WO2023060104A1 - Compositions and methods for treating cag repeat diseases - Google Patents
Compositions and methods for treating cag repeat diseases Download PDFInfo
- Publication number
- WO2023060104A1 WO2023060104A1 PCT/US2022/077572 US2022077572W WO2023060104A1 WO 2023060104 A1 WO2023060104 A1 WO 2023060104A1 US 2022077572 W US2022077572 W US 2022077572W WO 2023060104 A1 WO2023060104 A1 WO 2023060104A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- mismatch
- substitution
- strand
- double
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0085—Brain, e.g. brain implants; Spinal cord
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/50—Methods for regulating/modulating their activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2330/00—Production
- C12N2330/50—Biochemical production, i.e. in a transformed host cell
- C12N2330/51—Specially adapted vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Definitions
- Sequence Listing is provided herewith as a Sequence Listing XML, “IRIS- 001 WO_SEQ_LIST” created on October 4, 2022 and having a size of 1,298 KB.
- the contents of the Sequence Listing XML are incorporated by reference herein in their entirety.
- Repeat expansion disorders are autosomal dominant genetic disorders caused by expansion of DNA repeats.
- DNA repeats may be composed of single nucleotides to dodecamers or longer.
- the threshold at which repeat expansions become symptomatic varies with the particular disease.
- Repeat expansions may occur in coding or non-coding regions of genes. Repeat expansions may cause defects in a protein encoded by a gene; change the regulation of gene expression; produce a toxic RNA, or lead to chromosome instability.
- the present disclosure provides a double-stranded RNA comprising: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region; and ii) at least a second mismatch to the target CAG repeat region.
- the present disclosure provides a DNA molecule comprising a nucleotide sequence encoding the first strand of the double-stranded RNA, where the nucleotide sequence is operably linked to a promoter that is functional in a eukaryotic cell.
- the present disclosure provides a recombinant nucleic acid comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold; the present disclosure also provides a recombinant expression vector comprising a nucleotide sequence encoding such a recombinant nucleic acid.
- the present disclosure provides a DNA molecule comprising a nucleotide sequence encoding a recombinant nucleic acid comprising: a) a doublestranded RNA of the present disclosure; and b) a microRNA scaffold; the present disclosure also provides a recombinant expression vector comprising such a DNA molecule.
- the present disclosure provides viral and non-viral delivery vehicles comprising a recombinant expression vector of the present disclosure; and pharmaceutical compositions comprising such delivery vehicles.
- the present disclosure provides methods for selectively reducing translation of a disease-associated CAG repeat-containing RNA.
- the present disclosure provides a double stranded RNA comprising from 5’ to 3’: (a) a 5’ leader sequence; (b) a 5’ stem comprising a passenger sequence or a guide sequence; (c) a 5’ linker of 1-6 bases; (d) a terminal loop; I a 3’ linker of 1-6 bases; (f) a 3’ stem comprising: (i) a guide sequence if the 5’ stem comprises the passenger sequence; or (ii) a passenger sequence if the 5’ stem comprises the guide sequence; and (g) a 3’ trailer sequence; wherein the guide sequence targets a CAG repeat region of a CAG repeat containing RNA (e.g., mRNA or pre-mRNA) and comprises 1-5 base mismatches relative to the CAG repeat region, wherein the base mismatches are located at positions 8-16 of the guide sequence.
- RNA e.g., mRNA or pre-mRNA
- FIGS. 1A-1D Cloning and design of shRNAs expressed from a custom U6 promoter- driven construct.
- FIG. 1A Plasmid map for customized pxTRC-EGFP-puro.
- FIG. IB Initial shRNA expression cassette (SEQ ID NO:760).
- FIG. 1C shRNA construct modifications to improve shRNA processing accuracy and abundance (SEQ ID NO:761).
- FIG. ID shHDIL-l design (SEQ ID NO:762).
- green markings show Drosha cleavage on the 5’ leader and 3’ trailer sequences and Dicer cleavage at the 5’ upper stem and 3’ upper stem; and mismatch positions in guide strand are boxed in purple.
- FIGS. 2A-2C miRNA miR33 scaffold designs for shRNA expression.
- FIGS. 2A miR33 miRNA structure and sequence elements (SEQ ID NO:763).
- FIG. 2B Generalized miR33 scaffold for shRNA cloning and expression (SEQ ID NO:764).
- FIGS. 2C shHD-33full-mimic design (SEQ ID NO:765).
- green markings show Drosha cleavage on the 5’ leader and 3’ trailer sequences and Dicer cleavage at the 5’ upper stem and 3’ upper stem; and mismatch positions in the guide strand are boxed in purple.
- FIGS. 3A-3B Cell based evaluation of select shRNAs targeting the CAG repeat expansion of HTT.
- FIG. 3A HEK 293T Luciferase assay results for several shRNAs targeting CAG repeats. Wild- type (wt) and mutant (mut) constructs are indicated and percent luciferase activity is normalized to scrambled shRNA control. Mean of two independent replicates is shown. Error is standard error of the mean (S.E.M.). Statistical significance is indicated by p-values less than 0.05 (*) or 0.01 (**).
- FIG. 3B Quantified knockdown of HTT wt and mut proteins in patient-derived cells assayed by Western blot and fit to Hill plot equation. Single replicate or mean of two replicates is shown. Error is S.E.M.
- FIG. 4 is a graph comparing shRNA abundance for a virally encoded shRNA having a guide sequence perfectly matching the CAG repeat region of HTT mRNA vs. a virally encoded shRNA having a guide sequence comprising mismatch(es) relative to the CAG repeat region of HTT mRNA, wherein the mismatches are located at positions 8-16 of the guide sequence.
- FIG. 5 is a graph showing that lentiviral constructs encoding allele selective shRNAs significantly decreased expression of the pathogenic HTT allele (mut-HTT) in fibroblast cells transduced with shHD-33full and shHD33-fullmimic compared to the normal HTT allele.
- mut-HTT pathogenic HTT allele
- FIG. 6 depicts co-localization of DARP32 and GFP staining in zQ175 mouse striatum.
- FIG. 7A-7B depicts western blot analysis of wild-type (WT) and mut HTT protein in striatum of zQ175 mice in the AAV9-shHD33-Full-Mimic treatment group relative to the AAV9- shScr treatment group.
- FIG. 8 depicts dose-dependent AAV delivery and GFP expression in the striatum.
- FIG. 9 depicts allele-selective knockdown in vivo with a small binding RNA (sbRNA) delivered via a recombinant AAV vector.
- sbRNA small binding RNA
- FIG. 10 depicts transduction efficiency in the cerebellum following ICV administration of recombinant AAV virions comprising a recombinant AAV encoding an sbRNA.
- FIG. 11 depicts allele-selective knockdown in vivo with a small binding RNA (sbRNA) delivered via a recombinant AAV vector in a SCA2 mouse model (left panel) and partial restoration of expression of key cerebellar genes that are molecular markers of pathology in ATXN2-Q127 mice (right panel).
- sbRNA small binding RNA
- FIG. 12 depicts the effect of sbRNA on preservation of wild-type (WT) gene expression in ATXN2-Q127 mice. Protein levels were unchanged for non-target genes containing CAG repeats.
- FIG. 13A-13E depict the effect of the registry on knockdown (FIG. 13(A) Guide Strand Column, SEQ ID Nos:406, 873, 406, 406, 406, 874, 875, from top to bottom respectively; Loop Column, SEQ ID Nos:876, 876, 877, 878, 876, 879, 876, from top to bottom respectively; Passenger Strand Column, SEQ ID Nos:881, 880, 880, 880, 880, 882, 883, 884, from top to bottom respectively) (FIG. 13(E) SEQ ID Nos:868, 869, 870, 871 and 872 from top to bottom respectively).
- FIG. 14 is a schematic depiction of a guide sequence screening system.
- FIG. 15 depicts knockdown and allele selectivity using various guide sequences.
- FIG. 16 depicts guide sequence screening and allele selectivity.
- FIG. 17 depicts the effect of the number of mismatches to the target CAG repeat region on knockdown and allele selectivity.
- FIG. 18 depicts the effect of a single mismatch on knockdown and allele selectivity, where the mismatch is at position 8, 9, 10, or 11.
- FIG. 19 depicts the effect, on knockdown and allele selectivity, of distance between a first mismatch and a second mismatch, when the first mismatch is at position 8, 9, 10, or 11.
- FIG. 20 depicts the effect, on knockdown and allele selectivity, of distance between mismatches in guide sequences having three mismatches (left panel) or four mismatches (right panel) with a target CAG.
- FIG. 21 depicts the effect, on knockdown and allele selectivity, of distance between mismatches in guide sequences having three mismatches with a target CAG, where the first mismatch is at position 9, 10, or 11.
- FIG. 22 provides Table 6.
- FIG. 23 provides Table 7.
- FIG. 24 provides Table 8.
- FIG. 25 provides nucleotide sequences of sbRNAs comprising miR451 5’ and 3’ flanking polynucleotides.
- the present disclosure provides double-stranded RNAs that can exploit differences in the number of repeats and achieve allele-selective inhibition of repeat-containing proteins.
- the double-stranded RNAs target the repeat region of a repeat-containing target RNA molecule (e.g., mRNA or pre-mRNA) and contains 1-5 (e.g., 1, 2, 3, 4, or 5) nucleobase mismatches relative to the repeat region in the target mRNA or pre-mRNA at positions 8-16 (e.g., 8, 9, 10, 11, 12, 13, 14, 15, or 16) of the guide sequence, which enhances the ability of doublestranded RNAs to selectively inhibit mutant protein expression versus wild-type.
- a repeat-containing target RNA molecule e.g., mRNA or pre-mRNA
- 1-5 e.g., 1, 2, 3, 4, or 5
- 8-16 e.g., 8, 9, 10, 11, 12, 13, 14, 15, or 16
- Standard design of vector encoded double-stranded RNAs targeting the repeat region of a repeat containing target mRNA or pre-mRNA and comprising 1-5 mismatches relative to the repeat region at positions 8-16 of the guide sequence revealed positional shifts in processing of the 5’ cleavage sites. Due to the shift in processing, the positions of the mismatch(es) in the guide sequence were also shifted, placing them at offset or undesirable positions. Double stranded RNAs having mismatches at offset or undesirable positions may not have desirable functions.
- the design of the double-stranded RNAs of the disclosure has been modified for vector expression, enhancing proper processing to place mismatches at desired positions and provide more predictable 5’ cleavage sites.
- any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated.
- any number range recited herein relating to any physical feature, such as polymer subunits, size or thickness are to be understood to include any integer within the recited range, unless otherwise indicated.
- the term “about” means ⁇ 20% of the indicated range, value, or structure, unless otherwise indicated. It should be understood that the terms “a” and “an” as used herein refer to “one or more" of the enumerated components.
- nucleic acid or “polynucleotide” refer to any nucleic acid polymer composed of covalently linked nucleotide subunits, such as poly deoxyribonucleotides or polyribonucleotides.
- nucleic acids include RNA and DNA.
- RNA refers to a molecule comprising one or more ribonucleotides and includes double-stranded RNA, single-stranded RNA, isolated RNA, synthetic RNA, recombinant RNA, as well as modified RNA that differs from naturally-occurring RNA by the addition, deletion, substitution, and/or alteration of one or more nucleotides.
- Nucleotides of RNA molecules may comprise standard nucleotides or non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides.
- DNA refers to a molecule comprising one or more deoxyribonucleotides and includes double-stranded DNA, single-stranded DNA, isolated DNA, synthetic DNA, recombinant DNA, as well as modified DNA that differs from naturally-occurring DNA by the addition, deletion, substitution, and/or alteration of one or more nucleotides.
- Nucleotides of DNA molecules may comprise standard nucleotides or non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides.
- nucleoside means a compound comprising a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, naturally occurring nucleosides (as found in DNA and RNA) and modified nucleosides. Nucleosides may be linked to a phosphate moiety.
- nucleotide means a nucleoside further comprising a phosphate linking group.
- linked nucleosides may or may not be linked by phosphate linkages and thus includes, but is not limited to “linked nucleotides.”
- linked nucleosides are nucleosides that are connected in a continuous sequence (i.e. no additional nucleosides are present between those that are linked).
- nucleobase or “base” means a group of atoms that can be linked to a sugar moiety to create a nucleoside that is capable of incorporation into an oligonucleotide, and wherein the group of atoms is capable of bonding with a complementary naturally occurring nucleobase of another oligonucleotide or nucleic acid. Nucleobases may be naturally occurring or may be modified.
- oligonucleotide means a compound comprising a plurality of linked nucleosides.
- an oligonucleotide comprises one or more unmodified ribonucleosides (RNA) and/or unmodified deoxyribonucleosides (DNA) and/or one or more modified nucleosides.
- oligomeric compound means a polymeric structure comprising two or more sub-structures.
- an oligomeric compound comprises an oligonucleotide.
- an oligomeric compound comprises one or more conjugate groups and/or terminal groups.
- an oligomeric compound consists of an oligonucleotide. Oligomeric compounds also include naturally occurring nucleic acids.
- single-stranded means an oligomeric compound that is not hybridized to its complement and which lacks sufficient self-complementarity to form a stable self-duplex.
- double-stranded means an oligomeric compound that is partially or completely hybridized to its complement to form a stable duplex molecule.
- a double-stranded oligomeric compound may be composed of two separate strands of complementary oligomeric compounds hybridized to each other or a single oligomeric compound which has sufficient self- complementarity to form a stable self-duplex.
- Stable self-duplexes may contain stem-loop structure(s) and/or bulge(s).
- isolated refers to a substance that has been isolated from its natural environment or artificially produced.
- isolated refers to a cell that has been isolated from its natural environment (e.g., from a subject, organ, tissue, or bodily fluid).
- nucleic acid refers to a nucleic acid that has been isolated or purified from its natural environment (e.g., from a cell, cell organelle, or cytoplasm), recombinantly produced, amplified, or synthesized.
- an isolated nucleic acid includes a nucleic acid contained within a vector.
- wild-type or non-mutant form of a gene refers to a nucleic acid that encodes a protein associated with normal or non-pathogenic activity (e.g., a protein lacking a mutation, such as a repeat region expansion that results in higher risk of developing, onset, or progression of a neurodegenerative disease).
- mutation refers to any change in the structure of a gene, e.g., gene sequence, resulting in an altered form of the gene, which may be passed onto subsequent generations (hereditary mutation) or not (somatic mutation).
- Gene mutations include the substitution, insertion, or deletion of a single base in DNA or the substitution, insertion, deletion, or rearrangement of multiple bases or larger sections of genes or chromosomes, including repeat expansions.
- inhibitory nucleic acid refers to a nucleic acid that comprises a guide strand sequence that hybridizes to at least a portion of a target nucleic acid, e.g., target RNA, mRNA, or pre-mRNA, and inhibits its expression or activity.
- An inhibitory nucleic acid may target a protein coding region (e.g., exon) or non-coding region (e.g., 5’UTR, 3’UTR, intron, etc.) of a target nucleic acid.
- an inhibitory nucleic acid is a single stranded or double stranded molecule.
- an inhibitory nucleic acid may further comprise a passenger strand sequence on a separate strand (e.g., double stranded duplex) or in the same strand (e.g., single stranded, selfannealing duplex structure).
- an inhibitory nucleic acid is an RNA molecule, such as a siRNA, shRNA, pri-miRNA, pre-miRNA, or miRNA.
- an inhibitory nucleic acid is double-stranded RNA (dsRNA), such as a pri-miRNA, pre-miRNA, miRNA, or shRNA.
- a “microRNA” or “miRNA” refers to a small non-coding RNA molecule capable of mediating silencing of a target gene by cleavage of the target mRNA, translational repression of the target mRNA, target mRNA degradation, or a combination thereof.
- miRNA is transcribed as a hairpin or stem-loop (e.g., having a self-complementary, single-stranded backbone) duplex structure, referred to as a primary miRNA (pri-miRNA), which is enzymatically processed (e.g., by Drosha, DGCR8, Pasha, etc.) into a pre-miRNA.
- Pre-miRNA is exported into the cytoplasm, where it is enzymatically processed by Dicer to produce a miRNA duplex with the passenger strand and then a single- stranded mature miRNA molecule, which is subsequently loaded into the RNA-induced silencing complex (RISC).
- RISC RNA-induced silencing complex
- Reference to a miRNA may include synthetic or artificial miRNAs.
- a “synthetic miRNA” or “artificial miRNA” or “amiRNA” or “small binding RNA” refers to an endogenous, modified, or synthetic pri-miRNA or pre-miRNA (e.g., miRNA backbone or scaffold) in which the endogenous miRNA guide sequence and passenger sequence within the stem sequence have been replaced with a heterologous guide sequence and a heterologous passenger sequence that direct highly efficient RNA silencing of the targeted gene see, e.g., Eamens et al. (2014), Methods Mol. Biol. 1062:211-224).
- the nature of the complementarity of the guide and passenger sequences can be similar or different from the nature of complementarity of the guide and passenger sequences in the endogenous miRNA backbone upon which the synthetic miRNA is constructed.
- microRNA backbone refers to a pri-miRNA or pre-miRNA scaffold, with the stem sequence replaced by a heterologous RNA of interest, and is capable of producing a functional, mature miRNA that directs RNA silencing at the gene targeted by the miRNA of interest.
- a miR backbone comprises a 5’ flanking region (also referred to herein as a “5’ flanking polynucleotide” or a “5’ leader”), a loop motif region (also referred to herein as a “loop polynucleotide”), and a 3’ flanking region (also referred to herein as a “3’ flanking polynucleotide” or a “3’ trailer”).
- a miR backbone comprises a 5’ flanking region and a 3’ flanking region (and does not include a loop motif region).
- a miR backbone may be derived completely or partially from a wild type miRNA scaffold or be a completely artificial sequence.
- shRNA short hairpin RNA
- shRNA includes a conventional stemloop shRNA, which forms a precursor miRNA (pre -miRNA).
- shRNA also includes micro-RNA embedded shRNAs (miRNA-based shRNAs), wherein the guide strand and the passenger strand of the miRNA duplex are incorporated into an existing (or natural) miRNA or into a modified or synthetic (designed) miRNA.
- miRNA-based shRNAs micro-RNA embedded shRNAs
- a conventional shRNA forms a primary miRNA (pri-miRNA) or a structure very similar to a natural pri-miRNA.
- pri-miRNA is subsequently processed by Drosha and its cofactors into pre-miRNA. Therefore, the term “shRNA” includes pri- miRNA molecules and pre-miRNA molecules.
- a “stem-loop structure” refers to a nucleic acid having a secondary structure that includes a region of nucleotides which are known or predicted to form a double strand or self-duplex (stem portion) that is linked on one side by a region of predominantly single-stranded nucleotides (terminal loop portion).
- the terms “hairpin”, “self-duplex” and “fold-back” structures are also used herein to refer to stem-loop structures. Such structures are well known in the art and the term is used consistently with its known meaning in the art.
- the secondary structure does not require exact base-pairing.
- the stem can include one or more base mismatches or bulges.
- the base-pairing can be exact, i.e. not include any mismatches.
- the term “guide strand sequence” of an inhibitory nucleic acid refers to a sequence that is substantially complementary (e.g., at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary) to a region of about 10-50 nucleotides (e.g., about 15-30, 16-25, 18-23, or 19-22 nucleotides) of the mRNA or pre-mRNA targeted for silencing.
- the guide sequence is sufficiently complementary to the target mRNA sequence to direct target-specific silencing, e.g., to trigger the destruction of the target mRNA by the RNAi machinery or process or to reduce translation of the target mRNA.
- the guide strand sequence refers to the mature guide sequence remaining following cleavage by Dicer.
- the term “passenger strand sequence” of an inhibitory nucleic acid refers to a sequence that is homologous to the target mRNA or pre-mRNA, and partially or completely complementary to the guide strand sequence of an inhibitory nucleic acid.
- the guide strand sequence and passenger strand sequence of an inhibitory nucleic acid are hybridized to form a duplex structure (e.g., forming a double-stranded duplex or single-stranded self-annealing duplex structure).
- the guide strand sequence and passenger strand sequence refers to the mature sequences remaining following cleavage by Dicer.
- the term “5’ arm” or “5’ stem” refers to a portion of a double stranded RNA (e.g., shRNA, pre-miRNA, pri-mRNA) that comprises the guide strand or passenger strand.
- 3’ arm or “3’ stem” refers to a portion of a double stranded RNA that comprises the passenger strand to the 5’ stem’s guide strand, or the guide strand to the 5’ stem’s passenger strand.
- a “duplex,” when used in reference to an inhibitory nucleic acid, refers to two nucleic acid strands (e.g., a guide strand and passenger strand) hybridizing together to form a duplex structure.
- a duplex may be formed by two separate nucleic acid strands or by a single nucleic acid strand having a region of self-complementarity (e.g., hairpin or stem-loop).
- target nucleic acid means a nucleic acid molecule to which an antisense compound hybridizes.
- a target nucleic acid may be a mRNA (target mRNA) or pre-mRNA (target pre-mRNA) encoded by a target gene.
- targeting means the association of an antisense compound to a particular target nucleic acid molecule or a particular region of a target nucleic acid molecule.
- a double-stranded RNA targets a target nucleic acid if it is sufficiently complementary to the target nucleic acid to allow hybridization under physiological conditions.
- complementary refers to the ability of polynucleotides to form base pairs with each other.
- Base pairs are typically formed by hydrogen bonds between nucleotide subunits in antiparallel polynucleotide strands or a single, self-annealing polynucleotide strand.
- Complementary polynucleotide strands can form base pairs in the Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes.
- complementary nucleotides include G and U (wobble base pair).
- uracil rather than thymine is the base that is considered to be complementary to adenosine.
- a “U” is denoted in the context of the present invention, the ability to substitute a “T” is understood, unless otherwise stated.
- Complementarity also encompasses Watson-Crick base pairing between non-modified and modified nucleobases (e.g., 5-methyl cytosine substituted for cytosine).
- % complementarity refers to the number of nucleotides of a contiguous nucleotide sequence in a nucleic acid molecule that are complementary to an aligned reference sequence (e.g., a target mRNA, passenger strand), divided by the total number of nucleotides and multiplying by 100. In such an alignment, a nucleobase/nucleotide which does not form a base pair is called a mismatch.
- Insertions and deletions are not permitted in calculating % complementarity of a contiguous nucleotide sequence. It is understood by skilled persons in the art that in calculating complementarity, chemical modifications to nucleobases are not considered as long as the Watson-Crick base pairing capacity of the nucleobase is retained (e.g., 5-methyl cytosine is considered the same as cytosine for the purpose of calculating % complementarity).
- non-complementary in reference to nucleobases means a pair of nucleobases that do not form hydrogen bonds with one another.
- mismatch means a nucleobase of a first oligomeric compound that is not capable of pairing with a nucleobase at a corresponding position of a second oligomeric compound, when the first and second oligomeric compound are aligned.
- Either or both of the first and second oligomeric compounds may be oligonucleotides.
- Nucleotides that do not base pair include selfpairing nucleotides (A-A, T-T, U-U, C-C, and G-G), A and C, C and U, C and T, A and G.
- a mismatch does not include G-U wobble base pairs.
- nucleobases are not considered as long as the Watson-Crick base pairing capacity of the nucleobase is retained (e.g., 5-methyl cytosine is considered the same as cytosine for the purpose of calculating % identity).
- hybridizing refers to two nucleic acid strands forming hydrogen bonds between base pairs on antiparallel strands, thereby forming a duplex. While not limited to a particular mechanism, the most common mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
- the strength of hybridization between two nucleic acid strands may be described by the melting temperature (T m ), defined as at a given ionic strength and pH, the temperature at which 50% of a target sequence hybridizes to a complementary polynucleotide.
- heterologous refers to a nucleic acid that is not found in a native (naturally occurring) nucleic acid.
- a heterologous guide sequence and a heterologous passenger sequence comprises a nucleotide sequence that is not associated with the microRNA in nature.
- the “guide sequence” is interchangeable with “first strand” (or “targeting strand”, where the “targeting strand” hybridizes to a target RNA) of a double-stranded RNA, regardless of the orientation.
- expression cassette refers to any type of genetic construct containing a nucleic acid (e.g., transgene) in which part or all of the nucleic acid encoding sequence is capable of being transcribed.
- expression includes transcription of the nucleic acid, for example, to generate a biologically-active polypeptide product or inhibitory RNA (e.g., siRNA, shRNA, miRNA) from a transcribed gene.
- inhibitory RNA e.g., siRNA, shRNA, miRNA
- the transgene is operably linked to expression control sequences.
- transgene refers to an exogenous nucleic acid that has been transferred naturally or by genetic engineering means into another cell and is capable of being transcribed, and optionally translated.
- the term “gene expression” refers to the process by which a nucleic acid is transcribed from a nucleic acid molecule, and often, translated into a peptide or protein.
- the process can include transcription, post-transcriptional control, post-transcriptional modification, translation, post-translational control, post-translational modification, or any combination thereof.
- Reference to a measurement of “gene expression” may refer to measurement of the product of transcription (e.g., RNA or mRNA), or the product of translation (e.g., peptides or proteins).
- the term “inhibit expression of a gene” means to reduce, down-regulate, suppress, block, lower, or stop expression of the gene.
- the expression product of a gene can be an RNA molecule transcribed from the gene (e.g., an mRNA) or a polypeptide translated from an mRNA transcribed from the gene.
- a reduction in the level of an mRNA results in a reduction in the level of a polypeptide translated therefrom.
- inhibition of expression reduces the level of a polypeptide without substantially affecting production of the encoding mRNA.
- the level of expression may be determined using standard techniques for measuring mRNA or protein.
- vector refers to a genetic construct that is capable of transporting a nucleic acid molecule (e.g., transgene encoding inhibitory nucleic acid) between cells and effecting expression of the nucleic acid molecule when operably-linked to suitable expression control sequences.
- Expression control sequences may include transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
- the vector may be a plasmid, phage particle, transposon, cosmid, phagemid, chromosome, artificial chromosome, virus, virion, lipid nanoparticle, etc.
- the vector Once transformed into a suitable host cell, the vector may replicate and function independently of the host genome, or may, in some instances, integrate into the genome itself.
- a host cell refers to any cell that contains, or is capable of containing a composition of interest, e.g., an inhibitory nucleic acid.
- a host cell is a mammalian cell, such as a rodent cell (e.g., mouse or rat) or primate cell (e.g., monkey, chimpanzee, or human).
- a host cell may be in vitro or in vivo.
- a host cell may be from an established cell line or primary cells.
- a host cell may be obtained from a patient having or suspected of having a repeat expansion disease or disorder.
- a host cell is a non-CNS cell, such as a fibroblast.
- a host cell is a cell of the CNS, such as a neuron, a glial cell, an astrocyte, or a microglial cell.
- “expanded repeat containing gene” or “expanded repeat containing RNA” refers to a mutant gene or RNA molecule (e.g., pre-mRNA or mRNA) encoded by the mutant gene having a base sequence that includes a repeat region (e.g., CAG repeat) where the repeat region is expanded beyond a predetermined number or range of base repeats that are typically present in a “normal” expanded repeat containing gene or RNA encoded by the gene.
- the presence or length of the repeat region may affect normal processing, function or activity of the RNA or encoded protein and cause a “repeat expansion” or “expanded repeat” disease or disorder.
- Expanded repeats may be unstable (dynamic) mutations that change size in successive generations.
- An expanded repeat may be a dinucleotide repeat, a trinucleotide repeat, a tetranucleotide repeat, a pentanucleotide repeat, a hexanucleotide repeat, etc.
- a repeat is a CAG repeat or polyglutamine.
- An expanded repeat containing gene or RNA encoded by the expanded repeat containing gene may also be referred to as a “pathologic allele” or “pathogenic allele.”
- a pathologic or pathogenic allele of a CAG repeat containing gene or RNA encoded by the gene has > 30 consecutive CAG repeats.
- a “repeat expansion disease or disorder,” or “expanded repeat disease or disorder,” refers to a disease or disorder caused by the expansion of a base repeat sequence beyond a predetermined number or range of base repeats that are typically present in a “normal” expanded repeat containing gene or RNA encoded by the gene.
- a repeat expansion disease or disorder may manifest with markedly varied phenotypes depending on the size of the repeat expansion.
- Repeat expansion diseases or disorders are primarily neurodegenerative diseases. Some repeat expansion diseases are ophthalmologic diseases.
- a repeat expansion disease or disorder is a poly glutamine disease.
- neurodegenerative disease or “neurodegenerative disorder” refers to diseases or disorders that exhibit neural cell death as a pathological state.
- a neurodegenerative disease may exhibit chronic neurodegeneration, e.g., slow, progressive neural cell death over a period of several years, or acute neurodegeneration, e.g., sudden onset or neural cell death.
- chronic, neurodegenerative diseases include Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, spinocerebellar ataxia types 1-8 (SCA1-8), frontotemporal dementia (FTD), and amyotrophic lateral sclerosis (ALS).
- a neurodegenerative disease may exhibit death of mainly one type of neuron or of multiple types of neurons.
- subject As used herein, “subject,” “patient,” and “individual” are used interchangeably herein and refer to living organisms (e.g., mammals) selected for treatment or therapy. Examples of subjects include human and non-human mammals, such as primates (monkey, chimpanzee), cows, horses, sheep, dogs, cats, rats, mice, guinea pigs, pigs, and transgenic species thereof.
- mammals e.g., mammals
- Double stranded RNAs of the disclosure modulate expression of a target RNA (e.g., mRNA or pre-mRNA) transcript.
- Double stranded RNAs include precursor molecules, which are processed inside the cell prior to modulation.
- Double stranded RNAs may be encoded in a plasmid, vector, genome, or other nucleic acid expression vector for delivery to a cell.
- artificial double stranded RNA comprise from 5’ to 3’: (a) a 5’ leader sequence; (b) a 5’ stem comprising or substantially comprising a passenger sequence or a guide sequence; (c) a 5’ linker of 1-6 bases; (d) a terminal loop; (e) a 3’ linker of 1-6 bases; (f) a 3’ stem comprising or substantially comprising: (i) a guide sequence if the 5’ stem comprises or substantially comprises the passenger sequence; or (ii) a passenger sequence if the 5’ stem comprises or substantially comprises the guide sequence; and (g) a 3’ trailer sequence; wherein the guide sequence targets a CAG repeat region of a CAG repeat containing mRNA or pre-mRNA and comprises 1-5 base mismatches relative to the CAG repeat region, wherein the base mismatches are located at positions 8-16 of the guide sequence.
- the double stranded RNA refers to a single RNA oligonucleotide compound having at least partial self-complementarity to form a stable self-duplex. Unless otherwise specified, numbering of the nucleotide positions in the double-stranded RNA counts from the 5’ to 3’ direction on the single RNA strand. Similarly, unless otherwise specified, nucleotide sequence is read from the 5’ to 3’ direction on the single RNA strand.
- An artificial double stranded RNA of the present disclosure comprises a 5’ leader, also referred to as a 5’ flanking, sequence.
- the 5’ leader sequence may be derived from or obtained in whole or in part from wild type microRNA sequence or be in whole or in part artificial.
- 5’ leader sequence is derived from or obtained in whole or in part from the flanking sequence of a wild type pre-miRNA scaffold or pri-miRNA scaffold.
- the 5’ leader sequence is contiguously linked to the 5’ stem comprising or substantially comprising a passenger or a guide sequence.
- the 5’ leader sequence may be of any length.
- the 5’ leader sequence is about 1 nucleotide to about 1,000 nucleotides in length, about 1 nucleotide to about 900 nucleotides, about 1 nucleotide to about 800 nucleotides, about 1 nucleotide to about 700 nucleotides, about 1 nucleotide to about 600 nucleotides, about 1 nucleotide to about 500 nucleotides, 1 nucleotide to about 400 nucleotides, about 1 nucleotide to about 300 nucleotides, about 1 nucleotide to about 200 nucleotides, about 1 nucleotide to about 100 nucleotides, about 1 nucleotide to about 75 nucleotides about 1 nucleotide to about 50 nucleotides, about 1 nucleotide to about
- the 5’ leader comprises a 5’ bulge sequence.
- the term “bulge sequence” refers to a region of nucleic acid that is non-complementary to the nucleic acid opposite it in a duplex.
- a duplex may contain a region of complementary nucleic acids, then a region of non-complementary nucleic acids, followed by a second region of complementary nucleic acids.
- the regions of complementary nucleic acids will bind to each other, whereas the central non-complementary region will not bind, thereby forming a “bulge.”
- the two strands of nucleic acid positioned between the two complementary regions will be of different lengths, thereby forming a “bulge.”
- An artificial double-stranded RNA of the present disclosure comprises a 3’ trailer, also referred to as a 3’ flanking sequence.
- the 3’ bailer sequence may be derived from or obtained in whole or in part from wild type microRNA sequence or be in whole or in part artificial.
- the 3’ trailer sequence is derived from or obtained in whole or in part from the flanking sequence of a wild type pre-miRNA scaffold or pri-miRNA scaffold.
- the 3’ trailer sequence is contiguously linked to the 3’ stem comprising or substantially comprising a guide or a passenger sequence.
- the 3’ bailer sequence may be of any length.
- the 3’ trailer sequence is about 1 nucleotide to about 1,000 nucleotides in length, about 1 nucleotide to about 900 nucleotides, about 1 nucleotide to about 800 nucleotides, about 1 nucleotide to about 700 nucleotides, about 1 nucleotide to about 600 nucleotides, about 1 nucleotide to about 500 nucleotides, 1 nucleotide to about 400 nucleotides, about 1 nucleotide to about 300 nucleotides, about 1 nucleotide to about 200 nucleotides, about 1 nucleotide to about 100 nucleotides, about 1 nucleotide to about 75 nucleotides about 1 nucleotide to about 50 nucleotides, about 1 nucleotide to
- the 3’ bailer comprises a polyU (polyuridine) tail.
- the 3’ trailer comprises 3-6 uridines, e.g., 3 uridines, 4 uridines, 5 uridines or 6 uridines.
- the polyU tail is immediately adjacent to the guide sequence or passenger sequence in the 3’ stem.
- artificial double stranded RNA having a 3’ bailer comprising a polyU tail is expressed using a Pol III promoter.
- the 3’ bailer comprises a polyadenylation (pA) signal sequence.
- Suitable polyadenylation signals include, but are not limited to, an SV40 late pA signal, a BGH pA signal, and the like.
- an artificial double stranded RNA having a 3’ bailer comprising a pA signal sequence is expressed using a Pol II promoter.
- the 5’ leader sequence and 3’ trailer sequence have the same number of nucleotides. In some embodiments, the 5’ leader sequence and 3’ trailer sequence have different lengths.
- the 5’ leader sequence and 3’ trailer sequence are obtained or derived from, in whole or in part, the same miRNA scaffold, for example the same wild type pre- miRNA scaffold or the same pri-miRNA scaffold. In some embodiments, the 5’ leader sequence and 3’ trailer sequence are both obtained from or derived from, in whole or in part, the miR-33 scaffold. In some embodiments, the 5’ leader sequence and 3’ trailer sequence are both obtained or derived from, in whole or in part, the pri-miR-33 scaffold. In some embodiments, the 5’ leader sequence and 3’ bailer sequence are both obtained or derived from, in whole or part, the pre-miR- 33 scaffold.
- the 5’ leader sequence and 3’ trailer sequence are selected from Table E. In some embodiments, the 5’ leader sequence is not complementary to the 3’ trailer sequence. In some embodiments, the 5’ leader sequence is partially complementary to the 3’ trailer sequence. In some embodiments, the 5’ leader sequence contains one, two, or more C mismatches to the uridine(s) in the polyU tail in the 3’ trailer sequence (or C-T mismatch for a DNA sequence encoding the double stranded RNA).
- the 5’ leader and 3’ trailer sequences contain sequences that allow for recognition and cleavage by Drosha.
- the canonical pathway of miRNA biogenesis in mammals is initiated by the Drosha-DGCR8 (DiGeorge syndrome critical region gene 8) complex (the Microprocessor), which processes long primary miRNAs (pri-miRNAs) into ⁇ 60-nt pre-miRNAs for further processing by Dicer into a duplex ⁇ 22 nt long.
- primary miRNA sequences used as, or as part of the 5’ leader sequence and/or 3’ trailer sequence may direct Drosha cleavage of the double-stranded RNA.
- the artificial double-stranded RNA is processed by a Drosha independent/Dicer dependent pathway.
- splicing, 3 '-5' exoribonuclease, or pol III termination may substitute for Drosha cleavage.
- the artificial double-stranded RNA is processed by a Drosha dependent/Dicer independent pathway.
- Drosha dependent/ Dicer independent pathway processing is provided by pri-miR-451 , which is processed by Drosha, resulting in a pre- miR-451, which is then cleaved by Ago2 (argonaute 2), ac-pre-mir-451 , which is further resected by an as yet unknown mechanism to generate mature miR-451.
- the 5’ leader sequence and/or 3’ trailer sequence comprises or consists of a nucleotide sequence set forth in Table A.
- an artificial doublestranded RNA comprises a 5’ leader sequence comprising or consisting of CCGG and a 3’ trailer sequence comprising or consisting of UUUUUG.
- an artificial doublestranded RNA comprises a 5’ leader sequence comprising or consisting of CC and a 3’ trailer sequence comprising or consisting of UUUUUG.
- an artificial doublestranded RNA comprises a 5’ leader sequence comprising or consisting of GCUG and a 3’ trailer sequence comprising or consisting of ga uuuuug.
- an artificial doublestranded RNA comprises a 5’ leader sequence comprising or consisting of SEQ ID NO:7 and a 3’ trailer sequence comprising or consisting of SEQ ID NO: 13.
- the 5’ stem (or 5’ arm) of the double stranded RNA comprises a passenger sequence, also sometimes referred to as sense sequence.
- the passenger sequence has identity to the target mRNA transcript.
- the passenger sequence may be about 15-30 nucleotides in length, for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. In some embodiments, the passenger sequence may be about 19-24 nucleotides in length.
- the 3’ stem (or 3’ arm) of the double stranded RNA comprises a guide sequence, also sometimes referred to as antisense sequence.
- the guide sequence has complementarity to the target mRNA transcript.
- the guide strand may be about 15-30 nucleotides in length, for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. In some embodiments, the guide sequence may be about 19-24 nucleotides in length.
- the 5’ stem comprises the guide sequence while the 3’ stem comprises the passenger sequence of the double stranded RNA.
- the guide sequence and passenger sequence have sufficient complementarity to form a double stranded siRNA molecule upon processing in a host cell, which acts as a suitable substrate for the RNA interference machinery such that the guide sequence derived from the 3’ stem (or 5’ stem) is recognized by the RISC complex and targets its specific mRNA transcript.
- the guide sequence and passenger sequence have 100% complementarity.
- the guide sequence and passenger sequence are substantially complementary to each other, e.g.., about 70%, 75%, 80%, 85%, 90%, 95%, or 99% complementary.
- the passenger sequence may comprise one to ten or one to five base mismatches or bulges.
- the guide sequence may comprise a seed sequence, which has perfect or near-perfect Watson-Crick complementarity to the target mRNA sequence, located at positions 1-7, 2-7, 1-8, or 2-8, of the guide sequence relative to the first 5’ nucleotide of the guide strand.
- the seed region is important for efficient gene silencing by double stranded RNAs.
- the guide sequence targets a CAG repeat region of a CAG repeat containing mRNA and comprises 1-5 mismatches relative to the CAG repeat region, wherein the base mismatches are located at positions 8-16 of the guide sequence.
- a mismatch includes self-pairing nucleotides (A- A, U-U, T-T, C-C, and G-G), A and C pairing, C and U pairing, C and T pairing, and A and G pairing.
- the mismatch comprises a purine mismatch, such as introducing an adenosine base into the guide strand.
- the guide sequence targeting a CAG repeat region comprises about 1-5 base mismatches relative to the CAG repeat region of a CAG repeat containing mRNA. In some embodiments, the guide sequence targeting a CAG repeat region comprises about 1-4 base mismatches, about 1-3 base mismatches, about 1-2 base mismatches, about 2-5 base mismatches, about 3-4 base mismatches, about 3-5 base mismatches, or about 4-5 base mismatches relative to the CAG repeat region of a CAG repeat containing mRNA.
- the guide sequence targeting a CAG repeat region comprises about one mismatch, about two mismatches, about three mismatches, about four mismatches, or about five mismatches relative to the CAG repeat region of a CAG repeat containing mRNA.
- At least one mismatch (1, 2, 3, 4, or 5) relative to the CAG repeat region may be located at positions 8-12 of the guide sequence. In some embodiments, at least one mismatch (1, 2, or 3) relative to the CAG repeat region may be located at positions 9-11 of the guide sequence. In some embodiments, two or more mismatches relative to the CAG repeat region located at positions 8-16 of the guide sequence are contiguous or adjacent to each other. In some embodiments, at least one mismatch relative to the CAG repeat region located at positions 8-16 is not adjacent to another mismatch located at positions 8-16.
- a single mismatch relative to the CAG repeat region is located at position 8 of the guide sequence. In some embodiments, a single mismatch relative to the CAG repeat region is located at position 9 of the guide sequence. In some embodiments, a single mismatch relative to the CAG repeat region is located at position 10 of the guide sequence. In some embodiments, a single mismatch relative to the CAG repeat region is located at position 11 of the guide sequence.
- one mismatch relative to the CAG repeat region is located at position 8 of the guide sequence and one mismatch relative to the CAG repeat region is located at any of positions 9-16 of the guide sequence. In some embodiments, one mismatch relative to the CAG repeat region is located at position 9 of the guide sequence and one mismatch relative to the CAG repeat region is located at any of positions 10-16 of the guide sequence. In some embodiments, one mismatch relative to the CAG repeat region is located at position 10 of the guide sequence and one mismatch relative to the CAG repeat region is located at any of positions 11-16 of the guide sequence. In some embodiments, one mismatch relative to the CAG repeat region is located at position 11 of the guide sequence and one mismatch relative to the CAG repeat region is located at any of positions 12-16 of the guide sequence.
- one mismatch relative to the CAG repeat region is located at position 8 of the guide sequence, one mismatch relative to the CAG repeat region is located at position 9 of the guide sequence, and one mismatch relative to the CAG repeat region is located at any of positions 10-16 of the guide sequence. In some embodiments, one mismatch relative to the CAG repeat region is located at position 9 of the guide sequence, one mismatch relative to the CAG repeat region is located at position 10 of the guide sequence, and one mismatch relative to the CAG repeat region is located at any of positions 11-16 of the guide sequence.
- one mismatch relative to the CAG repeat region is located at position 10 of the guide sequence, one mismatch relative to the CAG repeat region is located position 11 of the guide sequence, and one mismatch relative to the CAG repeat region is located at any of positions 12-16 of the guide sequence. In some embodiments, one mismatch relative to the CAG repeat region is located at position 11 of the guide sequence, one mismatch relative to the CAG repeat region is located at position 12 of the guide sequence, and one mismatch relative to the CAG repeat region is located at any of positions 13-16 of the guide sequence.
- one mismatch relative to the CAG repeat region is located at position 8 of the guide sequence, one mismatch relative to the CAG repeat region is located position 9 of the guide sequence, one mismatch relative to the CAG repeat region is located at any of positions 12-16 of the guide sequence, and one mismatch relative to the CAG repeat region is located at position 14, 15, or 16. In some embodiments, one mismatch relative to the CAG repeat region is located at position 9 of the guide sequence, one mismatch relative to the CAG repeat region is located position 10 of the guide sequence, one mismatch relative to the CAG repeat region is located at any of positions 11-16 of the guide sequence, and one mismatch relative to the CAG repeat region is located at position 15 or 16.
- one mismatch relative to the CAG repeat region is located at position 9 of the guide sequence, one mismatch relative to the CAG repeat region is located position 11 of the guide sequence, one mismatch relative to the CAG repeat region is located at any of positions 12-16 of the guide sequence, and one mismatch relative to the CAG repeat region is located at position 13, 14, 15 or 16.
- one mismatch relative to the CAG repeat region is located at position 9 of the guide sequence, one mismatch relative to the CAG repeat region is located position 10 of the guide sequence, one mismatch relative to the CAG repeat region is located at position 11 of the guide sequence, one mismatch relative to the CAG repeat region is located at position 15 of the guide sequence, and one mismatch relative to the CAG repeat region is located at position 16 of the guide sequence.
- the mismatches at positions 9, 10 and 11 are A, A, and A, respectively, and the mismatches at positions 15 and 16 are AA, AU, UA, or UU.
- a guide sequence targeting a CAG repeat region in a UGC register comprise one mismatch relative to the CAG repeat region is located at position 9 of the guide sequence, one mismatch relative to the CAG repeat region is located position 10 of the guide sequence, one mismatch relative to the CAG repeat region is located at position 12 of the guide sequence, one mismatch relative to the CAG repeat region is located at position 15 of the guide sequence, and one mismatch relative to the CAG repeat region is located at position 16 of the guide sequence.
- the mismatches at positions 9, 10 and 12 are A, C, and A, respectively, and the mismatches at positions 15 and 16 are AA, UA, or UU.
- a guide sequence targeting a CAG repeat region in a GCU register comprise one mismatch relative to the CAG repeat region is located at position 9 of the guide sequence, one mismatch relative to the CAG repeat region is located position 10 of the guide sequence, one mismatch relative to the CAG repeat region is located at position 11 of the guide sequence, one mismatch relative to the CAG repeat region is located at position 15 of the guide sequence, and one mismatch relative to the CAG repeat region is located at position 16 of the guide sequence.
- the mismatches at positions 9, 10 and 11 are A, U, and A, respectively, and the mismatches at positions 15 and 16 are AA or AU.
- the guide sequence targeting a CAG repeat region comprises or consists of any sequence selected from Tables B1-B2.
- a double stranded RNA comprises a guide sequence selected from Tables B1-B2 and a corresponding passenger sequence that is perfectly complementary to the guide sequence or has one to ten or one to five mismatches or bulges compared to the selected guide sequence.
- Nucleotide mismatch(es) in guide sequence relative to the CAG repeat region of a CAG repeat containing mRNA is in bold and underlined.
- specificity or selectivity of a guide sequence targeting a CAG repeat region of a CAG repeat containing mRNA or pre-mRNA increases with the number of base mismatches relative to the CAG repeat region, wherein the base mismatches are located at positions 8-16 of the guide sequence.
- Specificity (or off-target activity) of a guide sequence may be determined by detecting potential off-target matches in the human unspliced transcriptome (Ensembl database, release 100).
- the following steps may be used to measure off-target activity: measure frequency of off-target genes with perfect matches to the guide sequence; measure frequency of off-target genes with perfect 17mer match to guide sequence within positions 1-21; measure frequency of off-target genes matching the guide sequence having 0, 1, 2, 3, or 4 mismatches between positions 8 and 21 inclusive.
- Off-target frequencies of perfect matches perfect 17mer match over positions 1-21, matches to guide with 0 mismatch, matches to guide with 1 mismatch, off-target match to guide with 2 mismatches, off-target match to guide with 3 mismatches, off-target match to guide with 4 mismatches may be tallied.
- specificity of a guide sequence targeting a CAG repeat region of a CAG repeat containing mRNA or pre-mRNA increases with 2-5 base mismatches relative to the CAG repeat region, wherein the base mismatches are located at positions 8-16 of the guide sequence. In some embodiments, specificity of a guide sequence targeting a CAG repeat region of a CAG repeat containing mRNA or pre-mRNA increases with 3-5 base mismatches relative to the CAG repeat region, wherein the base mismatches are located at positions 8-16 of the guide sequence.
- a guide sequence targeting a CAG repeat region of a CAG repeat containing mRNA or pre-mRNA having 1, 2, 3, 4, or 5 base mismatches relative to the CAG repeat region, wherein the base mismatches are located at positions 8-16 of the guide sequence has 0 predicted perfectly matching off-target transcripts.
- a guide sequence targeting a CAG repeat region of a CAG repeat containing mRNA or pre-mRNA having 1, 2, 3, 4, or 5 base mismatches relative to the CAG repeat region wherein the base mismatches are located at positions 8-16 of the guide sequence, 0-2 predicted off-target transcripts with one mismatch.
- a guide sequence targeting a CAG repeat region of a CAG repeat containing mRNA or pre-mRNA having 1, 2, 3, 4, or 5 base mismatches relative to the CAG repeat region wherein the base mismatches are located at positions 8-16 of the guide sequence, 0-2 predicted off-target transcripts having perfect 17mer match within positions 1-21.
- a guide sequence targeting a CAG repeat region of a CAG repeat containing mRNA or pre-mRNA having 1, 2, 3, 4, or 5 base mismatches relative to the CAG repeat region wherein the base mismatches are located at positions 8-16 of the guide sequence, 0-66 predicted off-target transcripts with one mismatch.
- Table B4 shows exemplary filtering criteria for off-target activity of the guide sequences targeting a CAG repeat region of a CAG repeat containing mRNA or pre-mRNA from Table B3.
- specificity of a guide sequence targeting a CAG repeat region of a CAG repeat containing mRNA or pre-mRNA is according to any one of the thresholds set in Table B4, or a combination thereof.
- a linker is present in the artificial double stranded RNA, joining the stem and the loop of the artificial double stranded RNA.
- a 5’ linker joins the 5’ stem and the loop of the artificial double stranded RNA.
- a 3’ linker joins the 3’ stem and the loop of the artificial double stranded RNA.
- a 5’ linker joins the 5’ stem and the loop of the artificial double stranded RNA
- a 3’ linker joins the 3’ stem and the loop of the artificial double stranded RNA.
- the 5’ linker and/or 3’ linker has about 1-6 nucleotides, 1-5 nucleotides, 1-4 nucleotides, 1-3 nucleotides, 1-2 nucleotides, 2-6 nucleotides, 3-6 nucleotides, 4-6 nucleotides, 5-6 nucleotides, 2-5 nucleotides, or 2-4 nucleotides. In some embodiments, the 5’ linker and/or 3’ linker has about 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, or 6 nucleotides.
- the 5’ linker the same number of nucleotides as the 3’ linker. In some embodiments, the 5’ linker is 100% complementary to the 3’ linker. In some embodiments, the 5’ linker comprises or consists of the nucleotide sequence CAGC and/or the 3’ linker comprises or consists of the nucleotide sequence of GCUG. In some cases, a sbRNA of the present disclosure does not include linkers.
- the 5’ linker and 3’ linker each comprise at least 4 nucleotides, optionally wherein at least 75% of the 5’ linker nucleotides are complementary to the 3’ linker nucleotides.
- RNA has a 5’ linker of SEQ ID NO: 15 and a 3’ linker of SEQ ID NO:23.
- a terminal loop separates the 5’ linker and the 3’ linker of the artificial double stranded RNA.
- the terminal loop sequence may be of any length or have about 4 nucleotides to about 1,000 nucleotides, about 4 nucleotides to about 900 nucleotides, about 4 nucleotides to about 800 nucleotides, about 4 nucleotides to about 700 nucleotides, about 4 nucleotides to about 600 nucleotides, about 4 nucleotides to about 500 nucleotides, about 4 nucleotides to about 400 nucleotides, about 4 nucleotides to about 300 nucleotides, about 4 nucleotides to about 200 nucleotides, about 4 nucleotides to about 100 nucleotides, about 4 nucleotides to about 90 nucleotides about 4 nucleotides to about 80 nucleotides, about 4 nucleotides to about 70 nucleotides, about 4 nucleo
- the terminal loop sequence has about 4 nucleotides, 5 nucleotides, 6 nucleotides, 7, nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12, nucleotides, 13 nucleotides, 14 nucleotides, or 15 nucleotides.
- the terminal loop comprises a palindromic sequence.
- the terminal loop comprises an asymmetric sequence.
- the terminal loop comprises or consists of the nucleotide sequence of ACCUGC. Examples of loop sequences are provided in Table D.
- a double stranded RNA is an artificial miRNA comprising from 5’ to 3’: a 5’ leader sequence, a passenger sequence or guide sequence, a terminal loop, a guide sequence or passenger sequence, and a 3’ trailer sequence, wherein the guide sequence targets a CAG repeat region of a CAG repeat containing RNA and comprises 1-5 base mismatches relative to the CAG repeat region, wherein the base mismatches are located at positions 8-16 of the guide sequence.
- the 5’ leader sequence, 3’ trailer sequence, and terminal loop of the artificial miRNA are selected from Table E.
- the guide sequence is selected from Tables B1-B2.
- Table E Exemplary 5’ leader, 3’ trailer, and Terminal Loop Sequences nucleotides and/or the corresponding 3’ trailer of Table E is extended at the 3’ terminus with 4 nucleotides that are non-complementary to the 4 nucleotides of the 5’ terminus of the corresponding 5’ leader sequence for improved processing.
- a 5’ leader of Table E is extended at the 5’ terminus with 4 U’s and/or the corresponding 3’ trailer of Table E is extended at the 3’ terminus with 4 U’s for improved processing.
- double stranded RNAs of the disclosure comprising guide sequences targeting a CAG repeat region of a CAG repeat containing mRNA
- double stranded RNAs comprising guide sequences targeting a different frame, also referred to as register, of the CAG repeat region of the CAG repeat containing mRNA.
- targeting CAG repeats includes guide sequence having a +1 shift in frame to target AGC repeats or a +2 shift in frame to target GCA repeats and still target the same CAG repeat containing mRNA transcript.
- cleavage by Drosha and/or Dicer define the sequence and function of the siRNA produced from the double stranded RNA.
- the double stranded RNA is cleaved by Drosha within the 5’ leader sequence and/or the 3’ trailer sequence to produce shRNA comprising the guide sequence and passenger sequence.
- the shRNA is cleaved by Dicer to produce siRNA.
- the siRNA are loaded onto the RNA induced silencing complex (RISC).
- the double stranded RNA is a pri-miRNA-like molecule that is cleaved by Drosha to produce pre-miRNA.
- the pre-miRNA molecule is a shRNA-like molecule that can subsequently be processed by Dicer to result in an siRNA-like duplex.
- cleavage of the double stranded RNA is Dicer independent (e.g., cleaved by Ago2).
- the shRNA produced from the double stranded RNA has a 5’ overhang and/or 3’ overhang, e.g., 1-6 nucleotides.
- the shRNA produced from the double stranded RNA has a 2-3 nucleotide overhang at the 5’ end and/or the 3’ end.
- the shRNA produced from the double stranded RNA has a dinucleotide overhang at the 5’ end and/or the 3’ end. In some embodiments, the shRNA produced from the double stranded RNA has about 38 to 300 nucleotides, 38 to 250 nucleotides, 38 to 200 nucleotides, 38 to 150 nucleotides, 38 to 100 nucleotides, 38 to 75 nucleotides or 38 to 50 nucleotides.
- the siRNA produced or processed from the double stranded RNA in the mammalian cell comprise the 1-5 base mismatches relative to the CAG repeat region at their predicted positions within positions 8-16 of the guide sequence.
- the presence of the 1-5 base mismatches relative to the CAG repeat region at their predicted positions within positions 8-16 of the guide sequence may be reflective of correct 5’ processing of the guide strand.
- the siRNA produced or processed from the double stranded RNA in the mammalian cell and having the 1-5 base mismatches relative to the CAG repeat region at their predicted positions within positions 8-16 of the guide sequence are at an abundance of at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% or more in the mammalian cell (in vitro or in vivo) compared to other siRNAs produced or processed from the same double stranded RNA.
- the guide strand leads RISC to cognate target mRNAs in a sequence specific manner.
- the guide strand induces cleavage of the target mRNA transcript.
- the guide strand induces translational repression and/or posterior repression through mRNA decay.
- a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region; and ii) at least a second mismatch to the target CAG repeat region, wherein: 1) when the first mismatch is at position 8 based on the numbering of SEQ ID NO: 743 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743)), SEQ ID NO:744 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:744)), SEQ ID NO:745 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:745)), SEQ ID NO:866 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:866)), or SEQ ID NO:867 (UG
- the first strand comprises no more than 2 mismatches with the target CAG repeat region. In some cases, the first strand comprises no more than 3 mismatches with the target CAG repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target CAG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand.
- the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides.
- the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the doublestranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides. In some cases, the double-stranded RNA has a length of 25 nucleotides. In some cases, the guide sequence comprises any one of SEQ ID NOs:298-375 (see Table 6; FIG. 22) and has a length of 21 nucleotides.
- each mismatch is generated by substituting a nucleotide (e.g., a nucleotide present in CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), a nucleotide present in GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), or a nucleotide present in UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 867)) with a different nucleotide.
- a nucleotide e.g., a nucleotide present in CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), a nucleotide present in GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), or a nucleotide present in UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 867)
- each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.
- a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 8 based on the numbering of SEQ ID NO:743 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743)), SEQ ID NO:744 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:744)), or SEQ ID NO:745 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:745); and ii) a second mismatch to the target CAG repeat region, wherein the second mismatch is from 1 to 8 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence: CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743) wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743) and the second substitution generates the second mismatch and is from 1 to 8 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence: GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), and the second substitution generates the second mismatch and is from 1 to 8 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence: UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 867), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 867), and the second substitution generates the second mismatch and is from 1 to 8 bases 3’ of the first mismatch.
- the first strand comprises no more than 2 mismatches with the target CAG repeat region. In some cases, the first strand comprises no more than 3 mismatches with the target CAG repeat region.
- the first strand comprises no more than 4 mismatches with the target CAG repeat region.
- the second strand is 100% complementary to the first strand.
- the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand.
- the second strand comprises from 1 to 4 mismatches to the first strand.
- the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand.
- the second strand comprises no more than 1 mismatch to the first strand.
- the second strand comprises no more than 2 mismatches to the first strand.
- the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides.
- the doublestranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides. In some cases, the double-stranded RNA has a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G. In some cases, the first strand comprises a nucleotide sequence selected from SEQ ID NOs:317-324.
- the first strand comprises the following nucleotide sequence: CUGCUGCAACUGCUGCUGCUG (SEQ ID NOG 17; RNA guide strand sequence of “CUG_NA_B” in Table 6). In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCAGAUGCUGCUGCUG (SEQ ID NO:318; RNA guide strand sequence of “CUG_NA_C” in Table 6). In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCAGCAGCUGCUGCUG (SEQ ID NOG 19; RNA guide strand sequence of “CUG_NA_D” in Table 6).
- the first strand comprises the following nucleotide sequence: CUGCUGCAGCUACUGCUGCUG (SEQ ID NO:320; RNA guide strand sequence of “CUG_NA_E” in Table 6). In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCAGCUGAUGCUGCUG (SEQ ID NO:321; RNA guide strand sequence of “CUG_NA_F” in Table 6). In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCAGCUGCAGCUGCUG (SEQ ID NO:322; RNA guide strand sequence of “CUG_NA_G” in Table 6).
- the first strand comprises the following nucleotide sequence: CUGCUGCAGCUGCUACUGCUG (SEQ ID NO:323; RNA guide strand sequence of “CUG_NA_H” in Table 6). In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCAGCUGCUGAUGCUG (SEQ ID NO:324; RNA guide strand sequence of “CUG_NA_I” in Table 6). In some cases, the first strand comprises a nucleotide sequence selected from SEQ ID NOs:804-819 (as depicted in Table 8; FIG. 24).
- a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 8 based on the numbering of SEQ ID NO:743 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743)), SEQ ID NO:866 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:866)), or SEQ ID NO: 867 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 867)); and b) a second strand that hybridizes to the first strand, wherein the first strand comprises a second mismatch and a third mismatch to the target CAG repeat region, and wherein the second and third mismatches are from 1 to 8 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 1 to 8 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), and wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 1 to 8 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:867), and wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 867), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 1 to 8 bases 3’ of the first mismatch.
- the first strand comprises no more than 3 mismatches with the target CAG repeat region.
- the first strand comprises no more than 4 mismatches with the target CAG repeat region.
- the second strand is 100% complementary to the first strand.
- the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand.
- the second strand comprises from 1 to 4 mismatches to the first strand.
- the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand.
- the second strand comprises no more than 1 mismatch to the first strand.
- the second strand comprises no more than 2 mismatches to the first strand.
- the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides.
- the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides. In some cases, the double-stranded RNA has a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.
- a double-stranded RNA of the present disclosure comprises a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA, wherein the first strand comprises a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 8 based on the numbering of SEQ ID NO:743 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743)), SEQ ID NO:867 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:867)), or SEQ ID NO: 866 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 866)); and b) a second strand that hybridizes to the first strand, wherein the first strand comprises a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, and wherein the second, third, and fourth mismatches are from 1 to 8 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 1 to 8 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 1 to 8 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 867), wherein the first substitution generates the first mismatch and is at position 8 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:867), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 1 to 8 bases 3’ of the first mismatch.
- the first strand comprises no more than 4 mismatches with the target CAG repeat region.
- the second strand is 100% complementary to the first strand.
- the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand.
- the second strand comprises from 1 to 4 mismatches to the first strand.
- the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand.
- the second strand comprises no more than 1 mismatch to the first strand.
- the second strand comprises no more than 2 mismatches to the first strand.
- the second strand comprises no more than 3 mismatches to the first strand.
- the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the doublestranded RNA has a length of 23 nucleotides.
- the double-stranded RNA has a length of 24 nucleotides. In some cases, the double-stranded RNA has a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.
- a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 9 based on the numbering of SEQ ID NO:743 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743)), SEQ ID NO:744 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:744)), SEQ ID NO:745 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:745), SEQ ID NO: 866 (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:866)), or SEQ ID NO:867 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:867); and ii
- the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), and the second substitution generates the second mismatch and is from 1 to 7 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), and the second substitution generates the second mismatch and is from 1 to 7 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 867), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:867), and the second substitution generates the second mismatch and is from 1 to 7 bases 3’ of the first mismatch.
- the first strand comprises no more than 2 mismatches with the target CAG repeat region.
- the second strand is 100% complementary to the first strand.
- the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand.
- the second strand comprises no more than 5 mismatches to the first strand.
- the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.
- the double-stranded RNA has a length of 25 nucleotides.
- each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.
- the first strand comprises a nucleotide sequence selected from SEQ ID NOs:298-304.
- a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first mismatch is at position 9 based on the numbering of SEQ ID NO:743 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743)), SEQ ID NO:744 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:744)), SEQ ID NO:745 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:745), (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:866)), or SEQ ID NO:867 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:867), where the first strand comprises a second mismatch and a third mismatch to the target CAG repeat region, and where the second and third mismatches
- the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 1 to 7 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:866), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 1 to 7 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 867), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:867), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 1 to 7 bases 3’ of the first mismatch.
- the first strand comprises no more than 3 mismatches with the target CAG repeat region.
- the first strand comprises no more than 4 mismatches with the target CAG repeat region.
- the second strand is 100% complementary to the first strand.
- the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand.
- the second strand comprises from 1 to 4 mismatches to the first strand.
- the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand.
- the second strand comprises no more than 1 mismatch to the first strand.
- the second strand comprises no more than 2 mismatches to the first strand.
- the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides.
- the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides. In some cases, the double-stranded RNA has a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.
- the first strand comprises a nucleotide sequence selected from SEQ ID NOs:325-332 and 336-338. In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCUAAAGCUGCUGCUG (SEQ ID NO:325; RNA guide strand sequence of “CUG_307” in Table 6). In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCUAAUACUGCUGCUG (SEQ ID NO:326; RNA guide strand sequence of “CUG_334” in Table 6).
- the first strand comprises the following nucleotide sequence: CUGCUGCUAAUGAUGCUGCUG (SEQ ID NO:327; RNA guide strand sequence of “CUG_361” in Table 6). In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCUAAUGCAGCUGCUG (SEQ ID NO:328; RNA guide strand sequence of “CUG_388” in Table 6). In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCUAAUGCUACUGCUG (SEQ ID NO:329; RNA guide strand sequence of “CUG_415” in Table 6).
- the first strand comprises the following nucleotide sequence: CUGCUGCUACAGAUGCUGCUG (SEQ ID NO:330; RNA guide strand sequence of “CUG_631” in Table 6). In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCUACAGCAGCUGCUG (SEQ ID NO:331; RNA guide strand sequence of “CUG_658” in Table 6). In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCUACAGCUGAUGCUG (SEQ ID NO:332; RNA guide strand sequence of “CUG_712” in Table 6).
- the first strand comprises the following nucleotide sequence: CUGCUGCUAAUGCUGAUGCUG (SEQ ID NO:336; RNA guide strand sequence of “CUG_442” in Table 6). In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCUACAACUGCUGCUG (SEQ ID NO:337; RNA guide strand sequence of “CUG_604” in Table 6). In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCUACAGCUACUGCUG (SEQ ID NO:338; RNA guide strand sequence of “CUG_685” in Table 6).
- a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first mismatch is at position 9 based on the numbering of SEQ ID NO:743 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743)), SEQ ID NO:744 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:744)), SEQ ID NO:745 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:745), (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:866)), or SEQ ID NO:867 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:867), wherein the first strand comprises a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, and where
- the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 1 to 7 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 1 to 7 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:867), wherein the first substitution generates the first mismatch and is at position 9 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 867), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 1 to 7 bases 3’ of the first mismatch.
- the first strand comprises no more than 4 mismatches with the target CAG repeat region.
- the second strand is 100% complementary to the first strand.
- the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand.
- the second strand comprises from 1 to 4 mismatches to the first strand.
- the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand.
- the second strand comprises no more than 1 mismatch to the first strand.
- the second strand comprises no more than 2 mismatches to the first strand.
- the second strand comprises no more than 3 mismatches to the first strand.
- the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the doublestranded RNA has a length of 23 nucleotides.
- the double-stranded RNA has a length of 24 nucleotides. In some cases, the double-stranded RNA has a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G. In some cases, the first strand comprises a nucleotide sequence selected from SEQ ID NOs:341-344 and 347-367.
- a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, wherein the first strand comprises: i) a first mismatch to the target CAG repeat region, where the first mismatch is at position 10 based on the numbering of SEQ ID NO:743 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743)), SEQ ID NO:744 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:744)), SEQ ID NO:745 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:745), (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:866)), or SEQ ID NO:867 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:867); and ii) a second mismatch to
- the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), and wherein the second substitution generates the second mismatch and is from 1 to 6 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:866), and wherein the second substitution generates the second mismatch and is from 1 to 6 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:867), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 867), and wherein the second substitution generates the second mismatch and is from 1 to 6 bases 3’ of the first mismatch.
- the first strand comprises no more than 2 mismatches with the target CAG repeat region. In some cases, the first strand comprises no more than 3 mismatches with the target CAG repeat region.
- the first strand comprises no more than 4 mismatches with the target CAG repeat region.
- the second strand is 100% complementary to the first strand.
- the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand.
- the second strand comprises from 1 to 4 mismatches to the first strand.
- the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand.
- the second strand comprises no more than 1 mismatch to the first strand.
- the second strand comprises no more than 2 mismatches to the first strand.
- the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides.
- the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides. In some cases, the double-stranded RNA has a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G. In some cases, the first strand comprises a nucleotide sequence selected from SEQ ID N0s:305-310. First mismatch at position 10; 3 mismatches
- a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first mismatch is at position 10 based on the numbering of SEQ ID NO:743 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743)), SEQ ID NO:744 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:744)), or (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:745)), where the first strand comprises a second mismatch and a third mismatch to the target CAG repeat region, and where the second and third mismatches are from 1 to 6 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 1 to 6 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 1 to 6 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 867), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 867), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 1 to 6 bases 3’ of the first mismatch.
- the first strand comprises no more than 3 mismatches with the target CAG repeat region.
- the first strand comprises no more than 4 mismatches with the target CAG repeat region.
- the second strand is 100% complementary to the first strand.
- the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand.
- the second strand comprises from 1 to 4 mismatches to the first strand.
- the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand.
- the second strand comprises no more than 1 mismatch to the first strand.
- the second strand comprises no more than 2 mismatches to the first strand.
- the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides.
- the doublestranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides. In some cases, the double-stranded RNA has a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.
- the first strand comprises a nucleotide sequence selected from SEQ ID NO:333-335, 339, and 340. In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCUGAAGAUGCUGCUG (SEQ ID NO:333; RNA guide strand sequence of “CUG_2116” in Table 6). In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCUGAAGCAGCUGCUG (SEQ ID NO:334; RNA guide strand sequence of “CUG_2143” in Table 6).
- the first strand comprises the following nucleotide sequence: CUGCUGCUGAAGCUACUGCUG (SEQ ID NO:335; RNA guide strand sequence of “CUG_2170” in Table 6). In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCUGAAACUGCUGCUG (SEQ ID NO:339; RNA guide strand sequence of “CUG_2089” in Table 6). In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCUGAAGCUGAUGCUG (SEQ ID NO:340; RNA guide strand sequence of “CUG_2197” in Table 6).
- a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first mismatch is at position 11 based on the numbering of SEQ ID NO:743 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743)), SEQ ID NO:744 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:744)), SEQ ID NO:745 (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:745), (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:866)), or SEQ ID NO:867 (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:867), wherein the first strand comprises a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, and where
- the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 1 to 6 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:866), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 1 to 6 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:867), wherein the first substitution generates the first mismatch and is at position 10 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 867), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 1 to 6 bases 3’ of the first mismatch.
- the first strand comprises no more than 4 mismatches with the target CAG repeat region.
- the second strand is 100% complementary to the first strand.
- the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand.
- the second strand comprises from 1 to 4 mismatches to the first strand.
- the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand.
- the second strand comprises no more than 1 mismatch to the first strand.
- the second strand comprises no more than 2 mismatches to the first strand.
- the second strand comprises no more than 3 mismatches to the first strand.
- the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the doublestranded RNA has a length of 23 nucleotides.
- the double-stranded RNA has a length of 24 nucleotides. In some cases, the double-stranded RNA has a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G. In some cases, the first strand comprises a nucleotide sequence selected from SEQ ID NOs:345, 346, and 368-375.
- a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first strand comprises: i) a first mismatch to the target CAG repeat region, wherein the first mismatch is at position 11 based on the numbering of SEQ ID NO:743 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743)), SEQ ID NO:744 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:744)), (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:745), (GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), or (UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 867); and ii) a second mismatch to the target CAG repeat region, wherein the second mismatch is
- the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), and the second substitution generates the second mismatch and is from 1 to 5 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:866), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), and the second substitution generates the second mismatch and is from 1 to 5 bases 3’ of the first mismatch
- the first strand is a variant comprising at least a first and a second substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:743), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO:743), and the second substitution generates the second mismatch and is from 1 to 5 bases 3’ of the first mismatch.
- the first strand comprises no more than 2 mismatches with the target CAG repeat region. In some cases, the first strand comprises no more than 3 mismatches with the target CAG repeat region. In some cases, the first strand comprises no more than 4 mismatches with the target CAG repeat region. In some cases, the second strand is 100% complementary to the first strand. In some cases, the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand.
- the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides.
- the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the doublestranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides. In some cases, the double-stranded RNA has a length of 25 nucleotides.
- each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.
- the first strand comprises a nucleotide sequence selected from SEQ ID NOs:311-315.
- the first strand comprises a nucleotide sequence selected from SEQ ID NOs:793-803 (as depicted in Table 8; FIG. 24).
- the first strand comprises the following nucleotide sequence: CUGCUGCUGCAACUGCUGCUG (SEQ ID NO:311); RNA guide strand sequence of “CUG_217” in Table 6). In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCUGCAGAUGCUGCUG (SEQ ID NOG 12; RNA guide strand sequence of “CUG_226” in Table 6). In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCUGCAGCAGCUGCUG (SEQ ID NO:313; RNA guide strand sequence of “CUG_235” in Table 6).
- the first strand comprises the following nucleotide sequence: CUGCUGCUGCAGCUACUGCUG (SEQ ID NOG 14; RNA guide strand sequence of “CUG_244” in Table 6). In some cases, the first strand comprises the following nucleotide sequence: CUGCUGCUGCAGCUGAUGCUG (SEQ ID NO:315; RNA guide strand sequence of “CUG_253” in Table 6).
- a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first mismatch is at position 11 based on the numbering of SEQ ID NO:743 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743)), SEQ ID NO:744 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:744)), or (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:745)), where the first strand comprises a second mismatch and a third mismatch to the target CAG repeat region, and where the second and third mismatches are from 1 to 5 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 1 to 5 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 1 to 5 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, and a third substitution of the nucleotide sequence UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 867), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 867), wherein the second substitution generates the second mismatch and the third substitution generates the third mismatch, and wherein the second substitution and the third substitution are from 1 to 5 bases 3’ of the first mismatch.
- the first strand comprises no more than 3 mismatches with the target CAG repeat region.
- the first strand comprises no more than 4 mismatches with the target CAG repeat region.
- the second strand is 100% complementary to the first strand.
- the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand.
- the second strand comprises from 1 to 4 mismatches to the first strand.
- the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand.
- the second strand comprises no more than 1 mismatch to the first strand.
- the second strand comprises no more than 2 mismatches to the first strand.
- the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand. In some cases, the second strand comprises no more than 5 mismatches to the first strand. In some cases, the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides.
- the doublestranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides. In some cases, the double-stranded RNA has a length of 25 nucleotides. In some cases, each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.
- a double-stranded RNA of the present disclosure comprises: a) a first strand that hybridizes to a target CAG repeat region of a CAG repeat-containing RNA; and b) a second strand that hybridizes to the first strand, where the first mismatch is at position 11 based on the numbering of SEQ ID NO:743 (CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743)), SEQ ID NO:744 (GCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:744)), or (UGCUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:745)), where the first strand comprises a second mismatch, a third mismatch, and a fourth mismatch to the target CAG repeat region, and where the second, third, and fourth mismatches are from 1 to 5 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of CUGCUGCUGCUGCUGCUGCUG (SEQ ID NO:743), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 1 to 5 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO:866), wherein the first substitution generates the first mismatch and is at position 11 based on the numbering of GCUGCUGCUGCUGCUGCUGCU (SEQ ID NO: 866), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 1 to 5 bases 3’ of the first mismatch.
- the first strand is a variant comprising at least a first, a second, a third, and a fourth substitution of the nucleotide sequence
- the first substitution generates the first mismatch and is at position 11 based on the numbering of UGCUGCUGCUGCUGCUGCUGC (SEQ ID NO: 867), wherein the second substitution generates the second mismatch, the third substitution generates the third mismatch, and the fourth substitution generates the fourth mismatch, and wherein the second, third, and fourth substitutions are from 1 to 5 bases 3’ of the first mismatch.
- the first strand comprises no more than 4 mismatches with the target CAG repeat region.
- the second strand is 100% complementary to the first strand.
- the second strand comprises from 1 to 10 mismatches (e.g., from 1 to 4, from 3 to 5, from 5 to 7, or from 5 to 10 mismatches) to the first strand. In some cases, the second strand comprises from 1 to 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1, 2, 3, or 4 mismatches to the first strand. In some cases, the second strand comprises no more than 1 mismatch to the first strand. In some cases, the second strand comprises no more than 2 mismatches to the first strand. In some cases, the second strand comprises no more than 3 mismatches to the first strand. In some cases, the second strand comprises no more than 4 mismatches to the first strand.
- the second strand comprises no more than 5 mismatches to the first strand.
- the double-stranded RNA has a length of from 18 nucleotides to 25 nucleotides. In some cases, the double-stranded RNA has a length of 20 nucleotides. In some cases, the double-stranded RNA has a length of 21 nucleotides. In some cases, the double-stranded RNA has a length of 22 nucleotides. In some cases, the double-stranded RNA has a length of 23 nucleotides. In some cases, the double-stranded RNA has a length of 24 nucleotides.
- the double-stranded RNA has a length of 25 nucleotides.
- each mismatch is generated by a substitution independently selected from: a) a substitution of a G with an A, a U, or a C; b) a substitution of a U with an A, a G, or a C; and c) a substitution of a C with an A, a U, or a G.
- the double stranded RNAs of the present disclosure may be targeted to any gene or nucleic acid construct containing the targeted repeat region.
- genes DNA or mRNA
- non-coding genes are targeted.
- coding regions of a gene are targeted.
- non-coding regions of a gene are targeted.
- double stranded RNAs of the present disclosure target CAG-repeat containing (polyglutamine) genes.
- the CAG repeat containing gene is selected from HIT, Ataxin 1, Ataxin 2, Ataxin 3, CACNA1A, Ataxin 7, PPP2R2B, TBP, Androgen receptor, Atrophin, MLLT3, BMP2K, THAP11, ZFHX3, POU3F2, MAML2, SMARCA2, MAML3, ORC4, RUNX2, MED12, EP400, MAGI1, UMAD1, DM1-AS, AC007161.3, IRF2BPL, and MAB21L1.
- polyglutamine Expansion of the CAG-repeat is associated with a number of dominant, genetic disorders referred to as polyglutamine (polyQ) diseases. While CAG-repeat containing proteins are ubiquitously expressed throughout the body, the pathology of polyglutamine diseases primarily appears in, but is not limited to, neuronal tissue. Thus, as used herein, the term polyglutamine disease refers to any disease or disorder associated with CAG-repeat expansion, including, but not limited to neurodegenerative diseases.
- Huntingtin also known as interesting transcript 15 (1T15). refers to a gene encoding huntingtin protein. The exact function of huntingtin is unknown but is involved in axonal transport.
- An example of a huntingtin transcript sequence is provided by NCBI Reference Sequence NM_002111.8 (SEQ ID NO:820).
- the polyglutamine tract of huntingtin has 10-35 CAG repeats. Expansion of the polyglutamine tract to 36 to more than 120 CAG repeats causes Huntington’s disease. Early signs and symptoms can include irritability, depression, small involuntary movements, poor coordination, and trouble learning new information or making decisions. Many people with Huntington disease develop involuntary jerking or twitching movements known as chorea. As the disease progresses, these movements become more pronounced. Affected individuals may have trouble walking, speaking, and swallowing. People with this disorder also experience changes in personality and a decline in thinking and reasoning abilities.
- Ataxin 1 ATXNI also known as spinocerebellar ataxia type 1 CS'CA / ), refers to a gene encoding a polyglutamine containing protein expressed primarily in the nucleus where it binds chromatin and functions as a transcriptional repressor.
- An example of a ATXN1 transcript sequence is provided by NCBI Reference Sequence NM_001128164.2 (SEQ ID NO:821).
- Mutant forms of ataxin- 1 containing expansion of the poly glutamine tract to typically about 40-83 repeats cause the movement disorder spinocerebellar ataxia type 1 (SCA1) through a toxic gain-of-function mechanism in the cerebellum.
- the cerebellar dysfunction is progressive and permanent.
- SCA1 speech and swallowing difficulties, muscle stiffness (spasticity), and weakness in the muscles that control eye movement (ophthalmoplegia). Eye muscle weakness leads to rapid, involuntary eye movements (nystagmus). Individuals with SCA1 may have difficulty processing, learning, and remembering information (cognitive impairment). Over time, individuals with SCA1 may develop numbness, tingling, or pain in the arms and legs (sensory neuropathy); uncontrolled muscle tensing (dystonia); muscle wasting (atrophy); and muscle twitches (fasciculations). Rarely, rigidity, tremors, and involuntary jerking movements (chorea) have been reported in people who have been affected for many years.
- Ataxin 2 also known as spinocerebellar ataxia type 2 (SCA2), refers to a gene encoding a polyglutamine containing, RNA-binding protein that targets cis-regulatory elements in 3' UTRs to stabilize a subset of mRNAs and increase protein expression.
- An example of an ATXN2 transcript sequence is provided by NCBI Reference Sequence: NM_001372574.1 (SEQ ID NO:822).
- Polyglutamine repeat expansion in ATXN2 (e.g., typically ⁇ 33 or more repeats) can cause signs and symptoms of spinocerebellar ataxia type 2 (SCA2). People with SCA2 initially experience problems with coordination and balance (ataxia).
- SCA2 Other early signs and symptoms of SCA2 include additional movement problems, speech and swallowing difficulties, and weakness in the muscles that control eye movement (ophthalmoplegia). Eye muscle weakness leads to involuntary back-and-forth eye movements (nystagmus) and a decreased ability to make rapid eye movements (saccadic slowing). Over time, individuals with SCA2 may develop loss of sensation and weakness in the limbs (peripheral neuropathy), muscle wasting (atrophy), uncontrolled muscle tensing (dystonia), and involuntary jerking movements (chorea).
- ALS amyotrophic lateral sclerosis
- Ataxin 3 also known as spinocerebellar ataxia type 3 (SCA 3), refers to a gene encoding a polyglutamine containing, deubiquitinating enzyme.
- An example of an ATXN3 transcript sequence is provided by NCBI Reference Sequence NM_004993.6 (SEQ ID NO:823).
- MBD Machado- Joseph disease
- SCA3 spinocerebellar ataxia type 3
- SCA3 may develop loss of sensation and weakness in the limbs (peripheral neuropathy), muscle cramps, muscle twitches (fasciculations), and swallowing difficulties. Individuals with SCA3 may have problems with memory, planning, and problem solving.
- CACNA1A Calcium voltage-gated channel subunit alphal A
- SCA6 spinocerebellar ataxia type 6
- An example of a CACNA1A transcript sequence is provided by NCBI reference sequence NM_000068.4 (SEQ ID NO:824). Expansion of the polyglutamine tract in the CACNA1A gene to typically 19-33 repeats causes spinocerebellar ataxia type 6 (SCA6).
- SCA6 spinocerebellar ataxia type 6
- People with this condition initially experience problems with coordination and balance (ataxia). Other early signs and symptoms of SCA6 include speech difficulties, involuntary eye movements (nystagmus), and double vision. Over time, individuals with SCA6 may develop loss of coordination in their arms, tremors, and uncontrolled muscle tensing (dystonia).
- Ataxin 7 also known as spinocerebellar ataxia type 7 (SCA7), encodes a poly glutamine containing protein that is an integral subunit of GCN5 (general control of amino acid synthesis-5; KAT2A)-containing SAGA family of histone acetyltransferase (HAT) complexes.
- GCN5 general control of amino acid synthesis-5; KAT2A
- HAT histone acetyltransferase
- An example of an ATXN7 transcript sequence is provided by NCBI Reference Sequence NM_001377405.1 (SEQ ID NO:825).
- SCA7 spinocerebellar ataxia type 7
- SCA7 spinocerebellar ataxia type 7
- later symptoms include loss of motor control, unclear speech (dysarthria), and difficulty swallowing (dysphagia).
- PPP2R2B Protein Phosphatase 2 Regulatory Subunit Bbeta
- SCA12 spinocerebellar ataxia type 12
- An example of a PPP2R2B transcript sequence is provided by NCBI Reference Sequence NM_181674.3 (SEQ ID NO: 826).
- SCA12 spinocerebellar ataxia type 12
- the age of onset of symptoms of SCA12 ranges from 8 to 55 years, though most commonly occurs in the fourth decade. Symptoms typically begin with tremors and progress to cerebellar ataxia. Signs of dementia have also been reported as associated with SCA12.
- TBP TATA-Box Binding Protein
- SCA17 spinocerebellar ataxia type 17
- TBP TATA-binding protein
- TFIID transcription factor IID
- An example of a TBP transcript sequence is provided by NCBI Reference Sequence NM_003194.5 (SEQ ID NO: 827).
- TBP typically has 25-42 poly glutamine repeats, expansion to 45-66 repeats is associated with spinocerebellar ataxia type 17 (SCA17).
- People with this condition typically experience symptoms such as ataxia, dementia, and involuntary movements such as chorea and dystonia, rigidity, and pyramidal signs such as spasticity, weakness, slowing of rapid alternating movements, and hyperreflexia.
- Androgen Receptor encodes a steroid-hormone activated transcription factor.
- An example of an AR transcript sequence is provided by NCBI Reference Sequence NM_000044.6 (SEQ ID NO:828). Expansion of the polyglutamine repeats from the typically 9-34 repeats to 38-62 repeats causes spinal bulbar muscular atrophy (SBMA), also known as Kennedy's disease. SBMA is characterized by muscle weakness and atrophy that worsens over time, resulting in cramping and difficulty with walking, swallowing, and speech. SBMA may also result in gynecomastia and infertility.
- Atrophin 1 encodes a protein that is hypothesized to be a transcriptional corepressor that recruits Nuclear Receptor Subfamily 2 Group E Member 1 (NR2E1) to repress transcription.
- An example of an ATN1 transcript sequence is provided by NCBI Reference Sequence NM_001007026.2 (SEQ ID NO:829).
- Dentatorubral pallidoluysian atrophy is a rare neurodegenerative disorder related to the expansion of the poly glutamine repeat in ATN 1 from the typical 7-35 copies to 49-93 copies. When DRPLA manifests before about age 20 it is typically associated with myoclonus, ataxia, seizures, behavioral changes, and intellectual disability. When it manifests after about age 20 it is associated with ataxia, choreoathetosis, delusions, and dementia.
- MLLT3 Myeloid/Lymphoid Or Mixed-Lineage Leukemia Translocated To Chromosome 3 (MLLT3). also known as AF-9, encodes a component of the super elongation complex (SEC), which is necessary to increase the catalytic rate of RNA polymerase II transcription.
- SEC super elongation complex
- An example of a MLLT3 transcript sequence is provided by NCBI Reference Sequence NM_004529.4 (SEQ ID NO: 830).
- MLLT3 includes an unstable poly glutamine repeat and genetic aberrations involving MLLT3 have been associated with leukemias and neuromotor development delay, cerebellar ataxia, and epilepsy.
- BMP2K Bone Morphogenic Protein 2 Inducible Kinase encodes a protein related to skeletal development and patterning.
- An example of a BMP2K transcript sequence is provided by NCBI Reference Sequence NM_198892.2 (SEQ ID NO:831).
- BMP2K includes a polyglutamine repeat and is associated with myopia and cancer, specifically gene mis-regulation associated with cancer.
- THAP11 THAP Domain Containing 11 encodes a transcriptional repressor associated with embryogenesis.
- An example of a THAP11 transcript sequence is provided by NCBI Reference Sequence NM_020457.3 (SEQ ID NO:832).
- THAP11 includes a poly glutamine repeat of typically about 29 copies, but ranges from 20 to over 40 copies. An increased number of polyglutamine repeats, for example 38 copies, is associated with neurodegenerative disease. Expansion of the poly glutamine in THAP11 is also associated with intracellular aggregation of THAP11, cellular toxicity, growth inhibition, G0/G1 arrest, and inhibition of transcription activity.
- Zinc Finger Homeobox 3 encodes a transcription factor that regulates myogenic and neuronal differentiation. It also functions as a tumor suppressor in several cancers and is associated with atrial fibrillation.
- An example of a ZFHX3 transcript sequence is provided by NCBI Reference Sequence NM_006885.4 (SEQ ID NO:833).
- ZFHX3 includes a polyglutamine repeat. Individuals with an expanded polyglutamine repeat, e.g. having 19 copies, is associated with coronary heart disease, hypertension, diabetes mellitus, or dyslipidemia as compared to those with fewer repeats, e.g. 17 copies.
- POU Class 3 Homeobox 2 encodes a transcription factor that is related to neuronal differentiation.
- An example of a POU3F2 transcript sequence is provided by NCBI Reference Sequence NM_005604.4 (SEQ ID NO:834).
- POU3F2 includes a polyglutamine tract and is associated with bipolar disorder, obesity, developmental delay, and intellectual disability.
- MAML2 Mastermind Like Transcriptional Coactivator 2 encodes a transcriptional coactivator for NOTCH proteins and promotes P-catenin turnover.
- An example of a MAML2 transcript sequence is provided by NCBI Reference Sequence NM_032427.4 (SEQ ID NO: 835).
- MAML2 includes a polyglutamine tract with observed variability and is associated with cancers such as mucoepidermoid carcinomas, hidradenoma, B cell-derived lymphomas, and chronic lymphocytic leukemia.
- MAML3 Mastermind Like Transcriptional Coactivator 3 encodes a transcriptional coactivator for NOTCH proteins.
- An example of a MAML3 transcript sequence is provided by NCBI Reference Sequence NM_018717.5 (SEQ ID NO:836).
- MAML3 includes a polyglutamine tract and is associated with cancers such as Schneiderian carcinoma and ossifying fibromyxoid tumor.
- SWI/SNF Related, Matrix Associated, Actin Dependent Regulator Of Chromatin, Subfamily A, Member 2 (SMARCA2) encodes a component of the SWI/SNF complex that is involved in transcriptional regulation by chromatin remodeling. SMARCA2 is also involved in neural development.
- An example of a SMARCA2 transcript sequence is provided by NCBI Reference Sequence NM_003070.5 (SEQ ID NO: 837).
- SMARCA2 includes a polymorphic poly glutamine tract and is associated conditions such as Nicolaides-Baraitser syndrome and blepharophimosis- impaired intellectual development syndrome.
- the SMARCA2 gene is also located on a chromosomal region that is linked to schizophrenia and bipolar disorder.
- Origin Recognition Complex Subunit 4 encodes a component of the six subunit origin recognition complex (ORC) that is necessary for the initiation of DNA replication.
- ORC4 transcript sequence is provided by NCBI Reference Sequence NM_001190879.3 (SEQ ID NO:838).
- ORC4 includes a region of polymorphic trinucleotide CAG repeats located upstream of the coding sequence and is associated with Meier-Gorlin syndrome 1 and Meier-Gorlin syndrome 2
- RUNX Family Transcription Factor 2 encodes a nuclear protein involved osteoblastic differentiation and skeletal morphogenesis.
- An example of a RUNX2 transcript sequence is provided by NCBI Reference Sequence NM_001024630.4 (SEQ ID NO:839).
- RUNX2 includes a polyglutamine tract and a polyalanine tract. Expansion of the polyglutamine tract from, e.g., typical 23 residues to, e.g., 27-30 residues causes cleidocranial dysplasia, decreased bone mineral density, and decreases RUNX2 transactivation capacity.
- Cleidocranial dysplasia is a disorder affecting the skull, bones and teeth. Signs and symptoms include absent or underdeveloped collar bones, delayed closing of fontanels in the skull, dental abnormalities, short stature, decreased bone density, hearing loss, and other bone abnormalities.
- Mediator Complex Subunit 12 encodes a component of the preinitiation complex that is involved in the control of initiation of transcription.
- An example of a MED 12 transcript sequence is provided by NCBI Reference Sequence NM_005120.3 (SEQ ID NO:840).
- MED12 has a polyglutamine tract and is associated with Opitz-Kaveggia syndrome, Lujan-Fryns syndrome, Ohdo syndrome, X-linked, and tumor formation, e.g., in uterine leiomyomas.
- EP400 encodes a component of the NuA4 histone acetyltransferase complex that is involved in transcriptional activation.
- An example of an EP400 transcript sequence is provided by NCBI Reference Sequence NM_015409.5 (SEQ ID NO:841).
- EP400 normally contains about 32 CAG repeats.
- EP400 is involved in ossifying fibromyxoid tumor and epilepsy, familial temporal lobe, 1.
- MAGI1 Membrane Associated Guanylate Kinase, WW And PDZ Domain Containing 1
- MAGIF Membrane Associated Guanylate Kinase, WW And PDZ Domain Containing 1
- An example of a MAGI1 transcript sequence is provided by NCBI Reference Sequence NM_015520.2 (SEQ ID NO:842).
- MAGI1 contains a polymorphic polyglutamine tract and is associated with conditions such as cervical large cell neuroendocrine carcinoma and microscopic colitis.
- UMADT UBAP1-MVB12- Associated (UMA) Domain Containing 1
- UAADT is a protein coding gene.
- An example of a UMAD1 transcript sequence is provided by NCBI Reference Sequence NM_001302348.2 (SEQ ID NO:843).
- UMAD1 includes a region of polymorphic trinucleotide CAG repeats upstream of the start codon and is associated with retinitis pigmentosa.
- DM1 Locus Antisense RNA is an RNA gene.
- An example of a DM1 -AS RNA sequence is provided by NCBI Reference Sequence NR_147193.1 (SEQ ID NO:844).
- DM1-AS includes a region of polymorphic trinucleotide CAG repeats in an intron and is associated with myotonic dystrophy 1 and branchiootorenal syndrome 2.
- AC007161.3 also known as ENSG00000283549 is an RNA gene and contains CAG repeats.
- Interferon Regulatory Factor 2 Binding Protein Like JRF2BPL encodes a transcription factor associated with the development of the central nervous system and in neuronal maintenance and with regulating female reproductive function.
- An example of an IRF2BPL transcript sequence is provided by NCBI Reference Sequence NM_024496.4 (SEQ ID NO:845).
- IRF2BPL includes a polyglutamine tract and is associated with neurological problems such as neurodevelopmental disorder with regression, abnormal movements, loss of speech, and seizures and Irf2bpl-related regressive neurodevelopmental disorder-dystonia-seizures syndrome.
- Mab-21 Like 1 encodes a protein associated with eye and cerebellum development.
- An example of a MAB21L1 transcript sequence is provided by NCBI Reference Sequence NM_005584.5 (SEQ ID NO:846).
- MAB21L1 is associated with cerebellar, ocular, craniofacial, and genital Syndrome and hydrophthalmos.
- MAB21L1 includes polymorphic trinucleotide CAG repeats in the 5’ untranslated portion of the gene that are associated with psychiatric conditions such as bipolar disorder.
- a pathogenic or pathologic allele of a CAG repeat containing gene or RNA encoded by the CAG repeat containing gene contains at least about 30 consecutive CAG repeats.
- double stranded RNAs of the disclosure are encoded by a nucleic acid molecule, for example a DNA sequence.
- Double stranded RNA sequences provided herein can be converted to DNA format by replacing each uracil base “U” with a thymine “T” base.
- nucleic acid molecule e.g., DNA
- RNA is contained within an expression cassette.
- the expression cassette further comprises one or more expression control sequences (regulatory sequences) operably linked with the transgene.
- “Operably linked” sequences include expression control sequences that are contiguous with the transgene or act in trans or at a distance from the transgene to control its expression. Examples of expression control sequences include transcription initiation sequences, termination sequences, promoter sequences, enhancer sequences, repressor sequences, splice site sequences, polyadenylation (poly A) signal sequences, or any combination thereof.
- a promoter is an endogenous promoter, synthetic promoter, hybrid promoter, constitutive promoter, inducible promoter, tissue-specific promoter (e.g., CNS-specific), or cell-specific promoter (neurons, glial cells, or astrocytes).
- constitutive promoters include, Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), cytomegalovirus (CMV) promoter (optionally with the CMV enhancer), SV40 promoter, and dihydrofolate reductase promoter.
- inducible promoters examples include zinc-inducible sheep metallothionine (MT) promoter, dexamethasone (Dex) -inducible mouse mammary tumor virus (MMTV) promoter, T7 polymerase promoter system, the ecdysone insect promoter, tetracycline- repressible system, tetracycline-inducible system, RU486-inducible system, and the rapamycin- inducible system.
- MT sheep metallothionine
- Dex dexamethasone
- MMTV mouse mammary tumor virus
- T7 polymerase promoter system examples include the ecdysone insect promoter, tetracycline- repressible system, tetracycline-inducible system, RU486-inducible system, and the rapamycin- inducible system.
- promoters include, for example, chicken beta-actin promoter (CBA promoter), a CAG promoter, an Hl promoter, a CD68 promoter, a JeT promoter, synapsin promoter, RNA pol II promoter, or an RNA pol III promoter (e.g., U6, Hl, etc.).
- a promoter is an RNA pol II promoter.
- pol II promoters include PGK, CBA, Ul, CMV, EIFla, EFla, CAG, or synaptophysin promoters.
- the promoter is a tissue-specific RNA pol II promoter.
- the tissue-specific RNA pol II promoter is derived from a gene that exhibits neuron-specific expression.
- an expression cassette comprises a pol II promoter and a poly(A) tail, e.g., with the DNA sequence encoding the double stranded RNA flanked on the 5’ end by the pol II promoter and on the 3’ end by the poly(A) tail.
- a promoter is a neuron specific promoter.
- neuronspecific promoters include those from neuron specific enolase (NSE), human synapsin 1, human synapsin 2 promoter, caMK kinase, and tubuline.
- a promoter is an RNA pol III promoter.
- pol III promoters include U6, Hl, 7SK, Y, RPR, MRP, and selenocysteine tRNA.
- an expression cassette comprises a pol III promoter and a poly(T) tail, e.g., with the DNA sequence encoding the double stranded RNA flanked on the 5’ end by the pol III promoter and on the 3’ end by the poly(T) tail.
- a promoter is a RNA pol I promoter.
- an expression cassette comprises a pol I promoter and a 3 ’-box, e.g. with the DNA sequence encoding the double stranded RNA flanked on the 5’ end by the pol I promoter and on the 3’ end by the 3’- box.
- RNA expression cassettes for double stranded RNAs are known in the art, see, e.g., ter Brake et al. Mol. Ther. (2008) 16:557; Maczuga et al., BMC Biotechnol. (2012) 12:42; and Bofill-De Ros and Gu (2016) 103:157.
- the DNA sequence encoding the double stranded RNA of the disclosure is positioned in an untranslated region of an expression cassette.
- the sequence encoding the inhibitory nucleic acid of the present disclosure is positioned in an intron, a 5' untranslated region (5 ’UTR), or a 3' untranslated region (3'UTR) of the expression cassette.
- the sequence encoding the inhibitory nucleic acid of the present disclosure is positioned in an intron downstream of the promoter and upstream of an expressed gene.
- the DNA sequence encoding a double stranded RNA of the disclosure is flanked by two AAV inverted terminal repeats (ITRs) (e.g., 5’ ITR and 3’ ITR) within the expression cassette.
- ITRs AAV inverted terminal repeats
- each AAV ITR is a full length ITR (e.g., approximately 145 bp in length, and containing functional Rep binding site (RBS) and terminal resolution site (trs)).
- RBS functional Rep binding site
- trs terminal resolution site
- one of the ITRs is truncated (e.g., shortened or not full- length).
- a truncated ITR lacks a functional terminal resolution site (trs) and is used for production of self-complementary AAV vectors (scAAV vectors).
- double-stranded RNAs described herein can be encoded by vectors, such as plasmids, non-viral vectors, or viral vectors.
- vectors for expressing doublestranded RNAs of the present disclosure may allow for continual or controlled expression of the double-stranded RNAs in the subject, rather than multiple doses of the double-stranded RNAs to the subject.
- the present disclosure provides a vector comprising an isolated nucleic acid comprising an expression cassette encoding a double-stranded RNA described herein.
- Viral vectors include, but are not limited to, herpesvirus (HSV) vectors, retroviral vectors, adenoviral vectors, adeno-associated viral (AAV) vectors, lentiviral vectors, baculoviral vectors, and the like.
- HSV herpesvirus
- retroviral vectors retroviral vectors
- adenoviral vectors adeno-associated viral
- AAV adeno-associated viral
- lentiviral vectors lentiviral vectors
- baculoviral vectors and the like.
- the vector encoding a double stranded RNA of the disclosure is a retroviral vector.
- a retroviral vector is a mouse stem cell virus, murine leukemia virus (e.g., Moloney murine leukemia virus vector), feline leukemia virus, feline sarcoma virus, or avian reticuloendotheliosis virus vector.
- the vector encoding a double stranded RNA of the disclosure is a lentivirus or lentiviral based vector.
- a lentiviral vector is a HIV (human immunodeficiency virus, including HIV type 1 and HIV type 2, equine infectious anemia virus, feline immunodeficiency virus (FIV), bovine immune deficiency virus (BIV), and simian immunodeficiency virus (SIV), equine infectious anemia virus, or Maedi-Visna viral vector.
- HIV human immunodeficiency virus, including HIV type 1 and HIV type 2, equine infectious anemia virus, feline immunodeficiency virus (FIV), bovine immune deficiency virus (BIV), and simian immunodeficiency virus (SIV), equine infectious anemia virus, or Maedi-Visna viral vector.
- HIV human immunodeficiency virus, including HIV type 1 and HIV type 2
- equine infectious anemia virus feline immunodeficiency virus (FIV), bovine immune deficiency virus (BIV), and simian immunodeficiency virus (SIV
- Production of replicationincompetent recombinant lentivirus may be achieved, for example, by co-transfection of expression vectors and packaging plasmids using commercially available packaging cell lines, such as TLA- HEK293TM, and packaging plasmids (Thermo Scientific/Open Biosystems, Huntsville, AL).
- the vector encoding a double stranded RNA of the disclosure is an adeno-associated virus (AAV) vector, such as a recombinant rAAV vector, which is produced by recombinant methods.
- AAV is a single-stranded, non-enveloped DNA virus having a genome that encodes proteins for replication (rep) and the capsid (Cap), flanked by two ITRs, which serve as the origin of replication of the viral genome.
- AAV also contains a packaging sequence, allowing packaging of the viral genome into an AAV capsid.
- the AAV vector comprises an expression cassette encoding a double stranded RNA of the present disclosure flanked by two cis-acting AAV ITRs (5’ ITR and 3’ ITR).
- Functional ITR sequences are used for the rescue, replication and packaging of the AAV viral particle.
- an AAV vector is defined herein to include at least those sequences required in cis for replication and packaging (e.g., one or two functional ITRs and packaging sequence) of the virus.
- each AAV ITR is a full length ITR (e.g., approximately 145 bp in length, and containing functional Rep binding site (RBS) and terminal resolution site (trs)).
- one or both of the ITRs is modified, e.g., by insertion, deletion, or substitution, provided that the ITRs provide for functional rescue, replication, and packaging.
- a modified ITR lacks a functional terminal resolution site (trs) and is used for production of self-complementary AAV vectors (sc AAV vectors).
- the ITRs are selected from any one of serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.RhlO, AAV11 and variants thereof. In some cases, the ITRs are from AAV2.
- rAAV vectors may have one or more AAV wild type genes deleted in whole or in part.
- the rAAV vector is replication defective.
- the rAAV vector lacks a functional Rep protein and/or capsid protein.
- one or more of the required components for packaging the rAAV vector may be provided by a stable host cell that has been engineered to contain the one or more required components (e.g., by a vector). Expression of the required components for AAV packaging may be under control of an inducible or constitutive promoter in the host packaging cell.
- AAV helper vectors are commonly used to provide transient expression of AAV rep and/or cap genes, which function in trans, to complement missing AAV functions that are necessary for AAV replication.
- AAV helper vectors lack AAV ITRs and can neither replicate nor package themselves.
- AAV helper vectors can be in the form of a plasmid, phage, transposon, cosmid, virus, or virion.
- Recombinant AAV vectors of the present disclosure may be encapsidated by an AAV capsid to form a rAAV particle.
- a “rAAV particle” or “rAAV virion” refers to an infectious, replication-defective virus including an AAV protein shell, encapsidating a transgene of interest which is flanked on both sides by AAV ITRs.
- a rAAV particle is produced in a suitable host cell which has sequences specifying a rAAV vector, AAV helper functions and accessory functions introduced therein to render the host cell capable of encoding AAV polypeptides that are required for packaging the rAAV vector (containing the transgene sequence of interest) into infectious rAAV particles for subsequent gene delivery to a target cell.
- rAAV particles may be produced using the triple transfection method (see, e.g., U.S. Patent No. 6,001,650, incorporated herein by reference in its entirety).
- the rAAV particles are produced by transfecting a host cell with a rAAV vector (comprising a transgene) to be packaged into rAAV particles, an AAV helper vector, and an accessory function vector.
- the AAV helper function vector supports efficient AAV vector production without generating any detectable wild-type AAV virions (e.g., AAV virions containing functional rep and cap genes).
- the accessory function vector encodes nucleotide sequences for non- AAV derived viral and/or cellular functions upon which AAV is dependent for replication (e.g., “accessory functions”).
- the accessory functions include those functions required for AAV replication, including, without limitation, those moieties involved in activation of AAV gene transcription, stage specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly.
- Viral-based accessory functions can be derived from any of the known helper viruses such as adenovirus, herpesvirus (other than herpes simplex virus type-1), and vaccinia virus.
- a double transfection method wherein the AAV helper function and accessory function are cloned on a single vector, is used to generate rAAV particles.
- the AAV capsid is an important element in determining the tissue-specificity of the rAAV particle.
- a rAAV particle having a particular capsid tissue specificity can be selected.
- the rAAV particle comprises a capsid selected from an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.RhlO, AAV11, and variants thereof.
- the AAV capsid is selected from a serotype that is capable of crossing the blood-brain barrier, e.g., AAV9, AAVrh.10, or a variant thereof.
- the AAV capsid is a chimeric AAV capsid.
- the rAAV vector is a mammalian serotype AAV vector (e.g., AAV genome and ITRs derived from mammalian serotype AAV), including a primate serotype AAV vector or human serotype AAV vector.
- the AAV vector is derived from any one of serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.RhlO, AAV11, and variants thereof.
- the AAV vector is a chimeric AAV vector.
- rAAV vectors may be vectors comprising an AAV genome and AAV capsid derived from the same AAV serotype.
- rAAV vectors are pseudotyped, meaning the rAAV vectors comprise an AAV genome derived from one AAV serotype and an AAV capsid derived at least in part from a different AAV serotype.
- the rAAV vector is AAV9 serotype.
- the rAAV comprises an AAV9 capsid protein (e.g., SEQ ID NO:2 of US Patent No. 7,198,951), an AAV9 rep protein (e.g., SEQ ID NO:3 of US Patent No. 7,198,951), or both.
- the rAAV comprises: (i) an AAV9 capsid protein (e.g., SEQ ID NO:2 of US Patent No. 7,198,951), and (ii) AAV2 ITRs.
- the rAAV particle is capable of transducing cells of the central nervous system (CNS). In some embodiments, the rAAV particle is capable of transducing nonneuronal cells or neuronal cells of the CNS. In some embodiments, the CNS cell is a neuron, glial cell, astrocyte, or microglial cell.
- the rAAV vector is a self-complementary AAV (scAAV) vector.
- scAAV vectors contain two complementary DNA strands in the form of a dimeric inverted repeat genome. The two complementary strands within the dimeric inverted repeat genome anneal together to form one double stranded DNA that is ready for immediate replication and transcription, thus bypassing the requirement for host cell DNA synthesis.
- Self-complementary AAV vectors are described in U.S. Patent Nos. 7,465,583; 7,790,154; 8,361,457; and 8,784,799.
- the present disclosure also provides host cells transfected with the rAAV comprising a
- the host cell is a prokaryotic cell or a eukaryotic cell.
- the host cell is a mammalian cell (e.g., HEK293T, COS cells, HeLa cells, KB cells), bacterial cell (E. coli), yeast cell, insect cell (Sf9, Sf21, Drosophila, mosquito), etc.
- the host cell is obtained or derived from a human subject.
- the host cell is a fibroblast.
- DNA molecule encoding one or both strands of a double-stranded RNA
- the present disclosure provides a DNA molecule comprising a nucleotide sequence encoding the first strand of a double-stranded RNA of the present disclosure.
- the nucleotide sequence encoding the first strand is operably linked to a promoter.
- the nucleotide sequence encoding the first strand is operably linked to a promoter that is functional in a eukaryotic cell.
- the present disclosure provides a DNA molecule comprising a nucleotide sequence encoding: i) the first strand of a double-stranded RNA of the present disclosure; and ii) the second strand of a double-stranded RNA of the present disclosure.
- the nucleotide sequence encoding the first strand and the second strand is operably linked to a promoter.
- the promoter is a PolII promoter.
- the promoter is a U6 promoter.
- the promoter is a CAG promoter.
- the promoter is a CBA promoter.
- the promoter is a CMV promoter.
- the promoter is an EFla promoter.
- the promoter is an Hl promoter.
- a DNA molecule of the present disclosure comprises a nucleotide sequence that encodes any one of SEQ ID NOs:295-375.
- a recombinant nucleic acid e.g., a recombinant RNA; which may be referred to as an “artificial microRNA” or a “small binding RNA” (sbRNA)
- a recombinant nucleic acid comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”), a loop polynucleotide, and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”)
- the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the second strand of the double-stranded RNA; and ii
- the present disclosure provides a recombinant nucleic acid (e.g., a recombinant RNA) comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the first strand of the double-stranded RNA; and iii) the 3’ flanking polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide is heterologous to the first and/
- a recombinant nucleic acid e.g., a recombinant RNA; which may be referred to as an “artificial microRNA” or a “small binding RNA” (sbRNA)
- a recombinant nucleic acid comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”) and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”)
- the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the second strand of the double-stranded RNA; and iv) the 3’ trailer polynucleotide; and wherein one or both of the 5’ flanking poly
- the present disclosure provides a recombinant nucleic acid (e.g., a recombinant RNA) comprising: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the first strand of the doublestranded RNA; and iv) the 3’ flanking polynucleotide; and wherein one or both of 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and/or the second strand of the double-stranded RNA.
- the 5’ flanking polynucleotide and the 3’ flanking polynucle compris
- the present disclosure provides a DNA molecule (e.g, a “cassette”, which can be inserted into an expression vector to generate a recombinant expression vector) comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or an “sbRNA”), where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”), a loop polynucleotide, and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of
- the present disclosure provides a DNA molecule (e.g, a “cassette”, which can be inserted into an expression vector to generate a recombinant expression vector) comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or “sbRNA”), where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the first
- the 5’ flanking polynucleotide, the loop polynucleotide, and the 3’ flanking polynucleotide are derived from miR33.
- the cassette includes a Pol3 transcription sequence; for example, in some cases, the cassette includes the nucleotide sequence TTTTTG 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide.
- a cassette has a length of from about 110 nucleotides to about 150 nucleotides.
- the cassette includes a Pol II transcription sequence; for example, in some cases, the cassette includes a polyadenylation sequence 3’ of the nucleotide sequence encoding the 3’ flanking polynucleotide.
- the present disclosure provides a DNA molecule (e.g, a “cassette”, which can be inserted into an expression vector to generate a recombinant expression vector) comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or “sbRNA”), where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”) and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii
- the present disclosure provides a DNA molecule (e.g, a “cassette”, which can be inserted into an expression vector to generate a recombinant expression vector) comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or “sbRNA”), where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double-stranded RNA; iii) the first strand of the double-stranded RNA; and iv) the 3’ flanking polynucleo
- the 5’ flanking polynucleotide and the 3’ flanking polynucleotide are derived from miR451.
- the cassette includes a Pol3 transcription sequence; for example, in some cases, the cassette includes the nucleotide sequence TTTTTG 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide.
- a cassette has a length of from about 110 nucleotides to about 650 nucleotides (e.g., from 110 nucleotides (nt) to 115 nt, from 115 nt to 120 nt, from 500 nt to 600 nt, or from 600 nt to 610 nt).
- the cassette includes a Pol II transcription sequence; for example, in some cases, the cassette includes a polyadenylation sequence 3’ of the nucleotide sequence encoding the 3’ flanking polynucleotide.
- the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence tgcacacctcctggcgggcagctctg (SEQ ID NO:738). In some cases, the portion of the cassette encoding the loop polynucleotide comprises the nucleotide sequence tgttctggcaatacctg (SEQ ID NO:739). In some cases, the portion of the cassette encoding the 3’ flanking polynucleotide comprises the nucleotide sequence gggaggcctgccctgactgcccac (SEQ ID NO:740).
- the cassette includes a Pol3 transcription sequence; for example, in some cases, the cassette includes the nucleotide sequence TTTTTG 3’ of the nucleotide sequence encoding the 3’ trailer polynucleotide. In some cases, a cassette has a length of from about 110 nucleotides to about 150 nucleotides. In some cases, the cassette includes a Pol II transcription sequence; for example, in some cases, the cassette includes a polyadenylation sequence 3’ of the nucleotide sequence encoding the 3’ flanking polynucleotide.
- the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence acctactgactgccagggcacttgggaatggcaagg (SEQ ID NO:854). In some cases, the portion of the cassette encoding the 3’ flanking polynucleotide comprises the nucleotide sequence tcttgctatacccagaaaacgtgccaggaagagaac (SEQ ID NO: 855).
- the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence acctactgactgccagggcacttgggaatggcaagg (SEQ ID NO: 854); and the portion of the cassette encoding the 3’ flanking polynucleotide comprises the nucleotide sequence tcttgctatacccagaaaacgtgccaggaagagaac (SEQ ID NO:855).
- the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence gctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattaagggcgaattcgagctcggtacctcgcgaatgcatctag atatcggcgctatgcttcctgtgcccccagtggggccctggctggctgggatTtcatcatatactgtaagtttgcgatgagacactacagtatagatg atgtactagtccgggcacccccagctctggagcctgacaaggaggacaggagagatgctgcaagcccaagaagctctctgctc acaacctactgactgccagggcacttgggaatggcaagg (
- the portion of the cassette encoding the 3’ flanking polynucleotide comprises the nucleotide sequence tcttgctatacccagaaaacgtgccaggaagagaactcaggaccctgaagcagactactggaagggagactccagctcaaaggcagggg ggtgggggcgtgggattgggggggtaggggagggaatagatacattttctctttcctgttaaagaaataaagataagccaggcacagtggct cacgcctgtaatcccaccactttcagaggccaaggcgctggatccagatctcgagcggccccg (SEQ ID NO:857).
- the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence gctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattaagggcgaattcgagctcggtacctcgcgaatgcatctag atatcggcgctatgcttcctgtgcccccagtggggccctggctggctgggatTtcatcatatactgtaagtttgcgatgagacactacagtatagatg atgtactagtccgggcacccccagctctggagcctgacaaggaggacaggagagatgctgcaagcccaagaagctctctgctc acaacctactgactgccagggcacttgggaatggcaagg (
- the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence gctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattaagggcgaattcgagctcggtacctcgcgaatgcatctag atatcggcgctatgcttcctgtgcccccagtggggccctggctggctgggatAtcatcatatactgtaagtttgcgatgagacactacagtatagatg atgtactagtccgggcacccccagctctggagcctgacaaggaggacaggagagatgctgcaagcccaagaagctctctgctc acaacctactgactgccagggcacttgggaatggcaagg (
- the portion of the cassette encoding the 3’ flanking polynucleotide comprises the nucleotide sequence tcttgctatacccagaaaacgtgccaggaagagaactcaggaccctgaagcagactactggaagggagactccagctcaaaggcagggg ggtgggggcgtgggattgggggggtaggggagggaatagatacattttctctttcctgttaaagaaataaagataagccaggcacagtggct cacgcctgtaatcccaccactttcagaggccaaggcgctggatccagatctcgagcggccccc (SEQ ID NO:859).
- the portion of the cassette encoding the 5’ flanking polynucleotide comprises the nucleotide sequence gctcctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattaagggcgaattcgagctcggtacctcgcgaatgcatctag atatcggcgctatgcttcctgtgcccccagtggggccctggctggctgggatAtcatcatatactgtaagtttgcgatgagacactacagtatagatg atgtactagtccgggcacccccagctctggagcctgacaaggaggacaggagagatgctgcaagcccaagaagctctctgctc acaacctactgactgccagggcacttgggaatggcaagg (
- cassettes The following are non-limiting examples of cassettes.
- tgcacacctcctggcgggcagctctg (SEQ ID NO:738) encodes the 5’ leader polynucleotide;
- the first upper case sequence encodes the first strand of the double-stranded RNA;
- tgttctggcaatacctg (SEQ ID NO:739) encodes the loop polynucleotide;
- the second upper case sequence encodes the second strand of the double-stranded RNA;
- gggaggcctgccctgactgcccac (SEQ ID NO:740) encodes the 3’ trailer polynucleotide;
- TTTTTG is the Pol3 transcription termination sequence.
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence 77777 j iq pi ace of the 3’ TTTTTG sequence.
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGCTGCTGCTGtgttctggcaatacctgCAGCAGCAGCA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:579; “CUG-10” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGCTGCTGCTGtgttctggcaatacctgCAGCAGCAGCAGAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ. ID NO:580; "CUG_19" in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACTACTGCTGCTGtgttctggcaatacctgCAGCAGCAGAAGAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:581; "CUG_28" in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence; 4)
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACTGATGCTGCTGtgttctggcaatacctgCAGCAGCAACAGAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:582; "CUG_37" in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACTGCAGCTGCTGtgttctggcaatacctgCAGCAGCAGCAGAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ. ID NO:583; "CUG_46" in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACTGCTACTGCTGtgttctggcaatacctgCAGCAGAAGCAGAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:584; CUG_55" in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACTGCTGATGCTGtgttctggcaatacctgCAGCAACAGCAGAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGCTGCTGCTGtgttctggcaatacctgCAGCAGCAGCAACAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGATACTGCTGCTGtgttctggcaatacctgCAGCAGCAGAAACAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGATGATGCTGCTGtgttctggcaatacctgCAGCAGCAACAACAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:588; “CUG_136” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence; 11)
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGATGCAGCTGCTGtgttctggcaatacctgCAGCAGCAGCAACAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:589; “CUG_145” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGATGCTACTGCTGtgttctggcaatacctgCAGCAGAAGCAACAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:590; “CUG_154” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGATGCTGATGCTGtgttctggcaatacctgCAGCAACAGCAACAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:591; “CUG_163” in Table 7; FIG. 23). In some cases, the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGCAACTGCTGCTGtgttctggcaatacctgCAGCAGCAGAAGCAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:592; “CUG_217” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGCAGATGCTGCTGtgttctggcaatacctgCAGCAGCAACAGCAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGCAGCAGCTGCTGtgttctggcaatacctgCAGCAGCAGCAGCAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:594; “CUG_235” in Table 7; FIG. 23). In some cases, the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGCAGCTACTGCTGtgttctggcaatacctgCAGCAGAAGCAGCAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:595; “CUG_244” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence; 18)
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGCAGCTGATGCTGtgttctggcaatacctgCAGCAACAGCAGCAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:596; “CUG_253” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCAGCTGCTGCTGCTGtgttctggcaatacctgCAGCAGCAGCAGCAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:597; “CUG_NA-A” in Table 7; FIG. 23). In some cases, the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCAACTGCTGCTGCTGtgttctggcaatacctgCAGCAGCAGCAGAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:598; “CUG_NA_B” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCAGATGCTGCTGCTGtgttctggcaatacctgCAGCAGCAGCAACAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:599; “CUG_NA_C” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence. In some cases, the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCAGCAGCTGCTGCTGtgttctggcaatacctgCAGCAGCAGCAGCAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NG:600; “CUG_NA_D” in Table 7; FIG. 23). In some cases, the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCAGCTACTGCTGCTGtgttctggcaatacctgCAGCAGCAGAAGCAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:601; “CUG_NA_E” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCAGCTGATGCTGCTGtgttctggcaatacctgCAGCAGCAACAGCAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:602; “CUG_NA_F” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence; 25)
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCAGCTGCAGCTGCTGtgttctggcaatacctgCAGCAGCAGCAGCAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:603; “CUG_NA_G” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCAGCTGCTACTGCTGtgttctggcaatacctgCAGCAGAAGCAGCAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:604; “CUG_NA_H” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCAGCTGCTGATGCTGtgttctggcaatacctgCAGCAACAGCAGCAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:605; “CUG_NA_I” in Table 7; FIG. 23). In some cases, the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAAAGCTGCTGCTGtgttctggcaatacctgCAGCAGCAGCAAAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATACTGCTGCTGtgttctggcaatacctgCAGCAGCAGAAAAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGATGCTGCTGtgttctggcaatacctgCAGCAGCAACAAAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGCAGCTGCTGtgttctggcaatacctgCAGCAGCAGCAAAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:609; “CUG_388” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence; 32)
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGCTACTGCTGtgttctggcaatacctgCAGCAGAAGCAAAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:610; “CUG_415” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGATGCTGCTGtgttctggcaatacctgCAGCAGCAACAGAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGCAGCTGCTGtgttctggcaatacctgCAGCAGCAGCAGAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGCTGATGCTGtgttctggcaatacctgCAGCAACAGCAGAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:613; “CUG_712” in Table 7; FIG. 23). In some cases, the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGATGCTGCTGtgttctggcaatacctgCAGCAGCAACAACAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGCAGCTGCTGtgttctggcaatacctgCAGCAGCAGCAACAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGCTACTGCTGtgttctggcaatacctgCAGCAGAAGCAACAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:616; “CUG_2170” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence; 39)
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGCTGATGCTGtgttctggcaatacctgCAGCAACAGCAAAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:617; “CUG_442” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAACTGCTGCTGtgttctggcaatacctgCAGCAGCAGAAGAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGCTACTGCTGtgttctggcaatacctgCAGCAGAAGCAGAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:619; “CUG_685” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAACTGCTGCTGtgttctggcaatacctgCAGCAGCAGAAACAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:620; “CUG_2089” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGCTGATGCTGtgttctggcaatacctgCAGCAACAGCAACAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAAAGATGCTGCTGtgttctggcaatacctgCAGCAGCAACAAAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:622; “CUG_4870” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGAAGCTGCTGtgttctggcaatacctgCAGCAGCAACAGAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:623; “CUG_9973” in Table 7; FIG. 23).
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGATGATGCTGtgttctggcaatacctgCAGCAACAACAGAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGCAGATGCTGtgttctggcaatacctgCAGCAACAGCAGAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGATACTGCTGtgttctggcaatacctgCAGCAGAAACAACAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGCAACTGCTGtgttctggcaatacctgCAGCAGAAGCAACAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAAAACTGCTGCTGtgttctggcaatacctgCAGCAGCAGAAAAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAAAGCAGCTGCTGtgttctggcaatacctgCAGCAGCAGCAAAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAAAGCTACTGCTGtgttctggcaatacctgCAGCAGAAGCAAAAGCA
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAAAGCTGATGCTGtgttctggcaatacctgCAGCAACAGCAAAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:631; “CUG_5113” in Table 7; FIG. 23). In some cases, the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATAATGCTGCTGtgttctggcaatacctgCAGCAGCAAAAAAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATACAGCTGCTGtgttctggcaatacctgCAGCAGCAGAAAAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:633; “CUG_5680” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATACTACTGCTGtgttctggcaatacctgCAGCAGAAGAAAAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:634 “CUG_5761” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATACTGATGCTGtgttctggcaatacctgCAGCAACAGAAAAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGAAGCTGCTGtgttctggcaatacctgCAGCAGCAACAAAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:636; “CUG_6328” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGATACTGCTGtgttctggcaatacctgCAGCAGAAACAAAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:637; “CUG_6409” in Table 7; FIG. 23).
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGATGATGCTGtgttctggcaatacctgCAGCAACAACAAAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGCAACTGCTGtgttctggcaatacctgCAGCAGAAGCAAAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGCAGATGCTGtgttctggcaatacctgCAGCAACAGCAAAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGCTAATGCTGtgttctggcaatacctgCAGCAAAAGCAAAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAAATGCTGCTGtgttctggcaatacctgCAGCAGCAAAAGAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAACAGCTGCTGtgttctggcaatacctgCAGCAGCAGAAGAAGCA
- the cassette does not include the 3’ TTTTTG sequence
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAACTACTGCTGtgttctggcaatacctgCAGCAGAAGAAGAAGCA
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAACTGATGCTGtgttctggcaatacctgCAGCAACAGAAGAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:645; “CUG_9487” in Table 7; FIG. 23). In some cases, the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGATACTGCTGtgttctggcaatacctgCAGCAGAAACAGAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:646; “CUG_10054” in Table 7; FIG. 23). In some cases, the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGCAACTGCTGtgttctggcaatacctgCAGCAGAAGCAGAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:647; “CUG_10621” in Table 7; FIG. 23). In some cases, the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGCTAATGCTGtgttctggcaatacctgCAGCAAAAGCAGAAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:648; “CUG_11188” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAAATGCTGCTGtgttctggcaatacctgCAGCAGCAAAAACAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:649; “CUG_222609” in Table 7; FIG. 23). In some cases, the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAACAGCTGCTGtgttctggcaatacctgCAGCAGCAGAAACAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:650; “CUG_22690” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAACTACTGCTGtgttctggcaatacctgCAGCAGAAGAAACAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:651; “CUG_22771” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence; 74)
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAACTGATGCTGtgttctggcaatacctgCAGCAACAGAAACAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:652; “CUG_22852” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGAAGCTGCTGtgttctggcaatacctgCAGCAGCAACAACAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:653; “CUG_233338” in Table 7; FIG. 23). In some cases, the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGATGATGCTGtgttctggcaatacctgCAGCAACAACAACAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:654; “CUG_23500” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGCAGATGCTGtgttctggcaatacctgCAGCAACAGCAACAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:655; “CUG_24067” in Table 7; FIG. 23). In some cases, the cassette does not include the 3’ TTTTTG sequence;
- a cassette comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGCTAATGCTGtgttctggcaatacctgCAGCAAAAGCAACAGCA GCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:656; “CUG_24553” in Table 7; FIG. 23). In some cases, the cassette does not include the 3’ TTTTTG sequence.
- pairs of 5’ flanking and 3’ flanking polynucleotides include: i) SEQ ID NO: 854 and SEQ ID NO: 855; ii) SEQ ID NO:856 and SEQ ID NO:857; and iii) SEQ ID NO:858 and SEQ ID NO:859.
- the cassette includes a 3’ TTTTTG transcription termination sequence.
- the cassette does not include a 3’ TTTTTG sequence.
- the cassette includes, at the 3’ end, the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10).
- the cassette includes, at the 3’ end, the nucleotide sequence TTTTT.
- the cassettes shown in FIG. 25 1)
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:854; ii) SEQ ID NO:379; iii) a sequence that is complementary to SEQ ID NO: 379, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 379; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 379; iii) a sequence that is complementary to SEQ ID NO: 379, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 379; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 379; iii) a sequence that is complementary to SEQ ID NO: 379, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 379; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:854; ii) SEQ ID NO:380; iii) a sequence that is complementary to SEQ ID NO: 380, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 380; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 380; iii) a sequence that is complementary to SEQ ID NO: 380, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 380; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 380; iii) a sequence that is complementary to SEQ ID NO: 380, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 380; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:854; ii) SEQ ID NO:381; iii) a sequence that is complementary to SEQ ID NO: 381, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 381; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 381; iii) a sequence that is complementary to SEQ ID NO: 381, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 381; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 381; iii) a sequence that is complementary to SEQ ID NO: 381, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 381; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:854; ii) SEQ ID NO:382; iii) a sequence that is complementary to SEQ ID NO: 382, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 382; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 382; iii) a sequence that is complementary to SEQ ID NO: 382, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 382; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 382; iii) a sequence that is complementary to SEQ ID NO: 382, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 382; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:854; ii) SEQ ID NO:383; iii) a sequence that is complementary to SEQ ID NO: 383, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 383; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 383; iii) a sequence that is complementary to SEQ ID NO: 383, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 383; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 383; iii) a sequence that is complementary to SEQ ID NO: 383, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 383; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:854; ii) SEQ ID NO:384; iii) a sequence that is complementary to SEQ ID NO: 384, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 384; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 384; iii) a sequence that is complementary to SEQ ID NO: 384, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 384; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 384; iii) a sequence that is complementary to SEQ ID NO: 384, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 384; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:854; ii) SEQ ID NO:385; iii) a sequence that is complementary to SEQ ID NO: 385, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 385; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 385; iii) a sequence that is complementary to SEQ ID NO: 385, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 385; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 385; iii) a sequence that is complementary to SEQ ID NO: 385, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 385; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:854; ii) SEQ ID NO:386; iii) a sequence that is complementary to SEQ ID NO: 386, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 386; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 386; iii) a sequence that is complementary to SEQ ID NO: 386, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 386; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 386; iii) a sequence that is complementary to SEQ ID NO: 386, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 386; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:854; ii) SEQ ID NO:387; iii) a sequence that is complementary to SEQ ID NO: 387, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 387; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 387; iii) a sequence that is complementary to SEQ ID NO: 387, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 387; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 387; iii) a sequence that is complementary to SEQ ID NO: 387, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 387; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:388; iii) a sequence that is complementary to SEQ ID NO: 388, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 388; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 388; iii) a sequence that is complementary to SEQ ID NO: 388, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 388; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858;
- SEQ ID NO: 388 a sequence that is complementary to SEQ ID NO: 388, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 388; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:389; iii) a sequence that is complementary to SEQ ID NO: 389, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 389; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 389; iii) a sequence that is complementary to SEQ ID NO: 389, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 389; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858;
- SEQ ID NO: 389 a sequence that is complementary to SEQ ID NO: 389, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 389; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:390; iii) a sequence that is complementary to SEQ ID NO: 390, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 390; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 390; iii) a sequence that is complementary to SEQ ID NO: 390, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 390; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 390; iii) a sequence that is complementary to SEQ ID NO: 309, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 390; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:391; iii) a sequence that is complementary to SEQ ID NO: 391, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 391; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 391; iii) a sequence that is complementary to SEQ ID NO: 391, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 391; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 391; iii) a sequence that is complementary to SEQ ID NO: 391, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 391; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:390; iii) a sequence that is complementary to SEQ ID NO: 390, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 390; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 390; iii) a sequence that is complementary to SEQ ID NO: 390, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 390; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 390; iii) a sequence that is complementary to SEQ ID NO: 390, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 390; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO: 391; iii) a sequence that is complementary to SEQ ID NO: 391, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 391; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 391; iii) a sequence that is complementary to SEQ ID NO: 391, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 391; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:858; ii) SEQ ID NO: 391; iii) a sequence that is complementary to SEQ ID NO: 391, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 391; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:392; iii) a sequence that is complementary to SEQ ID NO: 392, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 392; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 392; iii) a sequence that is complementary to SEQ ID NO: 392, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 392; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 392; iii) a sequence that is complementary to SEQ ID NO: 392, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 392; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:393; iii) a sequence that is complementary to SEQ ID NO: 393, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 393; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 393; iii) a sequence that is complementary to SEQ ID NO: 393, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 393; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 393; iii) a sequence that is complementary to SEQ ID NO: 393, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 393; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO: 854; ii) SEQ ID NO:394; iii) a sequence that is complementary to SEQ ID NO: 394, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 394; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 394; iii) a sequence that is complementary to SEQ ID NO: 394, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 394; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 394; iii) a sequence that is complementary to SEQ ID NO: 394, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 394; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:395; iii) a sequence that is complementary to SEQ ID NO: 395, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 395; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 395; iii) a sequence that is complementary to SEQ ID NO: 395, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 395; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 395; iii) a sequence that is complementary to SEQ ID NO: 395, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 395; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:396; iii) a sequence that is complementary to SEQ ID NO: 396, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 396; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 396; iii) a sequence that is complementary to SEQ ID NO: 396, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 396; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 396; iii) a sequence that is complementary to SEQ ID NO: 396, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 396; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:397; iii) a sequence that is complementary to SEQ ID NO: 397, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 397; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 397; iii) a sequence that is complementary to SEQ ID NO: 397, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 397; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 397; iii) a sequence that is complementary to SEQ ID NO: 397, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 397; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:398; iii) a sequence that is complementary to SEQ ID NO: 398, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 398; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 398; iii) a sequence that is complementary to SEQ ID NO: 398, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 398; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 398; iii) a sequence that is complementary to SEQ ID NO: 398, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 398; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:399; iii) a sequence that is complementary to SEQ ID NO: 399, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 399; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 399; iii) a sequence that is complementary to SEQ ID NO: 399, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 399; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 399; iii) a sequence that is complementary to SEQ ID NO: 399, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 399; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:400; iii) a sequence that is complementary to SEQ ID NO: 400, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 400; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 400; iii) a sequence that is complementary to SEQ ID NO: 400, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 400; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 400; iii) a sequence that is complementary to SEQ ID NO: 400, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 400; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:401; iii) a sequence that is complementary to SEQ ID NO: 401, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 401; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 401; iii) a sequence that is complementary to SEQ ID NO: 401, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 401; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 401; iii) a sequence that is complementary to SEQ ID NO: 401, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 401; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:402; iii) a sequence that is complementary to SEQ ID NO: 402, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 402; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 402; iii) a sequence that is complementary to SEQ ID NO: 402, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 402; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 402; iii) a sequence that is complementary to SEQ ID NO: 402, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 402; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:403; iii) a sequence that is complementary to SEQ ID NO: 403, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 403; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 403; iii) a sequence that is complementary to SEQ ID NO: 403, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 403; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 403; iii) a sequence that is complementary to SEQ ID NO: 403, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 403; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:404; iii) a sequence that is complementary to SEQ ID NO: 404, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 404; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 404; iii) a sequence that is complementary to SEQ ID NO: 404, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 404; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 404; iii) a sequence that is complementary to SEQ ID NO: 404, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 404; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:405; iii) a sequence that is complementary to SEQ ID NO: 405, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 405; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 405; iii) a sequence that is complementary to SEQ ID NO: 405, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 405; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 405; iii) a sequence that is complementary to SEQ ID NO: 405, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 405; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:406; iii) a sequence that is complementary to SEQ ID NO: 406, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 406; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 406; iii) a sequence that is complementary to SEQ ID NO: 406, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 406; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 406; iii) a sequence that is complementary to SEQ ID NO: 406, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 406; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:407; iii) a sequence that is complementary to SEQ ID NO: 407, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 407; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 407; iii) a sequence that is complementary to SEQ ID NO: 407, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 407; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 407; iii) a sequence that is complementary to SEQ ID NO: 407, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 407; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:408; iii) a sequence that is complementary to SEQ ID NO: 408, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 408; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 408; iii) a sequence that is complementary to SEQ ID NO: 408, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 408; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 408; iii) a sequence that is complementary to SEQ ID NO: 408, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 408; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:409; iii) a sequence that is complementary to SEQ ID NO: 409, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 409; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 409; iii) a sequence that is complementary to SEQ ID NO: 409, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 409; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 409; iii) a sequence that is complementary to SEQ ID NO: 409, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 409; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:410; iii) a sequence that is complementary to SEQ ID NO: 410, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 410; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 410; iii) a sequence that is complementary to SEQ ID NO: 410, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 410; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 410; iii) a sequence that is complementary to SEQ ID NO: 410, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 410; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:411; iii) a sequence that is complementary to SEQ ID NO: 411, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 411; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 411; iii) a sequence that is complementary to SEQ ID NO: 411, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 411; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 411; iii) a sequence that is complementary to SEQ ID NO: 411, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 411; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:412; iii) a sequence that is complementary to SEQ ID NO: 412, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 412; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 412; iii) a sequence that is complementary to SEQ ID NO: 412, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 412; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 412; iii) a sequence that is complementary to SEQ ID NO: 412, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 412; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:413; iii) a sequence that is complementary to SEQ ID NO: 413, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 413; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 413; iii) a sequence that is complementary to SEQ ID NO: 413, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 413; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 413; iii) a sequence that is complementary to SEQ ID NO: 413, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 413; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:414; iii) a sequence that is complementary to SEQ ID NO: 414, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 414; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 414; iii) a sequence that is complementary to SEQ ID NO: 414, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 414; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 414; iii) a sequence that is complementary to SEQ ID NO: 414, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 414; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:415; iii) a sequence that is complementary to SEQ ID NO: 415, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 415; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 415; iii) a sequence that is complementary to SEQ ID NO: 415, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 415; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 415; iii) a sequence that is complementary to SEQ ID NO: 415, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 415; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:416; iii) a sequence that is complementary to SEQ ID NO: 416, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 416; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 416; iii) a sequence that is complementary to SEQ ID NO: 416, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 416; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 416; iii) a sequence that is complementary to SEQ ID NO: 416, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 416; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:417; iii) a sequence that is complementary to SEQ ID NO: 417, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 417; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 417; iii) a sequence that is complementary to SEQ ID NO: 417, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 417; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 417; iii) a sequence that is complementary to SEQ ID NO: 417, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 417; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:418; iii) a sequence that is complementary to SEQ ID NO: 418, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 418; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 418; iii) a sequence that is complementary to SEQ ID NO: 418, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 418; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 418; iii) a sequence that is complementary to SEQ ID NO: 418, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 418; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:419; iii) a sequence that is complementary to SEQ ID NO: 419, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 419; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 419; iii) a sequence that is complementary to SEQ ID NO: 419, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 419; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 419; iii) a sequence that is complementary to SEQ ID NO: 419, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 419; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:420; iii) a sequence that is complementary to SEQ ID NO: 420, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 420; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 420; iii) a sequence that is complementary to SEQ ID NO: 420, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 420; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 420; iii) a sequence that is complementary to SEQ ID NO: 420, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 420; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:421; iii) a sequence that is complementary to SEQ ID NO: 421, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 421; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 421; iii) a sequence that is complementary to SEQ ID NO: 421, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 421; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 421; iii) a sequence that is complementary to SEQ ID NO: 421, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 421; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:422; iii) a sequence that is complementary to SEQ ID NO: 422, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 422; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 422; iii) a sequence that is complementary to SEQ ID NO: 422, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 422; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 422; iii) a sequence that is complementary to SEQ ID NO: 422, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 422; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:423; iii) a sequence that is complementary to SEQ ID NO: 423, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 423; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 423; iii) a sequence that is complementary to SEQ ID NO: 423, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 423; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 423; iii) a sequence that is complementary to SEQ ID NO: 423, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 423; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:424; iii) a sequence that is complementary to SEQ ID NO: 424, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 424; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 424; iii) a sequence that is complementary to SEQ ID NO: 424, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 424; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 424; iii) a sequence that is complementary to SEQ ID NO: 424, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 424; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:425; iii) a sequence that is complementary to SEQ ID NO: 425, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 425; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 425; iii) a sequence that is complementary to SEQ ID NO: 425, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 425; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 425; iii) a sequence that is complementary to SEQ ID NO: 425, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 425; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:426; iii) a sequence that is complementary to SEQ ID NO: 426, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 426; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 426; iii) a sequence that is complementary to SEQ ID NO: 426, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 426; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 426; iii) a sequence that is complementary to SEQ ID NO: 426, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 426; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:427; iii) a sequence that is complementary to SEQ ID NO: 427, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 427; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 427; iii) a sequence that is complementary to SEQ ID NO: 427, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 427; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 427; iii) a sequence that is complementary to SEQ ID NO: 427, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 427; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:428; iii) a sequence that is complementary to SEQ ID NO: 428, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 428; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 428; iii) a sequence that is complementary to SEQ ID NO: 428, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 428; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 428; iii) a sequence that is complementary to SEQ ID NO: 428, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 428; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:429; iii) a sequence that is complementary to SEQ ID NO: 429, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 429; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 429; iii) a sequence that is complementary to SEQ ID NO: 429, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 429; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 429; iii) a sequence that is complementary to SEQ ID NO: 429, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 429; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:430; iii) a sequence that is complementary to SEQ ID NO: 430, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 430; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 430; iii) a sequence that is complementary to SEQ ID NO: 430, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 430; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 430; iii) a sequence that is complementary to SEQ ID NO: 430, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 430; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:431; iii) a sequence that is complementary to SEQ ID NO: 431, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 431; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 431; iii) a sequence that is complementary to SEQ ID NO: 431, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 431; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 431; iii) a sequence that is complementary to SEQ ID NO: 431, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 431; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:432; iii) a sequence that is complementary to SEQ ID NO: 432, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 432; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 432; iii) a sequence that is complementary to SEQ ID NO: 432, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 432; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 432; iii) a sequence that is complementary to SEQ ID NO: 432, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 432; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:433; iii) a sequence that is complementary to SEQ ID NO: 433, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 433; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 433; iii) a sequence that is complementary to SEQ ID NO: 433, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 433; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 433; iii) a sequence that is complementary to SEQ ID NO: 433, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 433; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:434; iii) a sequence that is complementary to SEQ ID NO: 434, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 434; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 434; iii) a sequence that is complementary to SEQ ID NO: 434, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 434; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 434; iii) a sequence that is complementary to SEQ ID NO: 434, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 434; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:435; iii) a sequence that is complementary to SEQ ID NO: 435, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 435; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 435; iii) a sequence that is complementary to SEQ ID NO: 435, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 435; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 435; iii) a sequence that is complementary to SEQ ID NO: 435, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 435; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:436; iii) a sequence that is complementary to SEQ ID NO: 436, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 436; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 436; iii) a sequence that is complementary to SEQ ID NO: 436, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 436; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 436; iii) a sequence that is complementary to SEQ ID NO: 436, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 436; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:437; iii) a sequence that is complementary to SEQ ID NO: 437, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 437; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 437; iii) a sequence that is complementary to SEQ ID NO: 437, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 437; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 437; iii) a sequence that is complementary to SEQ ID NO: 437, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 437; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:438; iii) a sequence that is complementary to SEQ ID NO: 438, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 438; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 438; iii) a sequence that is complementary to SEQ ID NO: 438, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 438; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 438; iii) a sequence that is complementary to SEQ ID NO: 438, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 438; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:439; iii) a sequence that is complementary to SEQ ID NO: 439, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 439; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 439; iii) a sequence that is complementary to SEQ ID NO: 439, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 439; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 439; iii) a sequence that is complementary to SEQ ID NO: 439, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 439; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:440; iii) a sequence that is complementary to SEQ ID NO: 440, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 440; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 440; iii) a sequence that is complementary to SEQ ID NO: 440, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 440; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 440; iii) a sequence that is complementary to SEQ ID NO: 440, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 440; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:441; iii) a sequence that is complementary to SEQ ID NO: 441, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 441; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 441; iii) a sequence that is complementary to SEQ ID NO: 441, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 441; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 441; iii) a sequence that is complementary to SEQ ID NO: 441, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 441; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:442; iii) a sequence that is complementary to SEQ ID NO: 442, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 442; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 442; iii) a sequence that is complementary to SEQ ID NO: 442, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 442; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 442; iii) a sequence that is complementary to SEQ ID NO: 442, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 442; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:443; iii) a sequence that is complementary to SEQ ID NO: 443, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 443; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 443; iii) a sequence that is complementary to SEQ ID NO: 443, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 443; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 443; iii) a sequence that is complementary to SEQ ID NO: 443, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 443; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:444; iii) a sequence that is complementary to SEQ ID NO: 444, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 444; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 444; iii) a sequence that is complementary to SEQ ID NO: 444, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 444; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 444; iii) a sequence that is complementary to SEQ ID NO: 444, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 444; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:445; iii) a sequence that is complementary to SEQ ID NO: 445, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 445; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 445; iii) a sequence that is complementary to SEQ ID NO: 445, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 445; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 445; iii) a sequence that is complementary to SEQ ID NO: 445, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 445; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:446; iii) a sequence that is complementary to SEQ ID NO: 446, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 446; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 446; iii) a sequence that is complementary to SEQ ID NO: 446, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 446; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 446; iii) a sequence that is complementary to SEQ ID NO: 446, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 446; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:447; iii) a sequence that is complementary to SEQ ID NO: 447, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 447; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 447; iii) a sequence that is complementary to SEQ ID NO: 447, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 447; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 447; iii) a sequence that is complementary to SEQ ID NO: 447, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 447; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:448; iii) a sequence that is complementary to SEQ ID NO: 448, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 448; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 448; iii) a sequence that is complementary to SEQ ID NO: 448, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 448; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 448; iii) a sequence that is complementary to SEQ ID NO: 448, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 448; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:449; iii) a sequence that is complementary to SEQ ID NO: 449, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 449; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 449; iii) a sequence that is complementary to SEQ ID NO: 449, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 449; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 449; iii) a sequence that is complementary to SEQ ID NO: 449, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 449; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:450; iii) a sequence that is complementary to SEQ ID NO: 450, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 450; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 450; iii) a sequence that is complementary to SEQ ID NO: 450, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 450; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 450; iii) a sequence that is complementary to SEQ ID NO: 450, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 450; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:451; iii) a sequence that is complementary to SEQ ID NO: 451, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 451; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 451; iii) a sequence that is complementary to SEQ ID NO: 451, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 451; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 451; iii) a sequence that is complementary to SEQ ID NO: 451, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 451; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:452; iii) a sequence that is complementary to SEQ ID NO: 452, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 452; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 452; iii) a sequence that is complementary to SEQ ID NO: 452, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 452; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 452; iii) a sequence that is complementary to SEQ ID NO: 452, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 452; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:453; iii) a sequence that is complementary to SEQ ID NO: 453, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 453; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 453; iii) a sequence that is complementary to SEQ ID NO: 453, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 453; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 453; iii) a sequence that is complementary to SEQ ID NO: 453, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 453; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:454; iii) a sequence that is complementary to SEQ ID NO: 454, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 454; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 454; iii) a sequence that is complementary to SEQ ID NO: 454, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 454; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 454; iii) a sequence that is complementary to SEQ ID NO: 454, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 454; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:455; iii) a sequence that is complementary to SEQ ID NO: 455, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 455; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 455; iii) a sequence that is complementary to SEQ ID NO: 455, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 455; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 455; iii) a sequence that is complementary to SEQ ID NO: 455, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 455; and iv) SEQ ID NO: 859.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:456; iii) a sequence that is complementary to SEQ ID NO: 456, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 456; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:856; ii) SEQ ID NO: 456; iii) a sequence that is complementary to SEQ ID NO: 456, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 456; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:858; ii) SEQ ID NO: 456; iii) a sequence that is complementary to SEQ ID NO: 456, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 456; and iv) SEQ ID NO: 859.
- the present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or an “sbRNA”).
- the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a promoter that is functional in a eukaryotic cell.
- the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an RNA polymerase II promoter.
- the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an RNA polymerase III promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a CMV promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a CAG promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a CBA promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a U6 promoter.
- the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an EFl a promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3’ AAV ITR sequence.
- AAV adeno-associated virus
- ITR inverted terminal repeat
- the present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure, where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”), a loop polynucleotide, and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the loop polynucleotide; (iv) the second strand of the double-stranded RNA; and iii) the 3’ trailer polynucleotide; and where
- the present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure, where the recombinant RNA molecule comprises: a) a doublestranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide, a loop polynucleotide, and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the double- stranded RNA; iii) the loop polynucleotide; (iv) the first strand of the double-stranded RNA; and iii) the 3’ flanking polynucleotide; and wherein at least one of the 5’ flanking polynucleotide, the loop polynucleotide, and
- the present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure, where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide (also referred to herein as a “5’ leader”) and a 3’ flanking polynucleotide (also referred to herein as a “3’ trailer”), wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the first strand of the double-stranded RNA; iii) the second strand of the double-stranded RNA; and iv) the 3’ trailer polynucleotide; and wherein one or both of the 5’ flanking polynucleotide and the 3’ flanking polynucle
- the present disclosure provides a recombinant expression vector comprising a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure, where the recombinant RNA molecule comprises: a) a double-stranded RNA of the present disclosure; and b) a microRNA scaffold comprising a 5’ flanking polynucleotide and a 3’ flanking polynucleotide, wherein the recombinant nucleic acid comprises: i) the 5’ flanking polynucleotide; ii) the second strand of the doublestranded RNA; iii) the first strand of the double-stranded RNA; and iv) the 3’ flanking polynucleotide; and wherein one or both of 5’ flanking polynucleotide and the 3’ flanking polynucleotide is heterologous to the first and/or the second strand of the double-stranded RNA.
- Recombinant expression vector comprising a cassette
- the present disclosure provides a recombinant expression vector comprising cassette (a “DNA molecule”) of the present disclosure, where the cassette comprises a nucleotide sequence encoding a recombinant RNA molecule of the present disclosure (where the recombinant RNA molecule may be referred to as an “artificial microRNA” or an “sbRNA”).
- the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a promoter that is functional in a eukaryotic cell.
- the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an RNA polymerase II promoter.
- the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an RNA polymerase III promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a CMV promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to a U6 promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an EFla promoter. In some cases, the nucleotide sequence encoding the recombinant RNA molecule is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ adeno-associated virus (AAV) inverted terminal repeat (ITR) sequence and a 3’ AAV ITR sequence.
- AAV adeno-associated virus
- ITR inverted terminal repeat
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGCTGCTGCTGtgttctggcaatacctgCAGCAGCAGCA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:579; “CUG-10” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the
- AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGCTGCTGCTGtgttctggcaatacctgCAGCAGCAGCA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:580; “CUG_19” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.;
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACTACTGCTGCTGtgttctggcaatacctgCAGCAGCAGAA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:581; “CUG_28” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACTGATGCTGCTGtgttctggcaatacctgCAGCAGCAACA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:582; “CUG_37” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACTGCAGCTGCTGtgttctggcaatacctgCAGCAGCAGCA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:583; “CUG_46” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACTGCTACTGCTGtgttctggcaatacctgCAGCAGAAGCA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:584; CUG_55” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACTGCTGATGCTGtgttctggcaatacctgCAGCAACAGCA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:585; “CUG_64” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGCTGCTGCTGtgttctggcaatacctgCAGCAGCAGCA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:586; “CUG_118” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGATACTGCTGCTGtgttctggcaatacctgCAGCAGCAGAA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:587; “CUG_127” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGATGATGCTGCTGtgttctggcaatacctgCAGCAGCAACA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:588; “CUG_136” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGATGCAGCTGCTGtgttctggcaatacctgCAGCAGCAGCA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:589; “CUG_145” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGATGCTACTGCTGtgttctggcaatacctgCAGCAGAAGCA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:590; “CUG_154” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGATGCTGATGCTGtgttctggcaatacctgCAGCAACAGCA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:591; “CUG_163” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGCAACTGCTGCTGtgttctggcaatacctgCAGCAGCAGAA GCAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:592; “CUG_217” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGCAGATGCTGCTGtgttctggcaatacctgCAGCAGCAACA GCAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:593; “CUG_226” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGCAGCAGCTGCTGtgttctggcaatacctgCAGCAGCAGCA GCAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:594; “CUG_235” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGCAGCTACTGCTGtgttctggcaatacctgCAGCAGAAGCA GCAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:595; “CUG_244” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGCAGCTGATGCTGtgttctggcaatacctgCAGCAACAGCA GCAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:596; “CUG_253” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCAGCTGCTGCTGCTGtgttctggcaatacctgCAGCAGCAGCA GCAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:597; “CUG_NA-A” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCAACTGCTGCTGCTGtgttctggcaatacctgCAGCAGCAGCA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:598; “CUG_NA_B” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCAGATGCTGCTGCTGtgttctggcaatacctgCAGCAGCAGCA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:599; “CUG_NA_C” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence. In some cases, the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCAGCAGCTGCTGCTGtgttctggcaatacctgCAGCAGCAGCA GCAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NG:600; “CUG_NA_D” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCAGCTACTGCTGCTGtgttctggcaatacctgCAGCAGCAGAA GCAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:601; “CUG_NA_E” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCAGCTGATGCTGCTGtgttctggcaatacctgCAGCAGCAACA GCAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:602; “CUG_NA_F” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCAGCTGCAGCTGCTGtgttctggcaatacctgCAGCAGCAGCA GCAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:603; “CUG_NA_G” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCAGCTGCTACTGCTGtgttctggcaatacctgCAGCAGAAGCA GCAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:604; “CUG_NA_H” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCAGCTGCTGATGCTGtgttctggcaatacctgCAGCAACAGCA GCAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:605; “CUG_NA_I” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAAAGCTGCTGCTGtgttctggcaatacctgCAGCAGCAGCA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:606; “CUG_307” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATACTGCTGCTGtgttctggcaatacctgCAGCAGCAGAA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:607; “CUG_334” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGATGCTGCTGtgttctggcaatacctgCAGCAGCAACA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:608; “CUG_361” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGCAGCTGCTGtgttctggcaatacctgCAGCAGCAGCA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:609; “CUG_388” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGCTACTGCTGtgttctggcaatacctgCAGCAGAAGCA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:610; “CUG_415” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGATGCTGCTGtgttctggcaatacctgCAGCAGCAACA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:611; “CUG_631” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGCAGCTGCTGtgttctggcaatacctgCAGCAGCAGCA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:612; “CUG_658” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGCTGATGCTGtgttctggcaatacctgCAGCAACAGCA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:613; “CUG_712” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGATGCTGCTGtgttctggcaatacctgCAGCAGCAACA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:614; “CUG_2116” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGCAGCTGCTGtgttctggcaatacctgCAGCAGCAGCA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:615; “CUG_2143” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGCTACTGCTGtgttctggcaatacctgCAGCAGAAGCA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:616; “CUG_2170” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGCTGATGCTGtgttctggcaatacctgCAGCAACAGCA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:617; “CUG_442” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAACTGCTGCTGtgttctggcaatacctgCAGCAGCAGAA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:618; “CUG_604” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGCTACTGCTGtgttctggcaatacctgCAGCAGAAGCA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:619; “CUG_685” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAACTGCTGCTGtgttctggcaatacctgCAGCAGCAGAA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:620; “CUG_2089” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGCTGATGCTGtgttctggcaatacctgCAGCAACAGCA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:621; “CUG_2197” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAAAGATGCTGCTGtgttctggcaatacctgCAGCAGCAACA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:622; “CUG_4870” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGAAGCTGCTGtgttctggcaatacctgCAGCAGCAACA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:623; “CUG_9973” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGATGATGCTGtgttctggcaatacctgCAGCAACAACA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:624; “CUG_1013” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGCAGATGCTGtgttctggcaatacctgCAGCAACAGCA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:625; “CUG_1070” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGATACTGCTGtgttctggcaatacctgCAGCAGAAACA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:626; “CUG_2341” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGCAACTGCTGtgttctggcaatacctgCAGCAGAAGCA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:627; “CUG_2398” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAAAACTGCTGCTGtgttctggcaatacctgCAGCAGCAGAA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:628; “CUG_4789” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAAAGCAGCTGCTGtgttctggcaatacctgCAGCAGCAGCA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:629; “CUG_4951” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAAAGCTACTGCTGtgttctggcaatacctgCAGCAGAAGCA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:630; “CUG_5032” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAAAGCTGATGCTGtgttctggcaatacctgCAGCAACAGCA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:631; “CUG_5113” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATAATGCTGCTGtgttctggcaatacctgCAGCAGCAAAA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:632; “CUG_5599” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATACAGCTGCTGtgttctggcaatacctgCAGCAGCAGAA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:633; “CUG_5680” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATACTACTGCTGtgttctggcaatacctgCAGCAGAAGAA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:634 “CUG_5761” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATACTGATGCTGtgttctggcaatacctgCAGCAACAGAA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:635; “CUG_5842” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGAAGCTGCTGtgttctggcaatacctgCAGCAGCAACA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:636; “CUG_6328” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGATACTGCTGtgttctggcaatacctgCAGCAGAAACA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:637; “CUG_6409” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGATGATGCTGtgttctggcaatacctgCAGCAACAACA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:638; “CUG_6490” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGCAACTGCTGtgttctggcaatacctgCAGCAGAAGCA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:639; “CUG_6976” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGCAGATGCTGtgttctggcaatacctgCAGCAACAGCA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:640; “CUG_7057” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTAATGCTAATGCTGtgttctggcaatacctgCAGCAAAAGCA AAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:641; “CUG_7543” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAAATGCTGCTGtgttctggcaatacctgCAGCAGCAAAA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:642; “CUG_9244” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAACAGCTGCTGtgttctggcaatacctgCAGCAGCAGAA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:643; “CUG_9325” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAACTACTGCTGtgttctggcaatacctgCAGCAGAAGAA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:644; “CUG_9406” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAACTGATGCTGtgttctggcaatacctgCAGCAACAGAA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:645; “CUG_9487” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGATACTGCTGtgttctggcaatacctgCAGCAGAAACA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:646; “CUG_10054” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGCAACTGCTGtgttctggcaatacctgCAGCAGAAGCA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:647; “CUG_10621” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTACAGCTAATGCTGtgttctggcaatacctgCAGCAAAAGCA GAAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:648; “CUG_11188” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAAATGCTGCTGtgttctggcaatacctgCAGCAGCAAAA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:649; “CUG_222609” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAACAGCTGCTGtgttctggcaatacctgCAGCAGCAGAA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:650; “CUG_22690” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAACTACTGCTGtgttctggcaatacctgCAGCAGAAGAA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:651; “CUG_22771” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAACTGATGCTGtgttctggcaatacctgCAGCAACAGAA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:652; “CUG_22852” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGAAGCTGCTGtgttctggcaatacctgCAGCAGCAACA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:653; “CUG_233338” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGATGATGCTGtgttctggcaatacctgCAGCAACAACA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:654; “CUG_23500” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGCAGATGCTGtgttctggcaatacctgCAGCAACAGCA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:655; “CUG_24067” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises a cassette that comprises the nucleotide sequence: tgcacacctcctggcgggcagctctgCTGCTGCTGAAGCTAATGCTGtgttctggcaatacctgCAGCAAAAGCA ACAGCAGCAGCAgggaggcctgccctgactgcccacTTTTTG (SEQ ID NO:656; “CUG_24553” in Table 7; FIG. 23).
- the cassette does not include the 3’ TTTTTG sequence.
- the cassette includes the nucleotide sequence T n , where n is an integer from 5 to 10 (e.g., n is 5, 6, 7, 8, 9, or 10), in place of the 3’ TTTTTG sequence.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter.
- the cassette is operably linked to a CBA promoter.
- the cassette is operably linked to a CMV promoter.
- the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises one of the following cassettes.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:379; iii) a sequence that is complementary to SEQ ID NO: 379, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 379; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:856; ii) SEQ ID NO: 379; iii) a sequence that is complementary to SEQ ID NO: 379, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 379; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:858; ii) SEQ ID NO: 379; iii) a sequence that is complementary to SEQ ID NO: 379, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 379; and iv) SEQ ID NO: 859.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter. In some cases, the cassette is operably linked to a CBA promoter. In some cases, the cassette is operably linked to a CMV promoter. In some cases, the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises one of the following cassettes.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:380; iii) a sequence that is complementary to SEQ ID NO: 380, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 380; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:856; ii) SEQ ID NO: 380; iii) a sequence that is complementary to SEQ ID NO: 380, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 380; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:858; ii) SEQ ID NO: 380; iii) a sequence that is complementary to SEQ ID NO: 380, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 380; and iv) SEQ ID NO: 859.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter. In some cases, the cassette is operably linked to a CBA promoter. In some cases, the cassette is operably linked to a CMV promoter. In some cases, the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises one of the following cassettes.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:381; iii) a sequence that is complementary to SEQ ID NO: 381, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 381; and iv) SEQ ID NO: 855.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:856; ii) SEQ ID NO: 381; iii) a sequence that is complementary to SEQ ID NO: 381, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 381; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:858; ii) SEQ ID NO: 381; iii) a sequence that is complementary to SEQ ID NO: 381, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 381; and iv) SEQ ID NO: 859.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter. In some cases, the cassette is operably linked to a CBA promoter. In some cases, the cassette is operably linked to a CMV promoter. In some cases, the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises one of the following cassettes.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:382; iii) a sequence that is complementary to SEQ ID NO: 382, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 382; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:856; ii) SEQ ID NO: 382; iii) a sequence that is complementary to SEQ ID NO: 382, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 382; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:858; ii) SEQ ID NO: 382; iii) a sequence that is complementary to SEQ ID NO: 382, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 382; and iv) SEQ ID NO: 859.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter. In some cases, the cassette is operably linked to a CBA promoter. In some cases, the cassette is operably linked to a CMV promoter. In some cases, the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises one of the following cassettes.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:383; iii) a sequence that is complementary to SEQ ID NO: 383, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 383; and iv) SEQ ID NO: 855.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:856; ii) SEQ ID NO: 383; iii) a sequence that is complementary to SEQ ID NO: 383, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 383; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:858; ii) SEQ ID NO: 383; iii) a sequence that is complementary to SEQ ID NO: 383, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 383; and iv) SEQ ID NO: 859.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter. In some cases, the cassette is operably linked to a CBA promoter. In some cases, the cassette is operably linked to a CMV promoter. In some cases, the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises one of the following cassettes.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:384; iii) a sequence that is complementary to SEQ ID NO: 384, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 384; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:856; ii) SEQ ID NO: 384; iii) a sequence that is complementary to SEQ ID NO: 384, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 384; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:858; ii) SEQ ID NO: 384; iii) a sequence that is complementary to SEQ ID NO: 384, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 384; and iv) SEQ ID NO: 859.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter. In some cases, the cassette is operably linked to a CBA promoter. In some cases, the cassette is operably linked to a CMV promoter. In some cases, the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises one of the following cassettes.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:385; iii) a sequence that is complementary to SEQ ID NO: 385, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 385; and iv) SEQ ID NO: 855.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:856; ii) SEQ ID NO: 385; iii) a sequence that is complementary to SEQ ID NO: 385, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 385; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:858; ii) SEQ ID NO: 385; iii) a sequence that is complementary to SEQ ID NO: 385, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 385; and iv) SEQ ID NO: 859.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter. In some cases, the cassette is operably linked to a CBA promoter. In some cases, the cassette is operably linked to a CMV promoter. In some cases, the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises one of the following cassettes.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:386; iii) a sequence that is complementary to SEQ ID NO: 386, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 386; and iv) SEQ ID NO: 855.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:856; ii) SEQ ID NO: 386; iii) a sequence that is complementary to SEQ ID NO: 386, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 386; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:858; ii) SEQ ID NO: 386; iii) a sequence that is complementary to SEQ ID NO: 386, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 386; and iv) SEQ ID NO: 859.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter. In some cases, the cassette is operably linked to a CBA promoter. In some cases, the cassette is operably linked to a CMV promoter. In some cases, the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises one of the following cassettes.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:387; iii) a sequence that is complementary to SEQ ID NO: 387, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 387; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:856; ii) SEQ ID NO: 387; iii) a sequence that is complementary to SEQ ID NO: 387, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 387; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:858; ii) SEQ ID NO: 387; iii) a sequence that is complementary to SEQ ID NO: 387, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 387; and iv) SEQ ID NO: 859.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter. In some cases, the cassette is operably linked to a CBA promoter. In some cases, the cassette is operably linked to a CMV promoter. In some cases, the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises one of the following cassettes.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:388; iii) a sequence that is complementary to SEQ ID NO: 388, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 388; and iv) SEQ ID NO: 855.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:856; ii) SEQ ID NO: 388; iii) a sequence that is complementary to SEQ ID NO: 388, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 388; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:858; ii) SEQ ID NO: 388; iii) a sequence that is complementary to SEQ ID NO: 388, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 388; and iv) SEQ ID NO: 859.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter. In some cases, the cassette is operably linked to a CBA promoter. In some cases, the cassette is operably linked to a CMV promoter. In some cases, the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises one of the following cassettes.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:389; iii) a sequence that is complementary to SEQ ID NO: 389, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 389; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:856; ii) SEQ ID NO: 389; iii) a sequence that is complementary to SEQ ID NO: 389, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 389; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:858; ii) SEQ ID NO: 389; iii) a sequence that is complementary to SEQ ID NO: 389, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 389; and iv) SEQ ID NO: 859.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
- the cassette is operably linked to a CAG promoter. In some cases, the cassette is operably linked to a CBA promoter. In some cases, the cassette is operably linked to a CMV promoter. In some cases, the cassette is operably linked to a U6 promoter. In some cases, the cassette is operably linked to an EFla promoter. In some cases, the cassette is operably linked to an Hl promoter. In some cases, the recombinant expression vector comprises a 5’ AAV ITR sequence and a 3’ AAV ITR sequence. In some cases, the AAV ITRs are AAV9 ITRs. In some cases, the AAV ITRs are AAV2 ITRs.
- a recombinant expression vector comprises one of the following cassettes.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:854; ii) SEQ ID NO:390; iii) a sequence that is complementary to SEQ ID NO: 390, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 390; and iv) SEQ ID NO:855.
- a cassette comprises, in order from 5’ to 3’ : i) SEQ ID NO:856; ii) SEQ ID NO: 390; iii) a sequence that is complementary to SEQ ID NO: 390, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 390; and iv) SEQ ID NO:857.
- a cassette comprises, in order from 5’ to 3’: i) SEQ ID NO:858; ii) SEQ ID NO: 390; iii) a sequence that is complementary to SEQ ID NO: 309, where the sequence can comprise from 0 to 10 mismatches (non-complementary nucleotides) to SEQ ID NO: 390; and iv) SEQ ID NO: 859.
- the cassette is operably linked to a promoter that is functional in a eukaryotic cell.
- the cassette is operably linked to an RNA polymerase II promoter.
- the cassette is operably linked to an RNA polymerase III promoter.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Epidemiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Psychology (AREA)
- Virology (AREA)
- Dermatology (AREA)
- Hospice & Palliative Care (AREA)
- Psychiatry (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US18/699,523 US20240425856A1 (en) | 2021-10-06 | 2022-10-05 | Compositions and Methods for Treating Cag Repeat Diseases |
| JP2024521180A JP2024543782A (ja) | 2021-10-06 | 2022-10-05 | Cagリピート疾患を治療するための組成物および方法 |
| CA3232737A CA3232737A1 (en) | 2021-10-06 | 2022-10-05 | Compositions and methods for treating cag repeat diseases |
| EP22879440.0A EP4413137A4 (en) | 2021-10-06 | 2022-10-05 | Compositions and Treatment Methods for Recurring Diseases (CAG) |
| AU2022358732A AU2022358732A1 (en) | 2021-10-06 | 2022-10-05 | Compositions and methods for treating cag repeat diseases |
| IL311638A IL311638A (en) | 2021-10-06 | 2022-10-05 | Compositions and methods for treating cag repeat diseases |
| MX2024004119A MX2024004119A (es) | 2021-10-06 | 2024-04-03 | Composiciones y metodos para el tratamiento de enfermedades de repeticion cag |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202163253070P | 2021-10-06 | 2021-10-06 | |
| US63/253,070 | 2021-10-06 | ||
| US202263339363P | 2022-05-06 | 2022-05-06 | |
| US63/339,363 | 2022-05-06 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2023060104A1 true WO2023060104A1 (en) | 2023-04-13 |
Family
ID=85804745
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2022/077572 Ceased WO2023060104A1 (en) | 2021-10-06 | 2022-10-05 | Compositions and methods for treating cag repeat diseases |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US20240425856A1 (https=) |
| EP (1) | EP4413137A4 (https=) |
| JP (1) | JP2024543782A (https=) |
| AU (1) | AU2022358732A1 (https=) |
| CA (1) | CA3232737A1 (https=) |
| IL (1) | IL311638A (https=) |
| MX (1) | MX2024004119A (https=) |
| TW (1) | TW202329985A (https=) |
| WO (1) | WO2023060104A1 (https=) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4446415A1 (en) * | 2023-04-09 | 2024-10-16 | Dystrogen Gene Therapies Inc. | Nucleic acid molecule and use of the nucleic acid molecule in therapy of diseases induced by expansion of trinucleotide cag repeats |
| WO2024211376A3 (en) * | 2023-04-05 | 2024-12-05 | Iris Medicine, Inc. | Compositions and methods for treating cag repeat diseases |
| WO2025050048A3 (en) * | 2023-08-31 | 2025-05-01 | Iris Medicine, Inc. | Methods and compositions for treating ggggcc repeat expansion diseases |
| WO2025137623A1 (en) * | 2023-12-22 | 2025-06-26 | Iris Medicine, Inc. | Methods and compositions for treating ctg repeat expansion diseases |
| WO2025213123A1 (en) * | 2024-04-05 | 2025-10-09 | Encoded Therapeutics, Inc. | Methods and compositions for increasing expression of ube3a |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160376586A1 (en) * | 2013-09-02 | 2016-12-29 | Instytut Chemii Bioorganicznej Pan | Nucleic acid molecule, expression cassette, expression vector, eukaryotic host cell, induction method of rna interferencde in eukaryotic host and use of the nucleic acid molecule in therapy of diseases induced by expansion of trinucleotide gag repeats |
| US20180251762A1 (en) * | 2017-02-20 | 2018-09-06 | Northwestern University | USE OF TRINUCLEOTIDE REPEAT RNAs TO TREAT CANCER |
| US20180282724A1 (en) * | 2015-10-05 | 2018-10-04 | Proqr Therapeutics Ii B.V. | Use of single-stranded antisense oligonucleotide in prevention or treatment of genetic diseases involving a trinucleotide repeat expansion |
-
2022
- 2022-10-05 WO PCT/US2022/077572 patent/WO2023060104A1/en not_active Ceased
- 2022-10-05 TW TW111137904A patent/TW202329985A/zh unknown
- 2022-10-05 JP JP2024521180A patent/JP2024543782A/ja active Pending
- 2022-10-05 EP EP22879440.0A patent/EP4413137A4/en active Pending
- 2022-10-05 AU AU2022358732A patent/AU2022358732A1/en active Pending
- 2022-10-05 US US18/699,523 patent/US20240425856A1/en active Pending
- 2022-10-05 IL IL311638A patent/IL311638A/en unknown
- 2022-10-05 CA CA3232737A patent/CA3232737A1/en active Pending
-
2024
- 2024-04-03 MX MX2024004119A patent/MX2024004119A/es unknown
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20160376586A1 (en) * | 2013-09-02 | 2016-12-29 | Instytut Chemii Bioorganicznej Pan | Nucleic acid molecule, expression cassette, expression vector, eukaryotic host cell, induction method of rna interferencde in eukaryotic host and use of the nucleic acid molecule in therapy of diseases induced by expansion of trinucleotide gag repeats |
| US20180282724A1 (en) * | 2015-10-05 | 2018-10-04 | Proqr Therapeutics Ii B.V. | Use of single-stranded antisense oligonucleotide in prevention or treatment of genetic diseases involving a trinucleotide repeat expansion |
| US20180251762A1 (en) * | 2017-02-20 | 2018-09-06 | Northwestern University | USE OF TRINUCLEOTIDE REPEAT RNAs TO TREAT CANCER |
Non-Patent Citations (1)
| Title |
|---|
| See also references of EP4413137A4 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024211376A3 (en) * | 2023-04-05 | 2024-12-05 | Iris Medicine, Inc. | Compositions and methods for treating cag repeat diseases |
| EP4446415A1 (en) * | 2023-04-09 | 2024-10-16 | Dystrogen Gene Therapies Inc. | Nucleic acid molecule and use of the nucleic acid molecule in therapy of diseases induced by expansion of trinucleotide cag repeats |
| WO2025050048A3 (en) * | 2023-08-31 | 2025-05-01 | Iris Medicine, Inc. | Methods and compositions for treating ggggcc repeat expansion diseases |
| WO2025137623A1 (en) * | 2023-12-22 | 2025-06-26 | Iris Medicine, Inc. | Methods and compositions for treating ctg repeat expansion diseases |
| WO2025213123A1 (en) * | 2024-04-05 | 2025-10-09 | Encoded Therapeutics, Inc. | Methods and compositions for increasing expression of ube3a |
Also Published As
| Publication number | Publication date |
|---|---|
| MX2024004119A (es) | 2024-12-06 |
| EP4413137A1 (en) | 2024-08-14 |
| JP2024543782A (ja) | 2024-11-26 |
| US20240425856A1 (en) | 2024-12-26 |
| CA3232737A1 (en) | 2023-04-13 |
| IL311638A (en) | 2024-05-01 |
| TW202329985A (zh) | 2023-08-01 |
| AU2022358732A1 (en) | 2024-04-11 |
| EP4413137A4 (en) | 2026-02-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240425856A1 (en) | Compositions and Methods for Treating Cag Repeat Diseases | |
| US20230295663A1 (en) | Compositions and methods of treating amyotrophic lateral sclerosis (als) | |
| US20250161485A1 (en) | Aav capsid variants and uses thereof | |
| JP7565218B2 (ja) | 筋萎縮性側索硬化症および脊髄に関連する障害の治療 | |
| KR20190051020A (ko) | 안 질환 치료용 안티센스 올리고뉴클레오타이드 | |
| CN111108198A (zh) | 治疗亨廷顿病的组合物和方法 | |
| WO2016196507A1 (en) | Methods of delivery of transgenes for treating brain diseases | |
| US20180237775A1 (en) | Antisense oligonucleotides and uses thereof | |
| EP2627339A1 (en) | A modified human u1snrna molecule, a gene encoding for the modified human u1snrna molecule, an expression vector including the gene, and the use thereof in gene therapy | |
| JP2023532864A (ja) | 導入遺伝子発現系 | |
| JP2025513066A (ja) | Apoeの核酸制御 | |
| WO2025038430A1 (en) | Aav capsid variants and uses thereof | |
| WO2017064308A1 (en) | Antisense oligonucleotides for use in treating alzheimer's disease | |
| US20200248204A1 (en) | Methods of treating genetic hearing loss | |
| AU2022345874A1 (en) | Liver-specific expression cassettes, vectors and uses thereof for expressing therapeutic proteins | |
| JP7787094B2 (ja) | 筋萎縮性側索硬化症を治療するためのアンチセンス配列 | |
| EP4689120A2 (en) | Compositions and methods for treating cag repeat diseases | |
| CN119451703A (zh) | 髓鞘病症的治疗 | |
| EP4642911A2 (en) | Compositions and methods for regulating mapt | |
| WO2025213123A1 (en) | Methods and compositions for increasing expression of ube3a | |
| EP4118436A1 (en) | Diagnostic methods using sirt1 expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22879440 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 311638 Country of ref document: IL Ref document number: 3232737 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2022358732 Country of ref document: AU Ref document number: 809399 Country of ref document: NZ Ref document number: AU2022358732 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 2024521180 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2024/004119 Country of ref document: MX |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112024006209 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2022358732 Country of ref document: AU Date of ref document: 20221005 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11202402077R Country of ref document: SG |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2022879440 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2022879440 Country of ref document: EP Effective date: 20240506 |
|
| ENP | Entry into the national phase |
Ref document number: 112024006209 Country of ref document: BR Kind code of ref document: A2 Effective date: 20240328 |