WO2023068764A1 - 타액 내 세균의 군집을 이용한 치주질환 진단용 조성물 및 이의 용도 - Google Patents

타액 내 세균의 군집을 이용한 치주질환 진단용 조성물 및 이의 용도 Download PDF

Info

Publication number
WO2023068764A1
WO2023068764A1 PCT/KR2022/015871 KR2022015871W WO2023068764A1 WO 2023068764 A1 WO2023068764 A1 WO 2023068764A1 KR 2022015871 W KR2022015871 W KR 2022015871W WO 2023068764 A1 WO2023068764 A1 WO 2023068764A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nos
bacteria
primer set
periodontitis
Prior art date
Application number
PCT/KR2022/015871
Other languages
English (en)
French (fr)
Inventor
지숙
국중기
박순낭
임윤경
정재숙
최금희
Original Assignee
아주대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 아주대학교산학협력단 filed Critical 아주대학교산학협력단
Publication of WO2023068764A1 publication Critical patent/WO2023068764A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00—Nucleic acid detection characterised by assay method
    • C12Q2561/113—Real time assay

Definitions

  • the present invention relates to a composition for diagnosing periodontal disease using bacterial colonies in saliva and its use.
  • Periodontal disease is a chronic disease that causes serious destruction of tissues around teeth due to inflammation progressing without the patient feeling it. cause
  • Periodontitis is an inflammation that occurs in the tooth supporting tissue and is accompanied by the gradual destruction of connective tissue and the loss of alveolar bone and periodontal ligament. Depending on the rate of periodontal destruction, disease activity and host resistance, various types of bacteria are involved. Systemic diseases such as diabetes exacerbate periodontitis, and host factors such as drug use, smoking, pregnancy, obesity, and excessive stress also act as risk factors. In addition to this, it is known that genetic factors play a significant role in the case of rapidly progressing periodontitis.
  • One of the diagnostic methods currently used to diagnose periodontitis is a method of determining how much alveolar bone has been lost and the degree of inflammation of the gingiva. This is a diagnostic method.
  • the measurement method of periodontal pocket depth may cause errors depending on the shape of the tooth and the degree of gingival inflammation.
  • the method of confirming bone loss on radiographs is the most basic method of diagnosing periodontitis along with periodontal pocket probing.
  • this is a two-dimensional image that can show the loss of alveolar bone on the mesiodistal surface of the tooth, but has a limitation that it cannot show the loss of alveolar bone on the buccal and lingual surfaces of teeth that overlap with the tooth.
  • the method for confirming the depth of the periodontal pocket and bone loss on radiographs shows only the results of alveolar bone loss (loss of attachment) due to progression of periodontitis prior to the time of diagnosis, and thus cannot show the active state of the current disease.
  • Bacterial infection is the primary cause of periodontal disease, which is the main cause of tooth loss. Therefore, it is important to reduce the number of bacteria in the oral cavity and actively treat it through early diagnosis. Accordingly, there is a need to develop a method that can easily diagnose whether the current gum condition is a healthy condition without inflammation or a periodontitis condition for periodontal disease with late subjective symptoms.
  • An object of the present invention is to provide a composition for diagnosing periodontal disease.
  • Another object of the present invention is to provide a kit for diagnosing periodontal disease.
  • Another object of the present invention is to provide a method for providing information necessary for diagnosing periodontal disease.
  • the present invention is Porphyromonas gingivalis in a sample isolated from the subject ( Porphyromonas gingivalis ), Tannerella forsythia ( Tannerella forsythia ), Prevotella intermedia ( Prevotella intermedia ), Porphyromonas Endodonthalis ( Porphyromonas endodontalis ) and Filifactor alocis ( Filifactor alocis ) Performing real-time polymerase chain reaction (Real-time PCR) quantitative analysis on one or more bacteria selected from the group consisting of; And information necessary for diagnosing periodontal disease comprising the step of comparing the percentage of bacteria obtained through the real-time PCR quantitative analysis with those selected from the group consisting of normal people, gingivitis, moderate periodontitis, and patients with deep periodontitis.
  • Real-time PCR real-time polymerase chain reaction
  • the present invention is Porphyromonas gingivalis in a sample isolated from the subject ( Porphyromonas gingivalis ), Tannerella Forsythia ( Tannerella forsythia ), Treponema denticola ( Treponema denticola ), Prevotella intermedia ( Prevotella intermedia ), Porphyromonas Endodonthalis ( Porphyromonas endodontalis ), Filipactor allosis ( Filifactor alocis ), Fusobacterium nucleatum ( Fusobacterium nucleatum ) and Parvimonas Micra ( Parvimonas micra ) Performing real-time polymerase chain reaction (Real-time PCR) quantitative analysis on one or more bacteria selected from the group consisting of; And information necessary for diagnosing periodontal disease, comprising comparing the number of bacteria obtained through the real-time PCR quantitative analysis with those selected from the group consisting of normal people, gingivitis, moderate period
  • the present invention is Porphyromonas gingivalis in a sample isolated from the subject ( Porphyromonas gingivalis ), Tannerella Forsythia ( Tannerella forsythia ), Treponema denticola ( Treponema denticola ), Prevotella intermedia ( Prevotella intermedia ), Porphyromonas Endodonthalis ( Porphyromonas endodontalis ), Filipactor allosis ( Filifactor alocis ), Fusobacterium nucleatum ( Fusobacterium nucleatum ) and Parvimonas Micra ( Parvimonas micra ) Performing 16S rRNA sequencing analysis on one or more bacteria selected from the group consisting of; And comparing the percentage of bacteria obtained through the 16S rRNA sequencing analysis with those selected from the group consisting of normal people, gingivitis, moderate periodontitis and deep periodontitis patients.
  • the present invention is a primer set represented by SEQ ID NOs: 1 and 2, a primer set represented by SEQ ID NOs: 3 and 4, a primer set represented by SEQ ID NOs: 5 and 6, a primer set represented by SEQ ID NOs: 7 and 8, and SEQ ID NO: 9 And any one or more primer sets selected from the group consisting of a primer set represented by 10, a primer set represented by SEQ ID NOs: 11 and 12, a primer set represented by SEQ ID NOs: 13 and 14, and a primer set represented by SEQ ID NOs: 15 and 16. It provides a composition for diagnosing periodontal disease comprising a.
  • the present invention provides a periodontal disease diagnostic kit comprising the composition.
  • saliva has the advantage of being safe, accessible, quick, and non-invasive to minimize patient discomfort. can help
  • 1 is a result of comparing the diversity of each group by 16s rRNA sequencing analysis.
  • Figure 2 shows the results of comparing the clusters at the phylum level for each group by 16s rRNA sequencing analysis.
  • Figure 3 shows the results of comparing the clusters at the genera and species level for each group by 16s rRNA sequencing analysis.
  • Figure 4 is a result of comparing the % of specific bacteria for each group by real-time PCR quantitative analysis.
  • 5 is a result of comparing the counts of specific bacteria for each group by real-time PCR quantitative analysis.
  • gingiodontal disease may include diseases occurring in periodontal tissues including gingiva (gum), periodontal ligament, and bone tissue around teeth, such as periodontitis and gingivitis. Depending on the severity of the disease, it is classified into gingivitis, moderate periodontitis, and deep periodontitis. When the periodontal disease is onset, inflammation progresses and tissue is damaged to form a periodontal pocket, and as periodontitis is severe, the depth of the periodontal pocket deepens. It is known.
  • diagnosis means confirming the presence or character of a pathological condition.
  • diagnosis is to determine whether periodontal disease has occurred, the progress of the disease, or whether there is a risk or not.
  • sample used in the present invention may be saliva secreted from salivary glands into the mouth, and is preferably saliva that can be non-invasively collected from a subject.
  • primer is a nucleic acid sequence having a short free 3' hydroxyl group, capable of forming base pairs with a complementary template, and serving as a starting point for template strand copying. refers to a short nucleic acid sequence that Primers can initiate DNA synthesis in the presence of a reagent for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. PCR conditions and lengths of sense and antisense primers can be appropriately selected according to techniques known in the art.
  • oligonucleotides used as primers may also contain nucleotide analogs, such as phosphorothioates, alkylphosphorothioates or peptide nucleic acids, or Intercalating agents may be included.
  • the present invention is Porphyromonas gingivalis in a sample isolated from the subject ( Porphyromonas gingivalis ), Tannerella Forsythia ( Tannerella forsythia ), Prevotella intermedia ( Prevotella intermedia ), Porphyromonas endodontalis ( Porphyromonas endodontalis ) and Filipactor alosis ( Filifactor alocis ) Real-time polymerase chain reaction (Real-time PCR) performing quantitative analysis on one or more bacteria selected from the group consisting of; And information necessary for diagnosing periodontal disease comprising the step of comparing the percentage of bacteria obtained through the real-time PCR quantitative analysis with those selected from the group consisting of normal people, gingivitis, moderate periodontitis, and patients with deep periodontitis.
  • the present invention is Porphyromonas gingivalis in a sample isolated from the subject ( Porphyromonas gingivalis ), Tannerella Forsythia ( Tannerella forsythia ), Treponema denticola ( Treponema denticola ), Prevotella intermedia ( Prevotella intermedia ), Porphyromonas Endodonthalis ( Porphyromonas endodontalis ), Filipactor allosis ( Filifactor alocis ), Fusobacterium nucleatum ( Fusobacterium nucleatum ) and Parvimonas Micra ( Parvimonas micra ) Performing real-time polymerase chain reaction (Real-time PCR) quantitative analysis on one or more bacteria selected from the group consisting of; And information necessary for diagnosing periodontal disease, comprising comparing the number of bacteria obtained through the real-time PCR quantitative analysis with those selected from the group consisting of normal people, gingivitis, moderate period
  • Real-time PCR real-time polymerase chain reaction
  • the sample may be saliva.
  • the real-time polymerase chain reaction (Real-time PCR) quantitative analysis is a primer set represented by SEQ ID NOs: 1 and 2, a primer set represented by SEQ ID NOs: 3 and 4, a primer set represented by SEQ ID NOs: 5 and 6, SEQ ID NO: Primer sets represented by 7 and 8, primer sets represented by SEQ ID NOs: 9 and 10, primer sets represented by SEQ ID NOs: 11 and 12, primer sets represented by SEQ ID NOs: 13 and 14, and SEQ ID NOs: 15 and 16
  • the expression level of the target gene can be measured using one or more primer sets selected from the group consisting of primer sets.
  • the primer set may be a primer set for real-time polymerase chain reaction (Real-time PCR), but is not limited thereto.
  • Real-time PCR real-time polymerase chain reaction
  • the target genes of the primer sets represented by SEQ ID NOs: 1 and 2 are Porphyromonas gingivalis ( Porphyromonas gingivalis rpoB, the target gene of the primer set represented by SEQ ID NOs: 3 and 4 is Tannerella forsythia rpoB, the target gene of the primer set represented by SEQ ID NOs: 5 and 6 is Prevotella intermedia ( Prevotella intermedia ) rpoB, the target gene of the primer set represented by SEQ ID NOs: 7 and 8 is Porphyromonas endodonthalis ( Porphyromonas endodontalis ) rpoB, target genes of the primer set represented by SEQ ID NOs: 9 and 10 are 16s rRNA of Filifactor alocis , and target genes of the primer set represented by SEQ ID NOs: 11 and 12 are Treponema denticola ( Treponema denticola ) rpoB, SEQ ID NOs:
  • the comparing step is based on the cutoff value of bacterial % obtained through real-time polymerase chain reaction (Real-time PCR) quantitative analysis, based on the target gene of the primer set represented by SEQ ID NOs: 1 and 2
  • the cutoff value is 0.0034 or more
  • the cutoff value of the target gene of the primer set represented by SEQ ID NOs: 3 and 4 is 0.0021 or more
  • the cutoff value of the target gene of the primer set represented by SEQ ID NOs: 5 and 6 is 0.0013 or more
  • SEQ ID NO: 7 and 6 When the cutoff value of the target gene of the primer set represented by 8 is 0.0062 or more, or the cutoff value of the target gene of the primer set represented by SEQ ID NOs: 9 and 10 is 0.0004 or more, healthy gums and periodontal disease can be distinguished.
  • the comparing step is based on the cutoff value of the number of bacteria obtained through real-time polymerase chain reaction (Real-time PCR) quantitative analysis, based on the target gene of the primer set represented by SEQ ID NOs: 1 and 2
  • the cutoff value of 5 or more, the cutoff value of the target gene of the primer set represented by SEQ ID NOs: 3 and 4 is 10 or more, the cutoff value of the target gene of the primer set represented by SEQ ID NOs: 5 and 6 is 1 or more, SEQ ID NO: 7 and
  • the cutoff value of the target gene of the primer set represented by 8 is 9 or more, the cutoff value of the target gene of the primer set represented by SEQ ID NOs: 9 and 10 is 5 or more, and the target gene of the primer set represented by SEQ ID NOs: 11 and 12
  • the cutoff value is 11 or more, or the cutoff value of the target gene of the primer set represented by SEQ ID NOs: 15 and 16 is 94 or more, healthy gums and periodontal disease can be distinguished
  • the cutoff value for distinguishing between healthy gums and periodontal disease distinguishes healthy gums from gums with periodontal disease based on the percentage of bacteria or the number of bacteria compared to the total bacteria of saliva bacteria collected from the mouth of the person in question from the saliva sample.
  • the AUC value is derived from the cutoff value of bacteria having an AUC value of 0.7 or more.
  • Gingivitis is defined as periodontitis accompanied by alveolar bone resorption.
  • the comparing step is based on the cutoff value of bacterial % obtained through real-time polymerase chain reaction (Real-time PCR) quantitative analysis, target genes of the primer sets represented by SEQ ID NOs: 1 and 2
  • the cutoff value of is 0.0586 or more, or the cutoff value of the target gene of the primer set represented by SEQ ID NOs: 3 and 4 is 0.0048 or more, healthy gums/gingivitis and periodontitis can be distinguished.
  • the comparing step is based on the cutoff value of the number of bacteria obtained through real-time PCR quantitative analysis, the target gene of the primer set represented by SEQ ID NOs: 1 and 2
  • the cutoff value of 33 or more, the cutoff value of the target gene of the primer set represented by SEQ ID NOS: 3 and 4 is 7 or more
  • the cutoff value of the target gene of the primer set represented by SEQ ID NOS: 5 and 6 is 3 or more
  • the cutoff value of the target gene of the primer set represented by 8 is 29 or more
  • the cutoff value of the target gene of the primer set represented by SEQ ID NOs: 9 and 10 is 16 or more
  • the target gene of the primer set represented by SEQ ID NOs: 11 and 12 When the cutoff value of 11 or more, the cutoff value of the target gene of the primer set represented by SEQ ID NOs: 13 and 14 is 529 or more, or the cutoff value of the target gene of the primer set represented by SEQ ID NOs: 15 and 16 is
  • the cut-off value for distinguishing between healthy gums/gingivitis and periodontitis is the condition of the gums without resorption of alveolar bone based on the percentage of bacteria or the number of bacteria compared to the total bacteria of salivary bacteria collected from the oral cavity of the person in question from the saliva sample.
  • the cutoff value of bacteria may be derived from the cutoff value of bacteria with an AUC value of 0.7 or more.
  • the comparing step is based on the cutoff value of bacterial % obtained through real-time polymerase chain reaction (Real-time PCR) quantitative analysis, target genes of the primer sets represented by SEQ ID NOs: 1 and 2
  • the cutoff value of 0.1122 or more, the cutoff value of the target gene of the primer set represented by SEQ ID NOs: 3 and 4 is 0.0297 or more, or the cutoff value of the target gene of the primer set represented by SEQ ID NOs: 5 and 6 is 0.0037 or more, healthy Gum/gingivitis/moderate periodontitis and deep periodontitis can be distinguished.
  • the comparing step is based on the cutoff value of the number of bacteria obtained through real-time PCR quantitative analysis, the target gene of the primer set represented by SEQ ID NOs: 1 and 2
  • the cutoff value of 838 or more, the cutoff value of the target gene of the primer set represented by SEQ ID NOS: 3 and 4 is 213 or more, the cutoff value of the target gene of the primer set represented by SEQ ID NOS: 5 and 6 is 18 or more, SEQ ID NO: 9
  • the cutoff value of the target gene of the primer set represented by 10 is 159 or more, or the cutoff value of the target gene of the primer set represented by SEQ ID NOs: 13 and 14 is 529 or more, healthy gums / gingivitis / moderate periodontitis and deep periodontitis can be distinguished.
  • the cut-off value for distinguishing between healthy gums/gingivitis/moderate periodontitis and deep periodontitis is healthy gums, gingivitis gums based on the number of bacteria or % of salivary bacteria collected from the oral cavity of the person from the saliva sample relative to the total bacteria. And after obtaining the ROC curve and AUC value to distinguish moderate periodontitis gums from severe periodontitis gums, it was derived from the cut-off value of bacteria with an AUC value of 0.7 or more. It may be periodontitis with bone resorption and furcation lesions due to alveolar bone resorption in the posterior teeth.
  • the present invention is Porphyromonas gingivalis in a sample isolated from the subject ( Porphyromonas gingivalis ), Tannerella Forsythia ( Tannerella forsythia ), Treponema denticola ( Treponema denticola ), Prevotella intermedia ( Prevotella intermedia ), Porphyromonas Endodonthalis ( Porphyromonas endodontalis ), Filipactor allosis ( Filifactor alocis ), Fusobacterium nucleatum ( Fusobacterium nucleatum ) and Parvimonas Micra ( Parvimonas micra ) Performing 16S rRNA sequencing analysis on one or more bacteria selected from the group consisting of; And comparing the percentage of bacteria obtained through the 16S rRNA sequencing analysis with those selected from the group consisting of normal people, gingivitis, moderate periodontitis and deep periodontitis patients.
  • the cutoff value is 0.5276 for Porphyromonas gingivalis , 0.0352 for Tannerella forsythia , and 0.0352 for Treponema denticola ) is 0.0044, Prevotella intermedia is 0.0079, Porphyromonas endodontalis is 0.1662, Filifactor alocis is 0.0141, Fusobacterium nucleatum ( Fusobacterium nucleatum ) is 1.4741, Parvimonas micra is 0.1722, or Rothia Dentocariosa ( Rothia dentocariosa ) is a value of 0.6632, and healthy gums and periodontal disease can be distinguished when it is above the corresponding cutoff value.
  • the cutoff value is 0.2258 for Porphyromonas gingivalis , 0.0611 for Tannerella forsythia , and 0.0611 for Prevotella intermedia. intermedia ) is 0.1594, Porphyromonas Endodonthalis ( Porphyromonas endodontalis ) is 0.7348, Filifactor alocis is 0.1141, Fusobacterium nucleatum is 1.2996, Parvimonas micra is 0.2103, or Rotia dentocariosa ( Rothia dentocariosa ) has a value of 0.3136, and when it is above the corresponding cutoff value, healthy gums/gingivitis and periodontitis can be distinguished.
  • the cutoff value is 1.4374 for Porphyromonas gingivalis , 0.1443 for Tannerella forsythia , and 0.1443 for Prevotella intermedia. intermedia ) is 0.0294, Porphyromonas Endodonthalis ( Porphyromonas endodontalis ) with a value of 0.7348, Filifactor alocis with a value of 0.1141, or Fusobacterium nucleatum with a value of 1.8720, indicating healthy gums/gingivitis/moderate periodontitis and deep periodontitis when above the corresponding cutoff value. can be distinguished.
  • the cutoff value is the same as described above.
  • the sample may be saliva.
  • RNA is reverse transcribed into complementary DNA (cDNA) using reverse transcriptase, and the target is amplified using a target probe containing a target primer and a label using the cDNA as a template
  • cDNA complementary DNA
  • PCR methods are well known in the art, and commercially available kits may be used.
  • the PCR method may include analyzing a product amplified by PCR. Detection of the amplification product may be performed through capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement. As one of the methods for detecting amplification products, capillary electrophoresis can be performed. Capillary electrophoresis can use, for example, an ABI Sequencer. In addition, gel electrophoresis can be performed, and agarose gel electrophoresis or acrylamide gel electrophoresis can be used for gel electrophoresis depending on the size of the amplification product.
  • the fluorescence measurement method when PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer, the target sequence is labeled with a detectable fluorescent labeling material, and the labeled fluorescence is measured using a fluorescence meter. can do.
  • the radioactive measurement method is to label the amplification product by adding a radioactive isotope such as 32 P or 35 S to the PCR reaction solution during PCR, and then use a radioactive measuring instrument, for example, a Geiger counter or liquid scintillation Radioactivity can be measured using a liquid scintillation counter.
  • the PCR method may include analyzing a nucleotide sequence. Sequence analysis can use all methods known in the art, specifically, but not limited thereto, using an automatic sequencing analyzer, pyrosequencing, PCR-RELP method (restriction fragment length polymorphism), PCR-SSCP method (single strand conformation polymorphism), PCR-SSO method (specific sequence oligonucleotide), ASO (allele specific oligonucleotide) hybridization method combining PCR-SSO method and dot hybridization method, TaqMan-PCR method, MALDI-TOF/MS method, rolling circle amplification (RCA) method, high resolution melting (HRM method), primer extension method, southern blot hybridization method, and dot hybridization method, any one or more selected from known methods may be used.
  • an automatic sequencing analyzer pyrosequencing
  • PCR-RELP method restriction fragment length polymorphism
  • PCR-SSCP method single strand conformation polymorphism
  • the present invention is Porphyromonas gingivalis in a sample isolated from the subject ( Porphyromonas gingivalis ), Tannerella Forsythia ( Tannerella forsythia ), Treponema denticola ( Treponema denticola ), Prevotella intermedia ( Prevotella intermedia ), Porphyromonas Endodonthalis ( Porphyromonas endodontalis ), Filifactor alocis ( Filifactor alocis ), Fusobacterium nucleatum ( Fusobacterium nucleatum ), Parvimonas Micra ( Parvimonas micra ) and Rothia dentocariosa ( Rothia dentocariosa ) Performing 16S rRNA sequencing analysis on one or more bacteria selected from the group consisting of; And each value is calculated by substituting the percentage of bacteria obtained through the 16S rRNA sequencing analysis into the following equations 1-1 to 1-4, and the gum corresponding to the gum
  • Equation of gingivitis gums -1.9748 + (-0.01137)x( P. gingivalis %) + (-0.96119)x( T. forsythia %) + (0.003346)x( T. denticola %) + (-0.25645)x( F alocis %) + (0.568488)x( P. intermedia %) + (0.42965)x ( P. endodontalis %) + (0.200952)x ( F. nucleatum %) + (0.519156)x( R. dentocariosa %) + (-0.52904)x( P. micra %)
  • Equation of moderate periodontitis gingiva -1.9075 + (0.007068)x( P. gingivalis %) + (1.141592)x( T. forsythia %) + (-0.2656)x( T. denticola %) + (-1.46872)x( F alocis %) + (0.715288)x( P. intermedia %) + (0.77475)x ( P. endodontalis %) + (-0.04183)x ( F. nucleatum %) + (0.169773) x ( R. dentocariosa %) + (1.520645)x( P. micra %)
  • the present invention is Porphyromonas gingivalis in a sample isolated from the subject ( Porphyromonas gingivalis ), Tannerella Forsythia ( Tannerella forsythia ), Treponema denticola ( Treponema denticola ), Prevotella intermedia ( Prevotella intermedia ), Porphyromonas Endodonthalis ( Porphyromonas endodontalis ), Filifactor alocis ( Filifactor alocis ), Fusobacterium nucleatum ( Fusobacterium nucleatum ), Parvimonas Micra ( Parvimonas micra ) and Rothia dentocariosa ( Rothia dentocariosa ) Performing real-time polymerase chain reaction (Real-time PCR) quantitative analysis on one or more bacteria selected from the group consisting of; And each value is calculated by substituting the percentage of bacteria obtained through the real-time PCR quantitative analysis into the following equations 2-1
  • Equation of moderate periodontitis gingiva -2.18027+ (-0.14454)x( P. gingivalis %) + (12.54856)x( T. forsythia %) + (0.984939)x( T. denticola %) + (-4.98201)x( F alocis %) + (-6.46175)x( P. intermedia %) + (3.469277)x ( P. endodontalis %) + (1.076105)x ( F. nucleatum %) + (-1.23915)x( R. dentocariosa %) + (0.468393)x( P. micra %)
  • the present invention is Porphyromonas gingivalis in a sample isolated from the subject ( Porphyromonas gingivalis ), Tannerella Forsythia ( Tannerella forsythia ), Treponema denticola ( Treponema denticola ), Prevotella intermedia ( Prevotella intermedia ), Porphyromonas Endodonthalis ( Porphyromonas endodontalis ), Filifactor alocis ( Filifactor alocis ), Fusobacterium nucleatum ( Fusobacterium nucleatum ), Parvimonas Micra ( Parvimonas micra ) and Rothia dentocariosa ( Rothia dentocariosa ) Performing real-time polymerase chain reaction (Real-time PCR) quantitative analysis on one or more bacteria selected from the group consisting of; And each value is calculated by substituting the number of bacteria obtained through the real-time PCR quantitative analysis into the following equations 3-1
  • gingivitis gums -1.62912 + (-0.76032)x(number of P. gingivalis ) + (50.56172)x(number of T. forsythia ) + (-65.645)x(number of T. denticola ) + (-7.76311)x( F number of alocis ) + (-47.378)x(number of P. intermedia ) + (45.18652)x(number of P. endodontalis ) + (26.42666)x( number of F. nucleatum number) + (47.9035)x( R. dentocariosa number) + (5.394878) x (number of P. micra )
  • the present invention is a primer set represented by SEQ ID NOs: 1 and 2, a primer set represented by SEQ ID NOs: 3 and 4, a primer set represented by SEQ ID NOs: 5 and 6, a primer set represented by SEQ ID NOs: 7 and 8, and a sequence Any one or more selected from the group consisting of a primer set represented by Nos. 9 and 10, a primer set represented by SEQ ID NOs: 11 and 12, a primer set represented by SEQ ID NOs: 13 and 14, and a primer set represented by SEQ ID NOs: 15 and 16
  • a composition for diagnosing periodontal disease comprising a primer set.
  • the present invention provides a periodontal disease diagnostic kit comprising the composition for diagnosing periodontal disease.
  • the kit of the present invention may include conventional components included in PCR kits.
  • Conventional components included in the kit may be a reaction buffer, a polymerase, a cofactor such as dNTP (dATP, dCTP, dGTP and dTTP) and Mg 2+ .
  • dNTP dATP, dCTP, dGTP and dTTP
  • Mg 2+ Mg 2+ .
  • a variety of DNA polymerases can be used for the amplification step, including the Klenow fragment of E. coli DNA polymerase I, thermostable DNA polymerase and bacteriophage T7 DNA polymerase.
  • the polymerase is a thermostable DNA polymerase obtainable from a variety of bacterial species. Most of these polymerases can be isolated from the bacteria themselves or purchased commercially.
  • the study subjects were recruited from patients who visited the periodontal department of Ajou University Dental Hospital for examination, scaling, and periodontal treatment. This study was conducted after obtaining informed consent from all study subjects. Those with orthodontic appliances in the mouth, those with other systemic medical history that could affect the progression of periodontitis, those with smoking habits, and those who took antibiotics and antibacterial anti-inflammatory drugs for 3 months before saliva collection were excluded from the study.
  • Periodontitis was diagnosed through periodontal pocket measurement performed before periodontal treatment.
  • the classification of the patient's health and the severity of the disease was classified based on a new classification standard based on the results of a conference jointly held by the European Periodontological Society and the American Periodontal Society in 2017 (J Periodontol. 2018 Jun;89 Suppl 1:S159 -S172.).
  • Healthy gums Subjects with a periodontal pocket depth of 3 mm or less and a bleeding on probing (BOP) index of less than 10%
  • Gingivitis gums Subjects with a periodontal pocket depth of 3 mm or less and a BOP index of 10% or more at probing
  • Severe periodontitis Gums Subjects with a periodontal pocket depth of more than 6 mm locally, vertical bone resorption of more than 3 mm, and posterior furcation lesions (Class II or III)
  • the clinical indicators of periodontitis of the study subjects were evaluated: plaque index, gingivitis index, periodontal pocket depth, clinical adhesion level, modified fissure bleeding index, and degree of bleeding during probing.
  • Gingival Index The degree of gingival inflammation
  • Score 1 Mild inflammation accompanied by changes in gingival color and appearance, but without bleeding on probing
  • Score 2 Moderate inflammation with bleeding on probing accompanied by changes in gingival color and appearance
  • a total of 6 areas (buccal mesial surface, buccal center, buccal distal surface, lingual mesial surface, lingual center), 3 areas each from the outside and inside of one tooth , lingual distal plane) measured from the gingival margin to the base of the periodontal pocket.
  • the higher the value the more severe the edema, destruction of the alveolar bone, and periodontitis.
  • Saliva was collected by gargling with 10 ml of physiological saline for 1 minute and spitting out non-irritating saliva collection method.
  • EzBioCloud https://www.ezbiocloud.net/apps
  • a web-based analysis platform provided by ChunLab
  • taxonomic profiles of bacterial communities in healthy, gingivitis, moderate periodontitis, and severe periodontitis groups were analyzed and compared.
  • the number of operational taxonomic units (OTUs), Chao1 index, Shannon index, and phylogenetic diversity in each group were compared using the Wilcoxon rank-sum test.
  • the Kruskal-Wallis H test was performed to evaluate the differences in the dominant OTUs in each group.
  • OTU is a taxonomic unit that groups similar sequences among species in DNA sequencing results
  • the Chao1 and Shannon indices are indicators to evaluate the abundance and evenness of a population, respectively.
  • Figure 1 shows the result of confirming the difference in diversity (diversity) for each group by 16S rRNA sequencing analysis.
  • Alpha diversity analyzes the distribution of various microorganisms in a sample, which is the average species diversity in a local-scale place or habitat.
  • the proposed ACE, Chao1, Jackknife, No. of identified species, NPShannon, Shannon, Simpson, and Phylogenetic diversity are all items showing alpha diversity.
  • the diversity increased as the severity of the disease increased, and it was confirmed that various types of bacteria inhabited in the diseased group than in the healthy group.
  • Figure 2 shows the results of comparing the clusters at the phylum level for each group by 16S rRNA sequencing analysis. It was confirmed that Bacteroidetes, Fusobacteria, and Spirochaetes increased significantly as the severity of the disease increased, and Actinobacteria were present in high concentrations in healthy gums and It was confirmed that the depth decreased significantly as the depth increased. In addition, it was confirmed that Firmicutes and Proteobacteria were present in high concentrations in saliva and decreased as the severity of the disease increased.
  • 3 shows the results of comparing the clusters at the genera and species level for each group by 16S rRNA sequencing analysis.
  • 15 genera including Porphyromonas, Fusobacterium, and Treponema were present at a high rate, and in the healthy group, Rothia and Lautropia ( Lautropia) and Actinomyces, etc., were present in high proportions.
  • Porphyromonas gingivalis Porphyromonas gingivalis
  • 6 species including the Streptococcus sinensis group were present at a high rate.
  • the bacterial species marked with a group at the end of the name at the species level means that it may include similar 16S rRNA bacterial species other than the corresponding bacterial species.
  • the 16S rRNA sequencing technique reads only a part of the entire nucleotide sequence and judges the degree of similarity with the nucleotide sequence on the public database based on 97%, so it is sometimes judged to be the same as bacteria other than specific bacteria.
  • the F. nucleatum group may include all of the following bacteria: F. nucleatum subspecies nucleatum , vincentii , polymorphum , fusiforme , animalis , F. simiae , F. canifelinum , F. hwasookii
  • Porphyromonas gingivalis Porphyromonas gingivalis
  • Tannerella forsythia Tannerella forsythia
  • Treponema denticola Treponema denticola
  • Prevotella intermedia Prevotella intermedia
  • Porphyromonas Endodontalis Porphyromonas endodontalis
  • Phillipactor Allosis Filifactor alocis
  • Fusobacterium nucleatum Fusobacterium nucleatum
  • Parvimonas Micra Parvimonas micra
  • Rothia dentocariosa Rothia dentocariosa
  • the bacterium P. gingivalis was described in a paper (J Microbiol. 2011 Apr;49(2):315-9.), and the bacterium P. intermedia was described in a paper (International Journal of Oral Biology Vol.40 No.4 pp.205-210) and five types of bacteria ( T. forsythia, T. denticola , P. endodontalis , F. nuclatum , R. dentocariosa ), a thesis (Arch Microbiol. 2013 Jul;195(7): 473-82.), the number of bacteria was calculated based on the formula described. For the other two types of bacteria ( F. alocis , P. micra ), refer to the thesis (Sci Rep.
  • Each real-time PCR was performed in a total volume of 20 ⁇ L containing 2 ⁇ L of genomic DNA, 2 ⁇ L of forward and reverse primers, 6 ⁇ L of sterilized DNase-RNase-free water, and 10 ⁇ L of TOP realTM qPCR 2X PreMIX. . All data were analyzed using TOP realTM qPCR 2X PreMIX (SYBR Green) kit (Enzynomics, Daejeon, Korea) and ExicyclerTM 96 V4 Real-Time Quantitative Thermal Block (Bioneer, Daejeon, Korea). Primer sequences used in the experiment are shown in Table 2 below.
  • gingivalis rpoB Pg-F GGA AGA GAA GAC CGT AGC ACA AGG A One Pg-R: GAG TAG GCG AAA CGT CCA TCA GGT C 2 T. forsythia rpoB Tf-F2: GGATTGACCACCGGCGAAGACA 3 Tf-R2: CGGACACGACGGTTACTCAAATGG 4 P.
  • intermedia rpoB RTPi-F ACC CAT TGG CAG AAG TTA CG 5
  • RTPi-R TCA ATA GGA CAC AAG CGA CCA TAG 6 P.
  • endodontalis rpoB Pe-F1 AGCAGAGTTCCGTCGTCGTATTCA 7
  • Pe-R1 GCGCCCTGCCATCTTGTCTC 8
  • F. alocis 16S rRNA F AACCGGAGCAAAACTGAGAA 9
  • R CCGTCCGCCACTAACTTCTA 10
  • denticola rpoB Td-F2 CGGGCGTGCATCTTGTCGTCTAC 11
  • Td-R2 CTTAACCGGCCGCCTCTTTGAA 12
  • nucleatum rpoB Fn-F1 ACCTAAGGGAGAAACAGAACCA 13
  • Fn-R1 CCTGCCTTTAATTCATCTCCAT 14 P.
  • micra fusA (single copy) F: AGAATCAATTTCTCAAGGTGCAG 15 R: CAATGTCCATATTGTCCACTACCA 16 R. dentocariosa rpoB Rd-F8: CTGGGCAAAGCGTCTGGAAAAC 17 Rd-R8: GAAATCACGAATCGGGGAAATCTC 18 Universal primer 16S rRNA F: GTG STG CAY GGY TGT CGT CA 19 R: ACG TCR TCC MCA CCT TCC TC 20
  • the Kruskal-Wallis H test was performed to analyze whether the results of real-time PCR for each of the nine bacteria showed differences in each group. To confirm the correlation between 16S rRNA sequencing (%) and real-time PCR (%) of specific bacteria, Spearman's correlation coefficient analysis was performed.
  • ROC Receiveiver Operating Characteristic
  • FIGS. 4 and 5 show the results of comparing the % and count of specific bacteria for each group based on the results of real-time PCR quantitative analysis of specific bacteria.
  • Graph values of FIGS. 4 and 5 are shown in Tables 3 and 4 below, respectively.
  • pReg gives values of 0, 1, 2, and 3 from the healthy group to the severe periodontitis group, respectively, and indicates a p-value indicating whether the average increases or decreases. That is, the significance of the p value means that there is a difference between the groups, and the significance of the pReg means that there is a trend of increasing or decreasing the value as progressing to the stages of the healthy group, gingivitis group, moderate periodontitis group, and deep periodontitis group. .
  • the results of 16S rRNA sequencing of F. nucleatum are expressed as groups and subspecies of F. nucleatum include nucleatum , vincentii , polymorphum , fusiforme , animalis, F. Simiae, and F. nucleatum . canifelinum, F. hwasookii .
  • the F. nucleatum species-specific primers used in real-time PCR since they are primers that detect both F. nucleatum and F. simiae , not F. nucleatum alone, there is no correlation between the results of the two experiments. can be low
  • Periodontal disease is largely divided into gingivitis and periodontitis.
  • gingivitis refers to a condition of the gums without destruction of the alveolar bone around the teeth
  • periodontitis refers to a condition of the gums accompanied by destruction of the alveolar bone.
  • concentration standard can be used as a concentration that distinguishes between health and disease.
  • gingivitis It is a way to distinguish healthy gums and gingivitis from periodontitis (moderate or severe). In other words, by distinguishing between a state without bone loss and a state with bone loss, gingivitis can be reversibly restored to its original state by treatment, but periodontitis is a state accompanied by irreversible destruction and cannot be returned to its original state by treatment.
  • Deep periodontitis is a severe condition in which loss of alveolar bone is severe in part and tooth loss is a concern, so it is essential to distinguish it clinically. If an on-site diagnostic kit is developed based on the concentration of the bacteria, it can be said that the concentration standard indicates the condition in which a visit to the dentist is required.
  • P. gingivalis when the concentration of the bacteria in saliva was measured by real-time PCR using the primers in Table 2, if the percentage of P. gingivalis relative to the total bacteria was 0.1122% or less, it was healthy gums, gingivitis gums, or moderate periodontitis gums. If it exceeds 0.1122%, severe periodontitis is present in the gums, and the diagnosis of severe periodontitis can be an indicator of when to visit the dentist at an early stage. It is a method to distinguish healthy gums without destruction of gingivitis and moderate periodontitis from severe periodontitis requiring immediate treatment accompanied by severe destruction of alveolar bone. Its sensitivity is 0.76 and its specificity is 0.72.
  • the severity of periodontal disease in the oral cavity where the sample was collected can be classified into healthy gums, gingivitis, moderate periodontitis, and deep periodontitis by the formula calculated below.
  • the gum disease severity corresponding to the expression showing the highest value can be determined as the disease severity of the oral cavity.
  • Saliva samples from 8 people with healthy gums, 16 people with gingival marginal gums, 19 people with moderate periodontitis, and 29 people with severe periodontitis were analyzed for each of the nine bacteria obtained by realtimePCR. When % for is applied to the expression
  • Saliva samples from 8 people with healthy gums, 16 people with gingival marginal gums, 19 people with moderate periodontitis, and 29 people with severe periodontitis were analyzed for each of the nine bacteria obtained by realtimePCR.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

본 발명은 타액 내 세균의 군집을 이용한 치주질환 진단용 조성물 및 이의 용도에 관한 것으로, 본 발명에서는 타액 내 분포하는 세균의 군집과 상대적인 비율을 이용하여 치주질환의 심도를 구별하고자 한다. 치은염, 중등도 치주염, 심도 치주염에 따라 세균 군집 특성에서 차이를 나타내는 바, 이를 활용한 치주질환의 심도를 구별하는 기준을 제시한다. 더불어 시료 채취에 있어 타액은 안전하고, 접근이 쉽고 빠르며, 비침습적인 방법으로 환자의 불편을 최소화할 수 있는 이점이 있고, 타액을 이용한 진단키트의 개발은 환자 스스로 치주질환의 진전 정도를 파악하는데 도움을 줄 수 있다.

Description

타액 내 세균의 군집을 이용한 치주질환 진단용 조성물 및 이의 용도
본 발명은 타액 내 세균의 군집을 이용한 치주질환 진단용 조성물 및 이의 용도에 관한 것이다.
치주질환은 환자가 느끼지 못하는 사이에 염증이 진행되어 치아 주변 조직의 심각한 파괴를 야기하는 만성질환으로, 대부분의 경우 세균의 침투와 세균에 대한 숙주의 면역반응의 결과로 나타나는 질환으로 치아상실의 주요 원인이 된다.
치주염은 치아 지지조직에서 발생하는 염증으로 결합조직의 점진적 파괴와 더불어 치조골 및 치주인대의 소실을 수반한다. 치주 파괴의 속도, 질환의 활성과 숙주의 저항에 따라서 다양한 종류의 세균들이 연관되어 있다. 당뇨병과 같은 전신질환은 치주염을 악화시키며, 약물복용, 흡연, 임신, 비만 및 과도한 스트레스 등의 숙주요인도 위험요소로 작용한다. 이 외에도 급속히 진행되는 치주염인 경우는 유전적 요인이 크게 작용하는 것으로 알려져 있다.
현재 치주염을 진단하기 위해 사용하는 진단 방법 중 하나인, 열구 내로 탐침을 넣어 치주낭 깊이를 측정하는 방법은 치조골 소실이 얼마나 되었는지 확인하고 이와 함께 치은의 염증 정도를 확인하는 방법으로서, 치주염 진단의 가장 기본이 되는 진단 방식이다. 하지만 치주낭 깊이의 측정법은 치아의 형태 및 치은 염증의 정도에 따라 오차를 발생시킬 수 있다.
방사선 사진상의 골소실을 확인하는 방법은 치주낭 탐침과 더불어 가장 기본적인 치주염 진단 방법이다. 하지만 이는 2차원 영상으로 치아의 근원심면의 치조골 소실은 보여줄 수 있으나 치아와 상이 겹치는 치아의 협면 설면의 치조골 소실은 보여주지 못하는 한계를 가진다. 또한, 상기 치주낭 깊이와 방사선 사진 상의 골소실을 확인하는 방법은 진단시점 이전의 치주염 진행에 따른 치조골 소실 (부착 소실)의 결과만을 보여주는 것으로 현재 질환의 활성화 상태를 보여줄 수 없는 문제가 있다.
한편, 진단 시점의 치은에 염증이 있는지의 여부를 보여주는 현재 가장 유용한 방법으로서, 치아와 치은 사이의 열구 내로 탐침을 넣어 출혈이 있는지의 여부를 확인하는 방법이 있다. 하지만, 이 방법은 거짓 양성을 보일 가능성이 높다는 한계를 내포하고 있다(탐침시 출혈이 있다고 하더라도 실제 치은에 염증이 없을 수 있음).
종래의 이러한 방법들은 진료실에서 전문가에 의해 측정되는 방법이므로 번거롭고 시간과 비용이 많이 소요되며, 방법에 따라서는 환자의 통증을 필요적으로 수반한다.
치아 상실의 주요 원인인 치주질환은 세균감염이 일차적 원인이다. 따라서 구강 내 세균의 수를 줄이고 조기 진단을 통한 적극적인 치료가 중요하다. 이에 따라 자각 증상이 늦은 치주질환에 대하여 현재의 잇몸 상태가 염증이 없는 건강한 상태인지 치주염 상태인지를 손쉽게 진단할 수 있는 방법 개발의 필요성이 대두된다.
즉, 환자 스스로 잇몸 질환의 유무를 확인한 후 치료를 받아야 하는 시기를 조기에 결정할 수 있다면 치료 시간과 비용을 획기적으로 절감할 수 있을 것이다.
본 발명의 목적은 치주질환 진단용 조성물을 제공하는 데에 있다.
본 발명의 다른 목적은 치주질환 진단용 키트를 제공하는 데에 있다.
본 발명의 또 다른 목적은 치주질환 진단에 필요한 정보를 제공하는 방법을 제공하는 데에 있다.
상기 목적을 달성하기 위하여, 본 발명은 개체로부터 분리된 시료에서 포르피로모나스 긴기발리스(Porphyromonas gingivalis), 타네렐라 포르시시아(Tannerella forsythia), 프레보텔라 인터메디아(Prevotella intermedia), 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis) 및 필리팍터 알로시스(Filifactor alocis)로 이루어진 군에서 선택된 하나 이상의 세균을 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 수행하는 단계; 및 상기 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균%를 정상인, 치은염, 중증도 치주염 및 심도 치주염 환자로 이루어진 군에서 선택된 그것과 비교하는 단계를 포함하는 치주질환 진단에 필요한 정보를 제공하는 방법을 제공한다.
또한, 본 발명은 개체로부터 분리된 시료에서 포르피로모나스 긴기발리스(Porphyromonas gingivalis), 타네렐라 포르시시아(Tannerella forsythia), 트레포네마 덴티콜라(Treponema denticola), 프레보텔라 인터메디아(Prevotella intermedia), 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis), 필리팍터 알로시스(Filifactor alocis), 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum) 및 파르비모나스 미크라(Parvimonas micra)로 이루어진 군에서 선택된 하나 이상의 세균을 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 수행하는 단계; 및 상기 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균 수를 정상인, 치은염, 중증도 치주염 및 심도 치주염 환자로 이루어진 군에서 선택된 그것과 비교하는 단계를 포함하는 치주질환 진단에 필요한 정보를 제공하는 방법을 제공한다.
또한, 본 발명은 개체로부터 분리된 시료에서 포르피로모나스 긴기발리스(Porphyromonas gingivalis), 타네렐라 포르시시아(Tannerella forsythia), 트레포네마 덴티콜라(Treponema denticola), 프레보텔라 인터메디아(Prevotella intermedia), 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis), 필리팍터 알로시스(Filifactor alocis), 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum) 및 파르비모나스 미크라(Parvimonas micra)로 이루어진 군에서 선택된 하나 이상의 세균을 16S rRNA 시퀀싱 분석을 수행하는 단계; 및 상기 16S rRNA 시퀀싱 분석을 통해 얻은 세균%를 정상인, 치은염, 중증도 치주염 및 심도 치주염 환자로 이루어진 군에서 선택된 그것과 비교하는 단계를 포함하는 치주질환 진단에 필요한 정보를 제공하는 방법을 제공한다.
본 발명은 서열번호 1 및 2로 표시되는 프라이머 세트, 서열번호 3 및 4로 표시되는 프라이머 세트, 서열번호 5 및 6으로 표시되는 프라이머 세트, 서열번호 7 및 8로 표시되는 프라이머 세트, 서열번호 9 및 10으로 표시되는 프라이머 세트, 서열번호 11 및 12로 표시되는 프라이머 세트, 서열번호 13 및 14로 표시되는 프라이머 세트 및 서열번호 15 및 16으로 표시되는 프라이머 세트로 이루어진 군에서 선택된 어느 하나 이상의 프라이머 세트를 포함하는 치주질환 진단용 조성물을 제공한다.
또한, 본 발명은 상기 조성물을 포함하는 치주질환 진단 키트를 제공한다.
본 발명에서는 타액 내 분포하는 세균의 군집과 상대적인 비율을 이용하여 치주질환의 심도를 구별하고자 한다. 치은염, 중등도 치주염, 심도 치주염에 따라 세균 군집 특성에서 차이를 나타내는 바, 이를 활용한 치주질환의 심도를 구별하는 기준을 제시한다. 더불어 시료 채취에 있어 타액은 안전하고, 접근이 쉽고 빠르며, 비침습적인 방법으로 환자의 불편을 최소화할 수 있는 이점이 있고, 타액을 이용한 진단키트의 개발은 환자 스스로 치주질환의 진전 정도를 파악하는데 도움을 줄 수 있다.
도 1은 16s rRNA sequencing 분석으로 각 군별 군집의 다양성(diversity)을 비교한 결과이다.
도 2는 16s rRNA sequencing 분석으로 각 군별 문(phylum) 수준에서 군집을 비교한 결과이다.
도 3은 16s rRNA sequencing 분석으로 각 군별 속(genera) 및 종(species) 수준에서 군집을 비교한 결과이다.
도 4는 Real-time PCR 정량 분석으로 각 군별 특정 세균의 %를 비교한 결과이다.
도 5는 Real-time PCR 정량 분석으로 각 군별 특정 세균의 count를 비교한 결과이다.
도 6은 특정 세균의 분포(16s rRNA sequencing%)와 전체 구강의 치주낭 깊이의 합과의 상관관계를 비교한 결과이다.
도 7은 특정 세균의 분포(Real-time PCR%)와 전체 구강의 치주낭 깊이의 합과의 상관관계를 비교한 결과이다.
도 8은 특정 세균의 분포(Real-time PCR count)와 전체 구강의 치주낭 깊이의 합과의 상관관계를 비교한 결과이다.
도 9는 특정 세균의 분포를 16s rRNA sequencing%와 Real-time PCR% 간의 상관관계(spearman의 상관계수)로 비교한 결과이다.
이하, 본 발명을 보다 상세히 설명한다.
본 발명에서 사용된 용어 "치주질환"은 치주염, 치은염 등의 치아 주위 치은(잇몸), 치주인대, 골조직을 포함하는 치주 조직에서 발생한 질환을 포함할 수 있다. 병의 심도에 따라 치은염, 중증도 치주염, 심도 치주염으로 구분된다. 상기 치주질환은 발병 시, 염증이 진행되어 조직이 손상되면서 치주낭이 형성되고, 치주염이 심할수록 치주낭의 깊이가 깊어지게 되는데 치주낭이 깊어지면서 치주인대에 염증이 생기게 되고 최종적으로는 골소실이 유발된다고 알려져 있다.
본 발명에서 사용된 용어 "진단"은 병리 상태의 존재 또는 특징을 확인하는 것을 의미한다. 본 발명의 목적 상, 상기 진단은 치주질환의 발병 여부, 병의 진전 정도 또는 이로 인한 위험 여부를 확인하는 것이다.
본 발명에서 사용된 용어 "시료"는 침샘으로부터 입 안으로 분비되는 타액일 수 있고, 바람직하게는 비침습적으로 대상체로부터 채취 가능한 타액이다.
본 발명에서 사용된 용어 "프라이머"는 짧은 자유 3-말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 상보적인 템플레이트(template)와 염기쌍을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로서 작용하는 짧은 핵산 서열을 말한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응을 위한 시약(즉, DNA 폴리머라제 또는 역전사효소) 및 상이한 4 가지의 뉴클레오사이드 트리포스페이트의 존재 하에서 DNA 합성을 개시할 수 있다. PCR 조건, 센스 및 안티센스 프라이머의 길이는 당업계에 공지된 기술에 따라 적절히 선택될 수 있다.
본 발명에 있어서, 프라이머로서 사용된 올리고뉴클레오티드는 또한 뉴클레오티드 유사체(analogue), 예를들면, 포스포로티오에이트(phosphorothioate), 알킬포스포로티오에이트 또는 펩티드 핵산(peptide nucleic acid)을 포함할 수 있거나 또는 삽입 물질(intercalating agent)을 포함할 수 있다.
이에, 본 발명은 개체로부터 분리된 시료에서 포르피로모나스 긴기발리스(Porphyromonas gingivalis), 타네렐라 포르시시아(Tannerella forsythia), 프레보텔라 인터메디아(Prevotella intermedia), 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis) 및 필리팍터 알로시스(Filifactor alocis)로 이루어진 군에서 선택된 하나 이상의 세균을 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 수행하는 단계; 및 상기 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균%를 정상인, 치은염, 중증도 치주염 및 심도 치주염 환자로 이루어진 군에서 선택된 그것과 비교하는 단계를 포함하는 치주질환 진단에 필요한 정보를 제공하는 방법을 제공한다.
또한, 본 발명은 개체로부터 분리된 시료에서 포르피로모나스 긴기발리스(Porphyromonas gingivalis), 타네렐라 포르시시아(Tannerella forsythia), 트레포네마 덴티콜라(Treponema denticola), 프레보텔라 인터메디아(Prevotella intermedia), 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis), 필리팍터 알로시스(Filifactor alocis), 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum) 및 파르비모나스 미크라(Parvimonas micra)로 이루어진 군에서 선택된 하나 이상의 세균을 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 수행하는 단계; 및 상기 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균 수를 정상인, 치은염, 중증도 치주염 및 심도 치주염 환자로 이루어진 군에서 선택된 그것과 비교하는 단계를 포함하는 치주질환 진단에 필요한 정보를 제공하는 방법을 제공한다.
상기 비교하는 단계는 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균% 또는 세균수를 치주염의 심도를 보여주는 치주낭, 탐침시 출혈의 정도, 치조골의 흡수 정도에 의해 구획된 질환의 심도에 따른 세균%와 세균 수를 통해 설정된 컷오프 값과 비교할 수 있다.
상기 시료는 타액일 수 있다.
상기 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석은 서열번호 1 및 2로 표시되는 프라이머 세트, 서열번호 3 및 4로 표시되는 프라이머 세트, 서열번호 5 및 6으로 표시되는 프라이머 세트, 서열번호 7 및 8로 표시되는 프라이머 세트, 서열번호 9 및 10으로 표시되는 프라이머 세트, 서열번호 11 및 12로 표시되는 프라이머 세트, 서열번호 13 및 14로 표시되는 프라이머 세트 및 서열번호 15 및 16으로 표시되는 프라이머 세트로 이루어진 군에서 선택된 어느 하나 이상의 프라이머 세트를 이용하여 표적 유전자의 발현 수준을 측정할 수 있다.
상기 프라이머 세트는 실시간 중합효소 연쇄반응(Real-time PCR)용 프라이머 세트일 수 있으나, 이에 제한되는 것은 아님을 명시한다.
상기 서열번호 1 및 2로 표시되는 프라이머 세트의 표적 유전자는 포르피로모나스 긴기발리스(Porphyromonas gingivalis)의 rpoB, 서열번호 3 및 4로 표시되는 프라이머 세트의 표적 유전자는 타네렐라 포르시시아(Tannerella forsythia)의 rpoB, 서열번호 5 및 6으로 표시되는 프라이머 세트의 표적 유전자는 프레보텔라 인터메디아(Prevotella intermedia)의 rpoB, 서열번호 7 및 8로 표시되는 프라이머 세트의 표적 유전자는 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis)의 rpoB, 서열번호 9 및 10으로 표시되는 프라이머 세트의 표적 유전자는 필리팍터 알로시스(Filifactor alocis)의 16s rRNA, 서열번호 11 및 12로 표시되는 프라이머 세트의 표적 유전자는 트레포네마 덴티콜라(Treponema denticola)의 rpoB, 서열번호 13 및 14로 표시되는 프라이머 세트의 표적 유전자는 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum)의 rpoB 및 서열번호 15 및 16으로 표시되는 프라이머 세트의 표적 유전자는 파르비모나스 미크라(Parvimonas micra)의 fusA일 수 있다.
일 실시예로서, 상기 비교하는 단계는 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균%의 컷오프 값을 기준으로 하여, 서열번호 1 및 2로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.0034 이상, 서열번호 3 및 4로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.0021 이상, 서열번호 5 및 6으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.0013 이상, 서열번호 7 및 8로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.0062 이상, 또는 서열번호 9 및 10으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.0004 이상일 때, 건강한 잇몸과 치주질환을 구분할 수 있다.
다른 실시예로서, 상기 비교하는 단계는 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균 수의 컷오프 값을 기준으로 하여, 서열번호 1 및 2로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 5 이상, 서열번호 3 및 4로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 10 이상, 서열번호 5 및 6으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 1 이상, 서열번호 7 및 8로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 9 이상, 서열번호 9 및 10으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 5 이상, 서열번호 11 및 12로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 11 이상, 또는 서열번호 15 및 16으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 94 이상일 때, 건강한 잇몸과 치주질환을 구분할 수 있다.
건강한 잇몸과 치주질환을 구분할 수 있는 상기 컷오프 값은 타액 시료로부터 해당 사람의 구강에서 채취된 타액 세균의 전체 세균 대비 해당 세균의 % 또는 세균의 수를 근거로 건강한 잇몸과 치주질환이 있는 잇몸을 구별하기 위한 ROC 곡선과 AUC 값을 구한 뒤 AUC 값이 0.7 이상인 세균들의 컷오프 값에서 비롯된 것이며, 상기 치주질환은 개개 치아의 치주낭 깊이가 3mm 이하이고 전체 치열의 탐침시 출혈의 정도가 10% 이상인 대상자로 정의되는 치은염과 치조골의 흡수가 동반되는 치주염을 의미한다.
또다른 실시예로서, 상기 비교하는 단계는 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균%의 컷오프 값을 기준으로 하여, 서열번호 1 및 2로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.0586 이상, 또는 서열번호 3 및 4로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.0048 이상일 때, 건강한 잇몸/치은염과 치주염을 구분할 수 있다.
또다른 실시예로서, 상기 비교하는 단계는 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균 수의 컷오프 값을 기준으로 하여, 서열번호 1 및 2로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 33 이상, 서열번호 3 및 4로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 7 이상, 서열번호 5 및 6으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 3 이상, 서열번호 7 및 8로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 29 이상, 서열번호 9 및 10으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 16 이상, 서열번호 11 및 12로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 11 이상, 서열번호 13 및 14로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 529 이상, 또는 서열번호 15 및 16으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 233 이상일 때, 건강한 잇몸/치은염과 치주염을 구분할 수 있다.
건강한 잇몸/치은염과 치주염을 구분할 수 있는 상기 컷오프 값은 타액 시료로부터 해당 사람의 구강에서 채취된 타액 세균의 전체 세균 대비 해당 세균의 % 또는 세균의 수를 근거로 치조골의 흡수를 동반하지 않은 잇몸 상태인 건강한 잇몸과 치은염 잇몸을 치조골의 흡수를 동반하는 치주염이 있는 잇몸을 구별하기 위한 ROC 곡선과 AUC 값을 구한 뒤 AUC 값이 0.7 이상인 세균들의 컷오프 값에서 비롯된 것일 수 있다.
또다른 실시예로서, 상기 비교하는 단계는 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균%의 컷오프 값을 기준으로 하여, 서열번호 1 및 2로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.1122 이상, 서열번호 3 및 4로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.0297 이상, 또는 서열번호 5 및 6으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.0037 이상일 때, 건강한 잇몸/치은염/중등도 치주염과 심도 치주염을 구분할 수 있다.
또다른 실시예로서, 상기 비교하는 단계는 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균 수의 컷오프 값을 기준으로 하여, 서열번호 1 및 2로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 838 이상, 서열번호 3 및 4로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 213 이상, 서열번호 5 및 6으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 18 이상, 서열번호 9 및 10으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 159 이상, 또는 서열번호 13 및 14로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 529 이상일 때, 건강한 잇몸/치은염/중등도 치주염과 심도 치주염을 구분할 수 있다.
건강한 잇몸/치은염/중등도 치주염과 심도 치주염을 구분할 수 있는 상기 컷오프 값은 타액 시료로부터 해당 사람의 구강에서 채취된 타액 세균의 전체 세균 대비 해당 세균의 % 또는 세균의 수를 근거로 건강한 잇몸, 치은염 잇몸 및 중등도 치주염 잇몸을 심한 치주염 잇몸과 구별하기 위한 ROC 곡선과 AUC 값을 구한 뒤 AUC 값이 0.7 이상인 세균들의 컷오프 값에서 비롯된 것이며, 심한 치주염은 국소적으로 치주낭 깊이가 6mm 이상인 치주낭을 보이고 3mm 이상의 수직골 흡수를 보이며 구치부의 치조골 흡수로 인한 이개부 병변을 갖는 치주염일 수 있다.
또한, 본 발명은 개체로부터 분리된 시료에서 포르피로모나스 긴기발리스(Porphyromonas gingivalis), 타네렐라 포르시시아(Tannerella forsythia), 트레포네마 덴티콜라(Treponema denticola), 프레보텔라 인터메디아(Prevotella intermedia), 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis), 필리팍터 알로시스(Filifactor alocis), 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum) 및 파르비모나스 미크라(Parvimonas micra)로 이루어진 군에서 선택된 하나 이상의 세균을 16S rRNA 시퀀싱 분석을 수행하는 단계; 및 상기 16S rRNA 시퀀싱 분석을 통해 얻은 세균%를 정상인, 치은염, 중증도 치주염 및 심도 치주염 환자로 이루어진 군에서 선택된 그것과 비교하는 단계를 포함하는 치주질환 진단에 필요한 정보를 제공하는 방법을 제공한다.
일 실시예로서, 상기 컷오프 값은 포르피로모나스 긴기발리스(Porphyromonas gingivalis)는 0.5276, 타네렐라 포르시시아(Tannerella forsythia)는 0.0352, 트레포네마 덴티콜라(Treponema denticola)는 0.0044, 프레보텔라 인터메디아(Prevotella intermedia)는 0.0079, 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis)는 0.1662, 필리팍터 알로시스(Filifactor alocis)는 0.0141, 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum)은 1.4741, 파르비모나스 미크라(Parvimonas micra)는 0.1722, 또는 로티아 덴토카리오사(Rothia dentocariosa)은 0.6632의 값으로, 해당 컷오프 값 이상일 때 건강한 잇몸과 치주질환을 구분할 수 있다.
다른 실시예로서, 상기 컷오프 값은 포르피로모나스 긴기발리스(Porphyromonas gingivalis)는 0.2258, 타네렐라 포르시시아(Tannerella forsythia)는 0.0611, 프레보텔라 인터메디아(Prevotella intermedia)는 0.1594, 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis)는 0.7348, 필리팍터 알로시스(Filifactor alocis)는 0.1141, 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum)은 1.2996, 파르비모나스 미크라(Parvimonas micra)는 0.2103, 또는 로티아 덴토카리오사(Rothia dentocariosa)는 0.3136의 값으로, 해당 컷오프 값 이상일 때 건강한 잇몸/치은염과 치주염을 구분할 수 있다.
또다른 실시예로서, 상기 컷오프 값은 포르피로모나스 긴기발리스(Porphyromonas gingivalis)는 1.4374, 타네렐라 포르시시아(Tannerella forsythia)는 0.1443, 프레보텔라 인터메디아(Prevotella intermedia)는 0.0294, 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis)는 0.7348, 필리팍터 알로시스(Filifactor alocis)는 0.1141, 또는 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum)은 1.8720의 값으로, 해당 컷오프 값 이상일 때 건강한 잇몸/치은염/중등도 치주염과 심도 치주염을 구분할 수 있다.
상기 컷오프 값은 앞서 설명한 바와 동일한다.
상기 시료는 타액일 수 있다.
상기 실시간 중합효소 연쇄반응은, 역전사효소를 이용하여 RNA를 상보적인 DNA(cDNA)로 역전사 시킨 후에 만들어진 cDNA를 주형(template)으로하여 타겟 프라이머와 표지를 포함하는 타겟 프로브를 이용해 타겟을 증폭함과 동시에 증폭된 타겟에 타겟 프로프의 표지에서 발생하는 신호를 정량적으로 검출해 내는 분자생물학적 중합방법이다. 이러한 PCR 방법은 당업계에 잘 알려져 있으며, 상업적으로 이용가능한 키트를 이용할 수도 있다.
상기 PCR 방법은 PCR로 증폭된 산물을 분석하는 단계를 포함할 수 있다. 상기 증폭 산물의 검출은 모세관 전기영동, DNA 칩, 젤 전기영동, 방사성 측정, 형광 측정 또는 인광 측정을 통해 수행될 수 있다. 증폭 산물을 검출하는 방법 중의 하나로서, 모세관 전기영동을 수행할 수 있다. 모세관 전기영동은 예를 들면, ABI Sequencer를 이용할 수 있다. 또한, 젤 전기영동을 수행할 수 있으며, 젤 전기영동은 증폭 산물의 크기에 따라 아가로스 젤 전기영동 또는 아크릴아미드 젤 전기영동을 이용할 수 있다. 또한, 형광 측정 방법은 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 PCR을 수행하면 표적 서열이 검출 가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사성 측정 방법은 PCR 수행 시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 방사성 측정기구, 예를 들면, 가이거 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사성을 측정할 수 있다.
상기 PCR 방법은 염기서열을 분석하는 단계를 포함할 수 있다. 서열분석은 당업계에 공지된 방법을 모두 이용할 수 있으며, 구체적으로는 이에 제한되는 것은 아니나, 자동염기서열분석기를 사용하거나, 파이로시퀀싱(pyrosequencing), PCR-RELP법(restriction fragment length polymorphism), PCR-SSCP법(single strand conformation polymorphism), PCR-SSO법(specific sequence oligonucleotide), PCR-SSO법과 도트 하이브리드화법을 조합한 ASO(allele specific oligonucleotide) 하이브리드화법, TaqMan-PCR법, MALDI-TOF/MS법, RCA법(rolling circle amplification), HRM법(high resolution melting), 프라이머 신장법, 서던 블롯 하이브리드화법 및 도트 하이브리드화법 등의 공지의 방법 중 선택된 어느 하나 이상을 사용할 수 있다.
또한, 본 발명은 개체로부터 분리된 시료에서 포르피로모나스 긴기발리스(Porphyromonas gingivalis), 타네렐라 포르시시아(Tannerella forsythia), 트레포네마 덴티콜라(Treponema denticola), 프레보텔라 인터메디아(Prevotella intermedia), 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis), 필리팍터 알로시스(Filifactor alocis), 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum), 파르비모나스 미크라(Parvimonas micra) 및 로티아 덴토카리오사(Rothia dentocariosa)로 이루어진 군에서 선택된 하나 이상의 세균을 16S rRNA 시퀀싱 분석을 수행하는 단계; 및 상기 16S rRNA 시퀀싱 분석을 통해 얻은 세균%를 하기 수학식 1-1 내지 수학식 1-4의 수학식에 대입하여 각각의 값을 산출하고, 이러한 값 중 가장 높은 값을 보이는 식에 해당하는 잇몸 질환 심도를 해당 치아의 질환 심도로 판단하는 단계를 포함하는 치주질환 진단에 필요한 정보를 제공하는 방법을 제공한다:
[수학식 1-1]
건강한 잇몸의 식 = -3.52072 + (-0.02639)x(P. gingivalis %) + (0.839493)x(T. forsythia %) + (0.316224)x(T. denticola %) + (-0.98641)x(F. alocis %) + (0.646425)x(P. intermedia %) + (0.087085)x(P. endodontalis %) + (-0.08749)x(F. nucleatum %) + (1.391072)x(R. dentocariosa %) + (0.39933)x(P. micra %)
[수학식 1-2]
치은염 잇몸의 식 = -1.9748 + (-0.01137)x(P. gingivalis %) + (-0.96119)x(T. forsythia %) + (0.003346)x(T. denticola %) + (-0.25645)x(F. alocis %) + (0.568488)x(P. intermedia %) + (0.42965)x(P. endodontalis %) + (0.200952)x(F. nucleatum %) + (0.519156)x(R. dentocariosa %) + (-0.52904)x(P. micra %)
[수학식 1-3]
중등도 치주염 잇몸의 식 = -1.9075 + (0.007068)x(P. gingivalis %) + (1.141592)x(T. forsythia %) + (-0.2656)x(T. denticola %) + (-1.46872)x(F. alocis %) + (0.715288)x(P. intermedia %) + (0.77475)x(P. endodontalis %) + (-0.04183)x(F. nucleatum %) + (0.169773)x(R. dentocariosa %) + (1.520645)x(P. micra %)
[수학식 1-4]
심도 치주염 잇몸의 식 = -3.24579+ (0.296464)x(P. gingivalis %) + (-0.1594)x(T. forsythia %) + (-2.53253)x(T. denticola %) + (-0.11511)x(F. alocis %) + (1.83945)x(P. intermedia %) + (1.407898)x(P. endodontalis %) + (0.248094)x(F. nucleatum %) + (0.300277)x(R. dentocariosa %) + (-0.74747)x(P. micra %)
또한, 본 발명은 개체로부터 분리된 시료에서 포르피로모나스 긴기발리스(Porphyromonas gingivalis), 타네렐라 포르시시아(Tannerella forsythia), 트레포네마 덴티콜라(Treponema denticola), 프레보텔라 인터메디아(Prevotella intermedia), 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis), 필리팍터 알로시스(Filifactor alocis), 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum), 파르비모나스 미크라(Parvimonas micra) 및 로티아 덴토카리오사(Rothia dentocariosa)로 이루어진 군에서 선택된 하나 이상의 세균을 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 수행하는 단계; 및 상기 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균%를 하기 수학식 2-1 내지 수학식 2-4의 수학식에 대입하여 각각의 값을 산출하고, 이러한 값 중 가장 높은 값을 보이는 식에 해당하는 잇몸 질환 심도를 해당 치아의 질환 심도로 판단하는 단계를 포함하는 치주질환 진단에 필요한 정보를 제공하는 방법을 제공한다:
[수학식 2-1]
건강한 잇몸의 식 = -3.60258+ (-0.051)x(P. gingivalis %) + (3.457539)x(T. forsythia %) + (-10.0746)x(T. denticola %) + (-1.25858)x(F. alocis %) + (-1.7208)x(P. intermedia %) + (-8.5888)x(P. endodontalis %) + (1.976449)x(F. nucleatum %) + (5.348558)x(R. dentocariosa %) + (0.063522)x(P. micra %)
[수학식 2-2]
치은염 잇몸의 식 = -1.8156+ (-0.00877)x(P. gingivalis %) + (5.590504)x(T. forsythia %) + (-4.75712)x(T. denticola %) + (-1.4037)x(F. alocis %) + (-4.88342)x(P. intermedia %) + (5.253621)x(P. endodontalis %) + (0.331331)x(F. nucleatum %) + (3.02979)x(R. dentocariosa %) + (0.152853)x(P. micra %)
[수학식 2-3]
중등도 치주염 잇몸의 식 = -2.18027+ (-0.14454)x(P. gingivalis %) + (12.54856)x(T. forsythia %) + (0.984939)x(T. denticola %) + (-4.98201)x(F. alocis %) + (-6.46175)x(P. intermedia %) + (3.469277)x(P. endodontalis %) + (1.076105)x(F. nucleatum %) + (-1.23915)x(R. dentocariosa %) + (0.468393)x(P. micra %)
[수학식 2-4]
심도 치주염 잇몸의 식 = -1.84498 + (-0.00562)x(P. gingivalis %) + (13.76487)x(T. forsythia %) + (2.553924)x(T. denticola %) + (0.054474)x(F. alocis %) + (7.646578)x(P. intermedia %) + (4.540174)x(P. endodontalis %) + (-0.48413)x(F. nucleatum %) + (-0.52195)x(R. dentocariosa %) + (0.21387)x(P. micra %)
또한, 본 발명은 개체로부터 분리된 시료에서 포르피로모나스 긴기발리스(Porphyromonas gingivalis), 타네렐라 포르시시아(Tannerella forsythia), 트레포네마 덴티콜라(Treponema denticola), 프레보텔라 인터메디아(Prevotella intermedia), 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis), 필리팍터 알로시스(Filifactor alocis), 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum), 파르비모나스 미크라(Parvimonas micra) 및 로티아 덴토카리오사(Rothia dentocariosa)로 이루어진 군에서 선택된 하나 이상의 세균을 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 수행하는 단계; 및 상기 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균 수를 하기 수학식 3-1 내지 수학식 3-4의 수학식에 대입하여 각각의 값을 산출하고, 이러한 값 중 가장 높은 값을 보이는 식에 해당하는 잇몸 질환 심도를 해당 치아의 질환 심도로 판단하는 단계를 포함하는 치주질환 진단에 필요한 정보를 제공하는 방법을 제공한다:
[수학식 3-1]
건강한 잇몸의 식 = -2.30476 + (-1.49793)x(P. gingivalis 수) + (42.24108)x(T. forsythia 수) + (-51.0784)x(T. denticola 수) + (0.039624)x(F. alocis 수) + (-26.4862)x(P. intermedia 수) + (-90.5605)x(P. endodontalis 수) + (39.28479)x(F. nucleatum 수) + (17.65564)x(R. dentocariosa 수) + (4.278468)x(P. micra 수)
[수학식 3-2]
치은염 잇몸의 식 = -1.62912 + (-0.76032)x(P. gingivalis 수) + (50.56172)x(T. forsythia 수) + (-65.645)x(T. denticola 수) + (-7.76311)x(F. alocis 수) + (-47.378)x(P. intermedia 수) + (45.18652)x(P. endodontalis 수) + (26.42666)x(F. nucleatum 수) + (47.9035)x(R. dentocariosa 수) + (5.394878)x(P. micra 수)
[수학식 3-3]
중등도 치주염 잇몸의 식 = -1.8899 + (-2.13304)x(P. gingivalis 수) + (121.1973)x(T. forsythia 수) + (-123.48)x(T. denticola 수) + (-11.1651)x(F. alocis 수) + (-83.2768)x(P. intermedia 수) + (-64.0856)x(P. endodontalis 수) + (43.52085)x(F. nucleatum 수) + (24.10447)x(R. dentocariosa 수) + (32.03642)x(P. micra 수)
[수학식 3-4]
심도 치주염 잇몸의 식 = -2.79975 + (-0.26374)x(P. gingivalis 수) + (366.5963)x(T. forsythia 수) + (-147.396)x(T. denticola 수) + (39.73937)x(F. alocis 수) + (-140.134)x(P. intermedia 수) + (-102.176)x(P. endodontalis 수) + (55.15521)x(F. nucleatum 수) + (123.9248)x(R. dentocariosa 수) + (29.36675)x(P. micra 수)
또한, 본 발명은 서열번호 1 및 2로 표시되는 프라이머 세트, 서열번호 3 및 4로 표시되는 프라이머 세트, 서열번호 5 및 6으로 표시되는 프라이머 세트, 서열번호 7 및 8로 표시되는 프라이머 세트, 서열번호 9 및 10으로 표시되는 프라이머 세트, 서열번호 11 및 12로 표시되는 프라이머 세트, 서열번호 13 및 14로 표시되는 프라이머 세트 및 서열번호 15 및 16으로 표시되는 프라이머 세트로 이루어진 군에서 선택된 어느 하나 이상의 프라이머 세트를 포함하는 치주질환 진단용 조성물을 제공한다.
또한, 본 발명은 상기 치주질환 진단용 조성물을 포함하는 치주질환 진단 키트를 제공한다.
본 발명의 키트에는 상기의 프라이머 세트 이외에, PCR 키트에 포함되는 통상적인 구성성분을 포함할 수 있다. 상기 키트에 포함되는 통상적인 구성성분은 반응완충액, 중합효소, dNTP(dATP, dCTP, dGTP 및 dTTP) 및 Mg2 +와 같은 조인자 등일 수 있다. 다양한 DNA 중합효소가 증폭 단계에 이용될 수 있으며, E. coli DNA 중합 효소 I의 클레나우 단편, 열안정성 DNA 중합효소 및 박테리오파아지 T7 DNA 중합효소를 포함한다. 바람직하게는, 중합효소는 다양한 박테리아 종으로부터 얻을 수 있는 열안정성 DNA 중합효소이다. 상기 중합효소 대부분은 박테리아 그 자체로부터 분리될 수 있고 또는 상업적으로 구입할 수 있다.
이하에서는 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예 1: 연구 대상자 선정
검진 및 스케일링, 치주 치료를 위하여 아주대학교 치과병원 치주과에 내원한 환자를 대상으로 연구 대상자를 모집하였다. 본 연구는 모든 연구 대상자로부터 사전 동의를 얻은 후 수행되었다. 구강에 교정기구를 가지고 있거나 치주염의 진행에 영향을 줄 수 있는 다른 전신 병력이 있거나 흡연 습관이 있는 사람, 타액 채취 전 3개월 동안 항생제 및 항균소염제를 복용한 사람들은 연구 대상자에서 제외하였다.
치주염은 치주 치료 전 시행되는 치주낭 측정검사를 통해 진단하였다. 환자의 건강함과 질환의 심도 분류는 2017년 유럽 치주 학회와 미국 치주 학회가 공동으로 개최한 학회의 결과를 기반으로 새로운 분류 기준에 근거하여 분류하였다(J Periodontol. 2018 Jun;89 Suppl 1:S159-S172.).
건강한 잇몸, 치은염 잇몸, 중등도 치주염 잇몸, 심도 치주염 잇몸의 정의는 하기와 같다.
① 건강한(Health) 잇몸: 치주낭 깊이가 3 mm 이하이고, 탐침 시 출혈(BOP; Bleeding On Probing) 지수가 10% 미만인 대상자
② 치은염(Gingivitis) 잇몸: 치주낭 깊이가 3 mm 이하이고, 탐치 시 BOP 지수가 10% 이상인 대상자
③ 중등도 치주염(Moderate periodontitis) 잇몸: 치주낭 깊이가 3-4 mm, 최대 치주낭 깊이가 5 mm 이하이고, 대부분 수평골 흡수를 보이며 치주염에 의한 발치를 경험하지 않은 대상자(치조골의 흡수가 coronal third (15~33%))
④ 심도 치주염(Severe periodontitis) 잇몸: 국소적으로 치주낭 깊이가 6 mm 이상이고, 3 mm 이상의 수직골 흡수를 보이며 구치부 이개부 병변(Class II or III)을 보이는 대상자
실시예 2: 임상 지표 평가
1) 임상 지표
연구 대상자들의 치주염 임상 지표는 전 구강에 대한 치태 지수, 치은염 지수, 치주낭 깊이, 임상부착수준, 변형열구출혈지수, 탐침 시 출혈의 정도로 평가하였다.
① 치태 지수(PI: Plaque Index): 치면 세균막 침착 정도
Score 0 = 치태 없음
Score 1 = probe에 의해 긁히는 정도의 치태
Score 2 = 눈으로 보이는 분명한 치태
Score 3 = 풍부한 치태
② 치은염 지수(GI; Gingival Index): 치은의 염증 정도
Score 0 = 염증 없음
Score 1 = 치은의 색과 외형 변화가 동반되지만 탐침 시 출혈이 없는 가벼운 염증
Score 2 = 치은의 색과 외형 변화가 동반되면서 탐침 시 출혈이 동반되는 중등도 염증
Score 3 = 자연적인 풍부한 출혈이 동반되는 심한 염증
③ 치주낭 깊이(PD; Probing pocket Depth)
치주 탐침(Periodontal probe, Hu-Friedy PCP 10, USA)을 이용하여 한 치아의 바깥쪽과 안쪽에서 각각 3부위씩 총 6부위(협측근심면, 협측중앙, 협측원심면, 설측근심면, 설측 중앙, 설측원심면)에 대해 치은연에서 치주낭의 기저부까지의 길이를 측정한 값으로 수치가 클수록 부종, 치조골 파괴, 치주염이 심하다는 것을 의미한다.
④ 임상부착수준(CAL; Clinical Attachment Level)
치주 탐침을 이용하여 한 치아의 바깥쪽과 안쪽에서 각각 3부위씩 총 6부위에 대해 백악법랑경계부(Cementoenamel junction)에서 치주낭의 기저부까지의 길이를 측정한 값으로, 치은퇴축(gingival recession)이 있는 경우에는 치주낭 깊이에 치은퇴축 양을 합한 값이며, 치주낭 깊이가 갖는 의미와 마찬가지로 수치가 클수록 치주염의 정도가 심하다는 것을 의미한다.
⑤ 변형열구출혈지수(mSBI; modified Sulcus Bleeding Index)
종래 방법(Mombelli et al. 1987)을 근거로 치주 탐침을 이용하여 한 치아의 바깥쪽과 안쪽에서 각각 3부위씩 총 6부위에 대해 변형 열구 내 출혈 지수를 평가한 값으로 수치가 클수록 치주염의 정도가 심하다는 것을 의미한다.
Score 0 = 출혈이 없는 경우
Score 1 = 점상의 출혈이 있는 경우
Score 2 = 출혈이 치은연을 따라 넓게 번지는 경우
Score 3 = 흘러나오는 정도의 풍부한 출혈이 있는 경우
⑥ 탐침 시 출혈(BOP; Bleeding On Probing)
치주 탐침을 이용하여 한 치아의 바깥쪽과 안쪽에서 각각 3부위씩 총 6부위에 대해 출혈 여부를 기록하고 출혈이 보이는 곳의 백분율을 구한 뒤 전체 치아의 평균을 보여주는 수치로 수치가 클수록 구강 안 치은의 염증이 심하다는 것을 의미한다.
2) 임상 지표 평가
연구 대상자는 하기 표 1에 나타낸 바와 같이, 4개의 군으로 나누어 임상 지표를 평가하였다. 잇몸이 건강한 군 8명, 치은염 군 16명, 중등도 치주염 군 19명, 심도 치주염 군 29명을 대상으로 수행하였고 제시한 임상 지표에서 군별 유의한 차이를 확인하였다.
Figure PCTKR2022015871-appb-img-000001
실시예 3: 타액 채취
모든 연구 대상자는 타액 채취 전 1시간 동안 음식물 섭취, 칫솔질, 입안 헹굼(구강세정제)을 금지하도록 권고하였다. 10 ml의 생리식염수로 1분 동안 가글링 후 뱉는 비자극성 타액 채취 방식으로 타액을 채취하였다.
실시예 4: 16S rRNA　sequencing (Metataxonomics) 분석
채취한 타액 총 10ml 중 8ml을 취하여 원심분리하였다. 침전물 전체(세균 포함)의 DNA 추출 및 염기서열 분석(16S rRNA Sequencing)은 ㈜천랩에서 수행하였다. DNA 추출 후 세균의 16S rRNA의 V3와 V4 영역을 타겟으로 하는 프라이머(primer)를 사용하여 V3 및 V4 영역을 증폭시켰고, PCR 산물은 Illumina MiSeq sequencing system으로 분석하였다.
천랩에서 제공하는 웹 기반 분석 플랫폼인 EzBioCloud (https://www.ezbiocloud.net/apps)를 이용하여 건강한 군, 치은염 군, 중등도 치주염 군, 심도 치주염 군에서 세균 군집의 분류학적 프로파일을 분석 및 비교하였다. Wilcoxon rank-sum test를 이용하여 각 군별 OTU(Operational Taxonomic Unit) 수, Chao1 지수, Shannon 지수 및 계통발생학적 다양성을 비교하였다. 또한 각 군에서 우세한 OTU의 차이를 평가하기 위해 Kruskal-Wallis H test를 수행하였다. OTU는 DNA 시퀀싱 결과에서 유사한 시퀀스들을 종들끼리 묶는 분류 단위이며, Chao1 및 Shannon 지수는 각각 군집의 풍부도 및 균등도를 평가하는 지표이다.
도 1은 16S rRNA Sequencing 분석으로 각 군별 다양성(diversity)의 차이를 확인한 결과이다. 다양성 분석을 진행할 때는 크게 세 가지의 분석(Alpha diversity, Beta diversity, Gamma diversity)이 있는데, 이 중 Alpha diversity는 시료에 존재하는 다양한 미생물의 분포를 분석하는 것으로 국지적 규모의 장소 또는 서식지에서 평균 종 다양성을 의미한다. 제시한 ACE, Chao1, Jackknife, No. of identified species, NPShannon, Shannon, Simpson, Phylogenetic diversity 모두 alpha diversity를 보여주는 항목들이다. 결과에서 볼 수 있듯이, 질환의 심도가 증가할수록 다양성이 증가하는 것을 확인하였고, 건강한 군보다 질환 군에서 다양한 종류의 세균이 서식함을 확인할 수 있었다.
도 2는 16S rRNA Sequencing 분석으로 각 군별 문(phylum) 수준에서 군집을 비교한 결과이다. 의간균(Bacteroidetes), 후소박테리움균(Fusobacteria), 스피로헤타균(Spirochaetes)은 질환의 심도가 증가할수록 유의하게 증가하는 것을 확인하였고, 방선균(Actinobacteria)은 건강한 잇몸에서 높은 농도로 존재하고 질환의 심도가 증가할수록 유의하게 감소하는 것을 확인하였다. 또한, 타액에서 후벽균(Firmicutes)과 프로테오박테리아(Proteobacteria)가 높은 농도로 존재하였고 질환의 심도가 증가할수록 감소하는 경향을 확인하였다.
도 3은 16S rRNA Sequencing 분석으로 각 군별 속(genera) 및 종(species) 수준에서 군집을 비교한 결과이다. 질환 군에서는 포르피로모나스(Porphyromonas), 푸소박테리움(Fusobacterium), 트레포네마(Treponema) 등을 포함하여 15개의 속이 높은 비율로 존재하였고, 건강한 군에서는 로티아(Rothia), 라우트로피아(Lautropia), 방선균(Actinomyces) 등을 포함하여 5개의 속이 높은 비율로 존재하였다.
또한, 질환 군에서는 포르피로모나스 긴기발리스(Porphyromonas gingivalis) 등을 포함하여 29개의 종이 높은 비율로 존재하였고, 건강한 군에서는 스트렙토코커스 시넨시스(Streptococcus sinensis group) 등을 포함하여 6개의 종이 높은 비율로 존재하였다. 이때 종 수준에서 이름 끝에 group으로 표기된 세균 종은 해당 세균 종 이외의 유사한 16S rRNA 세균 종을 포함할 수 있음을 의미한다. 해당 16S rRNA sequencing 기법은 전체 염기서열의 일부만을 판독하여 공개된 데이터베이스 상의 염기서열과의 유사도를 97% 기준으로 판단하기 때문에 특정 세균 이외의 세균과 동일하게 판단되는 경우가 있는데 이런 경우에는 가장 대표적인 세균 종 이름 끝에 group으로 표기한다. 예를 들어, F. nucleatum group의 경우는 하기 세균들을 모두 포함할 수 있다: F. nucleatum subspecies nucleatum, vincentii, polymorphum, fusiforme, animalis, F. simiae , F . canifelinum , F . hwasookii
실시예 4: Real-time(RT) PCR을 이용한 특정 세균의 정량 분석
16S rRNA Sequencing 결과를 바탕으로 각 군별로 통계적 유의성을 나타내는 하기 9종의 세균을 선정하였고, 각 종 특이적인 프라이머를 사용하여 Real-time PCR로 정량 분석을 수행하였다:
포르피로모나스 긴기발리스(Porphyromonas gingivalis), 타네렐라 포르시시아(Tannerella forsythia), 트레포네마 덴티콜라(Treponema denticola), 프레보텔라 인터메디아(Prevotella intermedia), 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis), 필리팍터 알로시스(Filifactor alocis), 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum), 파르비모나스 미크라(Parvimonas micra), 로티아 덴토카리오사(Rothia dentocariosa)
타액 200 μL을 취하여 원심분리하였고, 침전물 전체의 DNA 추출은 (주)천랩에서 수행되었다. 전체 세균의 수(count)는 16S rRNA를 타겟으로 하는 유니버셜 프라이머(FEMS Immunol Med Microbiol. 2003 Oct 24;39(1):81-6.)를 이용하여 relatime-PCR로 분석하였다. 16s rRNA의 한 세균 내의 복제 수(copy number)를 고려하여 Real-time PCR의 결과 값을 6으로 나누어 1개의 세균으로 간주하였다.
9종의 세균 중 세균 P. gingivalis는 논문 (J Microbiol. 2011 Apr;49(2):315-9.)에 기재된 식, 세균 P. intermedia는 논문 (International Journal of Oral Biology Vol.40 No.4 pp.205-210)에 기재된 식 및 5종의 세균(T. forsythia, T. denticola , P. endodontalis , F. nuclatum , R. dentocariosa)에 대해서는 논문 (Arch Microbiol. 2013 Jul;195(7):473-82.)에 기재된 식을 근거로 하여 세균 수를 계산하였다. 그 외 2종의 세균(F. alocis , P. micra)에 대해서는 논문 (Sci Rep. 2016 Sep 19;6:33638., Front Microbiol. 2017 Aug 9;8:1443.)을 참조하여, 실제 세균의 DNA를 추출한 후 농도별 Real-time PCR을 수행하여 표준 곡선(standard curve)을 설정하였고, 이를 통해 세균 농도 관련 Real-time PCR 값에 대한 식(일차방정식)을 구하여 확인하고자 하는 타액 시료의 Real-time PCR을 수행한 후 이 식을 기준으로 시료 내 세균을 정량분석하였다. 계산식은 동일 실험을 독립적으로 3회 반복한 평균 값으로 획득하였다.
각 Real-time PCR은 2 μL의 genomic DNA, 2 μL의 정방향 및 역방향 프라이머, 6 μL의 멸균된 DNase-RNase-free water, 10 μL의 TOP realTM qPCR 2X PreMIX를 포함하는 총 부피 20 μL로 수행하였다. 모든 데이터는 TOP realTM qPCR 2X PreMIX(SYBR Green) kit(Enzynomics, Daejeon, Korea) 및 ExicyclerTM 96 V4 Real-Time Quantitative Thermal Block(Bioneer, Daejeon, Korea)을 사용하여 분석하였다. 실험에 사용된 프라이머 서열은 하기 표 2에 나타내었다.
박테리아 프라이머 타겟 시퀀스(5' to 3') 서열번호
P. gingivalis rpoB Pg-F: GGA AGA GAA GAC CGT AGC ACA AGG A 1
Pg-R: GAG TAG GCG AAA CGT CCA TCA GGT C 2
T. forsythia rpoB Tf-F2: GGATTGACCACCGGCGAAGACA 3
Tf-R2: CGGACACGACGGTTACTCAAATGG 4
P. intermedia rpoB RTPi-F: ACC CAT TGG CAG AAG TTA CG 5
RTPi-R: TCA ATA GGA CAC AAG CGA CCA TAG 6
P. endodontalis rpoB Pe-F1: AGCAGAGTTCCGTCGTCGTATTCA 7
Pe-R1: GCGCCCTGCCATCTTGTCTC 8
F. alocis 16S rRNA F: AACCGGAGCAAAACTGAGAA 9
R: CCGTCCGCCACTAACTTCTA 10
T. denticola rpoB Td-F2: CGGGCGTGCATCTTGTCGTCTAC 11
Td-R2: CTTAACCGGCCGCCTCTTTGAA 12
F. nucleatum rpoB Fn-F1: ACCTAAGGGAGAAACAGAACCA 13
Fn-R1: CCTGCCTTTAATTCATCTCCAT 14
P. micra fusA
(single copy)		 F: AGAATCAATTTCTCAAGGTGCAG 15
R: CAATGTCCATATTGTCCACTACCA 16
R. dentocariosa rpoB Rd-F8: CTGGGCAAAGCGTCTGGAAAAC 17
Rd-R8: GAAATCACGAATCGGGGAAATCTC 18
Universal primer 16S rRNA F: GTG STG CAY GGY TGT CGT CA 19
R: ACG TCR TCC MCA CCT TCC TC 20
실시예 5: 통계 분석
9종의 세균 각각에 대한 Real-time PCR의 결과가 각 군별로 차이를 보이는지 여부를 분석하기 위해 Kruskal-Wallis H test를 수행하였다. 특정 세균의 16S rRNA Sequencing(%)와 Real-time PCR(%) 간의 상관관계를 확인하기 위해 Spearman의 상관계수 분석을 수행하였다.
치주낭은 한 치아 당 6부위씩 전체 치아에 대해 측정하였고, 이들 전체의 합은 전체 치열(구강)의 치주염의 심도를 반영할 수 있는 근거로 치주낭 깊이의 합과 특정 세균의 농도(16S rRNA sequencing%, Real-time PCR%, Real-time PCR count)와의 상관관계는 단순선형회귀분석으로 평가하였다(%: 전체 세균 대비 해당 세균이 차지하는 비율, count: 채취한 전체 타액 (10ml) 중 15 ul 안에 든 세균 수)
질환의 심도를 구별하는 각 세균의 최적의 컷오프 값(cut-off value)를 구하기 위해 ROC(Receiver Operating. Characteristic) 곡선을 작성하였다. 치주염 심도별 질환의 정도를 구별하는 각 세균의 컷오프 값을 구하고 가장 높은 AUC(Area under the ROC Curve)를 보이는 값에 대해 컷오프 값을 제시하였고, 이때 민감도(sensitivity)와 특이도(specificity)를 제시하였다.
1) 특정 세균의 Real-time PCR 정량 분석 결과
도 4 및 도 5는 특정 세균의 Real-time PCR 정량 분석 결과를 바탕으로 각각 군별 특정 세균 % 및 count를 비교한 결과이다. 도 4 및 도 5의 그래프 값은 각각 하기 표 3 및 표 4에 표시하였다.
%의 결과에 있어서 P. gingivalis , T. forsythia, F. alocis , P. intermedia, P. endodontalis가 심도 치주염에서 높은 농도로 존재하고, R. dentocariosa는 건강한 군에서 높은 농도로 존재하는 것을 확인하였다. count 결과에 있어서 R. dentocariosa를 제외한 나머지 세균들이 질환의 심도가 증가할수록 타액 내에서 유의하게 높은 농도로 존재하는 것을 확인하였다.
참고로 pReg는 건강한 군부터 심도 치주염 군까지 각각 0, 1, 2, 3의 값을 주고 평균이 증가 또는 감소하는지에 대한 p-value를 나타낸다. 즉 p 값에 유의성이 있다는 것은 군간에 차이가 있다는 것이고, pReg에 유의성이 있다는 것은 건강한 군, 치은염 군, 중등도 치주염 군, 심도 치주염 군 단계로 진행되면서 값이 증가 또는 감소하는 추세가 있다는 것을 의미한다.
Figure PCTKR2022015871-appb-img-000002
Figure PCTKR2022015871-appb-img-000003
2) 특정 세균의 분포와 치주낭 깊이의 합과의 상관관계 분석 결과
도 6 내지 도 8은 특정 세균의 분포(16S rRNA Sequencing(%) 및 Real-time PCR(% 또는 count)와 전체 구강 치주낭 깊이의 합과의 상관관계(correlation)를 분석한 것으로 각 그래프의 값은 하기 표 5에 표시하였다.
특정 세균 분포와의 상관관계를 분석함에 있어, 질환의 심도를 구별하는 여러 임상 지표(PD, mSBI, BOP%, CAL, PI, GI 등) 중 치주낭 깊이의 합을 선정한 이유는 치주낭 깊이가 깊을수록 치은연하 세균총의 군집붕괴(Dysbiosis)가 많이 진행되었을 것이고 이러한 치은연하 세균총의 군집붕괴의 결과는 타액에 반영되었을 것으로 추측했기 때문이다. 제시된 표는 세균 농도와 전체 구강 치주낭 깊이의 합과의 상관관계를 보여주는 것으로 R2 값이 클수록 상관성이 높음을 의미한다.
16S rRNA Sequencing(%)의 경우, R. dentocariosa와 음의 상관관계를 나타내었으나 통계학적 유의성은 발견되지 않았고, 나머지 세균에 대해서는 모두 유의성 있는 양의 상관관계를 나타내었다. 즉 전체 치주낭 깊이가 깊을수록 해당 세균의 농도가 높아짐을 반영한다고 할 수 있다.
Real-time PCR(%)의 경우, F. nucleatum , P. micra , R. dentocariosa는 통계학적 유의성 있는 결과를 나타내지 못하였으나 나머지 세균에 대해서는 유의성 있는 양의 상관관계를 나타내었다.
Real-time PCR(count)의 경우, 전체 세균에서 양의 상관관계를 나타내었다.
Figure PCTKR2022015871-appb-img-000004
3) 특정 세균의 16S rRNA Sequencing( % ) 및 Real-time PCR(%)와의 상관관계 분석 결과
16S rRNA sequencing 기법의 경우 전체 염기서열의 일부만을 판독하여 공개된 데이터베이스 상의 염기서열과 97%의 유사도를 보이면 해당 세균으로 판단하기 때문에 상대적으로 정확성에 있어 Real-time PCR보다 낮을 수 있다. 이에, 16S rRNA sequencing (NGS; Next Generation Sequencing) 결과로부터 획득한 전체 세균 대비 해당 세균의 %의 값과 Real-time PCR 결과로부터 획득한 전체 세균 대비 해당 세균의 %간의 상관관계를 분석한 결과를 도 9에 나타내었다.
분석 결과, 모두 통계학적으로 유의성 있는 상관관계는 보여주었으며, 특히 P. gingivalis , P. intermedia의 유의성이 높았고, 상대적으로 F. nucleatum의 유의성이 낮았다. F. nucleatum의 16S rRNA sequencing의 결과는 group으로 표현되어 F. nucleatum subspecies nucleatum, vincentii , polymorphum , fusiforme , animalis, F. Simiae , F . canifelinum , F . hwasookii를 모두 포함하는 것으로 볼 수 있다. Real-time PCR에서 사용된 F. nucleatum의 종 특이적인 프라이머의 경우도 F. nucleatum 단독만의 프라이머가 아니고 F. nucleatum과 F. simiae를 모두 검출하는 프라이머이기 때문에 두 실험방법의 결과간의 상관관계가 낮을 수 있다.
4) 질환의 심도를 구별하기 위한 각 세균의 기준값 설정 및 진단방법
(1) (건강한 잇몸) vs. (치은염, 중등도 치주염, 심도 치주염)
건강한 잇몸과 치주질환(치은염과 치주염)을 구별하는 방법이다. 치주질환은 크게 치은염과 치주염으로 구별되는데, 치은염은 치아 주변 치조골의 파괴를 동반하지 않은 잇몸 상태를 말하고 치주염은 치조골의 파괴를 동반하는 잇몸 상태를 말한다. 이의 농도 기준은 건강과 질환의 유무를 구별하는 농도로 활용될 수 있다.
① AUC 0.7 이상 세균
② 16S rRNA sequencing (%): 전체 세균
③ RT-PCR(%): P. gingivalis , T. forsythia, P. intermedia , P. endodontalis, F. alocis
④ RT-PCR(count): P. gingivalis , T. forsythia, T. denticola , P. intermedia, P. endodontalis, F. alocis, P. micra
(예시) 타액을 이용한 치주염 진단 시 기준이 되는 세균의 농도 및 이의 진단방법
P. gingivalis의 경우 표 2의 프라이머를 사용하여 Real-time PCR로 타액 내 해당 세균의 농도를 측정하였을 때 전체 세균 대비 P. gingivalis의 %가 0.0034% 이하인 경우 건강한 잇몸으로 0.0034% 초과인 경우는 질환(치은염 및 치주염)이 있는 잇몸으로 진단하는 것의 AUC는 0.79로 0.0034%의 기준은 건강한 잇몸과 질환(치은염 및 치주염)을 구별하는 방법이다. 이의 민감도(sensitivity)는 0.83이고 이의 특이도(specificity)는 0.75이다.
Figure PCTKR2022015871-appb-img-000005
(2) (건강한 잇몸, 치은염) vs. (중등도 치주염, 심도 치주염)
건강한 잇몸과 치은염을 치주염(중등도, 심도)과 구별하는 방법이다. 즉 골 소실이 없는 상태와 골 소실이 있는 상태의 구별로 치은염은 치료에 의해 가역적으로 원래 상태로 회복이 가능하나 치주염은 비가역적 파괴를 동반하는 상태로 치료에 의해 원래 상태로 돌아갈 수 없기 때문에 의미가 있다.
① AUC 0.7 이상 세균
② 16S rRNA sequencing (%): P. gingivalis , T. forsythia, P. intermedia , P. endodontalis, F. alocis, F. nucleatum, P. micra, R. dentocariosa
③ RT-PCR(%): P. gingivalis, T. forsythia
④ RT-PCR(count): P. gingivalis , T. forsythia, T. denticola , P. intermedia, P. endodontalis, F. alocis, F. nucleatum, P. micra
(예시) 타액을 이용한 치주염 진단 시 기준이 되는 세균의 농도 및 이의 진단방법
P. gingivalis의 경우 표 2의 프라이머를 사용하여 Real-time PCR로 타액 내 해당 세균의 농도를 측정하였을 때 전체 세균 대비 P. gingivalis의 %가 0.0586% 이하인 경우 건강한 잇몸이거나 치은염 잇몸으로 0.0034% 초과인 경우는 치주염이 있는 잇몸으로 진단하는 것의 AUC는 0.73으로 0.0586%의 기준은 치조골의 파괴가 없는 건강한 잇몸과 치은염 잇몸을 치조골의 파괴를 동반하는 치주염 잇몸으로 구별하는 방법이다. 이의 민감도(sensitivity)는 0.71이고 이의 특이도(specificity)는 0.75이다.
Figure PCTKR2022015871-appb-img-000006
(3) (건강한 잇몸, 치은염, 중등도 치주염) vs. (심도 치주염)
건강한 잇몸, 치은염, 중등도 치주염을 심도 치주염과 구별하는 방법이다. 심도 치주염은 부분적으로 치조골의 소실이 심하여 치아의 상실이 우려되는 정도의 심한 상태이기 때문에 임상적으로 이의 구별은 반드시 필요하다. 만일 해당 세균의 농도 기준으로 현장 진단키트가 개발된다면 이의 농도 기준은 반드시 치과에 내원 해야 하는 상태를 말해준다고 할 수 있다.
① AUC 0.7 이상 세균
② 16S rRNA sequencing(%): P. gingivalis , T. forsythia, P. intermedia , P. endodontalis, F. alocis, F. nucleatum
③ RT-PCR(%): P. gingivalis, T. forsythia, P. intermedia,
④ RT-PCR(count): P. gingivalis , T. forsythia, T. denticola , P. intermedia, F. alocis, F. nucleatum
(예시) 타액을 이용한 치주염 진단 시 기준이 되는 세균의 농도 및 이의 진단방법
P. gingivalis의 경우 표 2의 프라이머를 사용하여 Real-time PCR로 타액 내 해당 세균의 농도를 측정하였을 때 전체 세균 대비 P. gingivalis의 %가 0.1122% 이하인 경우 건강한 잇몸이거나 치은염 잇몸이거나 중등도 치주염 잇몸으로 0.1122% 초과인 경우는 심한 치주염이 있는 잇몸으로 해당 심한 치주염으로의 진단은 조속한 시기에 치과를 방문하는 시기를 알려주는 지표가 될 수 있는 것으로, 진단하는 것의 AUC는 0.74으로 0.1122%의 기준은 치조골의 파괴가 없는 건강한 잇몸과 치은염 잇몸 및 중등도 치주염을 치조골의 심한 파괴를 동반하여 즉각적인 치료가 필요한 심한 치주염 잇몸으로 구별하는 방법이다. 이의 민감도(sensitivity)는 0.76이고 이의 특이도(specificity)는 0.72이다.
Figure PCTKR2022015871-appb-img-000007
5) 16S rRNA Sequencing 분석과 Realtime PCR 분석을 통해 얻어진 수학식을 근거로 타액 시료의 질환 심도 활용 방법
타액 내 9종의 세균 농도를 활용하여 샘플이 채취된 구강의 치주질환 심도를 아래 산출된 식에 의해 건강한 잇몸, 치은염, 중등도 치주염, 심도 치주염으로 구별할 수 있다.
1. 16S rRNA Sequencing의 방법을 통해 구해진 9종 세균의 세균 농도 활용하는 방법
치주질환의 심도에 따른 건강한 잇몸, 치은염 잇몸, 중등도 치주염 잇몸, 심도 치주염 잇몸을 산출하는 4개의 식이 존재한다.
(1) 건강한 잇몸의 식 = -3.52072 + (-0.02639)x(P. gingivalis %) + (0.839493)x(T. forsythia %) + (0.316224)x(T. denticola %) + (-0.98641)x(F. alocis %) + (0.646425)x(P. intermedia %) + (0.087085)x(P. endodontalis %) + (-0.08749)x(F. nucleatum %) + (1.391072)x(R. dentocariosa %) + (0.39933)x(P. micra %)
(2) 치은염 잇몸의 식 = -1.9748 + (-0.01137)x(P. gingivalis %) + (-0.96119)x(T. forsythia %) + (0.003346)x(T. denticola %) + (-0.25645)x(F. alocis %) + (0.568488)x(P. intermedia %) + (0.42965)x(P. endodontalis %) + (0.200952)x(F. nucleatum %) + (0.519156)x(R. dentocariosa %) + (-0.52904)x(P. micra %)
(3) 중등도 치주염 잇몸의 식 = -1.9075 + (0.007068)x(P. gingivalis %) + (1.141592)x(T. forsythia %) + (-0.2656)x(T. denticola %) + (-1.46872)x(F. alocis %) + (0.715288)x(P. intermedia %) + (0.77475)x(P. endodontalis %) + (-0.04183)x(F. nucleatum %) + (0.169773)x(R. dentocariosa %) + (1.520645)x(P. micra %)
(4) 심도 치주염 잇몸의 식 = -3.24579+ (0.296464)x(P. gingivalis %) + (-0.1594)x(T. forsythia %) + (-2.53253)x(T. denticola %) + (-0.11511)x(F. alocis %) + (1.83945)x(P. intermedia %) + (1.407898)x(P. endodontalis %) + (0.248094)x(F. nucleatum %) + (0.300277)x(R. dentocariosa %) + (-0.74747)x(P. micra %)
질환의 심도를 알고자 하는 사람의 타액을 채취하여 여기에 존재하는 세균에 대해 16S rRNA sequencing을 시행한 뒤 9종의 세균에 대한 전체 세균 대비 해당 세균의 농도%를 산출하고, 산출된 9종 세균의 %를 4개의 식에 적용한 뒤 가장 높은 값을 보이는 식에 해당하는 잇몸 질환 심도를 해당 구강의 질환 심도로 판단할 수 있다.
분석을 시행한 건강한 잇몸을 가진 사람 8명, 치은연 잇몸을 가진 사람 16명, 중등도 치주염을 가진 사람 19명, 심한 치주염을 가진 사람 29명의 타액 샘플에 대해 16S rRNA Sequencing을 통해 구해진 각 9종의 세균에 대한 %를 해당 식에 적용하였을 때
건강한 잇몸 8개 샘플 중 2개 (25%) 샘플은 건강한 잇몸으로, 4개 (50%) 샘플에 대해서는 치은염 잇몸으로, 2개 (25%) 샘플에 대해서는 중등도 치주염으로 분석되었다.
치은염 잇몸 16개 샘플 중 8개 (50%) 샘플은 치은염 잇몸으로, 1개 (6.25%) 샘플에 대해서는 건강한 잇몸으로, 5개 (31.25%) 샘플에 대해서는 중등도 치주염 잇몸으로, 2개 (12.50%) 샘플에 대해서는 심도 치주염 잇몸으로 분석되었다.
중등도 치주염 잇몸 19개 샘플 중 13개 (68.42%) 샘플은 중등도 치주염 잇몸으로, 2개 (10.53%) 샘플에 대해서는 치은염 잇몸으로, 4개 (21.05%) 샘플에 대해서는 심도 치주염으로 분석되었다.
심도 치주염 잇몸 29개 샘플 중 21개 (72.41%) 샘플은 심도 치주염 잇몸으로, 1개 (3.45%) 샘플에 대해서는 건강한 잇몸으로, 3개 (10.34%) 샘플에 대해서는 치은염 잇몸으로, 4개 (13.79%) 샘플에 대해서는 중등도 치주염 잇몸으로 분석되었다.
2. RealtimePCR 방법을 통해 구해진 9종 세균의 전체세균 대비 해당 세균의 %를 활용하는 방법
치주질환의 심도에 따른 건강한 잇몸, 치은염 잇몸, 중등도 치주염 잇몸, 심도 치주염 잇몸을 산출하는 4개의 식이 존재한다.
(1) 건강한 잇몸의 식 = -3.60258+ (-0.051)x(P. gingivalis %) + (3.457539)x(T. forsythia %) + (-10.0746)x(T. denticola %) + (-1.25858)x(F. alocis %) + (-1.7208)x(P. intermedia %) + (-8.5888)x(P. endodontalis %) + (1.976449)x(F. nucleatum %) + (5.348558)x(R. dentocariosa %) + (0.063522)x(P. micra %)
(2) 치은염 잇몸의 식 = -1.8156+ (-0.00877)x(P. gingivalis %) + (5.590504)x(T. forsythia %) + (-4.75712)x(T. denticola %) + (-1.4037)x(F. alocis %) + (-4.88342)x(P. intermedia %) + (5.253621)x(P. endodontalis %) + (0.331331)x(F. nucleatum %) + (3.02979)x(R. dentocariosa %) + (0.152853)x(P. micra %)
(3) 중등도 치주염 잇몸의 식 = -2.18027+ (-0.14454)x(P. gingivalis %) + (12.54856)x(T. forsythia %) + (0.984939)x(T. denticola %) + (-4.98201)x(F. alocis %) + (-6.46175)x(P. intermedia %) + (3.469277)x(P. endodontalis %) + (1.076105)x(F. nucleatum %) + (-1.23915)x(R. dentocariosa %) + (0.468393)x(P. micra %)
(4) 심도 치주염 잇몸의 식 = -1.84498 + (-0.00562)x(P. gingivalis %) + (13.76487)x(T. forsythia %) + (2.553924)x(T. denticola %) + (0.054474)x(F. alocis %) + (7.646578)x(P. intermedia %) + (4.540174)x(P. endodontalis %) + (-0.48413)x(F. nucleatum %) + (-0.52195)x(R. dentocariosa %) + (0.21387)x(P. micra %)
질환의 심도를 알고자 하는 사람의 타액을 채취하여 여기에 존재하는 세균에 대해 세균 특이 프라이머를 이용하여 RealtimePCR을 시행한 뒤 9종의 세균에 대한 전체 세균 대비 해당 세균의 농도%를 산출하고, 산출된 9종 세균의 %를 4개의 식에 적용한 뒤 가장 높은 값을 보이는 식에 해당하는 잇몸 질환 심도를 해당 구강의 질환 심도로 판단할 수 있다.
분석을 시행한 건강한 잇몸을 가진 사람 8명, 치은연 잇몸을 가진 사람 16명, 중등도 치주염을 가진 사람 19명, 심한 치주염을 가진 사람 29명의 타액 샘플에 대해 realtimePCR을 통해 구해진 각 9종의 세균에 대한 %를 해당 식에 적용하였을 때
건강한 잇몸 8개 샘플 중 3개 (37.50%) 샘플은 건강한 잇몸으로, 4개 (50%) 샘플에 대해서는 치은염 잇몸으로, 1개 (12.50%) 샘플에 대해서는 심도 치주염으로 분석되었다.
치은염 잇몸 16개 샘플 중 7개 (43.75%) 샘플은 치은염 잇몸으로, 3개 (18.75%) 샘플에 대해서는 중등도 치주염 잇몸으로, 6개 (37.50%) 샘플에 대해서는 심도 치주염 잇몸으로 분석되었다.
중등도 치주염 잇몸 19개 샘플 중 8개 (42.11%) 샘플은 중등도 치주염 잇몸으로, 6개 (31.58%) 샘플에 대해서는 치은염 잇몸으로, 5개 (26.32%) 샘플에 대해서는 심도 치주염으로 분석되었다.
심도 치주염 잇몸 29개 샘플 중 24개 (82.76%) 샘플은 심도 치주염 잇몸으로, 5개 (17.24%) 샘플에 대해서는 치은염 잇몸으로 분석되었다.
3. RealtimePCR 방법을 통해 구해진 9종 세균의 수를 활용하는 방법
치주질환의 심도에 따른 건강한 잇몸, 치은염 잇몸, 중등도 치주염 잇몸, 심도 치주염 잇몸을 산출하는 4개의 식이 존재한다.
1) 건강한 잇몸의 식 = -2.30476 + (-1.49793)x(P. gingivalis 수) + (42.24108)x(T. forsythia 수) + (-51.0784)x(T. denticola 수) + (0.039624)x(F. alocis 수) + (-26.4862)x(P. intermedia 수) + (-90.5605)x(P. endodontalis 수) + (39.28479)x(F. nucleatum 수) + (17.65564)x(R. dentocariosa 수) + (4.278468)x(P. micra 수)
(2) 치은염 잇몸의 식 = -1.62912 + (-0.76032)x(P. gingivalis 수) + (50.56172)x(T. forsythia 수) + (-65.645)x(T. denticola 수) + (-7.76311)x(F. alocis 수) + (-47.378)x(P. intermedia 수) + (45.18652)x(P. endodontalis 수) + (26.42666)x(F. nucleatum 수) + (47.9035)x(R. dentocariosa 수) + (5.394878)x(P. micra 수)
(3) 중등도 치주염 잇몸의 식 = -1.8899 + (-2.13304)x(P. gingivalis 수) + (121.1973)x(T. forsythia 수) + (-123.48)x(T. denticola 수) + (-11.1651)x(F. alocis 수) + (-83.2768)x(P. intermedia 수) + (-64.0856)x(P. endodontalis 수) + (43.52085)x(F. nucleatum 수) + (24.10447)x(R. dentocariosa 수) + (32.03642)x(P. micra 수)
(4) 심도 치주염 잇몸의 식 = -2.79975 + (-0.26374)x(P. gingivalis 수) + (366.5963)x(T. forsythia 수) + (-147.396)x(T. denticola 수) + (39.73937)x(F. alocis 수) + (-140.134)x(P. intermedia 수) + (-102.176)x(P. endodontalis 수) + (55.15521)x(F. nucleatum 수) + (123.9248)x(R. dentocariosa 수) + (29.36675)x(P. micra 수)
질환의 심도를 알고자 하는 사람의 타액을 채취하여 여기에 존재하는 세균에 대해 세균 특이 프라이머를 이용하여 RealtimePCR을 시행한 뒤 9종의 세균에 대한 세균 수를 산출하고, 산출된 9종 세균수를 4개의 식에 적용한 뒤 가장 높은 값을 보이는 식에 해당하는 잇몸 질환 심도를 해당 구강의 질환 심도로 판단할 수 있다.
분석을 시행한 건강한 잇몸을 가진 사람 8명, 치은연 잇몸을 가진 사람 16명, 중등도 치주염을 가진 사람 19명, 심한 치주염을 가진 사람 29명의 타액 샘플에 대해 realtimePCR을 통해 구해진 각 9종의 세균에 대한 세균 수를 해당 식에 적용하였을 때
건강한 잇몸 8개 샘플 중 건강한 잇몸으로 분류되는 샘플은 없었고, 6개 (75%) 샘플에 대해서는 치은염 잇몸으로, 2개 (25%) 샘플에 대해서는 중등도 치주염으로 분석되었다.
치은염 잇몸 16개 샘플 중 13개 (81.25%) 샘플은 치은염 잇몸으로, 1개 (6.25%) 샘플에 대해서는 중등도 치주염 잇몸으로, 2개 (12.50%) 샘플에 대해서는 심도 치주염 잇몸으로 분석되었다.
중등도 치주염 잇몸 19개 샘플 중 8개 (42.11%) 샘플은 중등도 치주염 잇몸으로, 9개 (47.37%) 샘플에 대해서는 치은염 잇몸으로, 2개 (10.53%) 샘플에 대해서는 심도 치주염으로 분석되었다.
심도 치주염 잇몸 29개 샘플 중 18개 (62.07%) 샘플은 심도 치주염 잇몸으로, 4개 (13.79%) 샘플에 대해서는 치은염 잇몸으로, 7개 (24.14%) 샘플에 대해서는 중등도 치주염으로 분석되었다.
이상으로 본 발명의 특정한 부분을 상세히 기술한 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
본 발명의 범위는 후술하는 특허청구범위에 의하여 나타내어지며, 특허청구범위의 의미 및 범위 그리고 그 균등개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (28)

  1. 개체로부터 분리된 시료에서 포르피로모나스 긴기발리스(Porphyromonas gingivalis), 타네렐라 포르시시아(Tannerella forsythia), 프레보텔라 인터메디아(Prevotella intermedia), 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis) 및 필리팍터 알로시스(Filifactor alocis)로 이루어진 군에서 선택된 하나 이상의 세균을 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 수행하는 단계; 및
    상기 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균%를 정상인, 치은염, 중증도 치주염 및 심도 치주염 환자로 이루어진 군에서 선택된 그것과 비교하는 단계를 포함하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  2. 개체로부터 분리된 시료에서 포르피로모나스 긴기발리스(Porphyromonas gingivalis), 타네렐라 포르시시아(Tannerella forsythia), 트레포네마 덴티콜라(Treponema denticola), 프레보텔라 인터메디아(Prevotella intermedia), 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis), 필리팍터 알로시스(Filifactor alocis), 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum) 및 파르비모나스 미크라(Parvimonas micra)로 이루어진 군에서 선택된 하나 이상의 세균을 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 수행하는 단계; 및
    상기 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균 수를 정상인, 치은염, 중증도 치주염 및 심도 치주염 환자로 이루어진 군에서 선택된 그것과 비교하는 단계를 포함하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  3. 제1항 또는 제2항에 있어서, 상기 비교하는 단계는 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균% 또는 세균수를 치주염의 심도를 보여주는 치주낭, 탐침시 출혈의 정도, 치조골의 흡수 정도에 의해 구획된 질환의 심도에 따른 세균%와 세균 수를 통해 설정된 컷오프 값과 비교하는 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  4. 제1항 또는 제2항에 있어서, 상기 시료는 타액인 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  5. 제1항 또는 제2항에 있어서, 상기 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석은 서열번호 1 및 2로 표시되는 프라이머 세트, 서열번호 3 및 4로 표시되는 프라이머 세트, 서열번호 5 및 6으로 표시되는 프라이머 세트, 서열번호 7 및 8로 표시되는 프라이머 세트, 서열번호 9 및 10으로 표시되는 프라이머 세트, 서열번호 11 및 12로 표시되는 프라이머 세트, 서열번호 13 및 14로 표시되는 프라이머 세트 및 서열번호 15 및 16으로 표시되는 프라이머 세트로 이루어진 군에서 선택된 어느 하나 이상의 프라이머 세트를 이용하여 표적 유전자의 발현 수준을 측정하는 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  6. 제5항에 있어서, 상기 서열번호 1 및 2로 표시되는 프라이머 세트의 표적 유전자는 포르피로모나스 긴기발리스(Porphyromonas gingivalis)의 rpoB, 서열번호 3 및 4로 표시되는 프라이머 세트의 표적 유전자는 타네렐라 포르시시아(Tannerella forsythia)의 rpoB, 서열번호 5 및 6으로 표시되는 프라이머 세트의 표적 유전자는 프레보텔라 인터메디아(Prevotella intermedia)의 rpoB, 서열번호 7 및 8로 표시되는 프라이머 세트의 표적 유전자는 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis)의 rpoB, 서열번호 9 및 10으로 표시되는 프라이머 세트의 표적 유전자는 필리팍터 알로시스(Filifactor alocis)의 16s rRNA, 서열번호 11 및 12로 표시되는 프라이머 세트의 표적 유전자는 트레포네마 덴티콜라(Treponema denticola)의 rpoB, 서열번호 13 및 14로 표시되는 프라이머 세트의 표적 유전자는 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum)의 rpoB 및 서열번호 15 및 16으로 표시되는 프라이머 세트의 표적 유전자는 파르비모나스 미크라(Parvimonas micra)의 fusA인 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  7. 제6항에 있어서, 상기 비교하는 단계는 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균%의 컷오프 값을 기준으로 하여, 서열번호 1 및 2로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.0034 이상, 서열번호 3 및 4로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.0021 이상, 서열번호 5 및 6으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.0013 이상, 서열번호 7 및 8로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.0062 이상, 또는 서열번호 9 및 10으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.0004 이상일 때, 건강한 잇몸과 치주질환을 구분하는 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  8. 제6항에 있어서, 상기 비교하는 단계는 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균 수의 컷오프 값을 기준으로 하여, 서열번호 1 및 2로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 5 이상, 서열번호 3 및 4로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 10 이상, 서열번호 5 및 6으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 1 이상, 서열번호 7 및 8로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 9 이상, 서열번호 9 및 10으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 5 이상, 서열번호 11 및 12로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 11 이상, 또는 서열번호 15 및 16으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 94 이상일 때, 건강한 잇몸과 치주질환을 구분하는 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  9. 제7항에 있어서, 상기 컷오프 값은 타액 시료로부터 해당 사람의 구강에서 채취된 타액 세균의 전체 세균 대비 해당 세균의 % 또는 세균의 수를 근거로 건강한 잇몸과 치주질환이 있는 잇몸을 구별하기 위한 ROC 곡선과 AUC 값을 구한 뒤 AUC 값이 0.7 이상인 세균들의 컷오프 값에서 비롯된 것이며, 상기 치주질환은 개개 치아의 치주낭 깊이가 3mm 이하이고 전체 치열의 탐침시 출혈의 정도가 10% 이상인 대상자로 정의되는 치은염과 치조골의 흡수가 동반되는 치주염인 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  10. 제8항에 있어서, 상기 컷오프 값은 타액 시료로부터 해당 사람의 구강에서 채취된 타액 세균의 전체 세균 대비 해당 세균의 % 또는 세균의 수를 근거로 건강한 잇몸과 치주질환이 있는 잇몸을 구별하기 위한 ROC 곡선과 AUC 값을 구한 뒤 AUC 값이 0.7 이상인 세균들의 컷오프 값에서 비롯된 것이며, 상기 치주질환은 개개 치아의 치주낭 깊이가 3mm 이하이고 전체 치열의 탐침시 출혈의 정도가 10% 이상인 대상자로 정의되는 치은염과 치조골의 흡수가 동반되는 치주염인 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  11. 제6항에 있어서, 상기 비교하는 단계는 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균%의 컷오프 값을 기준으로 하여, 서열번호 1 및 2로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.0586 이상, 또는 서열번호 3 및 4로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.0048 이상일 때, 건강한 잇몸/치은염과 치주염을 구분하는 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  12. 제6항에 있어서, 상기 비교하는 단계는 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균 수의 컷오프 값을 기준으로 하여, 서열번호 1 및 2로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 33 이상, 서열번호 3 및 4로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 7 이상, 서열번호 5 및 6으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 3 이상, 서열번호 7 및 8로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 29 이상, 서열번호 9 및 10으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 16 이상, 서열번호 11 및 12로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 11 이상, 서열번호 13 및 14로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 529 이상, 또는 서열번호 15 및 16으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 233 이상일 때, 건강한 잇몸/치은염과 치주염을 구분하는 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  13. 제11항에 있어서, 상기 컷오프 값은 타액 시료로부터 해당 사람의 구강에서 채취된 타액 세균의 전체 세균 대비 해당 세균의 % 또는 세균의 수를 근거로 치조골의 흡수를 동반하지 않은 잇몸 상태인 건강한 잇몸과 치은염 잇몸을 치조골의 흡수를 동반하는 치주염이 있는 잇몸을 구별하기 위한 ROC 곡선과 AUC 값을 구한 뒤 AUC 값이 0.7 이상인 세균들의 컷오프 값에서 비롯된 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  14. 제12항에 있어서, 상기 컷오프 값은 타액 시료로부터 해당 사람의 구강에서 채취된 타액 세균의 전체 세균 대비 해당 세균의 % 또는 세균의 수를 근거로 치조골의 흡수를 동반하지 않은 잇몸 상태인 건강한 잇몸과 치은염 잇몸을 치조골의 흡수를 동반하는 치주염이 있는 잇몸을 구별하기 위한 ROC 곡선과 AUC 값을 구한 뒤 AUC 값이 0.7 이상인 세균들의 컷오프 값에서 비롯된 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  15. 제6항에 있어서, 상기 비교하는 단계는 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균%의 컷오프 값을 기준으로 하여, 서열번호 1 및 2로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.1122 이상, 서열번호 3 및 4로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.0297 이상, 또는 서열번호 5 및 6으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 0.0037 이상일 때, 건강한 잇몸/치은염/중등도 치주염과 심도 치주염을 구분하는 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  16. 제6항에 있어서, 상기 비교하는 단계는 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균 수의 컷오프 값을 기준으로 하여, 서열번호 1 및 2로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 838 이상, 서열번호 3 및 4로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 213 이상, 서열번호 5 및 6으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 18 이상, 서열번호 9 및 10으로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 159 이상, 또는 서열번호 13 및 14로 표시되는 프라이머 세트의 표적 유전자의 컷오프 값이 529 이상일 때, 건강한 잇몸/치은염/중등도 치주염과 심도 치주염을 구분하는 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  17. 제15항에 있어서, 상기 컷오프 값은 타액 시료로부터 해당 사람의 구강에서 채취된 타액 세균의 전체 세균 대비 해당 세균의 % 또는 세균의 수를 근거로 건강한 잇몸, 치은염 잇몸 및 중등도 치주염 잇몸을 심한 치주염 잇몸과 구별하기 위한 ROC 곡선과 AUC 값을 구한 뒤 AUC 값이 0.7 이상인 세균들의 컷오프 값에서 비롯된 것이며, 심한 치주염은 국소적으로 치주낭 깊이가 6mm 이상인 치주낭을 보이고 3mm 이상의 수직골 흡수를 보이며 구치부의 치조골 흡수로 인한 이개부 병변을 갖는 치주염인 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  18. 제16항에 있어서, 상기 컷오프 값은 타액 시료로부터 해당 사람의 구강에서 채취된 타액 세균의 전체 세균 대비 해당 세균의 % 또는 세균의 수를 근거로 건강한 잇몸, 치은염 잇몸 및 중등도 치주염 잇몸을 심한 치주염 잇몸과 구별하기 위한 ROC 곡선과 AUC 값을 구한 뒤 AUC 값이 0.7 이상인 세균들의 컷오프 값에서 비롯된 것이며, 심한 치주염은 국소적으로 치주낭 깊이가 6mm 이상인 치주낭을 보이고 3mm 이상의 수직골 흡수를 보이며 구치부의 치조골 흡수로 인한 이개부 병변을 갖는 치주염인 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  19. 개체로부터 분리된 시료에서 포르피로모나스 긴기발리스(Porphyromonas gingivalis), 타네렐라 포르시시아(Tannerella forsythia), 트레포네마 덴티콜라(Treponema denticola), 프레보텔라 인터메디아(Prevotella intermedia), 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis), 필리팍터 알로시스(Filifactor alocis), 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum) 및 파르비모나스 미크라(Parvimonas micra)로 이루어진 군에서 선택된 하나 이상의 세균을 16S rRNA 시퀀싱 분석을 수행하는 단계; 및
    상기 16S rRNA 시퀀싱 분석을 통해 얻은 세균%를 정상인, 치은염, 중증도 치주염 및 심도 치주염 환자로 이루어진 군에서 선택된 그것과 비교하는 단계를 포함하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  20. 제19항에 있어서, 상기 컷오프 값은 포르피로모나스 긴기발리스(Porphyromonas gingivalis)는 0.5276, 타네렐라 포르시시아(Tannerella forsythia)는 0.0352, 트레포네마 덴티콜라(Treponema denticola)는 0.0044, 프레보텔라 인터메디아(Prevotella intermedia)는 0.0079, 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis)는 0.1662, 필리팍터 알로시스(Filifactor alocis)는 0.0141, 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum)은 1.4741, 파르비모나스 미크라(Parvimonas micra)는 0.1722, 또는 로티아 덴토카리오사(Rothia dentocariosa)은 0.6632의 값으로, 해당 컷오프 값 이상일 때 건강한 잇몸과 치주질환을 구분하는 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  21. 제19항에 있어서, 상기 컷오프 값은 포르피로모나스 긴기발리스(Porphyromonas gingivalis)는 0.2258, 타네렐라 포르시시아(Tannerella forsythia)는 0.0611, 프레보텔라 인터메디아(Prevotella intermedia)는 0.1594, 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis)는 0.7348, 필리팍터 알로시스(Filifactor alocis)는 0.1141, 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum)은 1.2996, 파르비모나스 미크라(Parvimonas micra)는 0.2103, 또는 로티아 덴토카리오사(Rothia dentocariosa)는 0.3136의 값으로, 해당 컷오프 값 이상일 때 건강한 잇몸/치은염과 치주염을 구분하는 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  22. 제19항에 있어서, 상기 컷오프 값은 포르피로모나스 긴기발리스(Porphyromonas gingivalis)는 1.4374, 타네렐라 포르시시아(Tannerella forsythia)는 0.1443, 프레보텔라 인터메디아(Prevotella intermedia)는 0.0294, 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis)는 0.7348, 필리팍터 알로시스(Filifactor alocis)는 0.1141, 또는 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum)은 1.8720의 값으로, 해당 컷오프 값 이상일 때 건강한 잇몸/치은염/중등도 치주염과 심도 치주염을 구분하는 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  23. 제19항 내지 제22항 중 어느 한 항에 있어서, 상기 시료는 타액인 것을 특징으로 하는 치주질환 진단에 필요한 정보를 제공하는 방법.
  24. 개체로부터 분리된 시료에서 포르피로모나스 긴기발리스(Porphyromonas gingivalis), 타네렐라 포르시시아(Tannerella forsythia), 트레포네마 덴티콜라(Treponema denticola), 프레보텔라 인터메디아(Prevotella intermedia), 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis), 필리팍터 알로시스(Filifactor alocis), 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum), 파르비모나스 미크라(Parvimonas micra) 및 로티아 덴토카리오사(Rothia dentocariosa)로 이루어진 군에서 선택된 하나 이상의 세균을 16S rRNA 시퀀싱 분석을 수행하는 단계; 및
    상기 16S rRNA 시퀀싱 분석을 통해 얻은 세균%를 하기 수학식 1-1 내지 수학식 1-4의 수학식에 대입하여 각각의 값을 산출하고, 이러한 값 중 가장 높은 값을 보이는 식에 해당하는 잇몸 질환 심도를 해당 치아의 질환 심도로 판단하는 단계를 포함하는 치주질환 진단에 필요한 정보를 제공하는 방법:
    [수학식 1-1]
    건강한 잇몸의 식 = -3.52072 + (-0.02639)x(P. gingivalis %) + (0.839493)x(T. forsythia %) + (0.316224)x(T. denticola %) + (-0.98641)x(F. alocis %) + (0.646425)x(P. intermedia %) + (0.087085)x(P. endodontalis %) + (-0.08749)x(F. nucleatum %) + (1.391072)x(R. dentocariosa %) + (0.39933)x(P. micra %)
    [수학식 1-2]
    치은염 잇몸의 식 = -1.9748 + (-0.01137)x(P. gingivalis %) + (-0.96119)x(T. forsythia %) + (0.003346)x(T. denticola %) + (-0.25645)x(F. alocis %) + (0.568488)x(P. intermedia %) + (0.42965)x(P. endodontalis %) + (0.200952)x(F. nucleatum %) + (0.519156)x(R. dentocariosa %) + (-0.52904)x(P. micra %)
    [수학식 1-3]
    중등도 치주염 잇몸의 식 = -1.9075 + (0.007068)x(P. gingivalis %) + (1.141592)x(T. forsythia %) + (-0.2656)x(T. denticola %) + (-1.46872)x(F. alocis %) + (0.715288)x(P. intermedia %) + (0.77475)x(P. endodontalis %) + (-0.04183)x(F. nucleatum %) + (0.169773)x(R. dentocariosa %) + (1.520645)x(P. micra %)
    [수학식 1-4]
    심도 치주염 잇몸의 식 = -3.24579+ (0.296464)x(P. gingivalis %) + (-0.1594)x(T. forsythia %) + (-2.53253)x(T. denticola %) + (-0.11511)x(F. alocis %) + (1.83945)x(P. intermedia %) + (1.407898)x(P. endodontalis %) + (0.248094)x(F. nucleatum %) + (0.300277)x(R. dentocariosa %) + (-0.74747)x(P. micra %)
  25. 개체로부터 분리된 시료에서 포르피로모나스 긴기발리스(Porphyromonas gingivalis), 타네렐라 포르시시아(Tannerella forsythia), 트레포네마 덴티콜라(Treponema denticola), 프레보텔라 인터메디아(Prevotella intermedia), 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis), 필리팍터 알로시스(Filifactor alocis), 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum), 파르비모나스 미크라(Parvimonas micra) 및 로티아 덴토카리오사(Rothia dentocariosa)로 이루어진 군에서 선택된 하나 이상의 세균을 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 수행하는 단계; 및
    상기 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균%를 하기 수학식 2-1 내지 수학식 2-4의 수학식에 대입하여 각각의 값을 산출하고, 이러한 값 중 가장 높은 값을 보이는 식에 해당하는 잇몸 질환 심도를 해당 치아의 질환 심도로 판단하는 단계를 포함하는 치주질환 진단에 필요한 정보를 제공하는 방법:
    [수학식 2-1]
    건강한 잇몸의 식 = -3.60258+ (-0.051)x(P. gingivalis %) + (3.457539)x(T. forsythia %) + (-10.0746)x(T. denticola %) + (-1.25858)x(F. alocis %) + (-1.7208)x(P. intermedia %) + (-8.5888)x(P. endodontalis %) + (1.976449)x(F. nucleatum %) + (5.348558)x(R. dentocariosa %) + (0.063522)x(P. micra %)
    [수학식 2-2]
    치은염 잇몸의 식 = -1.8156+ (-0.00877)x(P. gingivalis %) + (5.590504)x(T. forsythia %) + (-4.75712)x(T. denticola %) + (-1.4037)x(F. alocis %) + (-4.88342)x(P. intermedia %) + (5.253621)x(P. endodontalis %) + (0.331331)x(F. nucleatum %) + (3.02979)x(R. dentocariosa %) + (0.152853)x(P. micra %)
    [수학식 2-3]
    중등도 치주염 잇몸의 식 = -2.18027+ (-0.14454)x(P. gingivalis %) + (12.54856)x(T. forsythia %) + (0.984939)x(T. denticola %) + (-4.98201)x(F. alocis %) + (-6.46175)x(P. intermedia %) + (3.469277)x(P. endodontalis %) + (1.076105)x(F. nucleatum %) + (-1.23915)x(R. dentocariosa %) + (0.468393)x(P. micra %)
    [수학식 2-4]
    심도 치주염 잇몸의 식 = -1.84498 + (-0.00562)x(P. gingivalis %) + (13.76487)x(T. forsythia %) + (2.553924)x(T. denticola %) + (0.054474)x(F. alocis %) + (7.646578)x(P. intermedia %) + (4.540174)x(P. endodontalis %) + (-0.48413)x(F. nucleatum %) + (-0.52195)x(R. dentocariosa %) + (0.21387)x(P. micra %)
  26. 개체로부터 분리된 시료에서 포르피로모나스 긴기발리스(Porphyromonas gingivalis), 타네렐라 포르시시아(Tannerella forsythia), 트레포네마 덴티콜라(Treponema denticola), 프레보텔라 인터메디아(Prevotella intermedia), 포피로모나스 엔도돈탈리스(Porphyromonas endodontalis), 필리팍터 알로시스(Filifactor alocis), 푸소박테리움 뉴클레아툼(Fusobacterium nucleatum), 파르비모나스 미크라(Parvimonas micra) 및 로티아 덴토카리오사(Rothia dentocariosa)로 이루어진 군에서 선택된 하나 이상의 세균을 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 수행하는 단계; 및
    상기 실시간 중합효소 연쇄반응(Real-time PCR) 정량 분석을 통해 얻은 세균 수를 하기 수학식 3-1 내지 수학식 3-4의 수학식에 대입하여 각각의 값을 산출하고, 이러한 값 중 가장 높은 값을 보이는 식에 해당하는 잇몸 질환 심도를 해당 치아의 질환 심도로 판단하는 단계를 포함하는 치주질환 진단에 필요한 정보를 제공하는 방법:
    [수학식 3-1]
    건강한 잇몸의 식 = -2.30476 + (-1.49793)x(P. gingivalis 수) + (42.24108)x(T. forsythia 수) + (-51.0784)x(T. denticola 수) + (0.039624)x(F. alocis 수) + (-26.4862)x(P. intermedia 수) + (-90.5605)x(P. endodontalis 수) + (39.28479)x(F. nucleatum 수) + (17.65564)x(R. dentocariosa 수) + (4.278468)x(P. micra 수)
    [수학식 3-2]
    치은염 잇몸의 식 = -1.62912 + (-0.76032)x(P. gingivalis 수) + (50.56172)x(T. forsythia 수) + (-65.645)x(T. denticola 수) + (-7.76311)x(F. alocis 수) + (-47.378)x(P. intermedia 수) + (45.18652)x(P. endodontalis 수) + (26.42666)x(F. nucleatum 수) + (47.9035)x(R. dentocariosa 수) + (5.394878)x(P. micra 수)
    [수학식 3-3]
    중등도 치주염 잇몸의 식 = -1.8899 + (-2.13304)x(P. gingivalis 수) + (121.1973)x(T. forsythia 수) + (-123.48)x(T. denticola 수) + (-11.1651)x(F. alocis 수) + (-83.2768)x(P. intermedia 수) + (-64.0856)x(P. endodontalis 수) + (43.52085)x(F. nucleatum 수) + (24.10447)x(R. dentocariosa 수) + (32.03642)x(P. micra 수)
    [수학식 3-4]
    심도 치주염 잇몸의 식 = -2.79975 + (-0.26374)x(P. gingivalis 수) + (366.5963)x(T. forsythia 수) + (-147.396)x(T. denticola 수) + (39.73937)x(F. alocis 수) + (-140.134)x(P. intermedia 수) + (-102.176)x(P. endodontalis 수) + (55.15521)x(F. nucleatum 수) + (123.9248)x(R. dentocariosa 수) + (29.36675)x(P. micra 수)
  27. 서열번호 1 및 2로 표시되는 프라이머 세트, 서열번호 3 및 4로 표시되는 프라이머 세트, 서열번호 5 및 6으로 표시되는 프라이머 세트, 서열번호 7 및 8로 표시되는 프라이머 세트, 서열번호 9 및 10으로 표시되는 프라이머 세트, 서열번호 11 및 12로 표시되는 프라이머 세트, 서열번호 13 및 14로 표시되는 프라이머 세트 및 서열번호 15 및 16으로 표시되는 프라이머 세트로 이루어진 군에서 선택된 어느 하나 이상의 프라이머 세트를 포함하는 치주질환 진단용 조성물.
  28. 제27항에 따른 조성물을 포함하는 치주질환 진단 키트.
PCT/KR2022/015871 2021-10-19 2022-10-18 타액 내 세균의 군집을 이용한 치주질환 진단용 조성물 및 이의 용도 WO2023068764A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210138897A KR20230055473A (ko) 2021-10-19 2021-10-19 타액 내 세균의 군집을 이용한 치주질환 진단용 조성물 및 이의 용도
KR10-2021-0138897 2021-10-19

Publications (1)

Publication Number Publication Date
WO2023068764A1 true WO2023068764A1 (ko) 2023-04-27

Family

ID=86059423

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/015871 WO2023068764A1 (ko) 2021-10-19 2022-10-18 타액 내 세균의 군집을 이용한 치주질환 진단용 조성물 및 이의 용도

Country Status (2)

Country Link
KR (1) KR20230055473A (ko)
WO (1) WO2023068764A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120112001A (ko) * 2011-03-29 2012-10-11 조선대학교산학협력단 구강 세균감염성질환 원인균 검출용 프라이머 및 이의 용도
KR20200079795A (ko) * 2018-12-26 2020-07-06 주식회사 힐릭스코 구강 질환의 위험도 예측 방법 및 이를 수행하는 시스템, 그 방법이 을 수행하기 위한 프로그램이 기록된 컴퓨터 판독이 가능한 기록매체

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120112001A (ko) * 2011-03-29 2012-10-11 조선대학교산학협력단 구강 세균감염성질환 원인균 검출용 프라이머 및 이의 용도
KR20200079795A (ko) * 2018-12-26 2020-07-06 주식회사 힐릭스코 구강 질환의 위험도 예측 방법 및 이를 수행하는 시스템, 그 방법이 을 수행하기 위한 프로그램이 기록된 컴퓨터 판독이 가능한 기록매체

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KIM EUN-HYE, JOO JI-YOUNG, LEE YONG JOO, KOH JAE-KWON, CHOI JUNG-HYEOK, SHIN YERANG, CHO JUOK, PARK EUNHA, KANG JIHOON, LEE KYUSAN: "Grading system for periodontitis by analyzing levels of periodontal pathogens in saliva", PLOS ONE, vol. 13, no. 11, 26 November 2018 (2018-11-26), pages e0200900, XP093058576, DOI: 10.1371/journal.pone.0200900 *
KIM SEON MI, CHOI NAM-KI, MI-SUN KANG, OH, JONGSUK: "KIM, Seon Mi et al. Quantitative detection of periodontopathic bacteria using real-time PCR. Journal of the Korean academy of pediatric dentistry.", J KOREAN ACAD PEDIATR DENT, vol. 35, no. 3, 11 March 2008 (2008-03-11), pages 494 - 503, XP093059125 *
LOCHMAN JAN, ZAPLETALOVA MARTINA, POSKEROVA HANA, IZAKOVICOVA HOLLA LYDIE, BORILOVA LINHARTOVA PETRA: "Rapid Multiplex Real-Time PCR Method for the Detection and Quantification of Selected Cariogenic and Periodontal Bacteria", DIAGNOSTICS, vol. 10, no. 1, 1 January 2020 (2020-01-01), pages 8, XP093059119, DOI: 10.3390/diagnostics10010008 *
SAWAMOTO Y., SUGANO N., TANAKA H., ITO K.: "Detection of periodontopathic bacteria and an oxidative stress marker in saliva from periodontitis patients", ORAL MICROBIOLOGY AND IMMUNOLOGY., MUNKSGAARD, COPENHAGEN., DK, vol. 20, no. 4, 1 August 2005 (2005-08-01), DK , pages 216 - 220, XP093059127, ISSN: 0902-0055, DOI: 10.1111/j.1399-302X.2005.00215.x *

Also Published As

Publication number Publication date
KR20230055473A (ko) 2023-04-26

Similar Documents

Publication Publication Date Title
Walker et al. Genetic polymorphisms of the IL‐1α and IL‐1β genes in African‐American LJP patients and an African‐American control population
Paster et al. Bacterial diversity in necrotizing ulcerative periodontitis in HIV‐positive subjects
WO2023068769A1 (ko) 치은열구액 내 세균의 군집을 이용한 치주질환 진단용 조성물 및 이의 용도
EP0769560B1 (en) Detecting genetic predisposition to periodontal disease
Trevilatto et al. Association of IL1 gene polymorphisms with chronic periodontitis in Brazilians
Kinane Periodontal disease in children and adolescents: introduction and classification.
KR19990071059A (ko) 삼핵산 반복 서열을 이용한 신경정신 질환의 진단 방법 및 진단키트
WO2023068764A1 (ko) 타액 내 세균의 군집을 이용한 치주질환 진단용 조성물 및 이의 용도
WO2012070776A2 (ko) 만성 ｂ형 간질환 환자의 간세포암 발병 위험도 분석 및 예측방법
WO2023234659A1 (ko) 퇴행성 턱관절염의 진단 또는 예후 예측용 유전자 마커 및 이의 용도
JP2019000082A (ja) 侵襲性歯周炎の遺伝子検査および治療剤
Tomoyasu et al. External apical root resorption and the interleukin-1B gene polymorphism in the Japanese population
Tao et al. HepG2/erythrocyte glucose transporter (GLUT1) gene in NIDDM: a population association study and molecular scanning in Japanese subjects
WO2022191571A1 (ko) 치근외흡수와 관련된 단일염기다형성 및 그의 용도
Gutierrez et al. Identification of a novel mutation in the enamalin gene in a family with autosomal-dominant amelogenesis imperfecta
WO2016108348A1 (ko) 치주질환 예측 시스템 및 이를 이용한 치주질환 예측 방법
Švalkauskienė et al. Heritability estimates of dental arch parameters in Lithuanian twins
WO2022039565A1 (ko) 연령 관련 황반변성 진단용 바이오마커 및 이의 용도
Barrientos et al. The 9-bp deletion in region V of mitochondrial DNA: evidence of mutation recurrence
Ouryouji et al. Analysis of mutations in the amelogenin and the enamelin genes in severe caries in Japanese pediatric patients
Frayling et al. A rapid screening method for hepatocyte nuclear factor 1 alpha frameshift mutations; prevalence in maturity-onset diabetes of the young and late-onset non-insulin dependent diabetes
WO2022119204A1 (ko) Ebv 동정을 포함한 암 면역치료제 효능예측 표적유전체 분석법
WO2021107713A1 (ko) Lats1 유전자 변이 마커 기반의 근위축성 측삭경화증의 진단방법
WO2012134063A2 (ko) 구강 세균감염성질환 원인균 검출용 프라이머 및 이의 용도
WO2022220527A1 (ko) 피부색 판단용 유전자 다형성 마커 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22883986

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE