internucleotidic linkage is a Sp phosphorothioate linkage.
  • one wing e.g., the 5’ wing
  • one wing comprises one or more natural phosphate linkages as described in the present disclosure (in some embodiments, one or more consecutive natural phosphate linkages), and the other wing (e.g., the 3’-wing) contains no natural phosphate linkages as described in the present disclosure.
  • the structure of a RHO oligonucleotide comprises or consists of a wing-core-wing structure, wherein one wing comprises 2’-OR modifications wherein R is optionally substituted C 1-6 alkyl (e.g., 2’-MOE), while the other wing comprises no modifications of the same structure as a modification of the first wing, or a lower level (e.g., by number and/or percentage) of such modifications; additionally or alternatively, one wing comprises natural phosphate linkages while the other wing comprises no natural phosphate linkages or a lower level (e.g., by number and/or percentage) of natural phosphate linkages; additionally or alternatively, one wing may comprise a certain type of modified internucleotidic linkages (e.g., phosphorothioate internucleotidic linkage) while the other wing comprises no such type of modified internucleotidic linkages or a lower level (e.g., by
  • one wing comprises one or more natural phosphate linkages and one or more 2’-OR modifications wherein R is not ⁇ H or ⁇ Me, and the other wing comprises no natural phosphate linkages and no 2’-OR modifications wherein R is not ⁇ H or ⁇ Me.
  • one wing comprises one or more natural phosphate linkages and one or more 2’-MOE modifications, and each internucleotidic linkage in the other wing is a phosphorothioate linkage and each sugar of the other wing comprises a 2’-OMe modification.
  • one wing comprises one or more natural phosphate linkages and one or more 2’-MOE modifications, and each internucleotidic linkage in the other wing is a Sp phosphorothioate linkage and each sugar of the other wing comprises 2’-OMe modification.
  • the structure of a RHO oligonucleotide comprises or consists of a wing-core-wing structure in an asymmetrical format, wherein a first wing and a second wing independently has a pattern of internucleotidic linkages which is or comprises PS, PO, PS-PS, PS-PO, PO-PS, PO-PO, PO-PS-PS, PS-PO-PO-PO-PS, PS-PO-PO-PS, PS-PS-PS-PS, PS-nX-nX-nX-PS, or a pattern of internucleotidic linkages of a wing of an oligonucleotide in Table A1, wherein the patterns of internucleotidic linkages of the first and second wing are different, wherein PS represents a phosphorothioate linkage, PO represents a natural phosphate linkage, and nX (or Xn) represents a non- negatively charged
  • the structure of an oligonucleotide comprises or consists of a wing-core-wing structure in an asymmetrical format, wherein a first wing and a second wing independently has a pattern of stereochemistry of internucleotidic linkages which is or comprises O, SR, Sp, Rp, Sp-O, Rp-O, O-Sp, O-Rp, O-O-O, Sp-O-O, Rp-O-O-O-Rp, Rp-O-O-Rp, Rp-O-Rp-O-Rp, Rp-O-Rp-O-Rp, Rp-Rp-O-O-Rp, Rp-Rp-O-O-Rp, Sp-O-O-O-Sp, Sp-Sp-Sp-Sp, Sp-Sp-Sp-Sp, Sp-Sp-Sp-Sp, Sp-Sp-Sp-Sp, Sp-Sp-Sp-Sp, Sp-Sp
  • the first wing is the 5’ wing and the second wing is the 3’-wing. In some embodiments of an oligonucleotide having an asymmetrical format, the first wing is the 3’ wing and the second wing is the 5’-wing. In some embodiments, the first and second wings are of the same or different lengths.
  • an oligonucleotide e.g., a RHO oligonucleotide, having an asymmetrical structure (e.g., wherein one wing differs chemically from another wing in sugar modifications and/or patterns thereof, internucleotidic linkage types and/or stereochemistry, etc.) has improved properties and/or activities compared to an oligonucleotide having the same base sequence but a different structure (e.g., a symmetric structure wherein both wings have the same pattern of chemical modifications, or a different asymmetrical structure).
  • improved activity includes improved decrease of the expression, activity, and/or level or a gene or gene product.
  • improved activity is improved delivery to a cellular nucleus. In some embodiments, improved activity is improved delivery to a cellular nucleus and one wing in an oligonucleotide having an asymmetrical structure comprises 2’-F or two or more 2’-F. In some embodiments, improved activity is improved delivery to a cellular nucleus and one wing in an oligonucleotide having an asymmetrical structure comprises 2’-MOE or two or more 2’-MOE. In some embodiments, improved activity is improved delivery to a cellular nucleus and one wing in an oligonucleotide having an asymmetrical structure comprises 2’-OMe or two or more 2’-OMe.
  • improved activity is improved delivery to a cellular nucleus and one wing in an oligonucleotide having an asymmetrical structure comprises a bicyclic sugar or two or more bicyclic sugars. In some embodiments, the other wing does not contain such sugar modifications.
  • a core of an oligonucleotide e.g., a RHO oligonucleotide, comprises no more than 1, 2, 3, 4, or 5, or no more than 10%, 20%, 30%, 40%, or 50%, or no sugars comprising a 2’-OR modification wherein R is optionally substituted C 1-6 aliphatic.
  • a core of an oligonucleotide e.g., a RHO oligonucleotide
  • each sugar is a natural sugar found in natural unmodified DNA.
  • no less than 70%, 80%, 90% or 100% of internucleotidic linkages in a core are independently modified internucleotidic linkages.
  • no less than 60%, 70%, 80%, or 90% of internucleotidic linkages in a core are independently modified internucleotidic linkages of Sp configuration, and the core comprises 1, 2, 3, 4, 5, or 6 internucleotidic linkages independently selected from modified internucleotidic linkages of Rp configuration and natural phosphate linkages.
  • a core comprises 1 or 2 internucleotidic linkages independently selected from modified internucleotidic linkages of Rp configuration and natural phosphate linkages.
  • a core comprises 1 and no more than 1 internucleotidic linkage selected from a modified internucleotidic linkage of Rp configuration and a natural phosphate linkage, and the rest internucleotidic linkages of the core are independently modified internucleotidic linkages of Sp configuration.
  • a core comprises 2 and no more than 2 internucleotidic linkages each independently selected from a modified internucleotidic linkage of Rp configuration and a natural phosphate linkage, and the rest internucleotidic linkages of the core are independently modified internucleotidic linkages of Sp configuration.
  • a core comprises 1 and no more than 1 natural phosphate linkage, and the rest internucleotidic linkages in the core are independently modified internucleotidic linkages of Sp configuration. In some embodiments, a core comprises 2 and no more than 2 natural phosphate linkages, and the rest internucleotidic linkages are independently modified internucleotidic linkages of Sp configuration. In some embodiments, a core comprises 1 and no more than 1 modified internucleotidic linkage of Rp configuration, and the rest internucleotidic linkages are independently modified internucleotidic linkages of Sp configuration.
  • a core comprises 2 and no more than 2 modified internucleotidic linkages of Rp configuration, and the rest internucleotidic linkages are independently modified internucleotidic linkages of Sp configuration.
  • internucleotidic linkages that are not modified internucleotidic linkages of Sp configuration e.g., each and every pair of two natural phosphate linkages, two modified internucleotidic linkages of Rp configuration, or one natural phosphate linkage and one modified internucleotidic linkage
  • the Rp internucleotidic linkages (R) are separated by at least two Sp internucleotidic linkages (S).
  • a modified internucleotidic linkage is a phosphorothioate linkage.
  • patterns of backbone chiral centers of a core or of an oligonucleotide comprises one or more RpSpSp or (Sp)tRp(Sp)m units, wherein each of t and m is independently as described herein.
  • m is 2 or more.
  • each of t and m is independently 2 or more.
  • At least one or each Rp internucleotidic linkage of such units is independently bonded to two core sugars.
  • an Rp of an RpSpSp or (Sp)tRp(Sp)m unit is at a +1, +2, +3, -1, -2, or -3 position relative to a differentiating position (a position whose nucleobase or whose complementary nucleobase can differentiate a target sequence (e.g., comprising Rho P23H mutation) from other sequences (e.g., comprising no Rho P23H mutation such as a wild type sequence)).
  • ⁇ is counting from the nucleoside at a differentiating position toward the 5’-end of an oligonucleotide with the internucleotidic linkage at the ⁇ 1 position being the internucleotidic linkage bonded to the 5’-carbon of the nucleoside at the differentiating position
  • + is counting from the nucleoside at a differentiating position toward the 3’-end of an oligonucleotide with the internucleotidic linkage at the +1 position being the internucleotidic linkage bonded to the 3’-carbon of the nucleoside at the differentiating position.
  • a pattern of backbone chiral centers of an oligonucleotide or a portion (e.g., a core) thereof is or comprises Rp(Sp)m, wherein the Rp is at +1 position and m is 2 or more.
  • a pattern of backbone chiral centers of an oligonucleotide or a portion (e.g., a core) thereof is or comprises Rp(Sp)m, wherein the Rp is at +2 position and m is 2 or more.
  • a pattern of backbone chiral centers of an oligonucleotide or a portion (e.g., a core) thereof is or comprises Rp(Sp)m, wherein the Rp is at +3 position and m is 2 or more.
  • a pattern of backbone chiral centers of an oligonucleotide or a portion (e.g., a core) thereof is or comprises Rp(Sp)m, wherein the Rp is at -1 position and m is 2 or more.
  • a pattern of backbone chiral centers of an oligonucleotide or a portion (e.g., a core) thereof is or comprises Rp(Sp)m, wherein the Rp is at -2 position and m is 2 or more.
  • a pattern of backbone chiral centers of an oligonucleotide or a portion (e.g., a core) thereof is or comprises Rp(Sp)m, wherein the Rp is at -3 position and m is 2 or more.
  • a pattern of backbone chiral centers of an oligonucleotide or a portion (e.g., a core) thereof is or comprises (Sp)tRp(Sp)m, wherein the Rp is at +1 position and m is 2 or more.
  • a pattern of backbone chiral centers of an oligonucleotide or a portion (e.g., a core) thereof is or comprises (Sp)tRp(Sp)m, wherein the Rp is at +2 position and m is 2 or more.
  • a pattern of backbone chiral centers of an oligonucleotide or a portion (e.g., a core) thereof is or comprises (Sp)tRp(Sp)m, wherein the Rp is at +3 position and m is 2 or more.
  • a pattern of backbone chiral centers of an oligonucleotide or a portion (e.g., a core) thereof is or comprises (Sp)tRp(Sp)m, wherein the Rp is at -1 position and m is 2 or more.
  • a pattern of backbone chiral centers of an oligonucleotide or a portion (e.g., a core) thereof is or comprises (Sp)tRp(Sp)m, wherein the Rp is at -2 position and m is 2 or more.
  • a pattern of backbone chiral centers of an oligonucleotide or a portion (e.g., a core) thereof is or comprises (Sp)tRp(Sp)m, wherein the Rp is at -3 position and m is 2 or more.
  • t is 1. In some embodiments, t is 2. In some embodiments, t is 2 or more.
  • t is 1-10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10).
  • m is 2. In some embodiments, m is 2 or more. In some embodiments, m is 2-10 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10).
  • Rp of Rp(Sp)m or (Sp)tRp(Sp)m is the 1 st , 2 nd , 3 rd , 4 th , 5 th , 6 th , 7 th , 8 th , 9 th , 10 th , 11 th , 12 th , 13 th , 14 th , 15 th , 16 th , 17 th , 18 th , 19 th or 20 th internucleotidic linkage of an oligonucleotide or a portion (e.g., a core) thereof.
  • it is the 3 rd , 4 th , 5 th , 6 th , 7 th , 8 th , 9 th , 10 th , 11 th , 12 th , 13 th , 14 th , 15 th , 16 th , 17 th , 18 th , 19 th or 20 th internucleotidic linkage of a core (the 1 st internucleotidic linkage being the internucleotidic linkage bonded to a 5’-wing sugar and a core sugar).
  • it is the 5 th of a core.
  • it is the 6 th of a core.
  • it is the 7 th of a core. In some embodiments, it is the 8 th of a core. In some embodiments, it is the 9 th of a core. In some embodiments, it is the 10 th of a core. In some embodiments, it is the 5 th of an oligonucleotide. In some embodiments, it is the 6 th of an oligonucleotide. In some embodiments, it is the 7 th of an oligonucleotide. In some embodiments, it is the 8 th of an oligonucleotide. In some embodiments, it is the 9 th of an oligonucleotide.
  • it is the 10 th of an oligonucleotide. In some embodiments, it is the 11 th of an oligonucleotide. In some embodiments, it is the 12 th of an oligonucleotide. In some embodiments, it is the 13 th of an oligonucleotide. In some embodiments, it is the 14 th of an oligonucleotide. In some embodiments, it is the 15 th of an oligonucleotide.
  • a nucleobase at a differentiating position is complementary to a differentiating element/characteristic sequence element in a target sequence (e.g., a particular SNP allele, a mutation, etc.) is at position 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of a core (from 5’ to 3’, the first nucleobase of the core is at position 1).
  • a position is 5.
  • a position is 6.
  • a position is 7.
  • a position is 8.
  • a position is 9.
  • a position is 10.
  • such a nucleobase is at position 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of an oligonucleotide (the first nucleobase from the 5’-end of an oligonucleotide is at position 1).
  • a position is 5.
  • a position is 6.
  • a position is 7.
  • a position is 8.
  • a position is 9.
  • a position is 10.
  • a position is 11.
  • a position is 12.
  • a position is 13.
  • a position is 14.
  • a position is 15. In some embodiments, a position is 16.
  • a position is 17. In some embodiments, a position is 18. In some embodiments, a position is 19. In some embodiments, a position is 20. [00328] As described herein, core and wings can be of various lengths. In some embodiments, a core comprises no less than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases. In some embodiments, a wing comprises no less than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleobases. In some embodiments, a wing comprises no more than 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleobases. In some embodiments, for a wing-core-wing structure, both wings are of the same length, for example, of 5 nucleobases.
  • the two wings are of different lengths.
  • a core is no less than 40%, 45%, 50%, 60%, 70%, 80%, or 90% of total oligonucleotide length as measured by percentage of nucleoside units within the core over all nucleoside units of the oligonucleotide chain.
  • a core is no less than 50% of total oligonucleotide length.
  • a region e.g., a wing, a core, etc. is a block.
  • a region is a sugar modification block in that all sugars in the region are the same.
  • an oligonucleotide e.g., a RHO oligonucleotide
  • a gapmer e.g., a RHO oligonucleotide
  • an oligonucleotide e.g., a RHO oligonucleotide
  • a hemimer is an oligonucleotide wherein a 5’-end or a 3’-end region has a sequence that possesses a structure feature that the rest of the oligonucleotide does not have.
  • a 5’-end or a 3’-end region comprises 2 to 20 nucleosides.
  • a structural feature is a base modification.
  • a structural feature is a sugar modification.
  • a structural feature is a P-modification.
  • a structural feature is stereochemistry of linkage phosphorus.
  • a structural feature is or comprises a base modification, a sugar modification, a P-modification, or linkage phosphorus stereochemistry, or combinations thereof.
  • a hemimer is an oligonucleotide in which each sugar moiety of the 5’-end region shares a common modification.
  • a hemimer is an oligonucleotide in which each sugar moiety of the 3’-end region shares a common modification. In some embodiments, a common sugar modification of the 5’ or 3’-end region is not shared by any other sugar moieties in the oligonucleotide.
  • an example hemimer is an oligonucleotide comprising a sequence of substituted or unsubstituted 2’-O-alkyl sugar modified nucleosides, bicyclic sugar modified nucleosides, ⁇ -D- ribonucleosides or ⁇ -D-deoxyribonucleosides (for example 2’-MOE modified nucleosides, and LNATM or ENATM bicyclic sugar modified nucleosides) at one terminus region and a sequence of nucleosides with a different sugar moiety (such as a substituted or unsubstituted 2’-O-alkyl sugar modified nucleosides, bicyclic sugar modified nucleosides or natural ones) at the other terminus region.
  • an oligonucleotide e.g., a RHO oligonucleotide, or a portion thereof comprises one or more: unimer, altmer, blockmer, gapmer, hemimer, and/or skipmer.
  • an oligonucleotide e.g., a RHO oligonucleotide, is or comprises a combination of one or more: unimer, altmer, blockmer, gapmer, and/or skipmer.
  • an altmer is a stereoaltmer, P-modification altmer, or linkage altmer.
  • an altmer is a sugar modification altmer, which comprises two alternating types of sugars, wherein either: (a) one type of sugar comprises no modification and the other type comprises a modification; or (b) the two alternating types comprise different modifications.
  • a unimer is a stereounimer, P-modification unimer, linkage unimer, or sugar modification unimer.
  • an oligonucleotide e.g., a RHO oligonucleotide, is both an altmer and a gapmer.
  • a provided nucleotide is both a gapmer and a skipmer.
  • a hemimer structure provides advantageous benefits.
  • provided oligonucleotides are 5’-hemimers that comprises modified sugars in a 5’-end sequence.
  • provided oligonucleotides are 5’-hemimers that comprises modified 2’-modified sugars in a 5’-end sequence.
  • an oligonucleotide consists of a wing-core-wing structure, wherein the core comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more consecutive natural DNA sugars and each sugar in the core is a natural DNA sugar, each of the 5’ and 3’ wings independently comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified sugars and each sugar in the wings is independently a modified sugar, and the oligonucleotide optionally comprises one or more additional chemical moieties optionally linked to the oligonucleotide chain (e.g., at sugar, nucleobase, and/or internucleotidic linkage) through one or more linkers.
  • the core comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more consecutive natural DNA sugars and each sugar in the core is a natural DNA sugar
  • each of the 5’ and 3’ wings independently comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more modified sugars and each sugar in the wings is independently
  • each sugar modification in a wing is the same. In some embodiments, all wing sugar modifications are the same. [00333] In some embodiments, a wing is 2’-MOE wing in which each sugar independently comprises 2’-MOE modification. In some embodiments, in a wing each sugar is wherein R 2s is ⁇ OCH 2 CH 2 OCH 3 . In some embodiments, such a wing is a 5’-wing. In some embodiments, such a wing is a 3’-wing.
  • each internucleotidic linkage linking two wing sugars is independently a natural phosphate linkage, except that the internucleotidic linkage linking the first and second sugars from the 5’-end of a 5’-wing is a modified internucleotidic linkage, optionally chirally controlled.
  • the internucleotidic linkage linking the first and second sugars from the 5’-end of a 5’-wing is a chirally controlled phosphorothioate internucleotidic linkage. In some embodiments, it is Rp. In some embodiments, it is Sp.
  • each internucleotidic linkage linking two wing sugars is independently a natural phosphate linkage, except that the internucleotidic linkage linking the first and second sugars from the 3’-end of a 3’-wing is a modified internucleotidic linkage, optionally chirally controlled.
  • the internucleotidic linkage linking the first and second sugars from the 3’-end of a 3’-wing is a chirally controlled phosphorothioate internucleotidic linkage. In some embodiments, it is Rp. In some embodiments, it is Sp.
  • each 5’-wing sugar is independently wherein R 2s is ⁇ OR, wherein R is as described herein and is not ⁇ H. In some embodiments, each 5’-wing sugar is independently wherein R 2s is ⁇ OCH 2 CH 2 OCH 3 . In some embodiments, each 3’-wing sugar is independently wherein R 2s is ⁇ OR, wherein R is as described herein and is not ⁇ H. In some embodiments, R 2s is ⁇ OCH 2 CH 2 OCH 3 . In some embodiments, R 2s is ⁇ OMe. In some embodiments, each internucleotidic linkage linking two wing sugars wherein R 2s is ⁇ OMe is independently a modified internucleotidic linkage.
  • a modified internucleotidic linkage is a chirally controlled internucleotidic linkage. In some embodiments, it is a chirally controlled phosphorothioate internucleotidic linkage. In some embodiments, it is a chirally controlled Sp phosphorothioate internucleotidic linkage.
  • each core sugar is independentl wherein R 2s is ⁇ H. [00334]
  • the inte nkage linking a 5’-wing sugar and a core sugar is a chirally controlled internucleotidic linkage.
  • oligonucleotides having a wing-core-wing format include: WV- 39023, and WV-48182.
  • Non-limiting examples of oligonucleotides having a wing-core-wing format, wherein the first wing comprises a sugar modification which is also present in the second wing include: WV-39023, and WV-48182.
  • the structure of a RHO oligonucleotide is or comprise a wing-core structure.
  • Non-limiting examples of such a RHO oligonucleotide include but are not limited to: WV-39023, and WV-48182.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein the first or second wings each independently comprise at least one 2’-OMe modified sugar.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein the first or second wings each independently comprise at least one 2’-MOE modified sugar.
  • Non-limiting examples of such a RHO oligonucleotide include but are not limited to: WV- 39023, and WV-48182.
  • the structure of a RHO oligonucleotide comprises or consists of an asymmetrical format.
  • Non-limiting examples of such a RHO oligonucleotide include but are not limited to: WV-39023, and WV-48182.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein a first wing comprises at least one 2’-MOE and no 2’-OMe and a second wing comprises at least one 2’-OMe.
  • the structure of a RHO oligonucleotide is or comprises a wing-core-wing structure, wherein a first wing comprises at least one 2’-MOE and a second wing comprises at least one 2’-OMe and at least one 2’-MOE.
  • the structure of a RHO oligonucleotide is or comprises a wing-core-wing structure, wherein a first wing comprises at least one 2’-MOE and no 2’-OMe and a second wing comprises at least one 2’-OMe and at least one 2’-MOE.
  • a first wing comprises one or more phosphorothioate internucleotidic linkages and one or more non-negatively charged internucleotidic linkages (e.g., neutral internucleotidic linkages such as n001). In some embodiments, a first wing comprises one or more natural phosphate linkages, one or more phosphorothioate internucleotidic linkages and one or more non-negatively charged internucleotidic linkages (e.g., neutral internucleotidic linkages such as n001).
  • the structure of a RHO oligonucleotide is or comprises an asymmetrical format, wherein the structure of the oligonucleotide is a wing-core-wing structure, wherein the format of the first wing is different from that of the second wing.
  • the structure of a RHO oligonucleotide is or comprises an asymmetrical format, wherein the structure of the oligonucleotide is a wing-core-wing structure, wherein the first and second wings differ in sugar modification (or combinations or patterns thereof) and/or in internucleotidic linkages (or combinations or patterns thereof).
  • the structure of a RHO oligonucleotide is or comprises an asymmetrical format, wherein the structure of the oligonucleotide is a wing-core-wing structure, wherein the first and second wings differ in sugar modification (or combinations or patterns thereof).
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein one wing comprises one type of sugar, and the other comprises that type and a second type. In some embodiments, this is a non-limiting example of a RHO oligonucleotide having an asymmetrical format.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein one wing comprises a first type of sugar but not a second type of sugar, and the other comprises the second type of sugar but not the first type of sugar.
  • this is a non-limiting example of a RHO oligonucleotide having an asymmetrical format.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein one wing comprises a neutral or non-negatively charged internucleotidic linkage and the other wing does not comprise a neutral or non-negatively charged internucleotidic linkage.
  • the structure of a RHO oligonucleotide is or comprises a wing-core-wing structure, wherein the first and second wings each independently comprise at least one neutral or non-negatively charged internucleotidic linkage.
  • Non-limiting examples of such a RHO oligonucleotide include but are not limited to: WV-39023, and WV-48182.
  • the structure of a RHO oligonucleotide is or comprises a wing-core-wing structure, wherein at least one wing comprises a neutral or non-negatively charged internucleotidic linkage.
  • a RHO oligonucleotide include but are not limited to: WV-39023, and WV-48182.
  • a RHO oligonucleotide comprises at least one neutral or non-negatively charged internucleotidic linkage.
  • Non-limiting examples of such a RHO oligonucleotide include but are not limited to: WV-39023 and WV-48182.
  • a RHO oligonucleotide comprises at least two adjacent neutral or non-negatively charged internucleotidic linkages. In some embodiments, a RHO oligonucleotide comprises at least two neutral or non-negatively charged internucleotidic linkages none of which are adjacent to each other. Non-limiting examples of such a RHO oligonucleotide include but are not limited to: WV-39023 and WV-48182.
  • the structure of a RHO oligonucleotide comprises a core and at least one wing, wherein the core comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more consecutive 2’-deoxyribose sugars.
  • the structure of a RHO oligonucleotide comprises a core and at least one wing, wherein the core comprises at least 5 consecutive 2’-deoxyribose sugars.
  • the structure of a RHO oligonucleotide comprises a core and at least one wing, wherein the core comprises at least 6 consecutive 2’-deoxyribose sugars.
  • the structure of a RHO oligonucleotide comprises a core and at least one wing, wherein the core comprises at least 7 consecutive 2’-deoxyribose sugars. In some embodiments, the structure of a RHO oligonucleotide comprises a core and at least one wing, wherein the core comprises at least 8 consecutive 2’-deoxyribose sugars. In some embodiments, the structure of a RHO oligonucleotide comprises a core and at least one wing, wherein the core comprises at least 9 consecutive 2’-deoxyribose sugars.
  • the structure of a RHO oligonucleotide comprises a core and at least one wing, wherein the core comprises at least 10 consecutive 2’-deoxyribose sugars.
  • the structure of a RHO oligonucleotide is or comprises a wing-core-wing structure, wherein the oligonucleotide comprises at least one neutral or non-negatively charged internucleotidic linkage.
  • Non-limiting examples of such a RHO oligonucleotide include but are not limited to: WV-39023 and WV-48182.
  • a RHO oligonucleotide comprises at least three different types of internucleotidic linkages. Non-limiting examples of such a RHO oligonucleotide include but are not limited to: WV-39023 and WV-48182. [00349] In some embodiments, a RHO oligonucleotide comprises: at least one natural phosphate internucleotidic linkage; at least one phosphorothioate; and at least one neutral or non-negatively charged internucleotidic linkage. Non-limiting examples of such a RHO oligonucleotide include but are not limited to: WV-39023 and WV-48182.
  • a RHO oligonucleotide comprises: at least one natural phosphate internucleotidic linkage; at least one phosphorothioate which is chirally controlled; and at least one neutral or non-negatively charged internucleotidic linkage.
  • Non-limiting examples of such a RHO oligonucleotide include but are not limited to: WV-39023 and WV-48182.
  • a RHO oligonucleotide comprises: at least one natural phosphate internucleotidic linkage; at least one phosphorothioate; and at least one neutral or non-negatively charged internucleotidic linkage which is chirally controlled.
  • a RHO oligonucleotide comprises: at least one natural phosphate internucleotidic linkage; at least one phosphorothioate which is chirally controlled; and at least one neutral or non-negatively charged internucleotidic linkage which is chirally controlled.
  • the structure of a RHO oligonucleotide comprises a core and at least one wing, wherein the core comprises at least 12 consecutive 2’-deoxyribose sugars.
  • the structure of a RHO oligonucleotide comprises a core and at least one wing, wherein the core comprises at least 14 consecutive 2’-deoxyribose sugars.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein the first and second wing each comprise at least 2 different types of sugars.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein the first and second wing each comprise 2’-DNA sugar (a natural 2’-deoxyribose) and a sugar comprising 2’-modification.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein the first and second wing each comprise 2’-DNA sugar (a natural 2’-deoxyribose) and a 2’-OMe sugar.
  • a RHO oligonucleotide comprises at least one natural 2’- deoxyribose sugar (unmodified DNA sugar), at least one LNA sugar and at least one 2’-MOE sugar.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein the first and second wing each comprise a natural 2’-deoxyribose (unmodified DNA sugar), a LNA sugar and 2’-MOE sugar.
  • a RHO oligonucleotide comprises at least one natural 2’- deoxyribose (unmodified DNA sugar), at least one LNA sugar and at least one 2’-OMe sugar.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein the first and second wing each comprise a natural 2’-deoxyribose (unmodified DNA sugar), a LNA sugar and 2’-OMe sugar.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein the first and second wing each comprise at least 3 different types of sugars (e.g., selected from unmodified sugars and modified sugars with various modifications).
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein one wing comprises at least one 2’-F sugar and the other wing comprises at least one 2’-MOE sugar.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein at least one wing comprises one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) LNA sugars.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein the first and second wing each comprise one or more 2’-MOE sugars and one or more LNA sugars.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein the first and second wing each comprise one or more LNA sugars.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein one wing comprises one or more LNA sugars and one or more 2’-MOE sugars and the other wing comprises one or more LNA sugars and one or more 2’-OMe sugars.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein one wing comprises 2’-MOE and 2’-F sugars, and the other wing comprises a 2’- MOE sugar.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein one wing comprises a natural 2’-deoxyribose (unmodified DNA sugar), a LNA sugar, and a 2’-MOE sugar.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein one wing comprises at least 3 different types of sugars.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein the first and second wing each comprise a natural 2’-deoxyribose (unmodified DNA sugar) and at least 1 modified sugar (compared to 2’-deoxyribose (unmodified DNA sugar)).
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein the first and second wing each comprise a natural 2’-deoxyribose (unmodified DNA sugar) and at least 2 sugar modifications.
  • the structure of a RHO oligonucleotide is or comprises a wing, wherein the wing comprises at least 3 different types of sugars.
  • the structure of a RHO oligonucleotide comprises a wing, wherein the wing comprises at least 1 base(s).
  • the structure of a RHO oligonucleotide comprises a wing, wherein the wing comprises at least 2 base(s). [00374] In some embodiments, the structure of a RHO oligonucleotide comprises a wing, wherein the wing comprises at least 3 base(s). [00375] In some embodiments, the structure of a RHO oligonucleotide comprises a wing, wherein the wing comprises at least 4 base(s). [00376] In some embodiments, the structure of a RHO oligonucleotide comprises a wing, wherein the wing is 5 base(s).
  • the structure of a RHO oligonucleotide comprises a wing, wherein the wing comprises at least 6 base(s). [00378] In some embodiments, the structure of a RHO oligonucleotide comprises a wing, wherein the wing comprises at least 7 base(s). [00379] In some embodiments, the structure of a RHO oligonucleotide comprises a wing, wherein the wing is an 8 base(s). [00380] In some embodiments, the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein the first and second wing each comprise two different types of sugars.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein one wing comprises at least one 2’-MOE sugar and the other wing comprises at least one 2’-OMe sugar.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein one wing comprises a 2’-F sugar and one wing comprises a 2’-OMe sugar.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein one wing comprises a natural 2’-deoxyribose (unmodified DNA sugar) and at least one modified sugar.
  • the structure of a RHO oligonucleotide is or comprises a wing-core- wing structure, wherein one wing comprises a natural 2’-deoxyribose (unmodified DNA sugar) and at least two modified sugars.
  • a core region comprises a sequence complementary to a characteristic sequence element which differentiates a target nucleic acid sequence from other sequences, e.g., one allele of a differentiating position, e.g., a SNP location, a mutation site, etc.
  • a core region comprises a sequence complementary to one allele of a SNP or a mutation (e.g., disease- associated mutation(s) in a RHO gene) but is not complementary to other alleles of a SNP or the wild type or another form of mutation which is not or is less associated with a condition, disorder or disease.
  • a sequence is one nucleobase.
  • a core region comprises a nucleobase complementary to an allele of a SNP which is on the same strand/chromosome as disease-associated mutation(s) in a RHO gene.
  • a core region comprises a nucleobase complementary to a mutation (e.g., a RHO mutation (e.g., P23H)) which is associated with a condition, disorder or disease.
  • a mutation e.g., a RHO mutation (e.g., P23H)
  • the present disclosure demonstrates that properties and/or activities of oligonucleotides may be modulated through positioning of such a nucleobase.
  • a position of such a nucleobase is position 4, 5, 6, 7 or 8 counting from the 5’-end of a core region (the first nucleoside of the core region from the 5’-end being position 1). In some embodiments, a position is position 4 from the 5’-end of a core region. In some embodiments, a position is position 5 from the 5’-end of a core region. In some embodiments, a position is position 6 from the 5’-end of a core region. In some embodiments, a position is position 7 from the 5’-end of a core region. In some embodiments, a position is position 8 from the 5’-end of a core region.
  • a position of such a nucleobase is position 7, 8, 9, 10, 11 or 12 counting from the 5’-end of an oligonucleotide (the first nucleoside of the oligonucleotide from the 5’-end being position 1). In some embodiments, a position is position 7 from the 5’-end of an oligonucleotide. In some embodiments, a position is position 8 from the 5’-end of an oligonucleotide. In some embodiments, a position is position 9 from the 5’-end of an oligonucleotide. In some embodiments, a position is position 10 from the 5’-end of an oligonucleotide.
  • a position is position 11 from the 5’-end of an oligonucleotide.
  • an oligonucleotide comprises a 5’-end wing comprising 5 and no more than 5 nucleosides.
  • each wing sugar is 2’-modified.
  • each wing sugar is 2’-OMe modified.
  • each core sugar independently comprises no 2’-OR modification, wherein R is as described in the present disclosure.
  • each core sugar is independently an unmodified DNA sugar.
  • a wing may comprise one or more high-affinity sugars.
  • a 3’-wing comprises a high-affinity sugar.
  • each sugar in a 3’-wing is independently a high-affinity sugar.
  • High-affinity sugars are widely known in the art and may be utilized in accordance with the present disclosure.
  • a high affinity sugar is a 2’-MOE modified sugar.
  • a high-affinity sugar is a LNA sugar.
  • a 5’-wing comprises no or fewer high-affinity sugars.
  • a 5’-wing comprises no or fewer high-affinity sugars present in the 3’-wing.
  • a 5’-wing comprises no 2’-MOE modified sugar while each 3’-wing sugar is 2’-MOE modified.
  • each 5’-wing sugar is 2’-OMe modified, while each 3’-wing sugar is 2’-MOE modified.
  • an oligonucleotide e.g., a RHO oligonucleotide, may comprise any first wing, core and/or second wing, as described herein or known in the art.
  • an oligonucleotide which has a base sequence which is, comprises or comprises a span of a RHO oligonucleotide sequence disclosed herein can comprise a first wing, core and/or second wing, as described herein or known in the art.
  • Internucleotidic Linkages [00389] In some embodiments, oligonucleotides comprise base modifications, sugar modifications, and/or internucleotidic linkage modifications. Various internucleotidic linkages can be utilized in accordance with the present disclosure to link units comprising nucleobases, e.g., nucleosides.
  • RHO oligonucleotides comprise both one or more modified internucleotidic linkages and one or more natural phosphate linkages.
  • natural phosphate linkages are widely found in natural DNA and RNA molecules; they have the structure of ⁇ OP(O)(OH)O ⁇ , connect sugars in the nucleosides in DNA and RNA, and may be in various salt forms, for example, at physiological pH (about 7.4), natural phosphate linkages are predominantly exist in salt forms with the anion being ⁇ OP(O)(O ⁇ )O ⁇ .
  • a modified internucleotidic linkage, or a non-natural phosphate linkage is an internucleotidic linkage that is not natural phosphate linkage or a salt form thereof.
  • Modified internucleotidic linkages may also be in their salt forms.
  • phosphorothioate internucleotidic linkages which have the structure of ⁇ OP(O)(SH)O ⁇ may be in various salt forms, e.g., at physiological pH (about 7.4) with the anion being ⁇ OP(O)(S ⁇ )O ⁇ .
  • an oligonucleotide comprises an internucleotidic linkage which is a modified internucleotidic linkage, e.g., phosphorothioate, phosphorodithioate, methylphosphonate, phosphoroamidate, thiophosphate, 3’-thiophosphate, or 5’-thiophosphate.
  • a modified internucleotidic linkage is a chiral internucleotidic linkage which comprises a chiral linkage phosphorus.
  • a chiral internucleotidic linkage is a phosphorothioate linkage.
  • a chiral internucleotidic linkage is a non-negatively charged internucleotidic linkage. In some embodiments, a chiral internucleotidic linkage is a neutral internucleotidic linkage. In some embodiments, a chiral internucleotidic linkage is chirally controlled with respect to its chiral linkage phosphorus. In some embodiments, a chiral internucleotidic linkage is stereochemically pure with respect to its chiral linkage phosphorus. In some embodiments, a chiral internucleotidic linkage is not chirally controlled.
  • a pattern of backbone chiral centers comprises or consists of positions and linkage phosphorus configurations of chirally controlled internucleotidic linkages (Rp or Sp) and positions of achiral internucleotidic linkages (e.g., natural phosphate linkages).
  • Rp or Sp chirally controlled internucleotidic linkages
  • achiral internucleotidic linkages e.g., natural phosphate linkages
  • an oligonucleotide comprises a modified internucleotidic linkage (e.g., a modified internucleotidic linkage having the structure of Formula I, I-a, I-b, or I-c, I-n-1, I-n-2, I-n-3, I- n-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, II-d-2, etc., or a salt form thereof) as described in US 9394333, US 9744183, US 9605019, US 9598458, US 9982257, US 10160969, US 10479995, US 2020/0056173, US 2018/0216107, US 2019/0127733, US 10450568, US 2019/0077817, US 2019/0249173, US 2019/0375774, WO 2018/223056, WO 2018/223073, WO 2018/223081,
  • a modified internucleotidic linkage is a non-negatively charged internucleotidic linkage.
  • provided oligonucleotides comprise one or more non-negatively charged internucleotidic linkages.
  • a non-negatively charged internucleotidic linkage is a positively charged internucleotidic linkage.
  • a non-negatively charged internucleotidic linkage is a neutral internucleotidic linkage.
  • the present disclosure provides oligonucleotides comprising one or more neutral internucleotidic linkages.
  • a non-negatively charged internucleotidic linkage or a neutral internucleotidic linkage is as described in US 9394333, US 9744183, US 9605019, US 9598458, US 9982257, US 10160969, US 10479995, US 2020/0056173, US 2018/0216107, US 2019/0127733, US 10450568, US 2019/0077817, US 2019/0249173, US 2019/0375774, WO 2018/223056, WO 2018/223073, WO 2018/223081, WO 2018/237194, WO 2019/032607, WO 2019/055951, WO 2019/075357, WO
  • a non-negatively charged internucleotidic linkage or neutral internucleotidic linkage is one of Formula I-n-1, I-n-2, I-n-3, I-n-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c- 1, II-c-2, II-d-1, II-d-2, etc. as described in WO 2018/223056, WO 2019/032607, WO 2019/075357, WO 2019/032607, WO 2019/075357, WO 2019/200185, WO 2019/217784, and/or WO 2019/032612, such internucleotidic linkages of each of which are independently incorporated herein by reference.
  • provided oligonucleotides comprise one or more non-negatively charged internucleotidic linkages.
  • a non-negatively charged internucleotidic linkage can improve the delivery and/or activity (e.g., ability to decrease the level, activity and/or expression of a target gene or a gene product thereof) of an oligonucleotide.
  • a R’ group of one N(R’) 2 is R
  • a R’ group of the other N(R’) 2 is R
  • the two R groups are taken together with their intervening atoms to form an optionally substituted ring, e.g., a 5-membered ring as in n001.
  • each R’ is independently R, wherein each R is independently optionally substituted C 1-6 aliphatic.
  • R’ is R.
  • R’ is H.
  • R’ is ⁇ C(O)R. In some embodiments, R’ is ⁇ C(O)OR. In some embodiments, R’ is ⁇ S(O) 2 R. [00400] In some embodiments, R” is ⁇ NHR’. In some embodiments, ⁇ N(R’) 2 is ⁇ NHR’. [00401] As described herein, some embodiments, R is H. In some embodiments, R is optionally substituted C 1-6 aliphatic. In some embodiments, R is optionally substituted C 1-6 alkyl. In some embodiments, R is methyl. In some embodiments, R is substituted methyl. In some embodiments, R is ethyl. In some embodiments, R is substituted ethyl.
  • a non-negatively charged internucleotidic linkage is a neutral internucleotidic linkage.
  • a modified internucleotidic linkage (e.g., a non-negatively charged internucleotidic linkage) comprises optionally substituted triazolyl.
  • a modified internucleotidic linkage (e.g., a non-negatively charged internucleotidic linkage) comprises optionally substituted alkynyl.
  • a modified internucleotidic linkage comprises a triazole or alkyne moiety.
  • a triazole moiety e.g., a triazolyl group
  • a triazole moiety e.g., a triazolyl group
  • a triazole moiety is substituted.
  • a triazole moiety is unsubstituted.
  • a modified internucleotidic linkage comprises an optionally substituted cyclic guanidine moiety.
  • a modified internucleotidic linkage comprises an optionally substituted cyclic guanidine moiety and has the structure o , , wherein W is O or S. In some embodiments, W is O.
  • a non-negatively charged internucleotidic linkage is stereochemically controlled.
  • a non-negatively charged internucleotidic linkage comprises an optionally substituted 3-20 membered heterocyclyl or heteroaryl group having 1-10 heteroatoms.
  • a non-negatively charged internucleotidic linkage comprises an optionally substituted 3-20 membered heterocyclyl or heteroaryl group having 1-10 heteroatoms, wherein at least one heteroatom is nitrogen.
  • such a heterocyclyl or heteroaryl group is of a 5-membered ring.
  • such a heterocyclyl or heteroaryl group is of a 6-membered ring.
  • a non-negatively charged internucleotidic linkage comprises an optionally substituted 5-20 membered heterocyclyl group having 1-10 heteroatoms.
  • a non-negatively charged internucleotidic linkage comprises an optionally substituted 5-20 membered heterocyclyl group having 1-10 heteroatoms, wherein at least one heteroatom is nitrogen.
  • a non-negatively charged internucleotidic linkage comprises an optionally substituted 5-6 membered heterocyclyl group having 1-4 heteroatoms, wherein at least one heteroatom is nitrogen.
  • a non-negatively charged internucleotidic linkage comprises an optionally substitute group. In some embodiments, a non- negatively charged internucleotidic linkage comprises an substitute group. In some embodiments, a non-negatively charged internucleotidic linkage comprise group. In some embodiments, each R 1 is independently optionally substituted C 1-6 alkyl. In diments, each R 1 is independently methyl. [00406] In some embodiments, an oligonucleotide comprises different types of internucleotidic phosphorus linkages.
  • a chirally controlled oligonucleotide comprises at least one natural phosphate linkage and at least one modified (non-natural) internucleotidic linkage. In some embodiments, an oligonucleotide comprises at least one natural phosphate linkage and at least one phosphorothioate. In some embodiments, an oligonucleotide comprises at least one non-negatively charged internucleotidic linkage. In some embodiments, an oligonucleotide comprises at least one natural phosphate linkage and at least one non-negatively charged internucleotidic linkage.
  • an oligonucleotide comprises at least one phosphorothioate internucleotidic linkage and at least one non- negatively charged internucleotidic linkage. In some embodiments, an oligonucleotide comprises at least one phosphorothioate internucleotidic linkage, at least one natural phosphate linkage, and at least one non- negatively charged internucleotidic linkage.
  • oligonucleotides comprise one or more, e.g., 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more non-negatively charged internucleotidic linkages.
  • a non-negatively charged internucleotidic linkage is not negatively charged in that at a given pH in an aqueous solution less than 50%, 40%, 40%, 30%, 20%, 10%, 5%, or 1% of the internucleotidic linkage exists in a negatively charged salt form.
  • a pH is about pH 7.4. In some embodiments, a pH is about 4-9.
  • an internucleotidic linkage is a non-negatively charged internucleotidic linkage in that the neutral form of the internucleotidic linkage has no pKa that is no more than about 1, 2, 3, 4, 5, 6, or 7 in water. In some embodiments, no pKa is 7 or less. In some embodiments, no pKa is 6 or less. In some embodiments, no pKa is 5 or less. In some embodiments, no pKa is 4 or less. In some embodiments, no pKa is 3 or less.
  • no pKa is 2 or less. In some embodiments, no pKa is 1 or less.
  • pKa of the neutral form of an internucleotidic linkage can be represented by pKa of the neutral form of a compound having the structure of CH 3 ⁇ the internucleotidic linkage ⁇ CH 3 . For example be represente In some embodiments, a non-negatively charged internucleotidic linkage i nkage. In some embodiments, a non-negatively charged internucleotidic linkage is a positively-charged internucleotidic linkage.
  • a non- negatively charged internucleotidic linkage comprises a guanidine moiety. In some embodiments, a non- negatively charged internucleotidic linkage comprises a heteroaryl base moiety. In some embodiments, a non-negatively charged internucleotidic linkage comprises a triazole moiety. In some embodiments, a non- negatively charged internucleotidic linkage comprises an alkynyl moiety.
  • a neutral internucleotidic linkage can be more hydrophobic than a phosphorothioate internucleotidic linkage (PS), which can be more hydrophobic than a natural phosphate linkage (PO).
  • PS phosphorothioate internucleotidic linkage
  • PO natural phosphate linkage
  • a neutral internucleotidic linkage bears less charge.
  • incorporation of one or more neutral internucleotidic linkages into an oligonucleotide may increase oligonucleotides’ ability to be taken up by a cell and/or to escape from endosomes.
  • incorporation of one or more neutral internucleotidic linkages can be utilized to modulate melting temperature of duplexes formed between an oligonucleotide and its target nucleic acid.
  • incorporation of one or more non-negatively charged internucleotidic linkages, e.g., neutral internucleotidic linkages, into an oligonucleotide may be able to increase the oligonucleotide’s ability to mediate a function such as gene knockdown.
  • an oligonucleotide e.g., a RHO oligonucleotide capable of mediating knockdown of level of a nucleic acid or a product encoded thereby comprises one or more non-negatively charged internucleotidic linkages.
  • an oligonucleotide e.g., a RHO oligonucleotide capable of mediating knockdown of expression of a target gene comprises one or more non-negatively charged internucleotidic linkages.
  • oligonucleotides of the present disclosure comprise two or more different internucleotidic linkages.
  • an oligonucleotide comprises a phosphorothioate internucleotidic linkage and a non-negatively charged internucleotidic linkage. In some embodiments, an oligonucleotide comprises a phosphorothioate internucleotidic linkage, a non-negatively charged internucleotidic linkage, and a natural phosphate linkage. In some embodiments, a non-negatively charged internucleotidic linkage is a neutral internucleotidic linkage. In some embodiments, a non-negatively charged internucleotidic linkage is n001.
  • each phosphorothioate internucleotidic linkage is independently chirally controlled.
  • each chiral modified internucleotidic linkage is independently chirally controlled.
  • at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 chiral internucleotidic linkage are independently chirally controlled.
  • an internucleotidic linkage forms bonds through its oxygen atoms or heteroatoms with one optionally modified ribose or deoxyribose at its 5’ carbon, and the other optionally modified ribose or deoxyribose at its 3’ carbon.
  • each nucleoside units connected by an internucleotidic linkage independently comprises a nucleobase which is independently an optionally substituted A, T, C, G, or U, or an optionally substituted tautomer of A, T, C, G or U.
  • R is optionally substituted C 1-6 aliphatic.
  • R is methyl.
  • R is ethyl.
  • many other types of internucleotidic linkages may be utilized in accordance with the present disclosure, for example, those described in U.S. Pat. Nos.
  • a modified internucleotidic linkage is one described in US 9394333, US 9744183, US 9605019, US 9598458, US 9982257, US 10160969, US 10479995, US 2020/0056173, US 2018/0216107, US 2019/0127733, US 10450568, US 2019/0077817, US 2019/0249173, US 2019/0375774, WO 2018/223056, WO 2018/223073, WO 2018/223081, WO 2018/237194, WO 2019/032607, WO 2019/055951, WO 2019/075357, WO 2019/200185, WO 2019/217784, and/or WO 2019/032612, the nucleobases, sugars, internucleotidic linkages, chiral auxiliaries/reagents, and technologies for oligonucleotide synthesis (reagents, conditions, cycles, etc.) of each of which is independently incorporated herein by reference
  • an oligonucleotide comprises one or more nucleotides that independently comprise a phosphorus modification prone to “autorelease” under certain conditions. That is, under certain conditions, a particular phosphorus modification is designed such that it self-cleaves from the oligonucleotide to provide, e.g., a natural phosphate linkage. Certain examples of such phosphorus modification groups can be found in US 9982257.
  • an autorelease group is characterized by the ability to deliver an agent to the internucleotidic phosphorus linker, which agent facilitates further modification of the phosphorus atom such as, e.g., desulfurization.
  • the agent is water and the further modification is hydrolysis to form a natural phosphate linkage.
  • provided oligonucleotides or regions thereof comprises alternating phosphodiester (PO) and phosphorothioate (PS) internucleotidic linkages, e.g., [(PO)(PS)]x, [(PS)(PO)]x, etc., wherein x is 1-50.
  • an oligonucleotide or a region thereof comprises or consists of a pattern of backbone linkages (internucleotidic linkages) of (PM)(PO/PN)t, (PM)(PO)t, or (PM)(PN)t, wherein each PM is independently a modified internucleotidic linkage, each PN is independently a non-negatively charged internucleotidic linkage, and t is 1-50.
  • an oligonucleotide or a region thereof, e.g., a 3’-wing comprises or consists of a pattern of backbone linkages (internucleotidic linkages) of (PO/PN)m(PM), (PO)m(PM), or (PN)m(PM), wherein m is 1-50, and each other variable is independently as described in the present disclosure.
  • an oligonucleotide comprises or consists of a pattern of backbone linkages (internucleotidic linkages) of (PM)(PO/PN)t(PM)n(PO/PN)m(PM), (PM)(PN)t(PM)n(PO)m(PM), (PM)(PO)t(PM)n(PN)m(PM), (PM)(PO)t(PM)n(PO)m(PM), or (PM)(PN)t(PM)n(PN)m(PM), wherein n is 1-50, and each other variable is as described in the present disclosure.
  • a PM is a PS.
  • each PM is a PS.
  • a PN is n001. In some embodiments, each PN is n001. [00415] In some embodiments, t is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, t is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, t is 1-10, 1-15, 1-20, 1-25, 1-30, 2-10, 2-15, 2-20, 2-25, 2-30, 5-10, 5-15, 5-20, 5-25, 5-30, 8-10, 8-15, 8-20, 8- 25, 8-30, 10-15, 10-20, 10-25, or 10-30.
  • t is 1-3, 1-4, 1-5, 1-10, 2-3, 2-5, 2-6, or 2- 10. In some embodiments, t is 1. In some embodiments, t is 2. In some embodiments, t is 3. In some embodiments, t is 4. In some embodiments, t is 5. In some embodiments, t is 6. In some embodiments, t is 7. In some embodiments, t is 8. In some embodiments, t is 9. In some embodiments, t is 10. In some embodiments, t is 11. In some embodiments, t is 12. In some embodiments, t is 13. In some embodiments, t is 14. In some embodiments, t is 15. In some embodiments, t is 16. In some embodiments, t is 17.
  • t is 18. In some embodiments, t is 19. In some embodiments, t is 20. [00416] In some embodiments, m is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, m is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, m is 1-10, 1-15, 1-20, 1-25, 1-30, 2-10, 2-15, 2-20, 2-25, 2-30, 5-10, 5-15, 5-20, 5-25, 5-30, 8-10, 8-15, 8- 20, 8-25, 8-30, 10-15, 10-20, 10-25, or 10-30.
  • m is 1-3, 1-4, 1-5, 1-10, 2-3, 2-5, 2- 6, or 2-10. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4. In some embodiments, m is 5. In some embodiments, m is 6. In some embodiments, m is 7. In some embodiments, m is 8. In some embodiments, m is 9. In some embodiments, m is 10. In some embodiments, m is 11. In some embodiments, m is 12. In some embodiments, m is 13. In some embodiments, m is 14. In some embodiments, m is 15. In some embodiments, m is 16. In some embodiments, m is 17.
  • n is 1-10, 1-15, 1-20, 1-25, 1-30, 2-10, 2-15, 2-20, 2-25, 2-30, 5-10, 5-15, 5-20, 5- 25, 5-30, 8-10, 8-15, 8-20, 8-25, 8-30, 10-15, 10-20, 10-25, or 10-30. In some embodiments, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, n is 1.
  • n is 2. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5. In some embodiments, n is 6. In some embodiments, n is 7. In some embodiments, n is 8. In some embodiments, n is 9. In some embodiments, n is 10. In some embodiments, n is 11. In some embodiments, n is 12. In some embodiments, n is 13. In some embodiments, n is 14. In some embodiments, n is 15. In some embodiments, n is 16. In some embodiments, n is 17. In some embodiments, n is 18. In some embodiments, n is 19. In some embodiments, n is 20.
  • oligonucleotides in Table A1 Examples of certain patterns can be found, e.g., in oligonucleotides in Table A1.
  • Various types of internucleotidic linkages may be utilized in combination of other structural elements, e.g., sugars, to achieve desired oligonucleotide properties and/or activities.
  • the present disclosure routinely utilizes modified internucleotidic linkages and modified sugars, optionally with natural phosphate linkages and natural sugars, in designing oligonucleotides.
  • the present disclosure provides an oligonucleotide comprising one or more modified sugars.
  • the present disclosure provides an oligonucleotide comprising one or more modified sugars and one or more modified internucleotidic linkages, one or more of which are natural phosphate linkages.
  • Oligonucleotide Compositions [00420] Among other things, the present disclosure provides various oligonucleotide compositions. In some embodiments, the present disclosure provides oligonucleotide compositions of oligonucleotides described herein. In some embodiments, an oligonucleotide composition, e.g., a RHO oligonucleotide composition, comprises a plurality of an oligonucleotide described in the present disclosure.
  • an oligonucleotide composition e.g., a RHO oligonucleotide composition
  • an oligonucleotide composition e.g., a RHO oligonucleotide composition
  • Linkage phosphorus of natural phosphate linkages is achiral.
  • Linkage phosphorus of many modified internucleotidic linkages, e.g., phosphorothioate internucleotidic linkages, are chiral.
  • oligonucleotide compositions e.g., in traditional phosphoramidite oligonucleotide synthesis
  • stereorandom oligonucleotide compositions have sufficient properties and/or activities for certain purposes and/or applications.
  • stereorandom oligonucleotide compositions can be cheaper, easier and/or simpler to produce than chirally controlled oligonucleotide compositions.
  • stereoisomers within stereorandom compositions may have different properties, activities, and/or toxicities, resulting in inconsistent therapeutic effects and/or unintended side effects by stereorandom compositions, particularly compared to certain chirally controlled oligonucleotide compositions of oligonucleotides of the same constitution.
  • the present disclosure encompasses technologies for designing and preparing chirally controlled oligonucleotide compositions.
  • the present disclosure provides chirally controlled oligonucleotide compositions, e.g., of many oligonucleotides in Table A1 which contain S and/or R in their stereochemistry/linkage.
  • a chirally controlled oligonucleotide composition comprises a controlled/pre-determined (not random as in stereorandom compositions) level of a plurality of oligonucleotides, wherein the oligonucleotides share the same linkage phosphorus stereochemistry at one or more chiral internucleotidic linkages (chirally controlled internucleotidic linkages).
  • the oligonucleotides share the same pattern of backbone chiral centers (stereochemistry of linkage phosphorus).
  • a pattern of backbone chiral centers is as described in the present disclosure.
  • the oligonucleotides are structural identical.
  • an oligonucleotide composition is a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides share: 1) a common base sequence, 2) a common pattern of backbone linkages, and 3) the same linkage phosphorus stereochemistry at one or more (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 1-15, 1-10, 5-50, 5-40, 5-30, 5-25, 5-20, 5-15, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) chiral internucleotidic linkages (chirally controlled internucleotidic linkages), wherein the composition is enriched, relative to a substantially racemic preparation of oligonucleotides sharing the common base sequence and pattern of backbone linkages, for oligonucleotides of the plurality.
  • an oligonucleotide composition is a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides share: 1) a common base sequence, 2) a common patter of backbone linkages, and 3) a common pattern of backbone chiral centers, which pattern comprises at least one Sp, wherein the composition is enriched, relative to a substantially racemic preparation of oligonucleotides sharing the common base sequence and pattern of backbone linkages, for oligonucleotides of the plurality.
  • an oligonucleotide composition is a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides share: 1) a common base sequence, 2) a common patter of backbone linkages, and 3) a common pattern of backbone chiral centers, which pattern comprises at least one Rp, wherein the composition is enriched, relative to a substantially racemic preparation of oligonucleotides sharing the common base sequence and pattern of backbone linkages, for oligonucleotides of the plurality.
  • oligonucleotides of a plurality are of the same constitution.
  • the present disclosure provides a chirally controlled oligonucleotide composition
  • a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides are of a common constitution, and share the same linkage phosphorus stereochemistry at one or more (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more) chiral internucleotidic linkages (chirally controlled internucleotidic linkages), wherein the composition is enriched, relative to a substantially racemic preparation of oligonucleotides of the common constitution, for oligonucleotides of the plurality.
  • oligonucleotides of a plurality are structurally identical.
  • the present disclosure provides a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides are structurally identical, and share the same linkage phosphorus stereochemistry at one or more (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more) chiral internucleotidic linkages (chirally controlled internucleotidic linkages), wherein the composition is enriched, relative to a substantially racemic preparation of oligonucleotides of the same constitution as the oligonucleotides of the plurality, for oligonucleotides of the plurality.
  • oligonucleotides of the plurality share the same stereochemistry at each phosphorothioate internucleotidic linkage.
  • the present disclosure provides an oligonucleotide has the structure of Geo*SGeon001RTeoAeon001Rm5Ceo*ST*Sm5C*SG*SA*SA*SG*ST*SG*RG*SC*SmU*SmG*Sm5 Ceon001RmG*SmU or a salt thereof.
  • a provided oligonucleotide is of a purity as described herein, e.g., (DS) nc wherein DS is as described herein and nc is 18.
  • DS is 90%-100% (e.g., 0%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%). In some embodiments, DS is 95%-100%.
  • the present disclosure provides a chirally controlled composition comprising a plurality of oligonucleotides, each of which independently has the structure of Geo*SGeon001RTeoAeon001Rm5Ceo*ST*Sm5C*SG*SA*SA*SG*ST*SG*RG*SC*SmU*SmG*Sm5 Ceon001RmG*SmU or a salt thereof, wherein the composition is enriched, relative to a substantially racemic preparation of Geo*SGeon001RTeoAeon001Rm5Ceo*ST*Sm5C*SG*SA*SA*SG*ST*SG*RG*SC*SmU*SmG*Sm5 Ceon001RmG*SmU or a salt thereof, wherein the composition
  • the present disclosure provides a composition comprising a plurality of oligonucleotides, each of which independently has the structure of Geo*SGeon001RTeoAeon001Rm5Ceo*ST*Sm5C*SG*SA*SA*SG*ST*SG*RG*SC*SmU*SmG*Sm5 Ceon001RmG*SmU or a salt thereof, wherein about or at least about (e.g., 10%-100%, 10%-95%, 20%- 90%, 30%-90%, 40%-90%, 50%-90%, 50%-80%, about or at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in the composition that share the base sequence of an oligonucleotide of the plurality are oligonucleotides of the plurality
  • the present disclosure provides a composition comprising a plurality of oligonucleotides, each of which independently has the structure of Geo*SGeon001RTeoAeon001Rm5Ceo*ST*Sm5C*SG*SA*SA*SG*ST*SG*RG*SC*SmU*SmG*Sm5 Ceon001RmG*SmU or a salt thereof, wherein about or at least about (e.g., 10%-100%, 10%-95%, 20%- 90%, 30%-90%, 40%-90%, 50%-90%, 50%-80%, about or at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in the composition that share the constitution of an oligonucleotide of the plurality are oligonucleotides of the plurality.
  • the present disclosure provides a composition comprising an oligonucleotide Geo*SGeon001RTeoAeon001Rm5Ceo*ST*Sm5C*SG*SA*SA*SG*ST*SG*RG*SC*SmU*SmG*Sm5 Ceon001RmG*SmU or a salt thereof, wherein each chiral linkage phosphorus of the oligonucleotide independently has a de of about or at least about 80%-100% (e.g., 85%-100%, 90%-100%, 90%-98%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%).
  • 80%-100% e.g., 85%-100%, 90%-100%, 90%-98%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
  • the present disclosure provides an oligonucleotide has the structure of Geo*SGeon001RTeoAeon001Rm5Ceo*ST*Sm5C*SG*SA*SA*SG*ST*SG*RG*SC*SmU*SmG*Sm5 Ceo*SmGn001RmU or a salt thereof.
  • a provided oligonucleotide is of a purity as described herein, e.g., (DS) nc wherein DS is as described herein and nc is 18.
  • DS is 90%-100% (e.g., 0%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%). In some embodiments, DS is 95%-100%.
  • the present disclosure provides a chirally controlled composition comprising a plurality of oligonucleotides, each of which independently has the structure of Geo*SGeon001RTeoAeon001Rm5Ceo*ST*Sm5C*SG*SA*SA*SG*ST*SG*RG*SC*SmU*SmG*Sm5 Ceo*SmGn001RmU or a salt thereof, wherein the composition is enriched, relative to a substantially racemic preparation of Geo*SGeon001RTeoAeon001Rm5Ceo*ST*Sm5C*SG*SA*SA*SG*ST*SG*RG*SC*SmU*SmG*Sm5 Ceo*SmGn
  • the present disclosure provides a composition comprising a plurality of oligonucleotides, each of which independently has the structure of Geo*SGeon001RTeoAeon001Rm5Ceo*ST*Sm5C*SG*SA*SA*SG*ST*SG*RG*SC*SmU*SmG*Sm5 Ceo*SmGn001RmU or a salt thereof, wherein about or at least about (e.g., 10%-100%, 10%-95%, 20%- 90%, 30%-90%, 40%-90%, 50%-90%, 50%-80%, about or at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in the composition that share the base sequence of an oligonucleotide of the plurality are oligonucleotides of the plurality
  • the present disclosure provides a composition comprising a plurality of oligonucleotides, each of which independently has the structure of Geo*SGeon001RTeoAeon001Rm5Ceo*ST*Sm5C*SG*SA*SA*SG*ST*SG*RG*SC*SmU*SmG*Sm5 Ceo*SmGn001RmU or a salt thereof, wherein about or at least about (e.g., 10%-100%, 10%-95%, 20%- 90%, 30%-90%, 40%-90%, 50%-90%, 50%-80%, about or at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in the composition that share the constitution of an oligonucleotide of the plurality are oligonucleotides of the plurality
  • the present disclosure provides a composition comprising an oligonucleotide Geo*SGeon001RTeoAeon001Rm5Ceo*ST*Sm5C*SG*SA*SA*SG*ST*SG*RG*SC*SmU*SmG*Sm5 Ceo*SmGn001RmU or a salt thereof, wherein each chiral linkage phosphorus of the oligonucleotide independently has a de of about or at least about 80%-100% (e.g., 85%-100%, 90%-100%, 90%-98%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%).
  • 80%-100% e.g., 85%-100%, 90%-100%, 90%-98%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
  • an enrichment relative to a substantially racemic preparation is that at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of all oligonucleotides in the composition are oligonucleotide of the plurality.
  • an enrichment relative to a substantially racemic preparation is that at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of all oligonucleotides in the composition that share the common base sequence are oligonucleotides of the plurality.
  • the percentage is at least about 10%. In some embodiments, the percentage is at least about 20%. In some embodiments, the percentage is at least about 30%. In some embodiments, the percentage is at least about 40%. In some embodiments, the percentage is at least about 50%. In some embodiments, the percentage is at least about 60%. In some embodiments, the percentage is at least about 70%.
  • the percentage is at least about 75%. In some embodiments, the percentage is at least about 80%. In some embodiments, the percentage is at least about 85%. In some embodiments, the percentage is at least about 90%. In some embodiments, the percentage is at least about 91%. In some embodiments, the percentage is at least about 92%. In some embodiments, the percentage is at least about 93%. In some embodiments, the percentage is at least about 94%. In some embodiments, the percentage is at least about 95%. In some embodiments, the percentage is at least about 96%. In some embodiments, the percentage is at least about 97%. In some embodiments, the percentage is at least about 98%. In some embodiments, the percentage is at least about 99%.
  • oligonucleotide may be properly considered to have the same constitution and/or structure, and various forms of oligonucleotides sharing the same constitution may be properly considered to have the same constitution.
  • levels of oligonucleotides of a plurality in chirally controlled oligonucleotide compositions are controlled.
  • levels of oligonucleotides are random and not controlled.
  • a level of the oligonucleotides of a plurality in a chirally controlled oligonucleotide composition is about 1%-100%, (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in the chirally controlled oligonucleotide composition, or of all oligonucleotides in the chirally controlled oligon
  • an enrichment relative to a substantially racemic preparation is a level described herein.
  • a level as a percentage e.g., a controlled level, a pre-determined level, an enrichment
  • DS is 90%-100%
  • nc is the number of chirally controlled internucleotidic linkages as described in the present disclosure (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more).
  • each chiral internucleotidic linkage is independently chirally controlled and nc is the number of chiral internucleotidic linkage.
  • each chiral internucleotidic linkage is chirally controlled, and nc is the number of chiral internucleotidic linkage.
  • DS is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or more.
  • DS is or is at least 90%.
  • DS is or is at least 91%.
  • DS is or is at least 92%.
  • DS is or is at least 93%.
  • DS is or is at least 94%.
  • DS is or is at least 95%.
  • DS is or is at least 96%.
  • DS is or is at least 97%. In some embodiments, DS is or is at least 98%. In some embodiments, DS is or is at least 99%.
  • a level e.g., a controlled level, a pre-determined level, an enrichment
  • an oligonucleotide composition is a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides share: 1) a common base sequence, 2) a common pattern of backbone linkages, and 3) the same linkage phosphorus stereochemistry at one or more (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 1-15, 1-10, 5-50, 5-40, 5-30, 5-25, 5-20, 5-15, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) chiral internucleotidic linkages (chirally controlled internucleotidic linkages), wherein the percentage of the oligonucle
  • an oligonucleotide composition is a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides share: 1) a common base sequence, 2) a common patter of backbone linkages, and 3) a common pattern of backbone chiral centers, which pattern comprises at least one Sp, wherein the percentage of the oligonucleotides of the plurality within all oligonucleotides in the composition that share the common base sequence and pattern of backbone linkages is at least (DS) nc , wherein DS is 90%-100%, and nc is the number of chirally controlled internucleotidic linkages.
  • an oligonucleotide composition is a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides share: 1) a common base sequence, 2) a common patter of backbone linkages, and 3) a common pattern of backbone chiral centers, which pattern comprises at least one Rp, wherein the percentage of the oligonucleotides of the plurality within all oligonucleotides in the composition that share the common base sequence and pattern of backbone linkages is at least (DS) nc , wherein DS is 90%-100%, and nc is the number of chirally controlled internucleotidic linkages.
  • an oligonucleotide composition is a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, each of which is independently Geo*SGeon001RTeoAeon001Rm5Ceo*ST*Sm5C*SG*SA*SA*SG*ST*SG*RG*SC*SmU*SmG*Sm5 Ceon001RmG*SmU or a salt thereof, wherein the percentage of the oligonucleotides of the plurality within all oligonucleotides in the composition that share the constitution of an oligonucleotide of the plurality is at least (DS) nc , wherein DS is 90%-100%, and nc is 18.
  • an oligonucleotide composition is a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, each of which is independently Geo*SGeon001RTeoAeon001Rm5Ceo*ST*Sm5C*SG*SA*SA*SG*ST*SG*RG*SC*SmU*SmG*Sm5 Ceo*SmGn001RmU or a salt thereof, wherein the percentage of the oligonucleotides of the plurality within all oligonucleotides in the composition that share the constitution of an oligonucleotide of the plurality is at least (DS) nc , wherein DS is 90%-100%, and nc is 18.
  • the present disclosure provides a chirally controlled oligonucleotide composition
  • a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides are of a common constitution, and share the same linkage phosphorus stereochemistry at one or more (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 1-15, 1-10, 5-50, 5-40, 5-30, 5-25, 5-20, 5-15, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) chiral internucleotidic linkages (chirally controlled internucleotidic linkages), wherein the percentage of the oligonucleotides of the plurality within all oligonucleotides of the same constitution in the composition is at least (DS) nc , wherein DS is 90%-100%, and nc is the number of chirally controlled internucleot
  • oligonucleotides of the plurality are of different salt forms. In some embodiments, oligonucleotides of the plurality comprise one or more forms, e.g., various pharmaceutically acceptable salt forms, of a single oligonucleotide. In some embodiments, oligonucleotides of the plurality comprise one or more forms, e.g., various pharmaceutically acceptable salt forms, of two or more oligonucleotides.
  • oligonucleotides of the plurality comprise one or more forms, e.g., various pharmaceutically acceptable salt forms, of 2 NCC oligonucleotides, wherein NCC is the number of non-chirally controlled chiral internucleotidic linkages.
  • the 2 NCC oligonucleotides have relatively similar levels within a composition as, e.g., none of them are specifically enriched using chirally controlled oligonucleotide synthesis.
  • the present disclosure provides a chirally controlled oligonucleotide composition
  • a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides are structurally identical, and share the same linkage phosphorus stereochemistry at one or more (e.g., 1-50, 1-40, 1-30, 1- 25, 1-20, 1-15, 1-10, 5-50, 5-40, 5-30, 5-25, 5-20, 5-15, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) chiral internucleotidic linkages (chirally controlled internucleotidic linkages), wherein the percentage of the oligonucleotides of the plurality within all oligonucleotides of the same constitution as the oligonucleotides of the plurality in the composition is at least (DS) nc , wherein DS is 90%- 100%, and nc is the
  • level of a plurality of oligonucleotides in a composition can be determined as the product of the diastereopurity of each chirally controlled internucleotidic linkage in the oligonucleotides.
  • diastereopurity of an internucleotidic linkage connecting two nucleosides in an oligonucleotide (or nucleic acid) is represented by the diastereopurity of an internucleotidic linkage of a dimer connecting the same two nucleosides, wherein the dimer is prepared using comparable conditions, in some instances, identical synthetic cycle conditions (e.g., for the linkage between Nx and Ny in an oligonucleotide ....NxNy unlike, the dimer is NxNy).
  • all chiral internucleotidic linkages are chiral controlled, and the composition is a completely chirally controlled oligonucleotide composition.
  • not all chiral internucleotidic linkages are chiral controlled internucleotidic linkages, and the composition is a partially chirally controlled oligonucleotide composition.
  • at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of all chiral internucleotidic linkages are chirally controlled.
  • Oligonucleotides may comprise or consist of various patterns of backbone chiral centers (patterns of stereochemistry of chiral linkage phosphorus). Certain useful patterns of backbone chiral centers are described in the present disclosure.
  • a plurality of oligonucleotides share a common pattern of backbone chiral centers, which is or comprises a pattern described in the present disclosure (e.g., as in “Linkage Phosphorus Stereochemistry and Patterns Thereof”, a pattern of backbone chiral centers of a chirally controlled oligonucleotide in Table A1, etc.).
  • a chirally controlled oligonucleotide composition is chirally pure (or stereopure, stereochemically pure) oligonucleotide composition, wherein the oligonucleotide composition comprises a plurality of oligonucleotides, wherein the oligonucleotides are identical [including that each chiral element of the oligonucleotides, including each chiral linkage phosphorus, is independently defined (stereodefined)], and the composition does not contain other stereoisomers.
  • a chirally pure (or stereopure, stereochemically pure) oligonucleotide composition of an oligonucleotide stereoisomer does not contain other stereoisomers (as appreciated by those skilled in the art, one or more unintended stereoisomers may exist as impurities - example purities are descried in the present disclosure).
  • Chirally controlled oligonucleotide compositions can demonstrate a number of advantages over stereorandom oligonucleotide compositions. Among other things, chirally controlled oligonucleotide compositions are more uniform than corresponding stereorandom oligonucleotide compositions with respect to oligonucleotide structures.
  • compositions of individual stereoisomers can be prepared and assessed, so that chirally controlled oligonucleotide composition of stereoisomers with desired properties and/or activities can be developed.
  • chirally controlled oligonucleotide compositions provides better delivery, stability, clearance, activity, selectivity, and/or toxicity profiles compared to, e.g., corresponding stereorandom oligonucleotide compositions.
  • chirally controlled oligonucleotide compositions provide better efficacy, fewer side effects, and/or more convenient and effective dosage regimens.
  • patterns of backbone chiral centers as described herein can be utilized to provide controlled cleavage of oligonucleotide targets (e.g., transcripts such as pre-mRNA, mature mRNA, etc.; including control of cleavage sites, rate and/or extent of cleavage at cleavage sites, and/or overall rate and extent of cleavage, etc.) and greatly increased target selectivity.
  • oligonucleotide targets e.g., transcripts such as pre-mRNA, mature mRNA, etc.; including control of cleavage sites, rate and/or extent of cleavage at cleavage sites, and/or overall rate and extent of cleavage, etc.
  • chirally controlled oligonucleotide compositions of oligonucleotides comprising certain patterns of backbone chiral centers can differentiate sequences with nucleobase difference at very few positions, in some embodiments, at single position (e.g., at SNP site, point mutation site, etc
  • the present disclosure provides a stereorandom oligonucleotide composition, e.g., a stereorandom RHO oligonucleotide composition.
  • a stereorandom RHO oligonucleotide composition which is capable of decreasing the level, activity or expression of a RHO gene or a gene product thereof.
  • the present disclosure provides a stereorandom RHO oligonucleotide composition which is capable of decreasing the level, activity or expression of a RHO gene or a gene product thereof, and wherein the base sequence of the RHO oligonucleotides is, comprises, or comprises a span (e.g., at least 10 or 15 contiguous bases) of a base sequence disclosed herein (e.g., a base sequence in Table A1, wherein each T may be independently replaced with U and vice versa).
  • a span e.g., at least 10 or 15 contiguous bases
  • the present disclosure provides a stereorandom RHO oligonucleotide composition which is capable of decreasing the level, activity or expression of a RHO gene or a gene product thereof, and wherein the base sequence of the RHO oligonucleotides is or comprises a base sequence disclosed herein (e.g., a base sequence in Table A1, wherein each T may be independently replaced with U and vice versa).
  • the present disclosure provides a stereorandom RHO oligonucleotide composition which is capable of decreasing the level, activity or expression of a RHO gene or a gene product thereof, and wherein the base sequence of the RHO oligonucleotides is a base sequence disclosed herein (e.g., a base sequence in Table A1, wherein each T may be independently replaced with U and vice versa).
  • the base sequence of the RHO oligonucleotides is a base sequence disclosed herein (e.g., a base sequence in Table A1, wherein each T may be independently replaced with U and vice versa).
  • stereopure (or chirally controlled) oligonucleotide compositions e.g., stereopure (or chirally controlled) RHO oligonucleotide compositions, are described herein, including but not limited to: WV-39023 and WV-48182.
  • an oligonucleotide composition comprises a plurality of oligonucleotides, one or more internucleotidic linkages of which which are stereocontrolled (chirally controlled) and one or more internucleotidic linkages which are stereorandom.
  • a RHO oligonucleotide composition comprises a plurality of oligonucleotides, one or more internucleotidic linkages of which are stereocontrolled (chirally controlled) and one or more internucleotidic linkages which are stereorandom.
  • an oligonucleotide composition comprises a plurality of oligonucleotides, one or more internucleotidic linkages of which are stereocontrolled (e.g., chirally controlled) and one or more internucleotidic linkages which are stereorandom.
  • stereorandom or (substantially) racemic preparations/non-chirally controlled oligonucleotide compositions are typically prepared without chiral control, e.g., without using chiral auxiliaries, chiral modification reagents, and/or chiral catalysts that can provide high stereoselectivity (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or more; in some embodiments, 95%, 96%, 97%, 98%, 99% or 99.5% or more; in some embodiments, 97%, 98%, 99% or 99.5% or more; in some embodiments, 98%, 99% or 99.5% or more; in some embodiments, 98%, 99% or 99.5% or more) at linkage phosphorus during oligonucleotide synthesis.
  • high stereoselectivity e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 9
  • a substantially racemic (or chirally uncontrolled) preparation of oligonucleotides coupling steps are not chirally controlled in that the coupling steps are not specifically conducted to provide enhanced stereoselectivity.
  • An example substantially racemic preparation of oligonucleotides / non-chirally controlled oligonucleotide composition is a preparation of phosphorothioate oligonucleotides through traditional phosphoramidite oligonucleotide synthesis and sulfurization with non-chiral sulfurization reagents such as tetraethylthiuram disulfide or (TETD), 3H-1, 2-bensodithiol-3-one 1, 1-dioxide (BDTD), etc., which are well-known processes.
  • TETD tetraethylthiuram disulfide
  • BDTD 2-bensodithiol-3-one 1, 1-dioxide
  • the present disclosure provides a chirally controlled oligonucleotide composition, e.g., chirally controlled RHO oligonucleotide composition.
  • provided chirally controlled oligonucleotide compositions comprise a plurality of oligonucleotides, e.g., RHO oligonucleotides, of the same constitution, and have one or more (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 1-15, 1-10, 5-50, 5-40, 5-30, 5-25, 5-20, 5-15, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) internucleotidic linkages.
  • RHO oligonucleotides e.g., RHO oligonucleotides
  • a plurality of oligonucleotides e.g., in a chirally controlled oligonucleotide composition, is a plurality of an oligonucleotide selected from Table A1, wherein the oligonucleotide comprises at least one Rp or Sp linkage phosphorus in a chirally controlled internucleotidic linkage.
  • a plurality of oligonucleotides e.g., in a chirally controlled oligonucleotide composition, is a plurality of an oligonucleotide selected from Table A1, wherein each phosphorothioate internucleotidic linkage in the oligonucleotide is independently chirally controlled (each phosphorothioate internucleotidic linkage is independently Rp or Sp).
  • an oligonucleotide composition e.g., a RHO oligonucleotide composition is a substantially pure preparation of a single oligonucleotide in that oligonucleotides in the composition that are not the single oligonucleotide are impurities from the preparation process of the single oligonucleotide, in some case, after certain purification procedures.
  • a single oligonucleotide is an oligonucleotide of Table A1, wherein each chiral internucleotidic linkage of the oligonucleotide is chirally controlled (e.g., indicated as S or R but not X in “Stereochemistry/Linkage”).
  • a chirally controlled oligonucleotide composition can have, relative to a corresponding stereorandom oligonucleotide composition, increased activity and/or stability, increased delivery, and/or decreased ability to elicit adverse effects such as complement, TLR9 activation, etc.
  • a stereorandom (non-chirally controlled) oligonucleotide composition differs from a chirally controlled oligonucleotide composition in that its corresponding plurality of oligonucleotides do not contain any chirally controlled internucleotidic linkages but the stereorandom oligonucleotide composition is otherwise identical to the chirally controlled oligonucleotide composition.
  • the present disclosure pertains to a chirally controlled RHO oligonucleotide composition which is capable of decreasing the level, activity or expression of a RHO gene or a gene product thereof.
  • the present disclosure provides a chirally controlled RHO oligonucleotide composition which is capable of decreasing the level, activity or expression of a RHO gene or a gene product thereof, and comprises a plurality of oligonucleotides which share a common base sequence that is, comprises, or comprises a span (e.g., at least 10 or 15 contiguous bases) of a base sequence disclosed herein (e.g., in Table A1, wherein each T may be independently replaced with U and vice versa).
  • a span e.g., at least 10 or 15 contiguous bases
  • the present disclosure provides a chirally controlled RHO oligonucleotide composition which is capable of decreasing the level, activity or expression of a RHO gene or a gene product thereof, and comprises a plurality of oligonucleotides which share a common base sequence that is or comprises a base sequence disclosed herein (e.g., in Table A1, wherein each T may be independently replaced with U and vice versa).
  • the present disclosure provides a chirally controlled RHO oligonucleotide composition which is capable of decreasing the level, activity or expression of a RHO gene or a gene product thereof, and comprises a plurality of oligonucleotides which share a common base sequence that is a base sequence disclosed herein (e.g., in Table A1, wherein each T may be independently replaced with U and vice versa).
  • a provided chirally controlled oligonucleotide composition is a chirally controlled RHO oligonucleotide composition comprising a plurality of RHO oligonucleotides.
  • a chirally controlled oligonucleotide composition is a chirally pure (or “stereochemically pure”) oligonucleotide composition.
  • the present disclosure provides a chirally pure oligonucleotide composition of an oligonucleotide in Table A1, wherein each chiral internucleotidic linkage of the oligonucleotide is independently chirally controlled (Rp or Sp, e.g., can be determined from R or S but not X in “Stereochemistry/Linkage”).
  • the percentage of the oligonucleotide in the composition is significantly higher [e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 10 3 , 10 4 , 10 5 or more, or 10 nc , 15 nc , 20 nc , 25 nc , 30 nc , 35 nc , 40 nc , 45 nc , 50 nc , 60 nc , 70 nc , 80 nc , 90 nc , 100 nc or more, fold of the percentage of another stereoisomer, wherein nc is the number of chirally controlled internucleotidic linkage(s)] than any other possible stereoisomers, which may exist in the composition as impurities.
  • nc is the number of chirally controlled internucleotidic linkage(s)] than any other possible stereoisomers, which may exist in
  • a chirally pure oligonucleotide composition comprises a plurality of oligonucleotides, wherein oligonucleotides of the plurality are structurally identical and all have the same structure (the same stereoisomeric form; in the context of oligonucleotide, typically the same diastereomeric form as typically multiple chiral centers exist in an oligonucleotide), and the chirally pure oligonucleotide composition does not contain any other stereoisomers (in the context of oligonucleotide, typically diastereomers as typically multiple chiral centers exist in an oligonucleotide; to the extent, e.g., achievable by stereoselective preparation).
  • stereorandom (or “racemic”, “non-chirally controlled”) oligonucleotide compositions are random mixtures of many stereoisomers (e.g., 2 n diastereoisomers wherein n is the number of chiral linkage phosphorus for oligonucleotides in which other chiral centers (e.g., carbon chiral centers in sugars) are chirally controlled each independently existing in one configuration and only chiral linkage phosphorus centers are not chirally controlled).
  • chirally controlled oligonucleotide composition e.g., chirally controlled RHO oligonucleotide compositions in decreasing the level, activity and/or expression of a RHO target gene or a gene product thereof, are shown in, for example, the Examples section of this document.
  • the present disclosure provides an oligonucleotide composition comprising oligonucleotides that comprise at least one chiral linkage phosphorus.
  • the present disclosure provides a RHO oligonucleotide composition comprising RHO oligonucleotides that comprise at least one chiral linkage phosphorus.
  • the present disclosure provides a RHO oligonucleotide composition in which the RHO oligonucleotides comprise a chirally controlled phosphorothioate internucleotidic linkage, wherein the linkage phosphorus has a Rp configuration. In some embodiments, the present disclosure provides a RHO oligonucleotide composition in which the RHO oligonucleotides comprise a chirally controlled phosphorothioate internucleotidic linkage, wherein the linkage phosphorus has a Sp configuration.
  • chirally controlled oligonucleotide compositions e.g., chirally controlled RHO oligonucleotide compositions
  • desired biological effects e.g., as measured by decreased levels of mRNA, proteins, etc. whose levels are targeted for reduction
  • desired biological effects can be enhanced by more than 5, 10, 15, 20, 25, 30, 40, 50, or 100 fold (e.g., as measured by remaining levels of mRNA, proteins, etc.).
  • a change is measured by decrease of an undesired mRNA level compared to a reference condition.
  • a change is measured by increase of a desired mRNA level compared to a reference condition. In some embodiments, a change is measured by decrease of an undesired mRNA level compared to a reference condition.
  • a reference condition is absence of treatment, e.g., by a chirally controlled oligonucleotide composition. In some embodiments, a reference condition is a corresponding stereorandom composition of oligonucleotides having the same constitution.
  • the present disclosure provides a chirally controlled oligonucleotide composition, e.g., a chirally controlled RHO oligonucleotide composition, wherein the linkage phosphorus of at least one chirally controlled internucleotidic linkage is Sp.
  • the present disclosure provides a chirally controlled oligonucleotide composition, e.g., a chirally controlled RHO oligonucleotide composition, wherein the majority of linkage phosphorus of chirally controlled internucleotidic linkages are Sp.
  • the present disclosure provides a chirally controlled oligonucleotide composition, e.g., a chirally controlled RHO oligonucleotide composition, wherein the majority of chiral internucleotidic linkages are chirally controlled and are Sp at their linkage phosphorus.
  • the present disclosure provides a chirally controlled oligonucleotide composition, e.g., a chirally controlled RHO oligonucleotide composition, wherein each chiral internucleotidic linkage is chirally controlled and each chiral linkage phosphorus is Sp.
  • the present disclosure provides a chirally controlled oligonucleotide composition, e.g., chirally controlled RHO oligonucleotide composition, wherein at least one chirally controlled internucleotidic linkage has a Rp linkage phosphorus.
  • the present disclosure provides a chirally controlled oligonucleotide composition, e.g., a chirally controlled RHO oligonucleotide composition, wherein at least one chirally controlled internucleotidic linkage comprises a Rp linkage phosphorus and at least one chirally controlled internucleotidic linkage comprises a Sp linkage phosphorus.
  • the present disclosure provides a chirally controlled oligonucleotide composition, wherein at least two chirally controlled internucleotidic linkages have different linkage phosphorus stereochemistry and/or different P-modifications relative to one another, wherein a P- modification is a modification at a linkage phosphorus.
  • the present disclosure provides a chirally controlled oligonucleotide composition, wherein at least two chirally controlled internucleotidic linkages have different stereochemistry relative to one another, and the pattern of the backbone chiral centers of the oligonucleotides is characterized by a repeating pattern of alternating stereochemisty.
  • the present disclosure provides a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein with in each of the oligonucleotides at least two individual internucleotidic linkages have different P-modifications relative to one another.
  • the present disclosure provides a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein with in each of the oligonucleotides at least two individual internucleotidic linkages have different P-modifications relative to one another, and each of the oligonucleotide comprises a natural phosphate linkage.
  • the present disclosure provides a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein with in each of the oligonucleotides at least two individual internucleotidic linkages have different P-modifications relative to one another, and each of the oligonucleotide comprises a phosphorothioate internucleotidic linkage.
  • the present disclosure provides a chirally controlled oligonucleotide composition
  • a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein with in each of the oligonucleotides at least two individual internucleotidic linkages have different P-modifications relative to one another, and each of the oligonucleotide comprises a natural phosphate linkage and a phosphorothioate internucleotidic linkage.
  • the present disclosure provides a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein with in each of the oligonucleotides at least two individual internucleotidic linkages have different P-modifications relative to one another, and each of the oligonucleotide comprises a phosphorothioate triester internucleotidic linkage.
  • the present disclosure provides a chirally controlled oligonucleotide composition
  • a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein with in each of the oligonucleotides at least two individual internucleotidic linkages have different P-modifications relative to one another, and each of the oligonucleotide comprises a natural phosphate linkage and a phosphorothioate triester internucleotidic linkage.
  • the present disclosure provides a chirally controlled oligonucleotide composition
  • a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides, wherein with in each of the oligonucleotides at least two individual internucleotidic linkages have different P-modifications relative to one another, and each of the oligonucleotide comprises a phosphorothioate internucleotidic linkage and a phosphorothioate triester internucleotidic linkage.
  • the present disclosure provides a chirally controlled oligonucleotide composition, e.g., a chirally controlled RHO oligonucleotide composition, comprising a plurality of oligonucleotides which share a common base sequence that is the base sequence of an oligonucleotide disclosed herein, wherein at least one internucleotidic linkage is chirally controlled.
  • a chirally controlled oligonucleotide composition e.g., a chirally controlled RHO oligonucleotide composition, comprising a plurality of oligonucleotides which share a common base sequence that is the base sequence of an oligonucleotide disclosed herein, wherein at least one internucleotidic linkage is chirally controlled.
  • the present disclosure provides a chirally controlled oligonucleotide composition, e.g., a chirally controlled RHO oligonucleotide composition, comprising a plurality of oligonucleotides which share a common base sequence that is the base sequence of an oligonucleotide disclosed herein, wherein at least one internucleotidic linkage is chirally controlled, and at least one internucleotidic linkage has the structure of formula I or a salt form thereof.
  • a chirally controlled oligonucleotide composition e.g., a chirally controlled RHO oligonucleotide composition, comprising a plurality of oligonucleotides which share a common base sequence that is the base sequence of an oligonucleotide disclosed herein, wherein at least one internucleotidic linkage is chirally controlled, and at least one internucleotidic linkage has the structure of formula I or
  • the present disclosure provides a chirally controlled oligonucleotide composition, e.g., a chirally controlled RHO oligonucleotide composition, comprising a plurality of oligonucleotides which share a common base sequence that is the base sequence of an oligonucleotide disclosed herein, wherein at least one internucleotidic linkage is chirally controlled, and each chirally controlled internucleotidic linkage has the structure of formula I or a salt form thereof.
  • a chirally controlled oligonucleotide composition e.g., a chirally controlled RHO oligonucleotide composition, comprising a plurality of oligonucleotides which share a common base sequence that is the base sequence of an oligonucleotide disclosed herein, wherein at least one internucleotidic linkage is chirally controlled, and each chirally controlled internucleotidic linkage has the structure of
  • the present disclosure provides a chirally controlled oligonucleotide composition, e.g., a chirally controlled RHO oligonucleotide composition, comprising a plurality of oligonucleotides which share a common base sequence that is the base sequence of an oligonucleotide disclosed herein, wherein each modified internucleotidic linkage has the structure of formula I or a salt form thereof.
  • at least one internucleotidic linkage has the structure of Formula I-c.
  • each modified internucleotidic linkage independently has the structure of Formula I-c.
  • each internucleotidic linkage has the structure of formula I-c.
  • a chirally controlled internucleotidic linkage is a chirally controlled phosphorothioate internucleotidic linkage.
  • each chirally controlled internucleotidic linkage is a chirally controlled phosphorothioate internucleotidic linkage.
  • control of stereochemistry can provide improved properties and/or activities, including desired stability, reduced toxicity, improved reduction of target nucleic acids, etc.
  • the present disclosure provides useful patterns of backbone chiral centers for oligonucleotides and/or regions thereof, which pattern is a combination of stereochemistry of each chiral linkage phosphorus (Rp or Sp) of chiral linkage phosphorus, indication of each achiral linkage phosphorus (Op, if any), etc. from 5’ to 3’.
  • patterns of backbone chiral centers can control cleavage patterns of target nucleic acids when they are contacted with provided oligonucleotides or compositions thereof in a cleavage system (e.g., in vitro assay, cells, tissues, organs, organisms, subjects, etc.).
  • patterns of backbone chiral centers improve cleavage efficiency and/or selectivity of target nucleic acids when they are contacted with provided oligonucleotides or compositions thereof in a cleavage system.
  • a pattern of backbone chiral centers of an oligonucleotide e.g., a RHO oligonucleotide, or a region thereof comprises or is (Np)n(Op)m, wherein Np is Rp or Sp, Op represents a linkage phosphorus being achiral (e.g., as for the linkage phosphorus of natural phosphate linkages), and each of n and m is independently as defined and described in the present disclosure.
  • a pattern of backbone chiral centers of an oligonucleotide or a region thereof comprises or is (Sp)n(Op)m, wherein each variable is independently as defined and described in the present disclosure.
  • a pattern of backbone chiral centers of an oligonucleotide or a region thereof comprises or is (Rp)n(Op)m, wherein each variable is independently as defined and described in the present disclosure.
  • n is 1.
  • a pattern of backbone chiral centers of an oligonucleotide or a region thereof comprises or is (Sp)(Op)m, wherein m is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • a pattern of backbone chiral centers of an oligonucleotide or a region thereof comprises or is (Rp)(Op)m, wherein m is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • the pattern of backbone chiral centers of a 5’-wing is or comprises (Np)n(Op)m.
  • the pattern of backbone chiral centers of a 5’-wing is or comprises (Sp)n(Op)m.
  • the pattern of backbone chiral centers of a 5’-wing is or comprises (Rp)n(Op)m.
  • the pattern of backbone chiral centers of a 5’-wing is or comprises (Sp)(Op)m. In some embodiments, the pattern of backbone chiral centers of a 5’-wing is or comprises (Rp)(Op)m. In some embodiments, the pattern of backbone chiral centers of a 5’-wing is (Sp)(Op)m. In some embodiments, the pattern of backbone chiral centers of a 5’-wing is (Rp)(Op)m.
  • the pattern of backbone chiral centers of a 5’- wing is (Sp)(Op)m, wherein Sp is the linkage phosphorus configuration of the first internucleotidic linkage of the oligonucleotide from the 5’-end.
  • the pattern of backbone chiral centers of a 5’-wing is (Rp)(Op)m, wherein Rp is the linkage phosphorus configuration of the first internucleotidic linkage of the oligonucleotide from the 5’-end.
  • a pattern of backbone chiral centers of an oligonucleotide e.g., a RHO oligonucleotide, or a region thereof comprises or is (Op)m(Np)n, wherein Np is Rp or Sp, Op represents a linkage phosphorus being achiral (e.g., as for the linkage phosphorus of natural phosphate linkages), and each of n and m is independently as defined and described in the present disclosure.
  • a pattern of backbone chiral centers of an oligonucleotide or a region thereof comprises or is (Op)m(Sp)n, wherein each variable is independently as defined and described in the present disclosure.
  • a pattern of backbone chiral centers of an oligonucleotide or a region thereof comprises or is (Op)m(Rp)n, wherein each variable is independently as defined and described in the present disclosure.
  • n is 1.
  • a pattern of backbone chiral centers of an oligonucleotide or a region thereof comprises or is (Op)m(Sp), wherein m is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • a pattern of backbone chiral centers of an oligonucleotide or a region thereof comprises or is (Op)m(Rp), wherein m is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • the pattern of backbone chiral centers of a 3’-wing is or comprises (Op)m(Np)n.
  • the pattern of backbone chiral centers of a 3’-wing is or comprises (Op)m(Sp)n.
  • the pattern of backbone chiral centers of a 3’-wing is or comprises (Op)m(Rp)n.
  • the pattern of backbone chiral centers of a 3’-wing is or comprises (Op)m(Sp). In some embodiments, the pattern of backbone chiral centers of a 3’-wing is or comprises (Op)m(Rp). In some embodiments, the pattern of backbone chiral centers of a 3’-wing is (Op)m(Sp). In some embodiments, the pattern of backbone chiral centers of a 3’-wing is (Op)m(Rp).
  • the pattern of backbone chiral centers of a 3’- wing is (Op)m(Sp), wherein Sp is the linkage phosphorus configuration of the last internucleotidic linkage of the oligonucleotide from the 5’-end.
  • the pattern of backbone chiral centers of a 3’-wing is (Op)m(Rp), wherein Rp is the linkage phosphorus configuration of the last internucleotidic linkage of the oligonucleotide from the 5’-end.
  • m is 2; in some embodiments, m is 3; in some embodiments, m is 4; in some embodiments, m is 5; in some embodiments, m is 6.
  • a pattern of backbone chiral centers of an oligonucleotide e.g., a RHO oligonucleotide, or a region thereof (e.g., a core) comprises or is (Sp)m(Rp/Op)n or (Rp/Op)n(Sp)m, wherein each variable is independently as described in the present disclosure.
  • a pattern of backbone chiral centers of an oligonucleotide or a region thereof comprises or is (Sp)m(Rp)n or (Rp)n(Sp)m, wherein each variable is independently as described in the present disclosure.
  • a pattern of backbone chiral centers of an oligonucleotide or a region thereof comprises (Sp)m(Rp)n, wherein each variable is independently as described in the present disclosure.
  • n is 1; in some embodiments, n is 2; in some embodiments, m is 1; in some embodiments, m is greater than 1; in some embodiments, m is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more.
  • a pattern of backbone chiral centers of an oligonucleotide or a region thereof comprises (Rp)n(Sp)m, wherein each variable is independently as described in the present disclosure.
  • n is 1; in some embodiments, n is 2; in some embodiments, m is 1; in some embodiments, m is greater than 1; in some embodiments, m is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more.
  • a pattern of backbone chiral centers of an oligonucleotide or a region thereof comprises or is (Sp)m(Op)n or (Op)n(Sp)m, wherein each variable is independently as described in the present disclosure.
  • a pattern of backbone chiral centers of an oligonucleotide e.g., a RHO oligonucleotide, or a region thereof (e.g., a core) comprises or is (Np)t[(Rp/Op)n(Sp)m]y or [(Rp/Op)n(Sp)m]y(Np)t, wherein y is 1-50, and each other variable is independently as described in the present disclosure.
  • a pattern of backbone chiral centers of an oligonucleotide or a region thereof comprises or is (Np)t[(Rp)n(Sp)m]y or [(Rp)n(Sp)m]y(Np)t, wherein each variable is independently as described in the present disclosure.
  • a pattern of backbone chiral centers of an oligonucleotide e.g., a RHO oligonucleotide, or a region thereof (e.g., a core) comprises or is [(Rp/Op)n(Sp)m]y(Rp)k, [(Rp/Op)n(Sp)m]y, (Sp)t[(Rp/Op)n(Sp)m]y, (Sp)t[(Rp/Op)n(Sp)m]y(Rp)k, wherein k is 1-50, and each other variable is independently as described in the present disclosure.
  • a pattern of backbone chiral centers of an oligonucleotide or a region thereof comprises or is [(Op)n(Sp)m]y(Rp)k, [(Op)n(Sp)m]y, (Sp)t[(Op)n(Sp)m]y, (Sp)t[(Op)n(Sp)m]y(Rp)k, wherein each variable is independently as described in the present disclosure.
  • a pattern of backbone chiral centers of an oligonucleotide or a region thereof comprises or is [(Rp)n(Sp)m]y(Rp)k, [(Rp)n(Sp)m]y, (Sp)t[(Rp)n(Sp)m]y, (Sp)t[(Rp)n(Sp)m]y(Rp)k, wherein each variable is independently as described in the present disclosure.
  • an oligonucleotide comprises a core region.
  • an oligonucleotide comprises a core region, wherein each sugar in the core region does not contain a 2’-OR 1 , wherein R 1 is as described in the present disclosure.
  • an oligonucleotide comprises a core region, wherein each sugar in the core region is independently a natural DNA sugar.
  • the pattern of backbone chiral centers of the core comprises or is (Rp)(Sp)m. In some embodiments, the pattern of backbone chiral centers of the core comprises or is (Op)(Sp)m.
  • the pattern of backbone chiral centers of the core comprises or is (Np)t[(Rp/Op)n(Sp)m]y or [(Rp/Op)n(Sp)m]y(Np)t. In some embodiments, the pattern of backbone chiral centers of the core comprises or is (Np)t[(Rp/Op)n(Sp)m]y or [(Rp/Op)n(Sp)m]y(Np)t. In some embodiments, the pattern of backbone chiral centers of the core comprises or is (Np)t[(Rp)n(Sp)m]y or [(Rp)n(Sp)m]y(Np)t.
  • the pattern of backbone chiral centers of a core comprises or is [(Rp/Op)n(Sp)m]y(Rp)k, [(Rp/Op)n(Sp)m]y, (Sp)t[(Rp/Op)n(Sp)m]y, (Sp)t[(Rp/Op)n(Sp)m]y(Rp)k.
  • a pattern of backbone chiral centers of a core comprises or is [(Op)n(Sp)m]y(Rp)k, [(Op)n(Sp)m]y, (Sp)t[(Op)n(Sp)m]y, (Sp)t[(Op)n(Sp)m]y(Rp)k.
  • a pattern of backbone chiral centers of a core comprises or is [(Rp)n(Sp)m]y(Rp)k, [(Rp)n(Sp)m]y, (Sp)t[(Rp)n(Sp)m]y, or (Sp)t[(Rp)n(Sp)m]y(Rp)k.
  • a pattern of backbone chiral centers of a core comprises [(Rp)n(Sp)m]y(Rp)k.
  • a pattern of backbone chiral centers of a core comprises [(Rp)n(Sp)m]y(Rp).
  • a pattern of backbone chiral centers of a core comprises [(Rp)n(Sp)m]y. In some embodiments, a pattern of backbone chiral centers of a core comprises (Sp)t[(Rp)n(Sp)m]y. In some embodiments, a pattern of backbone chiral centers of a core comprises (Sp)t[(Rp)n(Sp)m]y(Rp)k. In some embodiments, a pattern of backbone chiral centers of a core comprises (Sp)t[(Rp)n(Sp)m]y(Rp).
  • a pattern of backbone chiral centers of a core is [(Rp)n(Sp)m]y(Rp)k. In some embodiments, a pattern of backbone chiral centers of a core is [(Rp)n(Sp)m]y(Rp). In some embodiments, a pattern of backbone chiral centers of a core is [(Rp)n(Sp)m]y. In some embodiments, a pattern of backbone chiral centers of a core is (Sp)t[(Rp)n(Sp)m]y.
  • a pattern of backbone chiral centers of a core is (Sp)t[(Rp)n(Sp)m]y(Rp)k. In some embodiments, a pattern of backbone chiral centers of a core is (Sp)t[(Rp)n(Sp)m]y(Rp). In some embodiments, each n is 1. In some embodiments, each t is 1. In some embodiments, t is 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, each of t and n is 1. In some embodiments, each m is 2 or more. In some embodiments, k is 1. In some embodiments, k is 2-10.
  • a pattern of backbone chiral centers comprises or is (Sp)m(Rp)n, (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, (Sp)t(Rp)n(Sp)m, (Np)t[(Rp)n(Sp)m]2, (Sp)t[(Rp)n(Sp)m]2, (Np)t(Op)n(Sp)m, (Sp)t(Op)n(Sp)m, (Np)t[(Op)n(Sp)m]2, or (Sp)t[(Op)n(Sp)m]2.
  • a pattern is (Np)t(Op/Rp)n(Sp)m(Op/Rp)n(Sp)m. In some embodiments, a pattern is (Np)t(Op/Rp)n(Sp)1- 5(Op/Rp)n(Sp)m. In some embodiments, a pattern is (Np)t(Op/Rp)n(Sp)2-5(Op/Rp)n(Sp)m. In some embodiments, a pattern is (Np)t(Op/Rp)n(Sp)2(Op/Rp)n(Sp)m.
  • a pattern is (Np)t(Op/Rp)n(Sp)3(Op/Rp)n(Sp)m. In some embodiments, a pattern is (Np)t(Op/Rp)n(Sp)4(Op/Rp)n(Sp)m. In some embodiments, a pattern is (Np)t(Op/Rp)n(Sp)5(Op/Rp)n(Sp)m. [00478] In some embodiments, Np is Sp. In some embodiments, (Op/Rp) is Op. In some embodiments, (Op/Rp) is Rp. In some embodiments, Np is Sp and (Op/Rp) is Rp.
  • Np is Sp and (Op/Rp) is Op. In some embodiments, Np is Sp and at least one (Op/Rp) is Rp, and at least one (Op/Rp) is Op. In some embodiments, a pattern of backbone chiral centers comprises or is (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, wherein m > 2.
  • a pattern of backbone chiral centers comprises or is (Rp)n(Sp)m, (Np)t(Rp)n(Sp)m, or (Sp)t(Rp)n(Sp)m, wherein n is 1, at least one t >1, and at least one m > 2.
  • oligonucleotides comprising core regions whose patterns of backbone chiral centers starting with Rp can provide high activities and/or improved properties.
  • oligonucleotides comprising core regions whose patterns of backbone chiral centers ending with Rp can provide high activities and/or improved properties.
  • oligonucleotides comprising core regions whose patterns of backbone chiral centers starting with Rp provide high activities (e.g., target cleavage) without significantly impacting its properties, e.g., stability.
  • oligonucleotides comprising core regions whose patterns of backbone chiral centers ending with Rp provide high activities (e.g., target cleavage) without significantly impacting its properties, e.g., stability.
  • patterns of backbone chiral centers start with Rp and end with Sp.
  • patterns of backbone chiral centers start with Rp and end with Rp.
  • patterns of backbone chiral centers start with Sp and end with Rp.
  • internucleotidic linkages connecting core nucleosides and wing nucleosides are included in the patterns of the core regions.
  • the wing sugar connected by such a connecting internucleotidic linkage has a different structure than the core sugar connected by the same connecting internucleotidic linkage (e.g., in some embodiments, the wing sugar comprises a 2’-modification while the core sugar does not contain the same 2’-modification or have two ⁇ H at the 2’ position).
  • the wing sugar comprises a sugar modification that the core sugar does not contain.
  • the wing sugar is a modified sugar while the core sugar is a natural DNA sugar.
  • the wing sugar comprises a sugar modification at the 2’ position (less than two ⁇ H at the 2’ position), and the core sugar has no modification at the 2’-position (two ⁇ H at the 2’ position).
  • introducing additional Rp internucleotidic linkages e.g., in addition to a Rp linkage linking two core sugars, which are optionally unmodified and are optionally at or near characteristic sequence, e.g., a SNP site
  • an additional Rp internucleotidic linkage links a sugar containing no 2’-substituent (e.g., a core sugar) and a sugar comprising a 2’-modification (e.g., 2’-OR’, wherein R’ is optionally substituted C 1-6 aliphatic (e.g., 2’-OMe, 2’-MOE, etc.), which can be a wing sugar).
  • a sugar containing no 2’-substituent e.g., a core sugar
  • a sugar comprising a 2’-modification e.g., 2’-OR’, wherein R’ is optionally substituted C 1-6 aliphatic (e.g., 2’-OMe, 2’-MOE, etc.), which can be a wing sugar).
  • an internucleotidic linkage linking a sugar containing no 2’-substituent to the 5’-end (e.g., to the 3’-carbon of the sugar) and a sugar comprising a 2’-modification to the 3’-end (e.g., to the 5’-carbon of the sugar) is a Rp internucleotidic linkage.
  • an internucleotidic linkage linking a sugar containing no 2’-substituent to the 3’-end (e.g., to the 5’-carbon of the sugar) and a sugar comprising a 2’-modification to the 5’-end (e.g., to the 3’-carbon of the sugar) is a Rp internucleotidic linkage.
  • each internucleotidic linkage linking a sugar containing no 2’-substituent and a sugar comprising a 2’-modification is independently a Rp internucleotidic linkage.
  • a Rp internucleotidic linkage is a Rp phosphorothioate internucleotidic linkage.
  • a pattern of backbone chiral centers of an oligonucleotide, e.g., a RHO oligonucleotide, or a region thereof (e.g., a core) comprises or is (Op)[(Rp/Op)n(Sp)m]y(Rp)k(Op), (Op)[(Rp/Op)n(Sp)m]y(Op), (Op)(Sp)t[(Rp/Op)n(Sp)m]y(Op), or (Op)(Sp)t[(Rp/Op)n(Sp)m]y(Rp)k(Op), wherein k is 1-50, and each other variable is independently as described in the present disclosure.
  • a pattern of backbone chiral centers of an oligonucleotide comprises or is (Op)[(Rp/Op)n(Sp)m]y(Rp)k(Op), (Op)[(Rp/Op)n(Sp)m]y(Op), (Op)(Sp)t[(Rp/Op)n(Sp)m]y(Op), or (Op)(Sp)t[(Rp/Op)n(Sp)m]y(Rp)k(Op), wherein each of f, g, h and j is independently 1-50, and each other variable is independently as described in the present disclosure, and the oligonucleotide comprises a core region whose pattern of backbone chiral centers comprises or is [(Rp/Op)n(Sp)m]y(Rp)k, [(Rp/Op
  • a pattern of backbone chiral centers is or comprises (Op)[(Rp/Op)n(Sp)m]y(Rp)k(Op). In some embodiments, a pattern of backbone chiral centers is or comprises (Op)[(Rp/Op)n(Sp)m]y(Rp)(Op). In some embodiments, a pattern of backbone chiral centers is or comprises (Op)[(Rp/Op)n(Sp)m]y(Op). In some embodiments, a pattern of backbone chiral centers is or comprises (Op)(Sp)t[(Rp/Op)n(Sp)m]y(Op).
  • a pattern of backbone chiral centers is or comprises (Op)(Sp)t[(Rp/Op)n(Sp)m]y(Rp)k(Op). In some embodiments, a pattern of backbone chiral centers is or comprises (Op)(Sp)t[(Rp/Op)n(Sp)m]y(Rp)(Op). In some embodiments, a pattern of backbone chiral centers is or comprises (Op)[(Rp)n(Sp)m]y(Rp)k(Op). In some embodiments, a pattern of backbone chiral centers is or comprises (Op)[(Rp)n(Sp)m]y(Rp)(Op).
  • a pattern of backbone chiral centers is or comprises (Op)[(Rp)n(Sp)m]y(Op). In some embodiments, a pattern of backbone chiral centers is or comprises (Op)(Sp)t[(Rp)n(Sp)m]y(Op). In some embodiments, a pattern of backbone chiral centers is or comprises (Op)(Sp)t[(Rp)n(Sp)m]y(Rp)k(Op). In some embodiments, a pattern of backbone chiral centers is or comprises (Op)(Sp)t[(Rp)n(Sp)m]y(Rp)(Op). In some embodiments, each n is 1.
  • a pattern of backbone chiral centers of an oligonucleotide comprises or is (Np)f(Op)g[(Rp/Op)n(Sp)m]y(Rp)k(Op)h(Np)j, (Np)f(Op)g[(Rp/Op)n(Sp)m]y(Op)h(Np)j, (Np)f(Op)g(Sp)t[(Rp/Op)n(Sp)m]y(Op)h(Np)j, or (Np)f(Op)g(Sp)t[(Rp/Op)n(Sp)m]y(Rp)k(Op)h(Np)j
  • a pattern of backbone chiral centers of an oligonucleotide comprises or is (Np)f(Op)g[(Rp/Op)n(Sp)m]y(Rp)k(Op)h(Np)j, (Np)f(Op)g[(Rp/Op)n(Sp)m]y(Op)h(Np)j, (Np)f(Op)g(Sp)t[(Rp/Op)n(Sp)m]y(Op)h(Np)j, or (Np)f(Op)g(Sp)t[(Rp/Op)n(Sp)m]y(Rp)k(Op)h(Np)j, and the oligonucleotide comprises a core region whose pattern of backbone chiral centers comprises or is [(Rp/Op)n(
  • a pattern of backbone chiral centers of an oligonucleotide is (Np)f(Op)g[(Rp/Op)n(Sp)m]y(Rp)k(Op)h(Np)j, (Np)f(Op)g[(Rp/Op)n(Sp)m]y(Op)h(Np)j, (Np)f(Op)g(Sp)t[(Rp/Op)n(Sp)m]y(Op)h(Np)j, or (Np)f(Op)g(Sp)t[(Rp/Op)n(Sp)m]y(Rp)k(Op)h(Np)j, and the oligonucleotide comprises a core region whose pattern of backbone chiral centers comprises or is [(Rp/Op)n(Sp)n(Sp)m]y(Rp)k(Op)h(Np)j
  • a pattern of backbone chiral centers is or comprises (Np)f(Op)g[(Rp/Op)n(Sp)m]y(Rp)k(Op)h(Np)j. In some embodiments, a pattern of backbone chiral centers is or comprises (Np)f(Op)g[(Rp/Op)n(Sp)m]y(Rp)(Op)h(Np)j. In some embodiments, a pattern of backbone chiral centers is or comprises (Np)f(Op)g[(Rp/Op)n(Sp)m]y(Op)h(Np)j.
  • a pattern of backbone chiral centers is or comprises (Np)f(Op)g(Sp)t[(Rp/Op)n(Sp)m]y(Op)h(Np)j. In some embodiments, a pattern of backbone chiral centers is or comprises (Np)f(Op)g(Sp)t[(Rp/Op)n(Sp)m]y(Rp)k(Op)h(Np)j. In some embodiments, a pattern of backbone chiral centers is or comprises (Np)f(Op)g(Sp)t[(Rp/Op)n(Sp)m]y(Rp)(Op)h(Np)j.
  • a pattern of backbone chiral centers is or comprises (Np)f(Op)g[(Rp)n(Sp)m]y(Rp)k(Op)h(Np)j. In some embodiments, a pattern of backbone chiral centers is or comprises (Np)f(Op)g[(Rp)n(Sp)m]y(Rp)(Op)h(Np)j. In some embodiments, a pattern of backbone chiral centers is or comprises (Np)f(Op)g[(Rp)n(Sp)m]y(Op)h(Np)j.
  • a pattern of backbone chiral centers is or comprises (Np)f(Op)g(Sp)t[(Rp)n(Sp)m]y(Op)h(Np)j. In some embodiments, a pattern of backbone chiral centers is or comprises (Np)f(Op)g(Sp)t[(Rp)n(Sp)m]y(Rp)k(Op)h(Np)j. In some embodiments, a pattern of backbone chiral centers is or comprises (Np)f(Op)g(Sp)t[(Rp)n(Sp)m]y(Rp)(Op)h(Np)j.
  • At least one Np is Sp. In some embodiments, at least one Np is Rp. In some embodiments, the 5’ most Np is Sp. In some embodiments, the 3’ most Np is Sp. In some embodiments, each Np is Sp. In some embodiments, (Np)f(Op)g[(Rp/Op)n(Sp)m]y(Rp)k(Op)h(Np)j is (Sp)(Op)g[(Rp)n(Sp)m]y(Rp)k(Op)h(Sp).
  • (Np)f(Op)g[(Rp/Op)n(Sp)m]y(Rp)k(Op)h(Np)j is (Sp)(Op)g[(Rp)n(Sp)m]y(Rp)(Op)h(Sp).
  • a pattern of backbone chiral center of an oligonucleotide is or comprises (Sp)(Op)g[(Rp)n(Sp)m]y(Rp)(Op)h(Sp).
  • a pattern of backbone chiral center of an oligonucleotide is (Sp)(Op)g[(Rp)n(Sp)m]y(Rp)(Op)h(Sp).
  • (Np)f(Op)g[(Rp/Op)n(Sp)m]y(Op)h(Np)j is (Sp)(Op)g[(Rp)n(Sp)m]y(Op)h(Sp).
  • a pattern of backbone chiral center of an oligonucleotide is or comprises (Sp)(Op)g[(Rp)n(Sp)m]y(Op)h(Sp). In some embodiments, a pattern of backbone chiral center of an oligonucleotide is (Sp)(Op)g[(Rp)n(Sp)m]y(Op)h(Sp).
  • (Np)f(Op)g(Sp)t[(Rp/Op)n(Sp)m]y(Op)h(Np)j is (Sp)(Op)g(Sp)t[(Rp)n(Sp)m]y(Op)h(Sp).
  • a pattern of backbone chiral center of an oligonucleotide is or comprises (Sp)(Op)g(Sp)t[(Rp)n(Sp)m]y(Op)h(Sp).
  • a pattern of backbone chiral center of an oligonucleotide is (Sp)(Op)g(Sp)t[(Rp)n(Sp)m]y(Op)h(Sp).
  • (Np)f(Op)g(Sp)t[(Rp/Op)n(Sp)m]y(Rp)k(Op)h(Np)j is (Sp)(Op)g(Sp)t[(Rp)n(Sp)m]y(Rp)k(Op)h(Sp).
  • (Np)f(Op)g(Sp)t[(Rp/Op)n(Sp)m]y(Rp)k(Op)h(Np)j is (Sp)(Op)g(Sp)t[(Rp)n(Sp)m]y(Rp)(Op)h(Sp).
  • a pattern of backbone chiral center of an oligonucleotide is or comprises (Sp)(Op)g(Sp)t[(Rp)n(Sp)m]y(Rp)(Op)h(Sp).
  • a pattern of backbone chiral center of an oligonucleotide is (Sp)(Op)g(Sp)t[(Rp)n(Sp)m]y(Rp)(Op)h(Sp).
  • each n is 1.
  • f is 1.
  • g is 1.
  • g is greater than 1.
  • g is 2.
  • g is 3.
  • g is 4.
  • g is 5.
  • g is 6.
  • g is 7.
  • g 8.
  • g is 9. In some embodiments, g is 10.
  • h is 1. In some embodiments, h is greater than 1. In some embodiments, h is 2. In some embodiments, h is 3. In some embodiments, h is 4. In some embodiments, h is 5. In some embodiments, h is 6. In some embodiments, h is 7. In some embodiments, h is 8. In some embodiments, h is 9. In some embodiments, h is 10. In some embodiments, j is 1. In some embodiments, k is 1. In some embodiments, k is 2-10.
  • a pattern of backbone chiral centers of an oligonucleotide comprises or is [(Rp/Op)n(Sp)m]y, (Sp)t[(Rp/Op)n(Sp)m]y, (Sp)t[(Rp/Op)n(Sp)m]yRp, [(Rp/Op)n(Sp)m]y(Rp)k, (Sp)t[(Rp/Op)n(Sp)m]y(Rp)k, (Sp)t[(Rp/Op)n(Sp)m]y(Rp)k(Op)h, (Sp)t[(Rp/Op)n(Sp)m]y(Rp)k(Op)h(Np)j, wherein each variable is independently
  • At least one (Rp/Op) is Rp. In some embodiments, at least one (Rp/Op) is Op. In some embodiments, each (Rp/Op) is Rp. In some embodiments, each (Rp/Op) is Op. In some embodiments, at least one of [(Rp)n(Sp)m]y or [(Rp/Op)n(Sp)m]y of a pattern is RpSp. In some embodiments, at least one of [(Rp)n(Sp)m]y or [(Rp/Op)n(Sp)m]y of a pattern is or comprises RpSpSp.
  • At least one of [(Rp)n(Sp)m]y or [(Rp/Op)n(Sp)m]y in a pattern is RpSp
  • at least one of [(Rp)n(Sp)m]y or [(Rp/Op)n(Sp)m]y in a pattern is or comprises RpSpSp.
  • [(Rp)n(Sp)m]y in a pattern is (RpSp)[(Rp)n(Sp)m] (y-1) ; in some embodiments, [(Rp)n(Sp)m]y in a pattern is (RpSp)[RpSpSp(Sp) (m-2) ][(Rp)n(Sp)m] (y-2) .
  • (Sp)t[(Rp)n(Sp)m]y(Rp) is (Sp)t(RpSp)[(Rp)n(Sp)m] (y-1) (Rp).
  • (Sp)t[(Rp)n(Sp)m]y(Rp) is (Sp)t(RpSp)[RpSpSp(Sp) (m-2) ][(Rp)n(Sp)m] (y-2) (Rp).
  • each [(Rp/Op)n(Sp)m] is independently [Rp(Sp)m].
  • the first Sp of (Sp)t represents linkage phosphorus stereochemistry of the first internucleotidic linkage of an oligonucleotide from 5’ to 3’.
  • the first Sp of (Sp)t represents linkage phosphorus stereochemistry of the first internucleotidic linkage of a region from 5’ to 3’, e.g., a core.
  • the last Np of (Np)j represents linkage phosphorus stereochemistry of the last internucleotidic linkage of the oligonucleotide from 5’ to 3’.
  • the last Np is Sp.
  • a pattern of backbone chiral centers of an oligonucleotide or a region is or comprises Sp(Op) 3 .
  • a pattern of backbone chiral centers of an oligonucleotide or a region is or comprises Rp(Op) 3 .
  • a pattern of backbone chiral centers of an oligonucleotide or a region is or comprises (Op) 3 Sp.
  • a pattern of backbone chiral centers of an oligonucleotide or a region is or comprises (Op) 3 Rp.
  • a pattern of backbone chiral centers of an oligonucleotide or a region (e.g., of a core) is or comprises Rp(Sp) 4 Rp(Sp) 4 Rp. In some embodiments, a pattern of backbone chiral centers of an oligonucleotide or a region (e.g., of a core) is or comprises (Sp) 5 Rp(Sp) 4 Rp. In some embodiments, a pattern of backbone chiral centers of an oligonucleotide or a region (e.g., of a core) is or comprises (Sp) 5 Rp(Sp) 5 .
  • a pattern of backbone chiral centers of an oligonucleotide or a region (e.g., of a core) is or comprises Rp(Sp) 4 Rp(Sp) 5 .
  • a pattern of backbone chiral centers of an oligonucleotide is or comprises Np(Op) 3 Rp(Sp) 4 Rp(Sp) 4 Rp(Op) 3 Np.
  • a pattern of backbone chiral centers of an oligonucleotide is or comprises Np(Op) 3 (Sp) 5 Rp(Sp) 4 Rp(Op) 3 Np.
  • a pattern of backbone chiral centers of an oligonucleotide is or comprises Np(Op) 3 (Sp) 5 Rp(Sp) 5 (Op) 3 Np. In some embodiments, a pattern of backbone chiral centers of an oligonucleotide is or comprises Np(Op) 3 Rp(Sp) 4 Rp(Sp) 5 (Op) 3 Np. In some embodiments, a pattern of backbone chiral centers of an oligonucleotide is or comprises Sp(Op) 3 Rp(Sp) 4 Rp(Sp) 4 Rp(Op) 3 Sp.
  • a pattern of backbone chiral centers of an oligonucleotide is or comprises Sp(Op) 3 (Sp) 5 Rp(Sp) 4 Rp(Op) 3 Sp. In some embodiments, a pattern of backbone chiral centers of an oligonucleotide is or comprises Sp(Op) 3 (Sp) 5 Rp(Sp) 5 (Op) 3 Sp. In some embodiments, a pattern of backbone chiral centers of an oligonucleotide is or comprises Sp(Op) 3 Rp(Sp) 4 Rp(Sp) 5 (Op) 3 Sp.
  • a pattern of backbone chiral centers of an oligonucleotide is or comprises Rp(Op) 3 Rp(Sp) 4 Rp(Sp) 4 Rp(Op) 3 Rp. In some embodiments, a pattern of backbone chiral centers of an oligonucleotide is or comprises Rp(Op) 3 (Sp) 5 Rp(Sp) 4 Rp(Op) 3 Rp. In some embodiments, a pattern of backbone chiral centers of an oligonucleotide is or comprises Rp(Op) 3 (Sp) 5 Rp(Sp) 5 (Op) 3 Rp.
  • a pattern of backbone chiral centers of an oligonucleotide is or comprises Rp(Op) 3 Rp(Sp) 4 Rp(Sp) 5 (Op) 3 Rp.
  • Rp immediately preceding or after Op
  • that Rp internucleotidic linkage is bonded to a sugar comprising a 2’-MOE modification.
  • m is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.
  • each m is independently 2 or more.
  • each m is independently 2, 3, 4, 5, 6, 7, 8, 9, or 10.
  • each m is independently 2-3, 2-5, 2-6, or 2-10. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4. In some embodiments, m is 5. In some embodiments, m is 6. In some embodiments, m is 7. In some embodiments, m is 8. In some embodiments, m is 9. In some embodiments, m is 10. In some embodiments, where there are two or more occurrences of m, they can be the same or different, and each of them is independently as described in the present disclosure. [00487] In some embodiments, y is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.
  • y is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, y is 1. In some embodiments, y is 2. In some embodiments, y is 3. In some embodiments, y is 4. In some embodiments, y is 5. In some embodiments, y is 6. In some embodiments, y is 7. In some embodiments, y is 8. In some embodiments, y is 9. In some embodiments, y is 10. [00488] In some embodiments, t is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, each t is independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, t is 2 or more. In some embodiments, t is 1.
  • t is 2. In some embodiments, t is 3. In some embodiments, t is 4. In some embodiments, t is 5. In some embodiments, t is 6. In some embodiments, t is 7. In some embodiments, t is 8. In some embodiments, t is 9. In some embodiments, t is 10. In some embodiments, where there are two or more occurrences of t, they can be the same or different, and each of them is independently as described in the present disclosure. [00489] In some embodiments, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3.
  • n is 4. In some embodiments, n is 5. In some embodiments, n is 6. In some embodiments, n is 7. In some embodiments, n is 8. In some embodiments, n is 9. In some embodiments, n is 10. In some embodiments, where there are two or more occurrences of n, they can be the same or different, and each of them is independently as described in the present disclosure. In many embodiments, in a pattern of backbone chiral centers, at least one occurrence of n is 1; in some cases, each n is 1. [00490] In some embodiments, k is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, k is 1.
  • k is 2. In some embodiments, k is 3. In some embodiments, k is 4. In some embodiments, k is 5. In some embodiments, k is 6. In some embodiments, k is 7. In some embodiments, k is 8. In some embodiments, k is 9. In some embodiments, k is 10. [00491] In some embodiments, f is 1-20. In some embodiments, f is 1-10. In some embodiments, f is 1-5. In some embodiments, f is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, f is 1. In some embodiments, f is 2. In some embodiments, f is 3. In some embodiments, f is 4.
  • f is 5. In some embodiments, f is 6. In some embodiments, f is 7. In some embodiments, f is 8. In some embodiments, f is 9. In some embodiments, f is 10. [00492] In some embodiments, g is 1-20. In some embodiments, g is 1-10. In some embodiments, g is 1-5. In some embodiments, g is 2-10. In some embodiments, g is 2-5. In some embodiments, g is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, g is 1. In some embodiments, g is 2. In some embodiments, g is 3. In some embodiments, g is 4.
  • g is 5. In some embodiments, g is 6. In some embodiments, g is 7. In some embodiments, g is 8. In some embodiments, g is 9. In some embodiments, g is 10. [00493] In some embodiments, h is 1-20. In some embodiments, h is 1-10. In some embodiments, h is 1-5. In some embodiments, h is 2-10. In some embodiments, h is 2-5. In some embodiments, h is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, h is 1. In some embodiments, h is 2. In some embodiments, h is 3. In some embodiments, h is 4.
  • h is 5. In some embodiments, h is 6. In some embodiments, h is 7. In some embodiments, h is 8. In some embodiments, h is 9. In some embodiments, h is 10. [00494] In some embodiments, j is 1-20. In some embodiments, j is 1-10. In some embodiments, j is 1-5. In some embodiments, j is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, j is 1. In some embodiments, j is 2. In some embodiments, j is 3. In some embodiments, j is 4. In some embodiments, j is 5. In some embodiments, j is 6. In some embodiments, j is 7.
  • j is 8. In some embodiments, j is 9. In some embodiments, j is 10. [00495] In some embodiments, at least one n is 1, and at least one m is no less than 2. In some embodiments, at least one n is 1, at least one t is no less than 2, and at least one m is no less than 3. In some embodiments, each n is 1. In some embodiments, t is 1. In some embodiments, at least one t > 1. In some embodiments, at least one t > 2. In some embodiments, at least one t > 3. In some embodiments, at least one t > 4. In some embodiments, at least one m > 1. In some embodiments, at least one m > 2. In some embodiments, at least one m > 3.
  • a pattern of backbone chiral centers comprises one or more achiral natural phosphate linkages.
  • the sum of m, t, and n is no less than 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.
  • the sum is 5.
  • the sum is 6.
  • the sum is 7.
  • the sum is 8.
  • the sum is 9.
  • the sum is 10.
  • the sum is 11.
  • the sum is 12.
  • the sum is 13. In some embodiments, the sum is 14.
  • each Rp and Sp independently represents linkage phosphorus configuration of a phosphorothioate internucleotidic linkage. In some embodiments, in a pattern described herein for a core region, each Rp and Sp independently represents linkage phosphorus configuration of a phosphorothioate internucleotidic linkage. [00497] In some embodiments, a number of linkage phosphorus in chirally controlled internucleotidic linkages are Sp.
  • At least 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of chirally controlled internucleotidic linkages have Sp linkage phosphorus. In some embodiments, at least 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of chirally controlled phosphorothioate internucleotidic linkages have Sp linkage phosphorus.
  • At least 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of all chiral internucleotidic linkages are chirally controlled internucleotidic linkages having Sp linkage phosphorus.
  • at least 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of all chiral internucleotidic linkages are chirally controlled phosphorothioate internucleotidic linkages having Sp linkage phosphorus.
  • the percentage is at least 20%. In some embodiments, the percentage is at least 30%. In some embodiments, the percentage is at least 40%. In some embodiments, the percentage is at least 50%. In some embodiments, the percentage is at least 60%. In some embodiments, the percentage is at least 65%. In some embodiments, the percentage is at least 70%. In some embodiments, the percentage is at least 75%. In some embodiments, the percentage is at least 80%.
  • the percentage is at least 90%. In some embodiments, the percentage is at least 95%. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 internucleotidic linkages are chirally controlled internucleotidic linkages having Sp linkage phosphorus. In some embodiments, at least 5 internucleotidic linkages are chirally controlled internucleotidic linkages having Sp linkage phosphorus. In some embodiments, at least 6 internucleotidic linkages are chirally controlled internucleotidic linkages having Sp linkage phosphorus.
  • At least 7 internucleotidic linkages are chirally controlled internucleotidic linkages having Sp linkage phosphorus. In some embodiments, at least 8 internucleotidic linkages are chirally controlled internucleotidic linkages having Sp linkage phosphorus. In some embodiments, at least 9 internucleotidic linkages are chirally controlled internucleotidic linkages having Sp linkage phosphorus. In some embodiments, at least 10 internucleotidic linkages are chirally controlled internucleotidic linkages having Sp linkage phosphorus.
  • At least 11 internucleotidic linkages are chirally controlled internucleotidic linkages having Sp linkage phosphorus.
  • at least 12 internucleotidic linkages are chirally controlled internucleotidic linkages having Sp linkage phosphorus.
  • at least 13 internucleotidic linkages are chirally controlled internucleotidic linkages having Sp linkage phosphorus.
  • at least 14 internucleotidic linkages are chirally controlled internucleotidic linkages having Sp linkage phosphorus.
  • At least 15 internucleotidic linkages are chirally controlled internucleotidic linkages having Sp linkage phosphorus.
  • at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 internucleotidic linkages are chirally controlled internucleotidic linkages having Rp linkage phosphorus.
  • no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 internucleotidic linkages are chirally controlled internucleotidic linkages having Rp linkage phosphorus.
  • one and no more than one internucleotidic linkage in an oligonucleotide is a chirally controlled internucleotidic linkage having Rp linkage phosphorus.
  • 2 and no more than 2 internucleotidic linkages in an oligonucleotide are chirally controlled internucleotidic linkages having Rp linkage phosphorus.
  • 3 and no more than 3 internucleotidic linkages in an oligonucleotide are chirally controlled internucleotidic linkages having Rp linkage phosphorus.
  • 4 and no more than 4 internucleotidic linkages in an oligonucleotide are chirally controlled internucleotidic linkages having Rp linkage phosphorus.
  • 5 and no more than 5 internucleotidic linkages in an oligonucleotide are chirally controlled internucleotidic linkages having Rp linkage phosphorus.
  • all, essentially all or most of the internucleotidic linkages in an oligonucleotide are in the Sp configuration (e.g., about 50%-100%, 55%-100%, 60%-100%, 65%-100%, 70%-100%, 75%-100%, 80%-100%, 85%-100%, 90%-100%, 55%-95%, 60%-95%, 65%-95%, or about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or more of all chirally controlled internucleotidic linkages, or of all chiral internucleotidic linkages, or of all internucleotidic linkages in the oligonucleotide) except for one or a minority of internucleotidic linkages (e.g., 1, 2, 3, 4, or 5, and/or less than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% of all chirally
  • all, essentially all or most of the internucleotidic linkages in a core are in the Sp configuration (e.g., about 50%-100%, 55%-100%, 60%-100%, 65%-100%, 70%-100%, 75%-100%, 80%-100%, 85%-100%, 90%-100%, 55%-95%, 60%-95%, 65%-95%, or about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or more of all chirally controlled internucleotidic linkages, or of all chiral internucleotidic linkages, or of all internucleotidic linkages, in the core) except for one or a minority of internucleotidic linkages (e.g., 1, 2, 3, 4, or 5, and/or less than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% of all chirally controlled internucleotidic linkages, or of all chiral
  • all, essentially all or most of the internucleotidic linkages in the core are a phosphorothioate in the Sp configuration (e.g., about 50%-100%, 55%-100%, 60%-100%, 65%-100%, 70%-100%, 75%-100%, 80%-100%, 85%-100%, 90%-100%, 55%-95%, 60%-95%, 65%-95%, or about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or more of all chirally controlled internucleotidic linkages, or of all chiral internucleotidic linkages, or of all internucleotidic linkages, in the core) except for one or a minority of internucleotidic linkages (e.g., 1, 2, 3, 4, or 5, and/or less than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% of all chirally controlled internucleotidic link
  • each internucleotidic linkage in the core is a phosphorothioate in the Sp configuration except for one phosphorothioate in the Rp configuration. In some embodiments, each internucleotidic linkage in the core is a phosphorothioate in the Sp configuration except for one phosphorothioate in the Rp configuration. [00499] In some embodiments, an oligonucleotide comprises one or more Rp internucleotidic linkages. In some embodiments, an oligonucleotide comprises one and no more than one Rp internucleotidic linkages.
  • an oligonucleotide comprises two or more Rp internucleotidic linkages. In some embodiments, an oligonucleotide comprises three or more Rp internucleotidic linkages. In some embodiments, an oligonucleotide comprises four or more Rp internucleotidic linkages. In some embodiments, an oligonucleotide comprises five or more Rp internucleotidic linkages. In some embodiments, about 5%-50% of all chirally controlled internucleotidic linkages in an oligonucleotide are Rp.
  • about 5%-40% of all chirally controlled internucleotidic linkages in an oligonucleotide are Rp. In some embodiments, about 10%-40% of all chirally controlled internucleotidic linkages in an oligonucleotide are Rp. In some embodiments, about 15%-40% of all chirally controlled internucleotidic linkages in an oligonucleotide are Rp. In some embodiments, about 20%-40% of all chirally controlled internucleotidic linkages in an oligonucleotide are Rp. In some embodiments, about 25%-40% of all chirally controlled internucleotidic linkages in an oligonucleotide are Rp.
  • the base sequence of an oligonucleotide or a region thereof, e.g., a core region comprises a sequence that is complementary to a characteristic sequence element which differentiates a target nucleic acid sequence from other sequences, e.g.,one allele of a differentiating position, e.g., a SNP, a mutation, etc.
  • such a complementary sequence consists of one nucleobase, e.g., for a differentiating single nucleobase such as SNP, point mutation, single nucleobase sequence difference (e.g., between two different genes), etc.
  • a characteristic sequence element corresponds to P23H mutation in RHO.
  • the present disclosure demonstrates that positioning of Rp internucleotidic linkages relative to a differentiating position (and/or complementary sequences thereof) can improve one or more of activities, properties and/or selectivities of oligonucleotides.
  • the present disclosure provides useful positioning of Rp internucleotidic linkages.
  • an Rp internucleotidic linkage is at position -4, -3, -2, -1, +1, +2, +3, or +4 relative to a sequence that is complementary to a characteristic sequence element, e.g., one allele of a differentiating position, a point mutation, etc.
  • an Rp internucleotidic linkage is at position -4, -3, -2, -1, +1, +2, +3, or +4 relative to a nucleobase (counting 5’ to 3’, the internucleotidic linkage bonded to 5’-carbon of the nucleobase is -1, and 3’-carbon +1) that is complementary to a differentiating nucleobase (e.g., of a SNP, a point mutation, etc.).
  • Rp is at -4.
  • Rp is at -3.
  • Rp is at -2.
  • Rp is at -1.
  • Rp is at +1.
  • each internucleotidic linkage in the core is a phosphorothioate in the Sp configuration except for one phosphorothioate in the Rp configuration, and the one phosphorothioate in the Rp configuration has a position relative to the SNP/mutation in the core (e.g., -1, +1, +2, +3, etc.).
  • an Rp internucleotidic linkage is at position -4, -3, -2, -1, +1, +2, +3, or +4 relative to a nucleobase that is complementary to an allele of an SNP at the SNP position or a point mutation.
  • the position is -4.
  • the position is -3.
  • the position is -2.
  • the position is -1.
  • the position is +1.
  • the position is +2.
  • the position is +3.
  • the position is +4.
  • such an Rp internucleotidic linkage is in a core region.
  • the position of an Rp internucleotidic linkage in a core is -4, -3, -2, -1, +1, +2, +3, or +4 (counting 5’ to 3’) relative to the nucleobase which is or recognizes (e.g., is complementary to) a SNP rs104893768 variant (e.g., A).
  • the position of an Rp internucleotidic linkage in a core is -1, +1, +2, or +3 (counting 5’ to 3’) relative to the nucleobase which is or recognizes a SNP rs104893768 variant.
  • the position of an Rp internucleotidic linkage in a core is -1 (counting 5’ to 3’) relative to the nucleobase which is or recognizes a SNP rs104893768 variant. In some embodiments, the position of an Rp internucleotidic linkage in a core is +1 (counting 5’ to 3’) relative to the nucleobase which is or recognizes a SNP rs104893768 variant. In some embodiments, the position of an Rp internucleotidic linkage in a core is +2 (counting 5’ to 3’) relative to the nucleobase which is or recognizes a SNP rs104893768 variant.
  • an Rp internucleotidic linkage in a core is +3 (counting 5’ to 3’) relative to the nucleobase which is or recognizes a SNP rs104893768 variant.
  • an Rp internucleotidic linkage is an Rp phosphorothioate internucleotidic linkage.
  • an oligonucleotide is complementary to an allele of a SNP that is associated with a condition, disorder or disease and not complementary to other alleles that is not associated or less associated with the condition, disorder or disease.
  • a SNP is a SNP in RHO.
  • a SNP is a SNP in RHO as described herein.
  • a SNP is a SNP in RHO
  • an oligonucleotide is complementary to an allele of a SNP that is associated with a RHO-related condition, disorder or disease, e.g., retinopathy (e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.) (such allele in many cases is on the same DNA strand/chromosome of disease-associated mutation(s)).
  • retinopathy e.g, retinal degeneration, retinal degenerative disease, retinal degenerative disorder, inherited retinal degenerative disorder, retinitis pigmentosa, autosomal dominant retinitis pigmentosa, etc.
  • a SNP is rsSNP rs104893768. In some embodiments, a SNP is rs104893768. In some embodiments, a SNP rs104893768 variant is A. Other SNPs that may be targeted are described herein and/or known in the art.
  • a Rp is the Rp of Rp(Sp)m wherein m is 2 or more as described herein, and wherein Rp(Sp)m is, or is a portion of, a pattern of backbone chiral centers of an oligonucleotide or a portion thereof (e.g., a core).
  • a Rp is the Rp of Rp(Sp)2 wherein Rp(Sp)2 is, or is a portion of, a pattern of backbone chiral centers of an oligonucleotide or a portion thereof (e.g., a core).
  • a Rp is the Rp of (Sp)tRp(Sp)m wherein m is 2 or more as described herein, t is as described herein, and (Sp)tRp(Sp)m is, or is a portion of, a pattern of backbone chiral centers of an oligonucleotide or a portion thereof (e.g., a core).
  • a Rp is the Rp of (Sp)tRp(Sp)2 wherein t is as described herein, and (Sp)tRp(Sp)2 is, or is a portion of, a pattern of backbone chiral centers of an oligonucleotide or a portion thereof (e.g., a core).
  • t is 2. In some embodiments, t is 2 or more.
  • the present disclosure pertains to a RHO oligonucleotide, wherein the position of an Rp internucleotidic linkage is -3 (counting 5’ to 3’) relative to the nucleobase which is or which recognizes a SNP rs104893768 variant.
  • an oligonucleotide is WV-39023. In some embodiments, an oligonucleotide is WV- 48182.
  • the core of an oligonucleotide e.g., a RHO oligonucleotide, having a wing-core-wing structure has a sequence which comprises a SNP (e.g., a nucleobase complementary to a SNP in a target nucleic acid sequence), including but not limited to a SNP described herein, and all, essentially all or most of the internucleotidic linkages in the core (e.g., about 50%-100%, 55%-100%, 60%- 100%, 65%-100%, 70%-100%, 75%-100%, 80%-100%, 85%-100%, 90%-100%, 55%-95%, 60%-95%, 65%-95%, or about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or more of all chirally controlled internucleotidic linkages, or of all chiral internucleotidic linkages, or of all internucleotidic linkages,
  • the core of an oligonucleotide e.g., a RHO oligonucleotide, having a wing-core-wing structure has a sequence which comprises a SNP, including but not limited to a SNP described herein, and all, essentially all or most of the internucleotidic linkages in the core are a phosphorothioate in the Sp configuration except for one or a minority of internucleotidic linkages which are a phosphorothioate in the Rp configuration.
  • a SNP including but not limited to a SNP described herein
  • the core of an oligonucleotide e.g., a RHO oligonucleotide, having a wing-core-wing structure has a sequence which comprises a SNP, including but not limited to a SNP described herein, and each internucleotidic linkage in the core is a phosphorothioate in the Sp configuration except for one phosphorothioate in the Rp configuration.
  • the core of an oligonucleotide e.g., a RHO oligonucleotide, having a wing-core-wing structure has a sequence which comprises a SNP, including but not limited to a SNP described herein, and each internucleotidic linkage in the core is a phosphorothioate in the Sp configuration except for one phosphorothioate in the Rp configuration.
  • the core of an oligonucleotide e.g., a RHO oligonucleotide, having a wing-core-wing structure has a sequence which comprises a SNP, including but not limited to a SNP described herein, and each internucleotidic linkage in the core is a phosphorothioate in the Sp configuration except for one phosphorothioate in the Rp configuration, and the one phosphorothioate in the Rp configuration has a position relative to the SNP in the core (e.g., the Rp is -1, +1, +2, +3, etc. to the SNP).
  • the core of an oligonucleotide e.g., a RHO oligonucleotide, having a wing-core-wing structure has a sequence which comprises a SNP, including but not limited to a SNP described herein, and the position of the an internucleotidic linkage in the Rp configuration in the core is -4, -3, -2, -1, +1, +2, +3, or +4 (counting 5’ to 3’) relative to the nucleobase which is or recognizes a SNP rs104893768 variant.
  • the core of an oligonucleotide e.g., a RHO oligonucleotide, having a wing-core- wing structure has a sequence which comprises a SNP, including but not limited to a SNP described herein, and the position of a phosphorothioate internucleotidic linkage in the Rp configuration in the core is -4, -3, -2, -1, +1, +2, +3, or +4 (counting 5’ to 3’) relative to the nucleobase which is or recognizes a SNP rs104893768 variant.
  • the position is -1, +1, +2, or +3 (counting 5’ to 3’) relative to the nucleobase which is or recognizes a SNP rs104893768 variant.
  • the core of an oligonucleotide e.g., a RHO oligonucleotide, having a wing-core-wing structure has a sequence which comprises a SNP, including but not limited to a SNP described herein, and the position of a phosphorothioate in the Rp configuration in the core is -1 (counting 5’ to 3’) relative to the nucleobase which is or recognizes a SNP rs104893768 variant.
  • the core of an oligonucleotide e.g., a RHO oligonucleotide, having a wing-core-wing structure has a sequence which comprises a SNP, including but not limited to a SNP described herein, and the position of a phosphorothioate in the Rp configuration in the core is +1 (counting 5’ to 3’) relative to the nucleobase which is or recognizes a SNP rs104893768 variant.
  • the core of an oligonucleotide e.g., a RHO oligonucleotide, having a wing-core-wing structure has a sequence which comprises a SNP, including but not limited to a SNP described herein, and the position of a phosphorothioate in the Rp configuration in the core is +2 (counting 5’ to 3’) relative to the nucleobase which is or recognizes a SNP rs104893768 variant.
  • the core of an oligonucleotide e.g., a RHO oligonucleotide, having a wing-core-wing structure has a sequence which comprises a SNP, including but not limited to a SNP described herein, and the position of a phosphorothioate in the Rp configuration in the core is +3 (counting 5’ to 3’) relative to the nucleobase which is or recognizes a SNP rs104893768 variant.
  • position of Rp may improve properties, activities and/or selectivities of oligonucleotides.
  • improvement of the ability of a RHO oligonucleotide to decrease the level, expression and/or activity of a RHO target gene (or to perform allele-specific knockdown of the level, expression and/or activity of a mutant RHO target gene), or a gene product thereof was achieved by designed positioning of a single chiral internucleotidic linkage (e.g., a phosphorothioate) in the Rp configuration relative to the SNP.
  • a single chiral internucleotidic linkage e.g., a phosphorothioate
  • a relatively inactive oligonucleotide composition wherein the base sequence of the core comprises a base which is or targets a SNP rs104893768 variant, and wherein the oligonucleotide composition is stereorandom, can be converted into a more active or highly active oligonucleotide composition by converting the oligonucleotide, including the core, into a chirally controlled or stereopure composition, wherein all, essentially all, or most of the internucleotidic linkages are in the Sp configuration except for one or a minority of internucleotidic linkages in the Rp configuration as described herein.
  • an oligonucleotide comprising a core, wherein the base sequence of the core comprises a base which is or targets a SNP rs104893768 variant, and all, essentially all, or most of the internucleotidic linkages in the core are in the Sp configuration except for one or a minority of internucleotidic linkages in the Rp configuration, can be converted into a more active or highly active oligonucleotide by altering the position of one or more (in some cases, one) internucleotidic linkages in the Rp configuration relative to the SNP.
  • a relatively inactive oligonucleotide comprising a core, wherein the base sequence of the core comprises a base which is or targets a SNP rs104893768 variant, and all of the internucleotidic linkages in the core are in the Sp configuration except for one internucleotidic linkage in the Rp configuration, can be converted into a more active or highly active oligonucleotide by moving the placement of the one internucleotidic linkage in the Rp configuration relative to the SNP.
  • a natural phosphate linkage may be similarly utilized, optionally with a modification, e.g., a sugar modification (e.g., a 5’- modification such as R 5s as described herein).
  • a modification improves stability of a natural phosphate linkage.
  • the present disclosure provides an oligonucleotide having a pattern of backbone chiral centers as described herein.
  • oligonucleotides in a chirally controlled oligonucleotide composition share a common pattern of backbone chiral centers as described herein.
  • At least about 25% of the internucleotidic linkages of an oligonucleotide are chirally controlled and have Sp linkage phosphorus.
  • at least about 30% of the internucleotidic linkages of an oligonucleotide are chirally controlled and have Sp linkage phosphorus.
  • at least about 40% of the internucleotidic linkages of a provided oligonucleotide are chirally controlled and have Sp linkage phosphorus.
  • At least about 50% of the internucleotidic linkages of a provided oligonucleotide are chirally controlled and have Sp linkage phosphorus.
  • at least about 60% of the internucleotidic linkages of a provided oligonucleotide are chirally controlled and have Sp linkage phosphorus.
  • at least about 65% of the internucleotidic linkages of a provided oligonucleotide are chirally controlled and have Sp linkage phosphorus.
  • at least about 70% of the internucleotidic linkages of a provided oligonucleotide are chirally controlled and have Sp linkage phosphorus.
  • At least about 75% of the internucleotidic linkages of a provided oligonucleotide are chirally controlled and have Sp linkage phosphorus. In some embodiments, at least about 80% of the internucleotidic linkages of a provided oligonucleotide are chirally controlled and have Sp linkage phosphorus. In some embodiments, at least about 85% of the internucleotidic linkages of a provided oligonucleotide are chirally controlled and have Sp linkage phosphorus. In some embodiments, at least about 90% of the internucleotidic linkages of a provided oligonucleotide are chirally controlled and have Sp linkage phosphorus.
  • the present disclosure provides chirally controlled oligonucleotide compositions, e.g., chirally controlled RHO oligonucleotide compositions, wherein the composition comprises a non-random or controlled level of a plurality of oligonucleotides, wherein oligonucleotides of the plurality share a common base sequence, and share the same configuration of linkage phosphorus independently at 1-50, 1-40, 1-30, 1-25, 1-20, 1-15, 1-10, 5-50, 5-40, 5-30, 5-25, 5-20, 5-15, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or more chiral internucleotidic linkages.
  • chirally controlled oligonucleotide compositions e.g., chirally controlled RHO oligonucleotide compositions, wherein the composition comprises a non-random or controlled level of a plurality of oligonucleot
  • provided oligonucleotides comprise 2-30 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotide compositions comprise 5-30 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotide compositions comprise 10-30 chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotide compositions comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or more chirally controlled internucleotidic linkages.
  • about 1-100% of all internucleotidic linkages are chirally controlled internucleotidic linkages.
  • a percentage is about 5%-100%.
  • a percentage is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 965, 96%, 98%, or 99%.
  • a percentage is about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 965, 96%, 98%, or 99%.
  • a pattern of backbone chiral centers in an oligonucleotide comprises a pattern of i o -i s -i o -i s -i o , i o -i s -i s -i s -i o , i o -i s -i s -i o -i s , i s -i o -i s -i o , i s -i o -i s -i o , i s -i o -i s -i o , i s -i o -i s -i o , i s -i o -i s -i o , i s -i o -i s -i o -i s , i s -i o -i s -i o
  • an internucleotidic linkage in the Sp configuration is a phosphorothioate internucleotidic linkage.
  • an achiral internucleotidic linkage is a natural phosphate linkage.
  • an internucleotidic linkage in the Rp configuration (having a Rp linkage phosphorus) is a phosphorothioate internucleotidic linkage.
  • each internucleotidic linkage in the Sp configuration is a phosphorothioate internucleotidic linkage.
  • each achiral internucleotidic linkage is a natural phosphate linkage.
  • each internucleotidic linkage in the Rp configuration is a phosphorothioate internucleotidic linkage.
  • each internucleotidic linkage in the Sp configuration is a phosphorothioate internucleotidic linkage
  • each achiral internucleotidic linkage is a natural phosphate linkage
  • each internucleotidic linkage in the Rp configuration is a phosphorothioate internucleotidic linkage.
  • a pattern of backbone chiral centers (e.g., a pattern of backbone chiral centers in an oligonucleotide, e.g., a RHO oligonucleotide or in a core or a wing or in two wings of an oligonucleotide, e.g., a RHO oligonucleotide) comprises a pattern of OpSpOpSpOp, OpSpSpSpOp, OpSpSpSpOp, SpOpSpOp, SpOpSpOp, SpOpSpOpSp, SpOpSpOpSpOp, SpOpSpOpSpOp, SpOpSpOpSpOpSpOp, SpOpSpSpSpOp, SpOpSpSpSpSpOp, SpSpOpSpSpSpOp, SpSpOpSpSpSpSp,
  • an internucleotidic linkage bonded to a wing nucleoside and a core nucleoside is considered one of the core internucleotidic linkages, for example, when describing types, modifications, numbers, and/or patterns of core internucleotidic linkages.
  • each internucleotidic linkage bonded to a wing nucleoside and a core nucleoside is considered one of the core internucleotidic linkages, for example, when describing types, modifications, numbers, and/or patterns of core internucleotidic linkages.
  • a core internucleotidic linkage is bonded to two core nucleosides.
  • a core internucleotidic linkage is bonded to a core nucleoside and a wing nucleoside. In some embodiments, each core internucleotidic linkage is independently bonded to two core nucleosides, or a core nucleoside and a wing nucleoside. In some embodiments, each wing internucleotidic linkage is independently bonded to two wing nucleosides. [00513] In some embodiments, at least about 25% of the oligonucleotides in a composition share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers.
  • At least about 30% of the oligonucleotides in a composition share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 50% of the oligonucleotides in a composition share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 60% of the oligonucleotides in a composition share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers.
  • At least about 70% of the oligonucleotides in a composition share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 80% of the oligonucleotides in a composition share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 85% of the oligonucleotides in a composition share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers.
  • At least about 90% of the oligonucleotides in a composition share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 92% of the oligonucleotides in a composition share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 94% of the oligonucleotides in a composition share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers.
  • At least about 95% of the oligonucleotides in a composition share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, at least about 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the oligonucleotides in a composition share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers. In some embodiments, greater than about 99% of the oligonucleotides in a composition share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers.
  • purity of a composition may be expressed as the percentage of oligonucleotides in a composition that share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers.
  • provided oligonucleotides e.g., RHO oligonucleotides, in chirally controlled oligonucleotide compositions each comprise different types of internucleotidic linkages.
  • provided oligonucleotides comprise at least one natural phosphate linkage and at least one modified internucleotidic linkage.
  • provided oligonucleotides comprise at least one natural phosphate linkage and at least two modified internucleotidic linkages. In some embodiments, provided oligonucleotides comprise at least one natural phosphate linkage and at least three modified internucleotidic linkages. In some embodiments, provided oligonucleotides comprise at least one natural phosphate linkage and at least four modified internucleotidic linkages. In some embodiments, provided oligonucleotides comprise at least one natural phosphate linkage and at least five modified internucleotidic linkages.
  • provided oligonucleotides comprise at least one natural phosphate linkage and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 modified internucleotidic linkages.
  • a modified internucleotidic linkage is a phosphorothioate internucleotidic linkage.
  • each modified internucleotidic linkage is a phosphorothioate internucleotidic linkage.
  • a modified internucleotidic linkage is a non-negatively charged internucleotidic linkage.
  • a modified internucleotidic linkage is a neutral internucleotidic linkage. In some embodiments, a modified internucleotidic linkage is n001. In some embodiments, each modified internucleotidic linkage is independently phosphorothioate or a neutral internucleotidic linkage. In some embodiments, each modified internucleotidic linkage is independently phosphorothioate or n001. In some embodiments, provided oligonucleotides comprise at least one natural phosphate linkage and at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive modified internucleotidic linkages.
  • provided oligonucleotides comprise at least one natural phosphate linkage and at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive phosphorothioate internucleotidic linkages.
  • oligonucleotides comprise two or more types of internucleotidic linkages.
  • oligonucleotides comprise two or more types of modified internucleotidic linkages.
  • oligonucleotides comprise one or more natural phosphate linkages and one or more types of modified internucleotidic linkages.
  • modified internucleotidic linkages are independently chiral internucleotidic linkages.
  • oligonucleotides comprises natural phosphate linkages and two or more types of modified internucleotidic linkages.
  • modified internucleotidic linkages are phosphorothioate internucleotidic linkages.
  • modified internucleotidic linkages are non-negatively charged internucleotidic linkages.
  • modified internucleotidic linkages are neutral internucleotidic linkages.
  • non-negatively charged internucleotidic linkages or neutral internucleotidic linkages are n001.
  • oligonucleotides comprises one or more natural phosphate linkages and one or more phosphorothioate internucleotidic linkages.
  • oligonucleotide comprises one or more natural phosphate linkages, one or more negatively charged modified internucleotidic linkages (e.g., phosphorothioate internucleotidic linkages) and one or more non-negatively charged internucleotidic linkages (e.g., neutral internucleotidic linkages such as n001).
  • each chiral internucleotidic linkage is independently chirally controlled.
  • each phosphorothioate internucleotidic linkage is independently chirally controlled.
  • one or more chiral internucleotidic linkages, e.g., n001, are not chirally controlled.
  • a modified linkage comprises a chiral auxiliary, which, for example, is used to control the stereoselectivity of a reaction, e.g., a coupling reaction in an oligonucleotide synthesis cycle.
  • oligonucleotides are linked to a solid support.
  • a solid support is a support for oligonucleotide synthesis.
  • a solid support comprises glass.
  • a solid support is CPG (controlled pore glass).
  • a solid support is polymer.
  • a solid support is polystyrene.
  • the solid support is Highly Crosslinked Polystyrene (HCP).
  • the solid support is hybrid support of Controlled Pore Glass (CPG) and Highly Cross-linked Polystyrene (HCP).
  • a solid support is a metal foam.
  • a solid support is a resin.
  • oligonucleotides are cleaved from a solid support.
  • purity, particularly stereochemical purity, and particularly diastereomeric purity of many oligonucleotides and compositions thereof wherein all other chiral centers in the oligonucleotides but the chiral linkage phosphorus centers have been stereodefined e.g., carbon chiral centers in the sugars, which are defined in, e.g., phosphoramidites for oligonucleotide synthesis
  • stereoselectivity as appreciated by those skilled in this art, diastereoselectivity in many cases of oligonucleotide synthesis wherein the oligonucleotide comprise more than one chiral centers
  • a coupling step has a stereoselectivity (diastereoselectivity when there are other chiral centers) of 60% at the linkage phosphorus.
  • the new internucleotidic linkage formed may be referred to have a 60% stereochemical purity (for oligonucleotides, typically diastereomeric purity in view of the existence of other chiral centers).
  • each coupling step independently has a stereoselectivity of at least 60%.
  • each coupling step independently has a stereoselectivity of at least 70%.
  • each coupling step independently has a stereoselectivity of at least 80%.
  • each coupling step independently has a stereoselectivity of at least 85%. In some embodiments, each coupling step independently has a stereoselectivity of at least 90%. In some embodiments, each coupling step independently has a stereoselectivity of at least 91%. In some embodiments, each coupling step independently has a stereoselectivity of at least 92%. In some embodiments, each coupling step independently has a stereoselectivity of at least 93%. In some embodiments, each coupling step independently has a stereoselectivity of at least 94%. In some embodiments, each coupling step independently has a stereoselectivity of at least 95%. In some embodiments, each coupling step independently has a stereoselectivity of at least 96%.
  • each coupling step independently has a stereoselectivity of at least 97%. In some embodiments, each coupling step independently has a stereoselectivity of at least 98%. In some embodiments, each coupling step independently has a stereoselectivity of at least 99%. In some embodiments, each coupling step independently has a stereoselectivity of at least 99.5%. In some embodiments, each coupling step independently has a stereoselectivity of virtually 100%. In some embodiments, a coupling step has a stereoselectivity of virtually 100% in that each detectable product from the coupling step analyzed by an analytical method (e.g., NMR, HPLC, etc.) has the intended stereoselectivity.
  • an analytical method e.g., NMR, HPLC, etc.
  • a chirally controlled internucleotidic linkage is typically formed with a stereoselectivity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99.5% or virtually 100% (in some embodiments, at least 90%; in some embodiments, at least 95%; in some embodiments, at least 96%; in some embodiments, at least 97%; in some embodiments, at least 98%; in some embodiments, at least 99%).
  • a chirally controlled internucleotidic linkage has a stereochemical purity (typically diastereomeric purity for oligonucleotides with multiple chiral centers) of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99.5% or virtually 100% (in some embodiments, at least 90%; in some embodiments, at least 95%; in some embodiments, at least 96%; in some embodiments, at least 97%; in some embodiments, at least 98%; in some embodiments, at least 99%) at its chiral linkage phosphorus.
  • stereochemical purity typically diastereomeric purity for oligonucleotides with multiple chiral centers
  • each chirally controlled internucleotidic linkage independently has a stereochemical purity (typically diastereomeric purity for oligonucleotides with multiple chiral centers) of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99.5% or virtually 100% (in some embodiments, at least 90%; in some embodiments, at least 95%; in some embodiments, at least 96%; in some embodiments, at least 97%; in some embodiments, at least 98%; in some embodiments, at least 99%) at its chiral linkage phosphorus.
  • stereochemical purity typically diastereomeric purity for oligonucleotides with multiple chiral centers
  • a non-chirally controlled internucleotidic linkage is typically formed with a stereoselectivity of less than 60%, 70%, 80%, 85%, or 90% (in some embodiments, less than 60%; in some embodiments, less than 70%; in some embodiments, less than 80%; in some embodiments, less than 85%; in some embodiments, less than 90%).
  • each non-chirally controlled internucleotidic linkage is independently formed with a stereoselectivity of less than 60%, 70%, 80%, 85%, or 90% (in some embodiments, less than 60%; in some embodiments, less than 70%; in some embodiments, less than 80%; in some embodiments, less than 85%; in some embodiments, less than 90%).
  • a non-chirally controlled internucleotidic linkage has a stereochemical purity (typically diastereomeric purity for oligonucleotides with multiple chiral centers) of less than 60%, 70%, 80%, 85%, or 90% (in some embodiments, less than 60%; in some embodiments, less than 70%; in some embodiments, less than 80%; in some embodiments, less than 85%; in some embodiments, less than 90%) at its chiral linkage phosphorus.
  • stereochemical purity typically diastereomeric purity for oligonucleotides with multiple chiral centers
  • each non-chirally controlled internucleotidic linkage independently has a stereochemical purity (typically diastereomeric purity for oligonucleotides with multiple chiral centers) of less than 60%, 70%, 80%, 85%, or 90% (in some embodiments, less than 60%; in some embodiments, less than 70%; in some embodiments, less than 80%; in some embodiments, less than 85%; in some embodiments, less than 90%) at its chiral linkage phosphorus.
  • stereochemical purity typically diastereomeric purity for oligonucleotides with multiple chiral centers
  • At least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 couplings of a monomer independently have a stereoselectivity less than about 60%, 70%, 80%, 85%, or 90% [for oligonucleotide synthesis, typically diastereoselectivity with respect to formed linkage phosphorus chiral center(s)].
  • at least one coupling has a stereoselectivity less than about 60%, 70%, 80%, 85%, or 90%.
  • At least two couplings independently have a stereoselectivity less than about 60%, 70%, 80%, 85%, or 90%. In some embodiments, at least three couplings independently have a stereoselectivity less than about 60%, 70%, 80%, 85%, or 90%. In some embodiments, at least four couplings independently have a stereoselectivity less than about 60%, 70%, 80%, 85%, or 90%. In some embodiments, at least five couplings independently have a stereoselectivity less than about 60%, 70%, 80%, 85%, or 90%. In some embodiments, each coupling independently has a stereoselectivity less than about 60%, 70%, 80%, 85%, or 90%.
  • each non-chirally controlled internucleotidic linkage is independently formed with a stereoselectivity less than about 60%, 70%, 80%, 85%, or 90%. In some embodiments, a stereoselectivity is less than about 60%. In some embodiments, a stereoselectivity is less than about 70%. In some embodiments, a stereoselectivity is less than about 80%. In some embodiments, a stereoselectivity is less than about 90%. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 couplings independently have a stereoselectivity less than about 90%.
  • At least one coupling has a stereoselectivity less than about 90%. In some embodiments, at least two couplings have a stereoselectivity less than about 90%. In some embodiments, at least three couplings have a stereoselectivity less than about 90%. In some embodiments, at least four couplings have a stereoselectivity less than about 90%. In some embodiments, at least five couplings have a stereoselectivity less than about 90%. In some embodiments, each coupling independently has a stereoselectivity less than about 90%. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 couplings independently have a stereoselectivity less than about 85%.
  • each coupling independently has a stereoselectivity less than about 85%. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 couplings independently have a stereoselectivity less than about 80%. In some embodiments, each coupling independently has a stereoselectivity less than about 80%. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 couplings independently have a stereoselectivity less than about 70%. In some embodiments, each coupling independently has a stereoselectivity less than about 70%.
  • At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 chiral internucleotidic linkages of the oligonucleotides independently have a stereochemical purity (typically diastereomeric purity for oligonucleotides comprising multiple chiral centers) less than about 60%, 70%, 80%, 85%, or 90% with respect to chiral linkage phosphorus of the internucleotidic linkage(s).
  • At least one internucleotidic linkage has a diastereomeric purity less than about 60%, 70%, 80%, 85%, or 90%. In some embodiments, at least two internucleotidic linkages independently have a diastereomeric purity less than about 60%, 70%, 80%, 85%, or 90%. In some embodiments, at least three internucleotidic linkages independently have a diastereomeric purity less than about 60%, 70%, 80%, 85%, or 90%. In some embodiments, at least four internucleotidic linkages independently have a diastereomeric purity less than about 60%, 70%, 80%, 85%, or 90%.
  • At least five internucleotidic linkages independently have a diastereomeric purity less than about 60%, 70%, 80%, 85%, or 90%. In some embodiments, each internucleotidic linkages independently has a diastereomeric purity less than about 60%, 70%, 80%, 85%, or 90%. In some embodiments, a diastereomeric purity is less than about 60%. In some embodiments, a diastereomeric purity is less than about 70%. In some embodiments, a diastereomeric purity is less than about 80%. In some embodiments, a diastereomeric purity is less than about 85%. In some embodiments, a diastereomeric purity is less than about 90%.
  • At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 internucleotidic linkages independently have a diastereomeric purity less than about 90%.
  • at least one internucleotidic linkage has a diastereomeric purity less than about 90%.
  • at least two internucleotidic linkages independently have a diastereomeric purity less than about 90%.
  • at least three internucleotidic linkages independently have a diastereomeric purity less than about 90%.
  • at least four internucleotidic linkages independently have a diastereomeric purity less than about 90%.
  • At least five internucleotidic linkages independently have a diastereomeric purity less than about 90%.
  • each chiral internucleotidic linkage internucleotidic linkage independently has a diastereomeric purity less than about 90%.
  • at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 internucleotidic linkages independently have a diastereomeric purity less than about 85%.
  • each chiral internucleotidic linkage independently has a diastereomeric purity less than about 85%.
  • At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 internucleotidic linkages independently have a diastereomeric purity less than about 80%.
  • each chiral internucleotidic linkage independently has a diastereomeric purity less than about 80%.
  • at least 5%-100% of all chiral elements of provided oligonucleotides each independently have a diastereomeric purity as described herein.
  • At least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of all chiral elements each independently have a diastereomeric purity as described herein.
  • at least 5%-100% of all chiral phosphorus centers each independently have a diastereomeric purity as described herein.
  • at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of all chiral linkage phosphorus each independently have a diastereomeric purity as described herein.
  • provided oligonucleotides e.g., oligonucleotides of a plurality in provided chirally controlled oligonucleotide compositions have a diastereomeric purity as described herein.
  • a stereochemical purity e.g., diastereomeric purity
  • a diastereomeric purity is about 60%-100%.
  • the percentage is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 93%, 95%, 96%, 97%, 98%, or 99%.
  • the percentage is at least 80%, 85%, 90%, 91%, 92%, 93%, 93%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the percentage is at least 90%, 91%, 92%, 93%, 93%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, a diastereomeric purity is at least 60%. In some embodiments, a diastereomeric purity is at least 70%. In some embodiments, a diastereomeric purity is at least 80%. In some embodiments, a diastereomeric purity is at least 85%. In some embodiments, a diastereomeric purity is at least 90%.
  • a diastereomeric purity is at least 91%. In some embodiments, a diastereomeric purity is at least 92%. In some embodiments, a diastereomeric purity is at least 93%. In some embodiments, a diastereomeric purity is at least 94%. In some embodiments, a diastereomeric purity is at least 95%. In some embodiments, a diastereomeric purity is at least 96%. In some embodiments, a diastereomeric purity is at least 97%. In some embodiments, a diastereomeric purity is at least 98%. In some embodiments, a diastereomeric purity is at least 99%. In some embodiments, a diastereomeric purity is at least 99.5%.
  • compounds of the present disclosure comprise multiple chiral elements (e.g., multiple carbon and/or phosphorus (e.g., linkage phosphorus of chiral internucleotidic linkages) chiral centers).
  • at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or more chiral elements of a provided compound each independently have a diastereomeric purity as described herein.
  • At least 1, 2, 3, 4, 5, 6, 7, 8, 9 or more chiral carbon centers of a provided compound each independently have a diastereomeric purity as described herein. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or more chiral phosphorus centers of a provided compound each independently have a diastereomeric purity as described herein. In some embodiments, each chiral element independently has a diastereomeric purity as described herein. In some embodiments, each chiral center independently has a diastereomeric purity as described herein. In some embodiments, each chiral carbon center independently has a diastereomeric purity as described herein.
  • each chiral phosphorus center independently has a diastereomeric purity as described herein. In some embodiments, each chiral phosphorus center independently has a diastereomeric purity of at least 90%, 91%, 92%, 93%, 93%, 95%, 96%, 97%, 98%, or 99% or more.
  • diastereoselectivity of a coupling or diastereomeric purity of a chiral linkage phosphorus center can be assessed through the diastereoselectivity of a dimer formation or diastereomeric purity of a dimer prepared under the same or comparable conditions, wherein the dimer has the same 5’- and 3’-nucleosides and internucleotidic linkage.
  • Various technologies can be utilized for identifying or confirming stereochemistry of chiral elements (e.g., configuration of chiral linkage phosphorus) and/or patterns of backbone chiral centers, and/or for assessing stereoselectivity (e.g., diastereoselectivity of couple steps in oligonucleotide synthesis) and/or stereochemical purity (e.g., diastereomeric purity of internucleotidic linkages, compounds (e.g., oligonucleotides), etc.).
  • stereoselectivity e.g., diastereoselectivity of couple steps in oligonucleotide synthesis
  • stereochemical purity e.g., diastereomeric purity of internucleotidic linkages, compounds (e.g., oligonucleotides), etc.
  • Example technologies include NMR [e.g., 1D (one-dimensional) and/or 2D (two- dimensional) 1 H- 31 P HETCOR (heteronuclear correlation spectroscopy)], HPLC, RP-HPLC, mass spectrometry, LC-MS, and cleavage of internucleotidic linkages by stereospecific nucleases, etc., which may be utilized individually or in combination.
  • NMR e.g., 1D (one-dimensional) and/or 2D (two- dimensional) 1 H- 31 P HETCOR (heteronuclear correlation spectroscopy)
  • HPLC RP-HPLC
  • mass spectrometry mass spectrometry
  • LC-MS cleavage of internucleotidic linkages by stereospecific nucleases, etc.
  • Example useful nucleases include benzonase, micrococcal nuclease, and svPDE (snake venom phosphodiesterase), which are specific for certain internucleotidic linkages with Rp linkage phosphorus (e.g., a Rp phosphorothioate linkage); and nuclease P1, mung bean nuclease, and nuclease S1, which are specific for internucleotidic linkages with Sp linkage phosphorus (e.g., a Sp phosphorothioate linkage).
  • Rp linkage phosphorus e.g., a Rp phosphorothioate linkage
  • nuclease P1 mung bean nuclease
  • nuclease S1 which are specific for internucleotidic linkages with Sp linkage phosphorus (e.g., a Sp phosphorothioate linkage).
  • cleavage of oligonucleotides by a particular nuclease may be impacted by structural elements, e.g., chemical modifications (e.g., 2’-modifications of a sugars), base sequences, or stereochemical contexts.
  • structural elements e.g., chemical modifications (e.g., 2’-modifications of a sugars), base sequences, or stereochemical contexts.
  • benzonase and micrococcal nuclease which are specific for internucleotidic linkages with Rp linkage phosphorus, were unable to cleave an isolated Rp phosphorothioate internucleotidic linkage flanked by Sp phosphorothioate internucleotidic linkages.
  • oligonucleotides sharing a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers share a common pattern of backbone phosphorus modifications and a common pattern of base modifications.
  • oligonucleotide compositions sharing a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers share a common pattern of backbone phosphorus modifications and a common pattern of nucleoside modifications.
  • oligonucleotides share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have identical structures.
  • an oligonucleotide in a composition exists in one form, e.g., a pharmaceutically acceptable salt form such as a sodium salt form. In some embodiments, in a composition an oligonucleotide exisits in two or more forms, e.g., two or more pharmaceutically acceptable salt forms.
  • the present disclosure provides an oligonucleotide composition
  • oligonucleotide composition comprising a plurality of oligonucleotides capable of directing RHO knockdown, wherein oligonucleotides of the plurality are of a particular oligonucleotide type, which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence, for oligonucleotides of the particular oligonucleotide type.
  • oligonucleotides having a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications and a common pattern of base modifications. In some embodiments, oligonucleotides having a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have a common pattern of backbone phosphorus modifications and a common pattern of nucleoside modifications. In some embodiments, oligonucleotides having a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone chiral centers have identical structures.
  • the present disclosure provides RHO oligonucleotide compositions comprising a plurality of oligonucleotides. In some embodiments, the present disclosure provides RHO oligonucleotide compositions comprising a plurality of oligonucleotides, wherein at least one oligonucleotide comprises a chirally controlled internucleotidic linkage. In some embodiments, the present disclosure provides RHO oligonucleotide compositions comprising a plurality of oligonucleotides, wherein none of the oligonucleotides comprises a chirally controlled internucleotidic linkage.
  • the present disclosure provides chirally controlled oligonucleotide compositions of RHO oligonucleotides.
  • the present disclosure provides a RHO oligonucleotide whose base sequence is or is complementary to a RHO sequence disclosed herein or a portion thereof (e.g., various bases sequences in Table A1, wherein each T may be independently replaced with U and vice versa).
  • the present disclosure provides a RHO oligonucleotide whose base sequence comprises a base sequence that is or is complementary to a RHO sequence disclosed herein or a portion thereof (e.g., various bases sequences in Table A1).
  • the present disclosure provides a RHO oligonucleotide whose base sequence comprises 15 contiguous bases of a base sequence that is or is complementary to a RHO sequence disclosed herein or a portion thereof (e.g., various bases sequences in Table A1, wherein each T may be independently replaced with U and vice versa).
  • the present disclosure provides a RHO oligonucleotide which has a base sequence comprising 15 contiguous bases with 0-3 mismatches of a base sequence that is or is complementary to a RHO sequence disclosed herein or a portion thereof (e.g., various bases sequences in Table A1, wherein each T may be independently replaced with U and vice versa).
  • the present disclosure provides a RHO oligonucleotide composition wherein the RHO oligonucleotides comprise at least one chiral internucleotidic linkage which is not chirally controlled.
  • the present disclosure provides a RHO oligonucleotide comprising a non-chirally controlled chiral internucleotidic linkage, wherein the base sequence of the RHO oligonucleotide comprises a base sequence that is or is complementary to a RHO sequence disclosed herein or a portion thereof (e.g., various bases sequences in Table A1, wherein each T may be independently replaced with U and vice versa).
  • the present disclosure provides a RHO oligonucleotide composition comprising a non-chirally controlled chiral internucleotidic linkage, wherein the base sequence of the RHO oligonucleotide is a base sequence that is or is complementary to a RHO sequence disclosed herein or a portion thereof (e.g., various bases sequences in Table A1, wherein each T may be independently replaced with U and vice versa).
  • the present disclosure provides a RHO oligonucleotide comprising a non-chirally controlled chiral internucleotidic linkage, wherein the base sequence of the RHO oligonucleotide comprises 15 contiguous bases of a base sequence that is or is complementary to a RHO sequence disclosed herein or a portion thereof (e.g., various bases sequences in Table A1, wherein each T may be independently replaced with U and vice versa).
  • the present disclosure provides a RHO oligonucleotide comprising a non-chirally controlled chiral internucleotidic linkage, wherein the base sequence of the RHO oligonucleotides comprises 15 contiguous bases with 0-3 mismatches of a base sequence that is or is complementary to a RHO sequence disclosed herein or a portion thereof (e.g., various bases sequences in Table A1, wherein each T may be independently replaced with U and vice versa).
  • the present disclosure provides a RHO oligonucleotide comprising a chirally controlled chiral internucleotidic linkage, wherein the base sequence of the RHO oligonucleotide comprises a base sequence that is or is complementary to a RHO sequence disclosed herein or a portion thereof (e.g., various bases sequences in Table A1, wherein each T may be independently replaced with U and vice versa).
  • the present disclosure provides a RHO oligonucleotide composition comprising a chirally controlled chiral internucleotidic linkage, wherein the base sequence of the RHO oligonucleotide is a base sequence that is or is complementary to a RHO sequence disclosed herein or a portion thereof (e.g., various bases sequences in Table A1, wherein each T may be independently replaced with U and vice versa).
  • the present disclosure provides a RHO oligonucleotide comprising a chirally controlled chiral internucleotidic linkage, wherein the base sequence of the RHO oligonucleotide comprises 15 contiguous bases of a base sequence that is or is complementary to a RHO sequence disclosed herein or a portion thereof (e.g., various bases sequences in Table A1, wherein each T may be independently replaced with U and vice versa).
  • the present disclosure provides a RHO oligonucleotide comprising a chirally controlled chiral internucleotidic linkage, wherein the base sequence of the RHO oligonucleotides comprises 15 contiguous bases with 0-3 mismatches of a base sequence that is or is complementary to a RHO sequence disclosed herein or a portion thereof (e.g., various bases sequences in Table A1, wherein each T may be independently replaced with U and vice versa).
  • oligonucleotides of the same oligonucleotide type have a common pattern of backbone phosphorus modifications and a common pattern of nucleoside modifications.
  • oligonucleotides of the same oligonucleotide type have a common pattern of sugar modifications. In some embodiments, oligonucleotides of the same oligonucleotide type have a common pattern of base modifications. In some embodiments, oligonucleotides of the same oligonucleotide type have a common pattern of nucleoside modifications. In some embodiments, oligonucleotides of the same oligonucleotide type have the same constitution. In many embodiments, oligonucleotides of the same oligonucleotide type are identical.
  • a plurality of oligonucleotides or oligonucleotides of a particular oligonucleotide type in a provided oligonucleotide composition are RHO oligonucleotides.
  • the present disclosure provides a chirally controlled RHO oligonucleotide composition
  • a chirally controlled RHO oligonucleotide composition comprising a plurality of RHO oligonucleotides, wherein the oligonucleotides share: 1) a common base sequence; 2) a common pattern of backbone linkages; and 3) the same linkage phosphorus stereochemistry at one or more (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 1-15, 1-10, 5-50, 5-40, 5-30, 5-25, 5-20, 5-15, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) chiral internucleotidic linkages (chirally controlled internucleotidic linkages), wherein the composition is enriched, relative to a substantially racemic preparation of oligonucleotides sharing the common base sequence and pattern of backbone linkages, for oligonucleotides of the plurality.
  • one or more” or “at least one” is 1-50, 1-40, 1-30, 1-25, 1-20, 1-15, 1-10, 5-50, 5-40, 5-30, 5-25, 5-20, 5-15, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more.
  • the present disclosure provides a chirally controlled RHO oligonucleotide composition
  • a chirally controlled RHO oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides share: 1) a common base sequence; 2) a common pattern of backbone linkages; and 3) a common pattern of backbone chiral centers, which composition is a substantially pure preparation of a single oligonucleotide in that at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 93%, 95%, 96%, 97%, 98%, or 99% of the oligonucleotides in the composition have the common base sequence, the common pattern of backbone linkages, and the common pattern of backbone chiral centers.
  • an oligonucleotide type is further defined by: 4) additional chemical moiety, if any.
  • the percentage is at least about 10%. In some embodiments, the percentage is at least about 20%. In some embodiments, the percentage is at least about 30%. In some embodiments, the percentage is at least about 40%. In some embodiments, the percentage is at least about 50%. In some embodiments, the percentage is at least about 60%. In some embodiments, the percentage is at least about 70%. In some embodiments, the percentage is at least about 75%. In some embodiments, the percentage is at least about 80%. In some embodiments, the percentage is at least about 85%. In some embodiments, the percentage is at least about 90%.
  • the percentage is at least about 91%. In some embodiments, the percentage is at least about 92%. In some embodiments, the percentage is at least about 93%. In some embodiments, the percentage is at least about 94%. In some embodiments, the percentage is at least about 95%. In some embodiments, the percentage is at least about 96%. In some embodiments, the percentage is at least about 97%. In some embodiments, the percentage is at least about 98%. In some embodiments, the percentage is at least about 99%. In some embodiments, the percentage is or is greater than (DS) nc , wherein DS and nc are each independently as described in the present disclosure.
  • a plurality of oligonucleotides share the same constitution.
  • a plurality of oligonucleotides e.g., RHO oligonucleotides
  • are identical the same stereoisomer.
  • a chirally controlled oligonucleotide composition e.g., a chirally controlled RHO oligonucleotide composition
  • a provided composition is characterized in that when it is contacted with a target nucleic acid [e.g., a RHO transcript (e.g., pre-mRNA, mature mRNA, other types of RNA, etc. that hybridizes with oligonucleotides of the composition)], levels of the target nucleic acid and/or a product encoded thereby is reduced compared to that observed under a reference condition.
  • a reference condition is selected from the group consisting of absence of the composition, presence of a reference composition, and combinations thereof.
  • a reference condition is absence of the composition. In some embodiments, a reference condition is presence of a reference composition. In some embodiments, a reference composition is a composition whose oligonucleotides do not hybridize with the target nucleic acid. In some embodiments, a reference composition is a composition whose oligonucleotides do not comprise a sequence that is sufficiently complementary to the target nucleic acid.
  • a provided composition is a chirally controlled oligonucleotide composition and a reference composition is a non-chirally controlled oligonucleotide composition which is otherwise identical but is not chirally controlled (e.g., a racemic preparation of oligonucleotides of the same constitution as oligonucleotides of a plurality in the chirally controlled oligonucleotide composition).
  • the present disclosure provides a chirally controlled RHO oligonucleotide composition
  • a chirally controlled RHO oligonucleotide composition comprising a plurality of RHO oligonucleotides capable of directing RHO knockdown, wherein the oligonucleotides share: 1) a common base sequence, 2) a common pattern of backbone linkages, and 3) the same linkage phosphorus stereochemistry at one or more (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 1-15, 1-10, 5-50, 5-40, 5-30, 5-25, 5-20, 5-15, 5-10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more) chiral internucleotidic linkages (chirally controlled internucleotidic linkages), wherein the composition is enriched, relative to a substantially racemic preparation of oligonucleotides sharing the common base sequence and pattern of backbone linkages, for oligonucle
  • the base sequence of an oligonucleotide may refer to the identity and/or modification status of nucleoside residues (e.g., of sugar and/or base components, relative to standard naturally occurring nucleotides such as adenine, cytosine, guanosine, thymine, and uracil) in the oligonucleotide and/or to the hybridization character (i.e., the ability to hybridize with particular complementary residues) of such residues.
  • nucleoside residues e.g., of sugar and/or base components, relative to standard naturally occurring nucleotides such as adenine, cytosine, guanosine, thymine, and uracil
  • oligonucleotide structural elements e.g., patterns of sugar modifications, backbone linkages, backbone chiral centers, backbone phosphorus modifications, etc.
  • oligonucleotide compositions are capable of reducing the expression, level and/or activity of a target gene or a gene product thereof.
  • oligonucleotide compositions are capable of reducing in the expression, level and/or activity of a target gene or a gene product thereof by sterically blocking translation after annealing to a target gene mRNA, by cleaving mRNA (pre-mRNA or mature mRNA), and/or by altering or interfering with mRNA splicing.
  • provided RHO oligonucleotide compositions are capable of reducing the expression, level and/or activity of a RHO target gene or a gene product thereof.
  • provided RHO oligonucleotide compositions are capable of reducing in the expression, level and/or activity of a RHO target gene or a gene product thereof by sterically blocking translation after annealing to a RHO target gene mRNA, by cleaving RHO mRNA (pre-mRNA or mature mRNA), and/or by altering or interfering with mRNA splicing.
  • an oligonucleotide composition e.g., a RHO oligonucleotide composition
  • a RHO oligonucleotide composition is a substantially pure preparation of a single oligonucleotide stereoisomer, e.g., a RHO oligonucleotide stereoisomer, in that oligonucleotides in the composition that are not of the oligonucleotide stereoisomer are impurities from the preparation process of said oligonucleotide stereoisomer, in some case, after certain purification procedures.
  • the present disclosure provides oligonucleotides and oligonucleotide compositions that are chirally controlled, and in some embodiments, stereopure.
  • a provided composition contains non-random or controlled levels of one or more individual oligonucleotide types.
  • oligonucleotides of the same oligonucleotide type are identical.
  • Sugars [00544] Various sugars, including modified sugars, can be utilized in accordance with the present disclosure.
  • the present disclosure provides sugar modifications and patterns thereof optionally in combination with other structural elements (e.g., internucleotidic linkage modifications and patterns thereof, pattern of backbone chiral centers thereof, etc.) that when incorporated into oligonucleotides can provide improved properties and/or activities.
  • the most common naturally occurring nucleosides comprise ribose sugars (e.g., in RNA) or deoxyribose sugars (e.g., in DNA) linked to the nucleobases adenosine (A), cytosine (C), guanine (G), thymine (T) or uracil (U).
  • a sugar e.g., various sugars in many oligonucleotides in Table A1 (unless otherwise notes), is a natural DNA sugar (in DNA nucleic acids or oligonucleotides, having the structure o , wherein a nucleobase is attached to the 1’ position, and the 3’ and 5’ positions are conne ucleotidic linkages (as appreciated by those skilled in the art, if at the 5’-end of an oligonucleotide, the 5’ position may be connected to a 5’-end group (e.g., ⁇ OH), and if at the 3’-end of an oligonucleotide, the 3’ position may be connected to a 3’-end group (e.g., ⁇ OH).
  • a 5’-end group e.g., ⁇ OH
  • 3’-end group e.g., ⁇ OH

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne, entre autres, des oligonucléotides RHO, des compositions et des méthodes. Selon certains modes de réalisation, les oligonucléotides selon l'invention comprennent des modifications de nucléobases, des modifications de sucres, des modifications de liaisons internucléotidiques et/ou des motifs associés, et ont des propriétés, activités et/ou sélectivités améliorées. Selon certains autres modes de réalisation, la présente invention concerne des oligonucléotides RHO, des compositions et des méthodes de prévention et/ou de traitement d'états, de troubles ou de maladies liés à RHO, tels que la rétinopathie (par exemple, la dégénérescence rétinienne, la maladie dégénérative de la rétine, le trouble dégénératif de la rétine, le trouble dégénératif de la rétine héréditaire, la rétinite pigmentaire, la rétinite pigmentaire dominante autosomique, etc.).
PCT/US2021/056900 2021-10-27 2021-10-27 Compositions d'oligonucléotides et leurs méthodes d'utilisation WO2023075766A1 (fr)

Priority Applications (3)

Application Number Priority Date Filing Date Title
PCT/US2021/056900 WO2023075766A1 (fr) 2021-10-27 2021-10-27 Compositions d'oligonucléotides et leurs méthodes d'utilisation
AU2021471586A AU2021471586A1 (en) 2021-10-27 2021-10-27 Oligonucleotide compositions and methods of use thereof
CA3236136A CA3236136A1 (fr) 2021-10-27 2021-10-27 Compositions d'oligonucleotides et leurs methodes d'utilisation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US2021/056900 WO2023075766A1 (fr) 2021-10-27 2021-10-27 Compositions d'oligonucléotides et leurs méthodes d'utilisation

Publications (1)

Publication Number Publication Date
WO2023075766A1 true WO2023075766A1 (fr) 2023-05-04

Family

ID=86158394

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/056900 WO2023075766A1 (fr) 2021-10-27 2021-10-27 Compositions d'oligonucléotides et leurs méthodes d'utilisation

Country Status (3)

Country Link
AU (1) AU2021471586A1 (fr)
CA (1) CA3236136A1 (fr)
WO (1) WO2023075766A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11873316B2 (en) 2016-11-23 2024-01-16 Wave Life Sciences Ltd. Compositions and methods for phosphoramidite and oligonucleotide synthesis

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019157531A1 (fr) * 2018-02-12 2019-08-15 Ionis Pharmaceuticals, Inc. Composés modifiés et leurs utilisations
WO2020219983A2 (fr) * 2019-04-25 2020-10-29 Wave Life Sciences Ltd. Compositions d'oligonucléotides et leurs méthodes d'utilisation
WO2020227691A2 (fr) * 2019-05-09 2020-11-12 Wave Life Sciences Ltd. Compositions oligonucléotidiques et leurs procédés d'utilisation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019157531A1 (fr) * 2018-02-12 2019-08-15 Ionis Pharmaceuticals, Inc. Composés modifiés et leurs utilisations
WO2020219983A2 (fr) * 2019-04-25 2020-10-29 Wave Life Sciences Ltd. Compositions d'oligonucléotides et leurs méthodes d'utilisation
WO2020227691A2 (fr) * 2019-05-09 2020-11-12 Wave Life Sciences Ltd. Compositions oligonucléotidiques et leurs procédés d'utilisation

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11873316B2 (en) 2016-11-23 2024-01-16 Wave Life Sciences Ltd. Compositions and methods for phosphoramidite and oligonucleotide synthesis

Also Published As

Publication number Publication date
CA3236136A1 (fr) 2023-05-04
AU2021471586A1 (en) 2024-05-09

Similar Documents

Publication Publication Date Title
US20230145795A1 (en) Oligonucleotide compositions and methods of use thereof
CA3137740A1 (fr) Compositions d'oligonucleotides et leurs procedes d'utilisation
US20220098585A1 (en) Oligonucleotide compositions and methods thereof
JP7422068B2 (ja) オリゴヌクレオチド組成物及びその方法
CA3139513A1 (fr) Compositions oligonucleotidiques et leurs procedes d'utilisation
CA3156176A1 (fr) Compositions oligonucleotidiques et leurs procedes d'utilisation
CA3154768A1 (fr) Compositions d'oligonucleotides et leurs procedes d'utilisation
US20230295619A1 (en) Oligonucleotide compositions and methods thereof
CA2989682A1 (fr) Compositions d'oligonucleotides et procedes associes
WO2023075766A1 (fr) Compositions d'oligonucléotides et leurs méthodes d'utilisation
WO2023076352A2 (fr) Compositions oligonucléotidiques et leurs procédés d'utilisation
AU2022352779A1 (en) Oligonucleotide compositions and methods thereof
WO2024020188A2 (fr) Compositions d'oligonucléotides et méthodes associées
WO2023220087A1 (fr) Compositions d'oligonucléotides et procédés associés
TW202412817A (zh) 寡核苷酸組合物及其方法
WO2023049218A1 (fr) Compositions oligonuclétiques double brin et procédés s'y rapportant
TW202340464A (zh) 以ATN1 mRNA或pre-mRNA作為標的之反義寡核苷酸

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21962701

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: AU2021471586

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 3236136

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2021471586

Country of ref document: AU

Date of ref document: 20211027

Kind code of ref document: A