WO2023059172A1 - 푸조박테리아 표적 펩타이드, 이를 포함하는 암 진단용 조성물 및 약물 전달 조성물 - Google Patents

푸조박테리아 표적 펩타이드, 이를 포함하는 암 진단용 조성물 및 약물 전달 조성물 Download PDF

Info

Publication number
WO2023059172A1
WO2023059172A1 PCT/KR2022/015317 KR2022015317W WO2023059172A1 WO 2023059172 A1 WO2023059172 A1 WO 2023059172A1 KR 2022015317 W KR2022015317 W KR 2022015317W WO 2023059172 A1 WO2023059172 A1 WO 2023059172A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
cancer
fuzobacteria
peptide
present
Prior art date
Application number
PCT/KR2022/015317
Other languages
English (en)
French (fr)
Inventor
김한상
김경아
안중배
백순명
용동은
이혁민
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Publication of WO2023059172A1 publication Critical patent/WO2023059172A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/76—Viruses; Subviral particles; Bacteriophages
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/42—Proteins; Polypeptides; Degradation products thereof; Derivatives thereof, e.g. albumin, gelatin or zein
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00—Bacteriophages
    • C12N2795/00011—Details
    • C12N2795/14011—Details ssDNA Bacteriophages
    • C12N2795/14022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • the present invention relates to a fuzobacteria-targeting peptide, a composition for diagnosing cancer and a drug delivery composition containing the same.
  • Colon cancer or colorectal cancer is a malignant tumor that occurs in the appendix, colon, and rectum, and is a cancer that develops in the mucous membrane, the innermost surface of the large intestine.
  • the diagnosis of colorectal cancer is possible only when cancer cells are detected through a biopsy through colonoscopy. Most colorectal cancer is asymptomatic in its early stages, so diagnosis is quite difficult, and there is currently no method for predicting colorectal cancer in a non-invasive way.
  • Existing diagnostic methods are often found when solid cancers such as colorectal cancer have progressed.
  • colorectal cancer includes a complex mixture of malignant cells, non-transformed cells, and microorganisms, among which microorganisms, that is, pathogenic bacteria, can further aggravate the stage of colorectal cancer.
  • microorganisms that is, pathogenic bacteria
  • the presence or absence of colon cancer can be determined through pathogenic bacteria.
  • Bacteriophage is a very small microorganism that infects bacteria, and is commonly referred to as a phage for short.
  • Bacteriophages proliferate inside bacterial cells after infection with bacteria, and have the ability to kill bacteria by destroying the cell wall of the host bacteria when progeny bacteriophages come out of the bacteria after proliferation.
  • the bacterial infection method of bacteriophage is highly specific, so the types of bacteriophage capable of infecting a specific bacterium are limited to some.
  • a specific bacteriophage can only infect bacteria of a specific category, and thus, a specific bacteriophage kills only specific bacteria and does not affect other bacteria.
  • microbiota or microbiome refers to the microbial community including bacteria, archaea, and eukarya present in a given habitat, and the gut microbiota plays an important role in human physiology. It is known to have a great effect on human health and disease through interaction with human cells.
  • Fusobacterium nucleatum is one of the most widespread bacterial species in these colon cancer tissues and may contribute to the development of colon cancer. More specifically, Puzobacteria are associated with human colorectal cancer, and 40-60% of tumor tissues of colorectal cancer patients are infected with Puzobacteria, and Puzobacteria are selectively present in tumor cells more than 10 times higher than surrounding cells. It can expand the number of tumor-promoting bone marrow cells, activate the ⁇ -catenin-WNT signaling mechanism through the binding reaction of FadA adhesin to E-cadherin of the host bacteria, and activate T cells and natural cells through the bacterial Fap2 protein. It can alter the anticancer immune response by promoting immunoglobulins on killer cells and T cell immunoreceptors with immunoreceptor tyrosine-based inhibitory motif domains.
  • the inventors of the present invention paid attention to Fusobacteria in the diagnosis and treatment of colorectal cancer, and found that when the above-described bacteriophages were applied to Fuzobacteria, various carcinomas including colon cancer could be more efficiently treated and diagnosed. recognized.
  • fuzobacteria an anaerobic bacterium, selectively exists in cancer cell tissue with low oxygen concentration compared to surrounding tissue, and is expected to have an advantage in labeling tumor tissue and developing it as a treatment method with more than 10 times selectivity.
  • the inventors of the present invention discovered a specific peptide sequence capable of selectively targeting Fuzobacteria, and administered the synthesized peptide sequence to a subject to use a composition for diagnosing various carcinomas including colorectal cancer or for treating carcinoma.
  • a usable drug delivery composition has been developed.
  • an object to be solved by the present invention is to provide a composition for diagnosing various carcinomas, including colorectal cancer, or a drug delivery composition for treating various carcinomas using a peptide having selectivity for Puzobacteria.
  • composition capable of selectively killing Fuzobacteria and treating various carcinomas including colorectal cancer by displaying a peptide having selectivity to Fuzobacteria on bacteriophage.
  • the present invention includes a peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 77 to SEQ ID NO: 83, wherein the peptide targets Fuzobacteria, a Fuzobacteria targeting peptide to provide.
  • the nucleic acid sequence of SEQ ID NOs: 1 to 76 and the amino acid sequence of a single peptide consisting of SEQ ID NOs: 77 to 152 of the present invention are M13 bacteriophage peptide library (peptide library constructed to have 9 amino acid sequences, about 8.60 x 10 10 amino acid sequences With) was used to find sequences selective for Puzobacteria.
  • the aforementioned peptide may be expressed in the major coat protein P3 of M13 bacteriophage.
  • the present invention provides an expression vector comprising one of the nucleotide sequences of SEQ ID NOs: 1 to 7 encoding an amino acid sequence selected from the group consisting of SEQ ID NOs: 77 to 83 .
  • the expression vector described above may be characterized as a phagemid vector.
  • the present invention provides a transformant transformed with the expression vector described above.
  • the present invention provides a composition for diagnosing cancer comprising a Fuzobacteria-targeting peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 77 to 83.
  • the above-mentioned Puzobacteria target peptide is a color enzyme, a radioisotope, a chromophore, a luminescent material, a fluorescent material, a super paramagnetic particle, and an ultrasuper paramagnetic particle. particles) may be labeled with one selected from the group consisting of.
  • the above-described Puzobacteria-targeting peptide targets at least one cancer cell of colon cancer, melanoma, pancreatic cancer, liver cancer, gastric cancer, colon cancer, lung cancer, ovarian cancer, breast cancer, and cervical cancer infected with Puzobacteria, can be diagnosed
  • the present invention provides a drug delivery composition
  • a Fuzobacteria targeting peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 77 to SEQ ID NO: 83.
  • the above-described drug is physically or chemically bound to the Fuzobacteria-targeting peptide, and may be an anticancer agent for treating cancer cells infected with Fuzobacteria.
  • the above-described anticancer agent can target and treat at least one cancer cell of colon cancer, melanoma, pancreatic cancer, liver cancer, stomach cancer, colon cancer, lung cancer, ovarian cancer, breast cancer, and cervical cancer infected with Puzobacteria. there is.
  • the above-described anticancer agents are Leucovorin, Levamisole, Irinotecan, Oxaliplatin, Capecitabine, Uracil/Tegapur (Uracil) /Tegafur, Docetaxel, cis-platin, camptothecin, paclitaxel, tamoxifen, anasterozole, Gleevec, 5-fluorouracil (5-FU), Floxuridine, Leuprolide, Flutamide, Zoledronate, Doxorubicin, Vincristine, Gemcitabine ), streptozocin, carboplatin, topotecan, belotecan, vinorelbine, hydroxyurea, nitrosourea, valrubicin (Valrubicin), retinoic acid class, methotrexate, mechlorethamine, chlorambucil, busulfan, doxifluridine, vinbla Vinblastin, Mitomycin, Prednisone,
  • the aforementioned anticancer agent is physically or chemically bound to the aforementioned Puzobacteria-targeting peptide, and may be a gene drug that treats cancer cells infected with Fuzobacteria.
  • the above-mentioned gene drug Bcl-2 antagonist X (Bax), B-cell lymphoma 2 (BCl-2), Focal adhesion kinase, Matrix metalloproteinase, Vascular endothelial growth factor (VEGF), Fatty acid synthase, Multiple drug resistance protein (MDR), Harvey rat sarcoma viral oncogene homolog (H-Ras), Kirsten-rat sarcoma viral oncogene homolog (K-Ras), Polo Like Kinase 1 (PLK-1), Transforming growth factor beta (TGF- ⁇ ), Signal Transducer And Activator Of Transcription 3 (STAT3), Epidermal growth factor receptor (EGFR), Protein kinase C alpha (PKC- ⁇ ), Epstein-Barr virus, human papillomavirus E6 (HPV E6), BCR -Can be selected from the group consisting of small interfering RNA (siRNA) and single
  • the present invention can target Fuzobacteria with high affinity, and thus can accurately target Fusobacteria, which is a harmful bacterium, in various diseases including cancer.
  • the present invention can target Puzobacteria with high affinity, and thus can detect the presence or absence of Puzobacteria with high reliability.
  • the peptide having selectivity for Fuzobacteria and the bacteriophage or peptide expressing the peptide having selectivity for Fuzobacteria according to an embodiment of the present invention are used as a kit for detecting Fuzobacteria, for example, an RT-PCR kit
  • a kit for detecting Fuzobacteria for example, an RT-PCR kit
  • the distribution of cancer cells infected with Puzobacteria and the presence or absence of metastasis can be confirmed.
  • the peptide having selectivity for Fuzobacteria is a drug delivery system, and when a chemical anticancer drug or gene drug is delivered into cancer cells infected with Fuzobacteria, the above-mentioned chemical anticancer drug and gene drug are inside the cancer cell. Invasion is possible, drug delivery can be improved more efficiently, and as a result, the effect of anticancer treatment can also be enhanced.
  • Figure 1 shows the distribution of bacteria in various carcinoma types.
  • Figure 2a is a schematic diagram listing the types of Fuzobacteria used to screen bacteriophage peptides having selectivity to Fuzobacteria in the present invention.
  • Figure 2b is a schematic diagram of a phage display (M13 Bacteriophage display, Pharge display) method used to screen bacteriophage peptides having selectivity to Fuzobacteria.
  • Figure 3 is a schematic diagram of the amino acid sequence and nucleotide sequence of a bacteriophage peptide having selectivity to Fuzobacteria according to an embodiment of the present invention.
  • FIG. 4a to 4e show a nucleotide sequence and an amino acid sequence (FIG. 4a) having selectivity to Fuzobacteria in the present invention according to an embodiment of the present invention, used to express a protein selective to Fuzobacteria in the coat protein of M13 bacteriophage Expression pCD-TriC9 phagemid vector map (Fig. 4b), gene cloning PCR for sequences selective to Fuzobacteria (Fig. 4c), enzymes tested for binding affinity of bacteriophages containing peptide sequences selective to Fuzobacteria
  • ELISA enzyme-linked immunosorbent assay
  • FIG. 4e The result of the enzyme-linked immunosorbent assay (ELISA) of testing the binding affinity according to the type of Fuzobacteria are shown.
  • 5a to 5i are diagrams showing bacterial detection efficiency using peptides of SEQ ID NOs: 77 to 83 to which fluorescent markers are bound.
  • 6 to 8 are schematic diagrams of the structure of bacteriophage used in the present invention.
  • expressions such as “A or B,” “at least one of A and/and B,” or “one or more of A or/and B” may include all possible combinations of the items listed together.
  • the expression “configured to” means “suitable for,” “having the capacity to,” depending on the circumstances. ,” “designed to,” “adapted to,” “made to,” or “capable of.”
  • the term "subject” may refer to an animal including a human having a cancer disease including colorectal cancer, and terms such as a host, a subject, and a patient may be used interchangeably.
  • the cancer disease may include at least one selected from the group consisting of colon cancer, melanoma, pancreatic cancer, liver cancer, stomach cancer, colon cancer, lung cancer, ovarian cancer, breast cancer, and cervical cancer infected with Puzobacteria.
  • peptide refers to an amino acid chain connected by a plurality of peptide bonds, and may be used interchangeably with terms such as proteins, polypeptides, or amino acids.
  • expression vector is a nucleic acid used for the purpose of inserting or inserting external DNA, and may be used in combination with a cloning vector, plasmid, or phagemid. there is.
  • transformation of the expression vector into the vector may be performed by a transformation technique known to those skilled in the art.
  • a transformation technique known to those skilled in the art.
  • microprojectile bombardment, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, PEG-mediated fusion, microinjection ) and liposome-mediated method can be used, and the transformants are Escherichia coli, Bacillus subtilis, Streptomyces, Pseudomonas, Proteus mummy It may be Proteus mirabilis, Staphylococcus, or Agrobacterium tumefaciens, but is not limited thereto.
  • the term "diagnosis of colon cancer” means determining whether a patient has a possibility of developing colon cancer, whether the possibility of developing colon cancer is relatively high, or whether colon cancer has already developed.
  • the method of the present invention can be used to delay or prevent the occurrence of colorectal cancer through special and appropriate management as a patient with a high risk of developing colorectal cancer for any specific patient.
  • the method of the present invention can be used clinically to determine treatment by diagnosing colorectal cancer at an early stage and selecting the most appropriate treatment method.
  • Example 1 Selection of bacteriophage peptides having selectivity to the present Fuzobacteria according to an embodiment of the present invention
  • Figure 1 shows the distribution of bacteria in various carcinoma types.
  • FIG. 1 a distribution chart according to carcinoma of Fusobacteria targeted by a bacteriophage according to an embodiment of the present invention is shown, and Fusobacteria are pancreas cancer, glioblastoma (GBM), lung It appears to be found in a variety of carcinomas, including cancer, ovary, breast, bone, melanoma and colon cancer.
  • GBM glioblastoma
  • Puzobacteria are anaerobic bacteria found only in the oral cavity. However, in the case of cancer cells, as oxygen consumption is higher than that of normal cells and a hypoxic environment is induced, Puzobacteria may move to the site of the cancer cells where the hypoxic environment is created, and a colony thereof may be formed. Accordingly, when targeting Puzobacteria to areas other than the oral cavity, the distribution and presence of cancer cells, and even metastasis of cancer cells can be confirmed.
  • the inventors of the present invention selected Fuzobacteria as a target bacterium for the treatment and diagnosis of various carcinomas including colorectal cancer.
  • Figure 2a is a schematic diagram of the types of Puzobacteria.
  • a total of nine types of Fusobacteria were used to screen for bacteriophage peptides having Fusobacterium selectivity, among which PD-B70 ( Fusobacterium nucleatum subspecies vincentii ), PD-B2298 ( Fusobacterium nucleatum subspecies nucleatum ), PD-B3771 ( Fusobacterium nucleatum subspecies animalis ), and PD-C387 ( Fusobacterium nucleatum subspecies nucleatum ) are patient-derived Fusobacteria, ATCC-25586 ( Fusobacterium nucleatum subspecies nucleatum ), ATCC-23726 ( Fusobacterium nucleatum subspecies nucleatum ), ATCC-51191 ( Fusobacterium nucleatum subspecies animalis) , ATCC-10953 ( Fusobacterium nucleatum subspecies polymorphum ) and
  • FIG. 2B a schematic diagram of the phage display method is shown, and in the present invention, bacteriophages capable of specifically detecting the above-described 9 types of Fuzobacteria were screened through phage display.
  • the phage display method can discover peptides for molecular diagnosis composed of new sequences through biopanning.
  • FIG. 3 a schematic diagram of a nucleotide sequence and an amino acid sequence having selectivity for Fuzobacteria according to an embodiment of the present invention is shown.
  • the bacteriophage peptide having selectivity for Puzobacteria according to an embodiment of the present invention was identified through sequencing of a total of 7 bacteriophage candidates selected in FIG. It became.
  • nucleotide sequence at the DNA level for the bacteriophage peptide capable of specifically recognizing Fuzobacteria used in the present invention may be the sequence of SEQ ID NOs: 1 to 7, and the amino acid sequence at the protein level may be a sequence of SEQ ID NOs: 77 to 83, but is not limited thereto, which is the top 14 most frequently found sequence, and may further include the bottom 138 sequences.
  • sequence of the bacteriophage used in the present invention may include all of the sequences in [Table 1] below.
  • PD-B70 Fusobacterium nucleatum subspecies vincentii
  • PD-B2298 Fusobacterium nucleatum subspecies nucleatum
  • PD-B3771 Fusobacterium nucleatum subspecies animalis
  • PD-C387 Fusobacterium nucleatum subspecies nucleatum
  • ATCC-25586 Fusobacterium nucleatum subspecies nucleatum
  • ATCC-23726 Fusobacterium nucleatum subspecies nucleatum
  • ATCC-51191 Fusobacterium nucleatum subspecies animalis
  • ATCC-10953 Fusobacterium nucleatum subspecies polymorphum
  • ATCC-49256 Fusobacterium nucleatum subspecies polymorphum
  • the Puzobacteria were cultured in Gifu Anaerobic Media (GAM) broth for 18 hours in an anaerobic chamber maintained at 37°C. 10 mL of the culture medium was centrifuged at 1500 ⁇ g for 10 minutes to obtain a cell pellet, followed by 12% [w/v] skim milk powder, 1% [v/v] dimethyl sulfoxide, and 1% [ v/v] and resuspended in a solution composed of glycerol. Afterwards, the bacterial suspension was lyophilized using a low-temperature lyophilizer and powdered, and stored in a 4°C refrigerator until use.
  • GAM Gifu Anaerobic Media
  • lyophilized Puzobacteria were dissolved in distilled water (ddH 2 O) and absorbance was measured at OD600. After mixing 9 types of Puzobacteria in an equal amount of 1:1, the mixture for screening was applied to a plate. Phage display screening was performed using the Trico-C9 peptide library (about 8.60 x 10 10 ).
  • the library used in the present invention is made so that nine peptide sequences are expressed at the end of a gene producing p3, a kind of coat protein, in the genome of M13 bacteriophage.
  • FIGS. 4A to 4E ELISA verification results for the binding ability and selectivity of the bacteriophage peptide having selectivity to Fuzobacteria used in the present invention according to an embodiment of the present invention are shown.
  • Figure 4a shows the nucleotide sequence of clones 1 to 7 including the nucleotide sequence of SEQ ID NOs: 1 to 7 of the bacteriophage peptide for verification of the bacteriophage of the present invention according to an embodiment of the present invention and the amino acid sequence translated therefrom.
  • Figure 4b shows a vector map of the pCD-TriC9 phagemid for cloning the base sequences of clones 1 to 7 including the base sequences of SEQ ID NOs: 1 to 7 of bacteriophage peptides.
  • Figure 4c shows the PCR results of the nucleotide sequences of SEQ ID NOs: 1 to 7 through cloning of the pCD-TriC9 phagemid.
  • Figure 4d shows peptides translated from the genes of SEQ ID NOs: 1, 2, 3, 4, 5, 6 and 7 cloned in Figures 4a to 4c, namely SEQ ID NOs: 77, 78, 79, 80, 81, 82 and 83 This is the result of measuring the binding affinity of the peptide to Fuzobacteria by ELISA.
  • Figure 4e shows the peptides translated from the genes of SEQ ID NOs: 1, 2, 3, 4, 5, 6 and 7 cloned in Figures 4a to 4c, namely SEQ ID NOs: 77, 78, 79, 80, 81, 82 and 83 It shows the results of the ELISA test that tested the binding affinity according to the nine types of Fuzobacteria.
  • the peptides of SEQ ID NOs: 77 to 83 of the bacteriophage having selectivity for Fuzobacteria can target Fuzobacteria with high affinity, and thus, can be used as harmful bacteria in various diseases including cancer.
  • Known Fuzobacteria can be accurately targeted and eliminated.
  • the peptides of SEQ ID NOs: 77 to 83 of the bacteriophage having selectivity for Fuzobacteria can target Fuzobacteria with high affinity as described above, as well as removing Fuzobacteria. The presence or absence can be detected with high reliability.
  • the bacteriophage peptide having selectivity for Puzobacteria according to an embodiment of the present invention is used as a diagnostic kit, the distribution of cancer cells infected with Puzobacteria and metastasis can be confirmed.
  • a mixture of 9 types of Fuzobacteria or each of 9 types of Fuzobacteria was coated on a plate, and a blocking reaction was performed using a 5% BSA solution to prevent non-specific binding.
  • Each selected M13 bacteriophage was reacted on a plate coated with Puzobacteria. After washing three times with a phosphate buffer solution containing 0.1% Tween 20, it was reacted with the M13-HRP antibody.
  • the reaction plate was washed three times with a phosphate buffer solution containing 0.1% Tween 20 and reacted using a TMB color solution.
  • the reaction was stopped with 1M sulfuric acid (H 2 SO 4 ), and the absorbance was measured at OD450 to compare binding strength.
  • 5a to 5i are diagrams showing bacterial detection efficiency using peptides of SEQ ID NOs: 77 to 83 to which fluorescent markers are bound.
  • peptide sequences of SEQ ID NOs: 77 to 83 translated from the nucleotide sequences of SEQ ID NOs: 1 to 7 having high bacterial detection efficiency in Example 1 were selected to detect the fluorescent marker Fluorescein isothiocyanate (FITC). Seven kinds of peptides from Clone-1 to Clone-7 were synthesized. The synthesis method is not limited, and various known methods for synthesizing peptides and substances may be used. The combination of the following anticancer agents and the peptides according to an embodiment of the present invention may also be combined in the same way as FITC.
  • FITC Fluorescein isothiocyanate
  • 25586N on the X axis is ATCC-25586 ( Fusobacterium nucleatum subspecies nucleatum )
  • 23726N is ATCC-23726 ( Fusobacterium nucleatum subspecies nucleatum )
  • 10953P is ATCC-10953 ( Fusobacterium nucleatum subspecies polymorphum ), 4925 Fusobacterium nucleatum subspecies vincentii
  • 51191A is ATCC-51191 ( Fusobacterium nucleatum subspecies animalis )
  • B70 is PD-B70 (Fusobacterium nucleatum subspecies vincentii )
  • C387 is PD-C387 ( Fusobacterium nucleatum subspecies nucleatum )
  • B3771 means PD-B3771 ( Fusobacterium
  • FIG. 5i shows the FITC fluorescence intensity values of FIGS. 5b to 5h by varying the intensity of the shade.
  • the peptides of SEQ ID NOs: 77 to 83 of the bacteriophage having selectivity for Fuzobacteria can target Fuzobacteria and adjacent cancer cells by binding to a fluorescent marker.
  • the peptides of SEQ ID NOs: 77 to 83 of the bacteriophage having selectivity for Fuzobacteria according to an embodiment of the present invention may bind various anticancer agents in addition to the fluorescent substance.
  • the peptide according to the present invention can be used as an intelligent drug delivery system that selectively delivers drugs to cancer tissues. If the peptide of the present invention is used for cancer treatment by linking it with a conventionally known drug, the efficacy of the drug can be increased because the drug is selectively delivered only to cancer tissues and cancer cells by the peptide of the present invention, and at the same time, the drug affects normal tissues side effects can be significantly reduced.
  • a chemical anticancer drug may be used as a drug to be delivered, and binding to the peptide according to an embodiment of the present invention may be performed in a similar or identical manner to binding to a fluorescent substance such as FITC.
  • chemotherapy agents include Leucovorin, Levamisole, Irinotecan, Oxaliplatin, Capecitabine, or Uracil/Tegafur At least one of them may be used, but is not limited thereto, and chemical anticancer drugs that can be used in cancer in which Fuzobacteria are formed, such as Docetaxel, cis-platin, camptothecin, Paclitaxel, Tamoxifen, Anasterozole, Gleevec, 5-Fluorouracil (5-FU), Floxuridine, Leuprolide, Flota Flutamide, Zoledronate, Doxorubicin, Vincristine, Gemcitabine, Streptozocin, Carboplatin, Topotecan, Belotecan, Vinorelbine, hydroxyurea, nitrosourea, Valrubicin, retinoic acid class, methotrexate, mechloreta Meclorethamine, Chlorambucil, Busulfan, Doxifluor drugs
  • Puzobacteria were cultured in Gifu Anaerobic Media (GAM) broth for 18 hours in an anaerobic chamber maintained at 37°C.
  • the culture medium was centrifuged at 3000 xg for 10 minutes to obtain a cell pellet and washed three times with phosphate buffered saline (PBS).
  • PBS phosphate buffered saline
  • the absorbance was measured at OD600.
  • a diluted solution was prepared so that the OD600 value per well was 0.1, and 100 ⁇ L was dispensed into a 96-well plate. To adsorb the bacteria to the plate, the plate was dried by placing it in a 37° C. incubator.
  • the plate was washed 5 times with a phosphate buffer solution containing 0.05% Tween 20. Thereafter, a blocking reaction to prevent non-specific binding of peptides using a 1% BSA solution was performed at room temperature for 1 hour.
  • the FITC-conjugated peptide was prepared so that the final concentration per well was 100 ⁇ M, and after the blocking reaction, the plate coated with Fuzobacteria was treated and reacted overnight at 4 ° C. After washing three times with phosphate buffer containing 0.05% Tween 20, fluorescence (ex 480 nm / em 525 nm) was measured in ELISA.
  • 6 to 8 are schematic diagrams of the structure of the bacteriophage used in the present invention.
  • the bacteriophage peptide having selectivity for Fusobacteria is expressed at the P3 region of the coat protein of M13 bacteriophage to specifically recognize (target) Fusobacteria.
  • P8 and P9 other than P3 may be cross-linked with various substances.
  • the bacteriophage used in the present invention uses an amphiphilic crosslinking agent (Phage-guided bioorthogonal targeting) for P8 and P9, so that various compositions can be bound.
  • an amphiphilic crosslinking agent Phage-guided bioorthogonal targeting
  • a chemical anticancer drug can be used, and the chemical anticancer drug is packaged by a water-soluble polymer such as Dextran and then linked with a crosslinking agent to form a bacteriophage. It can bind to the P8 and P9 sites.
  • the chemical anticancer drug is at least one of Leucovorin, Levamisole, Irinotecan, Oxaliplatin, Capecitabine, or Uracil/Tegafur.
  • One may be used, but is not limited thereto, and chemical anti-cancer drugs that can be used in cancer in which fuzobacteria are formed, that is, docetaxel, cis-platin, camptothecin, paclitaxel ( paclitaxel), Tamoxifen, Anasterozole, Gleevec, 5-fluorouracil (5-FU), Floxuridine, Leuprolide, Flotamide ( Flutamide, Zoledronate, Doxorubicin, Vincristine, Gemcitabine, Streptozocin, Carboplatin, Topotecan, Belotecan (Belotecan), Vinorelbine, hydroxyurea, nitrosourea, Valrubicin, retinoic acid class, methotrexate, mechlorethamine (
  • the reactive group of the linker may include all of various reactive groups capable of forming amide bonds with P8 and P9 of bacteriophage, including a thiol group or an amine group.
  • the bacteriophage including the bacteriophage peptide having selectivity for the Puzobacteria according to an embodiment of the present invention further contains the above-mentioned chemotherapeutic agent, it is possible to invade into cancer cells, thereby improving drug delivery efficiency. It can be, and accordingly, the effect of anticancer treatment can also be enhanced.
  • the bacteriophage including the bacteriophage peptide having selectivity for Fuzobacteria may further include a gene drug as well as a chemical anticancer agent.
  • gene drugs are Bcl-2 Antagonist X (Bax), B-cell lymphoma 2 (BCl-2), Focal adhesion kinase, Matrix metalloproteinase, Vascular endothelial growth factor (VEGF), Fatty acid synthase, Multiple drug in cancer cells.
  • bacteriophage containing the bacteriophage peptide having selectivity for Fuzobacteria can deliver a gene drug into cancer cells, thereby modifying the gene
  • genetic scissors may be applied to the bacteriophage including the bacteriophage peptide having selectivity for this Fuzobacteria according to an embodiment of the present invention.
  • the bacteriophage containing the bacteriophage peptide having selectivity for the Fuzobacteria according to an embodiment of the present invention is introduced with genetic scissors so that the DNA of the bacteriophage will contain a DNA sequence having the ability to kill cancer cells. Accordingly, when the bacteriophage is injected, the DNA sequence having the ability to kill cancer cells is injected into the Puzobacteria or into various cancer cells in which the Puzobacteria exist, and their proteins can be expressed.
  • the bacteriophage including the bacteriophage peptide having selectivity for the Fuzobacteria causes direct genetic modification in cancer cells and can have an anticancer effect.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biochemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • Hematology (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Oncology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biotechnology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Inorganic Chemistry (AREA)

Abstract

서열번호 77 내지 서열번호 83으로 이루어진 군에서 선택되는 아미노산 서열로 이루어진 펩타이드를 포함하는 푸조박테리아 표적 펩타이드, 이를 포함하는 암 진단용 조성물 및 약물 전달 조성물을 제공하며, 상기 푸조박테리아 표적 펩타이드는 암을 포함하는 다양한 질병에서 유해균인 푸조박테리아를 정확하게 표적하여 암 진단 및 약물 전달에 효과적으로 이용될 수 있다.

Description

푸조박테리아 표적 펩타이드, 이를 포함하는 암 진단용 조성물 및 약물 전달 조성물
본 발명은 푸조박테리아 표적 펩타이드, 이를 포함하는 암 진단용 조성물 및 약물 전달 조성물에 관한 것이다.
대장암(colon cancer) 또는 대장직장종양(colorectal cancer)은 맹장, 결장과 직장에 생기는 악성 종양으로 대장의 가장 안쪽 표면인 점막에서 발생한 암이다. 대장암의 확진은 대장 내시경 검사를 통한 조직검사를 통해 암세포를 발견해야 가능하다. 대부분 대장암은 조기에는 증상이 없으므로 진단이 상당히 어렵고, 현재 비침습적인 방법으로 대장암을 예측하는 방법은 전무하다. 기존 진단방법으로는 대장암 등의 고형암이 진행된 경우에 발견되는 경우가 많기 때문에, 대장암으로 인한 의료비용과 사망을 예방하기 위해선 대장종양 발생 및 원인인자를 미리 예측하여, 고위험군에서 대장암 발생을 예방하는 방법을 제공하는 것이 효율적인 방법이다.
나아가, 대장암은 악성 세포, 형질 전환되지 않은 세포 및 미생물의 복합 혼합물을 포함하며, 이 중 미생물 즉, 병원성 박테리아가 대장암의 병기를 더욱 악화시킬 수 있다. 또한, 병원성 박테리아를 통해 대장암의 존재 유무를 판단할 수도 있다.
발명의 배경이 되는 기술은 본 발명에 대한 이해를 보다 용이하게 하기 위해 작성되었다. 발명의 배경이 되는 기술에 기재된 사항들이 선행기술로 존재한다고 인정하는 것으로 이해되어서는 안 된다.
최근 세균성 질환의 대처 방안으로 박테리오파지(bacteriophage)의 활용이 크게 주목을 받고 있다. 특히 자연 친화적 방식의 선호로 인하여 박테리오파지에 대한 관심은 어느 때보다 높다고 할 수 있다. 박테리오파지는 세균에 감염하는 아주 작은 미생물로서 보통 파지(phage)라고 줄여서 부르기도 한다.
박테리오파지는 박테리아에 감염(infection)한 후 박테리아 세포 내부에서 증식을 하고, 증식 후 자손 박테리오파지들이 박테리아 밖으로 나올 때 숙주인 박테리아의 세포벽을 파괴하는 방식으로 박테리아를 사멸시키는 능력을 갖고 있다. 박테리오파지의 박테리아 감염 방식은 매우 특이성이 높아서 특정 박테리아에 감염할 수 있는 박테리오파지의 종류는 일부로 한정된다.
즉, 특정 박테리오파지는 특정 범주의 박테리아에만 감염할 수 있고 이로 인하여 특정 박테리오파지는 특정 박테리아만을 사멸시키며 다른 박테리아에는 영향을 주지 않는다.
한편, 인체에 공생하는 미생물은 100조에 이르러 인간 세포보다 10배 많으며, 미생물의 유전자수는 인간 유전자수의 100배가 넘는 것으로 알려지고 있다. 미생물총(microbiota 혹은 microbiome)은 주어진 거주지에 존재하는 박테리아(bacteria), 고세균(archaea), 진핵생물(eukarya)을 포함한 미생물 군집(microbial community)을 말하고, 장내 미생물총은 사람의 생리현상에 중요한 역할을 하며, 인체 세포와 상호작용을 통해 인간의 건강과 질병에 큰 영향을 미치는 것으로 알려져 있다.
이러한 공생 미생물 중 푸조박테리움 뉴클레아텀(Fusobacterium nucleatum)은 이러한 대장암 조직에 가장 널리 퍼져있는 박테리아 종 중 하나이며, 대장암 발생에 기여할 수 있다. 보다 구체적으로, 푸조박테리아는 인간 대장 결장암과 연관이 있는데 대장암 환자 종양 조직 중 40-60%에서 푸조박테리아에 감염되어 있고, 푸조박테리아는 주변세포에 비해 선택적으로 종양세포에 10배 이상 고농도로 존재하고 있으며, 이는 종양 촉진 골수 세포수를 확장시킬 수 있고, 숙주균의 E-cadherin에 대한 FadA adhesin의 결합 반응으로 β-catenin-WNT 신호 전달 기전을 활성화시키며, 세균성 Fap2 단백질을 통한 T 세포 및 자연 살상 세포상의 면역글로불린과 면역 수용체 티로신 기반 억제 모티프 (Immunoreceptor tyrosine-based inhibitory motif) 도메인을 지닌 T 세포 면역수용체를 촉진하여 항암 억제 면역 반응을 변경시킬 수 있다.
이에, 본 발명의 발명자들은 대장암 진단 및 치료에 있어, 푸조박테리아를 주목하였으며, 전술한 박테리오파지를 푸조박테리아에 적용할 경우, 보다 효율적으로 대장암을 포함하는 다양한 암종을 치료 및 진단할 수 있다는 것을 인지하였다. 특히 혐기성 세균인 푸조박테리아는 주변 조직에 비해 산소 농도가 적은 암 세포 조직에서 선택적으로 존재하며 10배 이상의 선택성을 가져 종양조직을 표지하고 치료법으로 개발하는데 장점이 있을 것으로 기대 된다.
결국, 본 발명의 발명자들은 푸조박테리아를 선택적으로 표적할 수 있는 특정 펩타이드 서열을 발견하였으며, 이 합성된 펩타이드 서열을 개체에게 투여하여 대장암을 포함하는 다양한 암종을 진단하기 위한 조성물 또는 암종을 치료하는데 사용할 수 있는 약물 전달 조성물을 개발하는데 이르렀다.
따라서, 본 발명이 해결하고자 하는 과제는, 푸조박테리아에 선택성을 갖는 펩타이드를 이용하여 대장암을 포함하는 다양한 암종을 진단 하기 위한 조성물 또는 다양한 암종을 치료하기 위한 약물 전달 조성물을 제공하는 것이다.
나아가, 푸조박테리아에 선택성을 갖는 펩타이드를 박테리오파지에 표현시킴(display)에 따라 푸조박테리아를 선택적으로 사멸하고, 대장암을 포함하는 다양한 암종을 치료할 수 있는 조성물을 제공하는 것이다.
본 발명의 과제들은 이상에서 언급한 과제들로 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
전술한 바와 같은 과제를 해결하기 위해, 본 발명은 서열번호 77 내지 서열번호 83 으로 이루어진 군에서 선택되는 아미노산 서열로 이루어진 펩타이드를 포함하고, 상기 펩타이드는 푸조박테리아를 표적으로 하는, 푸조박테리아 표적 펩타이드를 제공한다.
본 발명의 서열번호 1 내지 76의 핵산 서열과 서열번호 77 내지 152 로 이루어진 단일 펩타이드의 아미노산 서열은 M13 박테리오파지 펩타이드 라이브러리 (9개의 아미노산 서열을 가지도록 제작된 펩타이드 라이브러리, 약 8.60 x 1010 개의 아미노산 서열을 지님)를 이용하여 푸조박테리아에 선택적인 서열을 찾아내었다.
본 발명의 특징에 따르면, 전술한 펩타이드는, M13 박테리오파지의 외피단백질(major coat protein) P3에 표현되는 것일 수 있다.
전술한 바와 같은 과제를 해결하기 위해, 본 발명은 서열번호 77 내지 서열번호 83 으로 이루어진 군에서 선택되는 아미노산 서열을 암호화하는 서열번호 1 내지 7의 염기서열 중 하나를 포함하는, 발현 벡터를 제공한다.
본 발명의 특징에 따르면, 전술한 발현 벡터는 파지미드(phagemid) 벡터 인 것을 특징으로 할 수 있다.
전술한 바와 같은 과제를 해결하기 위해, 본 발명은 전술한 발현 벡터로 형질전환된 형질전환체를 제공한다.
전술한 바와 같은 과제를 해결하기 위해, 본 발명은 서열번호 77 내지 83 으로 이루어진 군에서 선택되는 아미노산 서열로 이루어진 푸조박테리아 표적 펩타이드를 포함하는, 암 진단용 조성물을 제공한다.
본 발명의 특징에 따르면, 전술한 푸조박테리아 표적 펩타이드는, 발색효소, 방사성동위원소, 발색단(chromophore), 발광물질, 형광물질(fluorescer), 상자성입자(super paramagnetic particles) 및 초상자성입자(ultrasuper paramagnetic particles)로 이루어진 군에서 선택되는 하나로 표지될 수 있다.
본 발명의 특징에 따르면, 전술한 푸조박테리아 표적 펩타이드는 푸조박테리아가 감염된 결장암, 흑색종, 췌장암, 간암, 위암, 대장암, 폐암, 난소암, 유방암, 및 자궁경부암 중 적어도 하나의 암세포를 표적하여 진단할 수 있다.
전술한 바와 같은 과제를 해결하기 위해, 본 발명은 서열번호 77 내지 서열번호 83 으로 이루어진 군에서 선택되는 아미노산 서열로 이루어진 푸조박테리아 표적 펩타이드를 포함하는, 약물 전달 조성물을 제공한다.
본 발명의 특징에 따르면, 전술한 약물은, 상기 푸조박테리아 표적 펩타이드와 물리적 또는 화학적으로 결합된 것이며, 푸조박테리아가 감염된 암세포를 치료하는 항암제일 수 있다.
본 발명의 특징에 따르면, 전술한 항암제는, 푸조박테리아가 감염된 결장암, 흑색종, 췌장암, 간암, 위암, 대장암, 폐암, 난소암, 유방암, 및 자궁경부암 중 적어도 하나의 암세포를 표적하여 치료할 수 있다.
본 발명의 특징에 따르면, 전술한 항암제는, 류코보린(Leucovorin), 레바미솔(Levamisole), 이로노테칸(Irinotecan), 옥살리플라틴(Oxaliplatin), 카페시타빈(Capecitabin), 우라실/테가푸르(Uracil/Tegafur), 도세탁셀(Docetaxel), 시스플라틴(cis-platin), 캠토세신(camptothecin), 파클리탁셀(paclitaxel), 타목시펜(Tamoxifen), 아나스테로졸(Anasterozole), 글리벡(Gleevec), 5-플루오로우라실(5- FU), 플록슈리딘(Floxuridine), 류프로리드(Leuprolide), 플로타미드(Flutamide), 졸레드로네이트 (Zoledronate), 독소루비신(Doxorubicin), 빈크리스틴(Vincristine), 젬시타빈(Gemcitabine), 스트렙토조토신 (Streptozocin), 카보플라틴(Carboplatin), 토포테칸(Topotecan), 벨로테칸(Belotecan), 비노렐빈(Vinorelbine), 히도록시우레아(hydroxyurea), 니트로소우레아(nitrosourea), 발루비신(Valrubicin), 레티노익산 (retinoic acid) 계열, 메소트렉세이트(Methotrexate), 메클로레타민(Meclorethamine), 클로람부실 (Chlorambucil), 부술판(Busulfan), 독시플루리딘(Doxifluridine), 빈블라스틴(Vinblastin), 마이토마이신 (Mitomycin), 프레드니손(Prednisone), 테스토스테론(Testosterone), 미토산트론(Mitoxantron), 아스피린 (aspirin), 살리실레이트(salicylates), 이부프로펜(ibuprofen), 나프로센(naproxen), 페노프로펜 (fenoprofen), 인도메타신(indomethacin), 페닐부타존(phenyltazone), 시클로포스파미드(cyclophosphamide), 메클로에타민(mechlorethamine), 덱사메타손(dexamethasone), 프레드니솔론(prednisolone), 셀레콕시브 (celecoxib), 발데콕시브(valdecoxib), 니메슐리드(nimesulide), 다우노루비신(daunorubicin), 액티노마이신-D(actinomycin-D), 에토포사이드(etoposide), 테니포사이드(teniposide), 비산트렌(bisantrene), 호모해링토닌(homoharringtonine), 부설판(busulfan), 클로람부실(chlorambucil), 멜팔란 (melphalan), 니트로겐 무스타드(nitrogen mustard), 코르티손(cortisone) 및 코르티코스테로이드 (corticosteroid)로 이루어진 군에서 선택될 수 있다.
본 발명의 특징에 따르면, 전술한 항암제는, 전술한 푸조박테리아 표적 펩타이드와 물리적 또는 화학적으로 결합된 것이며, 푸조박테리아가 감염된 암세포를 치료하는 유전자 약물일 수 있다.
본 발명의 특징에 따르면, 전술한 유전자 약물은, 암세포의 Bcl-2 Antagonist X (Bax), B-cell lymphoma 2 (BCl-2), Focal adhesion kinase, Matrix metalloproteinase, Vascular endothelial growth factor (VEGF), Fatty acid synthase, Multiple drug resistance protein(MDR), Harvey rat sarcoma viral oncogene homolog (H-Ras), Kirsten-rat sarcoma viral oncogene homolog (K-Ras), Polo Like Kinase 1(PLK-1), Transforming growth factor beta (TGF-β), Signal Transducer And Activator Of Transcription 3 (STAT3), Epidermal growth factor receptor (EGFR), Protein kinase C alpha (PKC-α), Epstein-Barr virus, human papillomavirus E6 (HPV E6), BCR-ABL fusion gene 및 Telomerase로 이루어진 군에서 선택된 1종 이상의 단백질을 타겟으로 하는 짧은 간섭 RNA (small interfering RNA, siRNA) 및 단일 가이드 RNA (single guide RNA, sgRNA)로 이루어진 군에서 선택될 수 있다.
이하, 실시예를 통하여 본 발명을 보다 상세히 설명한다. 다만, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것에 불과하므로 본 발명의 범위가 이들 실시예에 의해 한정되는 것으로 해석되어서는 아니된다.
본 발명은 푸조박테리아를 높은 친화력으로 표적할 수 있으며, 이에 따라, 암을 포함하는 다양한 질병에서 유해균인 푸조박테리아를 정확하게 표적할 수 있다.
더욱이, 본 발명은 전술한 바와 같이 푸조박테리아를 높은 친화력으로 표적할 수 있음에 따라, 푸조박테리아의 존재 유·무를 높은 신뢰도를 특성으로 가지며 검출할 수 있다.
이에, 본 발명의 일 실시예에 따른 본 푸조박테리아에 선택성을 갖는 펩타이드 및 푸조박테리아에 선택성을 갖는 펩타이드를 발현하는 박테리오파지 또는 펩타이드가 푸조박테리아 검출용 키트로서 이용될 경우, 예를 들어 RT-PCR 키트, DNA 칩 키트 또는 단백질 칩 키트 등의 형태로 푸조박테리아에 감염된 암세포의 분포 및 전이 유·무를 확인할 수 있다.
본 발명의 일 실시예에 따른 본 푸조박테리아에 선택성을 갖는 펩타이드는, 약물 전달체로서, 푸조박테리아가 감염된 암세포 내에 화학적 항암치료제 또는 유전자 약물을 전달할 경우, 전술한 화학적 항암치료제 및 유전자 약물은 암세포의 내부까지 침입이 가능하고, 약물 전달이 보다 효율적으로 향상될 수 있으며, 그 결과로 항암 치료의 효과 또한 증진될 수 있다.
본 발명에 따른 효과는 이상에서 예시된 내용에 의해 제한되지 않으며, 더욱 다양한 효과들이 본 명세서 내에 포함되어 있다.
도 1은 다양한 암종에서의 박테리아 분포도를 도시한 것이다.
도 2a는 본 발명에서 푸조박테리아에 선택성을 갖는 박테리오파지 펩타이드를 스크리닝하기 위하여 사용된 푸조박테리아의 종류를 나열한 개략도이다..
도 2b는 푸조박테리아에 선택성을 갖는 박테리오파지 펩타이드를 스크리닝 하기 위하여 사용된 파지 디스플레이 (M13　Bacteriophage display, Pharge display) 방법에 대한 개략도이다.
도 3은 본 발명의 일 실시예에 따른 푸조박테리아에 선택성을 갖는 박테리오파지 펩타이드의 아미노산 서열 및 염기서열 대한 개략도이다.
도 4a 내지 도 4e는 본 발명의 일 실시예에 따른 본 발명에 푸조박테리아에 선택성을 갖는 염기서열 및 아미노산 서열 (도 4a), M13 박테리오파지의 외피단백질에 푸조박테리아에 선택적인 단백질 표현하기 위하여 사용된 발현 pCD-TriC9 phagemid 벡터맵 (도 4b), 푸조박테리아에 선택적인 서열에 대한 유전자 클로닝 PCR (도 4c), 푸조박테리아에 선택적인 펩타이드서열을 포함하는 박테리오파지의 결합 친화력(binding affinity)을 시험한 효소면역분석법 (Enzyme-linked immunosorbent assay, ELISA) 결과 (도 4d), 푸조박테리아 종류에 따른 결합친화력을 시험한 ELISA 결과 (도 4e)를 도시한 것이다.
도 5a 내지 도 5i 는 형광표지인자가 결합된 서열번호 77 내지 83의 펩타이드를 활용한 박테리아 검출 효능을 도시하는 도면이다.
도 6 내지 도 8 은 본 발명에서 이용되는 박테리오파지의 구조에 대한 개략도이다.
본 발명의 이점 및 특징, 그리고 그것들을 달성하는 방법은 첨부되는 도면과 함께 상세하게 후술되어 있는 실시예들을 참조하면 명확해질 것이다. 그러나, 본 발명은 이하에서 개시되는 실시예들에 한정되는 것이 아니라 서로 다른 다양한 형태로 구현될 것이며, 단지 본 실시예들은 본 발명의 개시가 완전하도록 하며, 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 발명의 범주를 완전하게 알려주기 위해 제공되는 것이며, 본 발명은 청구항의 범주에 의해 정의될 뿐이다.
본 문서에서, "가진다," "가질 수 있다," "포함한다," 또는 "포함할 수 있다" 등의 표현은 해당 특징(예: 수치, 기능, 동작, 또는 부품 등의 구성요소)의 존재를 가리키며, 추가적인 특징의 존재를 배제하지 않는다.
본 문서에서, "A 또는 B," "A 또는/및 B 중 적어도 하나," 또는 "A 또는/및 B 중 하나 또는 그 이상" 등의 표현은 함께 나열된 항목들의 모든 가능한 조합을 포함할 수 있다. 예를 들면, "A 또는 B," "A 및 B 중 적어도 하나," 또는 "A 또는 B 중 적어도 하나"는, (1) 적어도 하나의 A를 포함, (2) 적어도 하나의 B를 포함, 또는(3) 적어도 하나의 A 및 적어도 하나의 B 모두를 포함하는 경우를 모두 지칭할 수 있다.
본 문서에서 사용된 표현 "~하도록 구성된(또는 설정된)(configured to)"은 상황에 따라, 예를 들면, "~에 적합한(suitable for)," "~하는 능력을 가지는(having the capacity to)," "~하도록 설계된(designed to)," "~하도록 변경된(adapted to)," "~하도록 만들어진(made to)," 또는 "~ 를 할 수 있는(capable of)"과 바꾸어 사용될 수 있다.
본 문서에서 사용된 용어들은 단지 특정한 실시 예를 설명하기 위해 사용된 것으로, 다른 실시예의 범위를 한정하려는 의도가 아닐 수 있다. 단수의 표현은 문맥상 명백하게 다르게 뜻하지 않는 한, 복수의 표현을 포함할 수 있다. 기술적이거나 과학적인 용어를 포함해서 여기서 사용되는 용어들은 본 문서에 기재된 기술분야에서 통상의 지식을 가진 자에 의해 일반적으로 이해되는 것과 동일한 의미를 가질 수 있다. 본 문서에 사용된 용어들 중 일반적인 사전에 정의된 용어들은, 관련 기술의 문맥상 가지는 의미와 동일 또는 유사한 의미로 해석될 수 있으며, 본 문서에서 명백하게 정의되지 않는 한, 이상적이거나 과도하게 형식적인 의미로 해석되지 않는다. 경우에 따라서, 본 문서에서 정의된 용어일지라도 본 문서의 실시예들을 배제하도록 해석될 수 없다.
본 발명의 여러 실시예들의 각각 특징들이 부분적으로 또는 전체적으로 서로 결합 또는 조합 가능하며, 당업자가 충분히 이해할 수 있듯이 기술적으로 다양한 연동 및 구동이 가능하며, 각 실시예들이 서로에 대하여 독립적으로 실시 가능할수도 있고 연관 관계로 함께 실시 가능할 수도 있다.
본 명세서에 사용되는 용어 "개체"는, 대장암을 포함한 암 질환을 가진 인간을 포함하는 동물을 의미할 수 있으며, 숙주, 대상체, 환자와 같은 용어로 혼용되어 사용될 수 있다.
나아가, 상기 암 질환은 푸조박테리아가 감염된 결장암, 흑색종, 췌장암, 간암, 위암, 대장암, 폐암, 난소암, 유방암, 및 자궁경부암으로 이루어진 군에서 선택되는 적어도 하나를 포함할 수 있다.
본 명세서에서 사용되는 용어 “펩타이드”는, 다수 개의 펩타이드 결합으로 연결된 아미노산 사슬을 의미하며, 단백질, 폴리펩타이드 또는 아미노산과 같은 용어로 혼용되어 사용될 수 있다.
본 명세서에서 사용되는 용어 “발현 벡터”는, 외부 DNA를 삽입하거나 삽입되어 사용하려는 목적으로 이용되는 핵산으로서, 클로닝 벡터(cloning vector), 플라스미드(plasmid) 또는 파지미드(phagemid)와 혼용되어 사용될 수 있다.
본 발명에서 상기 발현 벡터로 상기 벡터로 형질전환하는 것은 당업자에게 공지된 형질전환기술에 의해 수행될 수 있다. 바람직하게는 미세사출법(microprojectile bombardment), 전기충격유전자전달법(electroporation), 인산 칼슘(CaPO4) 침전, 염화 칼슘(CaCl2) 침전, PEG-매개 융합법(PEG-mediated fusion), 미세주입법(microinjection) 및 리포좀 매개법(liposome-mediated method)를 이용할 수 있으며, 상기 형질전환체는 대장균(Escherichia coli), 바실러스 서브틸리스(Bacillus subtilis), 스트렙토마이세스(Streptomyces), 슈도모나스(Pseudomonas), 프로테우스 미라빌리스(Proteus mirabilis), 스타필로코쿠스(Staphylococcus), 아그로박테리움 투메파시엔스(Agrobacterium tumefaciens)일 수 있으나, 이로 제한되는 것은 아니다.
본 발명에서 사용되는 용어, "대장암 진단" 이란 환자에 대하여 대장암이 발병할 가능성이 있는지, 대장암이 발병할 가능성이 상대적으로 높은지, 또는 대장암이 이미 발병하였는지 여부를 판별하는 것을 의미한다. 본 발명의 방법은 임의의 특정 환자에 대한 대장암 발병 위험도가 높은 환자로써 특별하고 적절한 관리를 통하여 발병 시기를 늦추거나 발병하지 않도록 하는데 사용할 수 있다. 또한, 본 발명의 방법은 대장암을 조기에 진단하여 가장 적절한 치료방식을 선택함으로써 치료를 결정하기 위해 임상적으로 사용될 수 있다.
이하 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 하나 이상의 구체예를 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1: 본 발명의 일 실시예에 따른 본 푸조박테리아에 선택성을 갖는 박테리오파지 펩타이드 선별
도 1에는 다양한 암종에서의 박테리아 분포도가 도시된다.
도 1을 참조하면, 본 발명의 일 실시예에 따른 박테리오파지가 표적하는 푸조박테리아의 암종에 따른 분포도가 도시되며, 푸조박테리아는 췌장(pancreas) 암, 교모세포종(glioblastoma, GBM), 폐(lung)암, 난소(ovary)암, 유방(breast)암, 뼈(bone)암, 흑색종(melanoma) 및 대장(colon)암 등을 포함하는 다양한 암종에서 발견되는 것으로 나타난다.
푸조박테리아는 구강 내에서만 발견되는 혐기성 박테리아다. 그러나, 암세포의 경우, 산소 소비가 일반 세포에 비해 많고 저산소성 환경을 유발함에 따라, 푸조박테리아가 저산소 환경이 조성된 암세포의 부위에 이동하여 이의 군집이 형성될 수 있다. 이에, 구강 이외의 영역에 대한 푸조박테리아를 표적할 경우, 암세포의 분포 및 유무, 나아가, 암세포의 전이까지 확인할 수 있다.
따라서, 본 발명의 발명자들은 대장암을 포함하는 다양한 암종의 치료 및 진단을 위한 표적 균으로서, 푸조박테리아를 선정하였다.
도 2a는 푸조박테리아의 종류에 대한 개략도이다.
도 2a를 참조하면, 본 발명에서는 푸조박테리아 선택성을 갖는 박테리오파지 펩타이드의 선별을 위하여, 총 9종의 푸조박테리아를 이용하였으며, 이 중 PD-B70 (Fusobacterium nucleatum subspecies vincentii), PD-B2298 (Fusobacterium nucleatum subspecies nucleatum), PD-B3771 (Fusobacterium nucleatum subspecies animalis), 및 PD-C387 (Fusobacterium nucleatum subspecies nucleatum) 는 환자로부터 유래된 푸조박테리아이며, ATCC-25586 (Fusobacterium nucleatum subspecies nucleatum), ATCC-23726 (Fusobacterium nucleatum subspecies nucleatum), ATCC-51191 (Fusobacterium nucleatum subspecies animalis), ATCC-10953 (Fusobacterium nucleatum subspecies polymorphum) 및 ATCC-49256 (Fusobacterium nucleatum subspecies vincentii)은 ATCC(American Type Culture Collection)에서 상업적으로 이용되는 푸조박테리아 하위종이다.
그 다음, 도 2b를 참조하면, 파지 디스플레이 방법에 대한 개략도가 도시되며, 본 발명은 파지 디스플레이를 통하여 전술한 9종의 푸조박테리아를 특이적으로 감지할 수 있는 박테리오파지를 스크리닝하였다. 파지 디스플레이 방법은 바이오패닝(biopanning)을 거쳐 새로운 서열로 구성된 분자진단용 펩타이드를 발굴할 수 있다.
먼저, 본 발명에서는 전술한 9종의 푸조박테리아를 도포한 뒤, 다양한 종류의 파지 라이브러리와 접촉시킨 뒤, 반복된 워싱 단계를 통하여, 푸조박테리아에 특이적으로 결합된 M13 박테리오파지 기반의 총 7종의 박테리오파지 후보군을 선별하였다.
이에, 도 3을 참조하면, 본 발명의 일 실시예에 따른 푸조박테리아에 선택성을 갖는 염기서열 및 아미노산 서열에 대한 개략도가 도시된다.
이때, 본 발명의 일 실시예에 따른 푸조박테리아에 선택성을 갖는 박테리오파지 펩타이드는 앞서 도 2b에서 선별된 총 7종의 박테리오파지 후보군들의 시퀀싱을 통하여 규명되었으며, 시퀀싱은 Creative biolabs INC (미국)에서 의뢰되어 수행되었다.
보다 구체적으로, 본 발명에서 이용되는 푸조박테리아를 특이적으로 인식할 수 있는 박테리오파지 펩타이드에 대한 DNA 레벨에서의 염기서열은 서열번호 1 내지 7의 서열일 수 있으며, 단백질(protein) 레벨에서의 아미노산 서열은 서열번호 77 내지 83의 서열일 수 있으나, 이에 제한되는 것은 아니며, 이는 가장 많이 발견된 상위 14개의 서열이며, 하위 138개의 서열을 더 포함할 수 있다.
예를 들어, 본 발명에서 이용되는 박테리오파지의 서열은 하기의 [표 1]의 서열을 모두 포함할 수 있다.
Count Ratio Percentage Length Nucl_Seq 서열번호 AA_Seq 서열번호
713671 1.01E-01 10.1% 27 AGCTGGGACGGCAAAGGCGCTCACTTC 서열번호 1 SWDGKGAHF 서열번호 77
665405 9.39E-02 9.4% 27 CGCAAAACCTGGGCTGGCAACTGGGAG 서열번호 2 RKTWAGNWE 서열번호 78
663577 9.36E-02 9.4% 27 ACCTGGGACGGCAAAGGCGCTCACTTC 서열번호 3 TWDGKGAHF 서열번호 79
577170 8.15E-02 8.1% 27 AGCATGTGGAGCGACCCTATGGCTCAC 서열번호 4 SMWSDPMAH 서열번호 80
426693 6.02E-02 6.0% 21 CCTCCTTGGCTGGCTGACATC 서열번호 5 PPWLADI 서열번호 81
374072 5.28E-02 5.3% 27 ACCTGGGACGGCAAAGGCGCTCACTAC 서열번호 6 TWDGKGAHY 서열번호 82
348498 4.92E-02 4.9% 27 AGCTGGGACGGCAAAGGCGCTCACTAC 서열번호 7 SWDGKGAHY 서열번호 83
192353 2.71E-02 2.7% 27 GTGTGGGTGACCGGCAGCGCTCACGAC 서열번호 8 VWVTGSAHD 서열번호 84
158578 2.24E-02 2.2% 27 AAATGGGACGGCCGCGGCATGCACAAA 서열번호 9 KWDGRGMHK 서열번호 85
144588 2.04E-02 2.0% 27 AGCTGGGACGGCAAAGGCCCTCACTTC 서열번호 10 SWDGKGPHF 서열번호 86
125123 1.77E-02 1.8% 27 ACCTGGGACGGCAAAGGCCCTCACTTC 서열번호 11 TWDGKGPHF 서열번호 87
108760 1.53E-02 1.5% 27 AAATGGGACGGCCGCGGCATGCACAAC 서열번호 12 KWDGRGMHN 서열번호 88
87916 1.24E-02 1.2% 21 GCTCCTTGGCTGGAGGGCCTG 서열번호 13 APWLEGL 서열번호 89
78682 1.11E-02 1.1% 27 AGCATCTGGAGCGACCCTATGGCTCAC 서열번호 14 SIWSDPMAH 서열번호 90
55246 7.80E-03 0.8% 21 GCTCCTTGGCTGATGGACCTG 서열번호 15 APWLMDL 서열번호 91
52922 7.47E-03 0.7% 21 CCTGCTTGGCTGGAGGACCTG 서열번호 16 PAWLEDL 서열번호 92
52856 7.46E-03 0.7% 21 GAGGACTGGCACTGGCCTCTG 서열번호 17 EDWHWPL 서열번호 93
50585 7.14E-03 0.7% 30 ATCTGGGACAACGACCGCAAAATGCACCAC 서열번호 18 IWDNDRKMHH 서열번호 94
47516 6.71E-03 0.7% 27 AGCTGGGACGGCAAAGGCCCTCACTAC 서열번호 19 SWDGKGPHY 서열번호 95
47136 6.65E-03 0.7% 27 ACCTGGGACGGCAAAGGCCCTCACTAC 서열번호 20 TWDGKGPHY 서열번호 96
32606 4.60E-03 0.5% 21 CCTCCTTGGCTGGTGGGCCTG 서열번호 21 PPWLVGL 서열번호 97
32519 4.59E-03 0.5% 27 TTCCTGAACAGCGAGATGCTGCACGTG 서열번호 22 FLNSEMLHV 서열번호 98
25339 3.58E-03 0.4% 27 CGCAAAACCTGAGCTGGCAACTGGGAG 서열번호 23 RKT*AGNWE 서열번호 99
24889 3.51E-03 0.4% 33 GTGCGCTACGGCGTGCTGAACGCTTACACCCGC 서열번호 24 VRYGVLNAYTR 서열번호 100
23121 3.26E-03 0.3% 33 ATGGACTTCTGGCCTATGAGCCAGCAGCTGGCT 서열번호 25 MDFWPMSQQLA 서열번호 101
22836 3.22E-03 0.3% 27 AACCCTTTCTTCCCTGGCTTCGACCTG 서열번호 26 NPFFPGFDL 서열번호 102
22130 3.12E-03 0.3% 21 GCTCCTTGGCTGCAGGACTTC 서열번호 27 APWLQDF 서열번호 103
21502 3.03E-03 0.3% 27 AGCTGGGACGGCAAAGGCCTTCACTAC 서열번호 28 SWDGKGLHY 서열번호 104
17502 2.47E-03 0.2% 27 GAGGACAGCTAGTACGACTACATGTTC 서열번호 29 EDS*YDYMF 서열번호 105
17190 2.43E-03 0.2% 27 AACCCTTTCTTCCCTGGCTACGACCTG 서열번호 30 NPFFPGYDL 서열번호 106
16911 2.39E-03 0.2% 27 AGCCACTAGACCCAGAGCTGGCAGTGG 서열번호 31 SH*TQSWQW 서열번호 107
16445 2.32E-03 0.2% 27 GGCAAAACCTGGGCTGGCAACTGGGAG 서열번호 32 GKTWAGNWE 서열번호 108
16210 2.29E-03 0.2% 27 AACCCTTACTTCCCTGGCTTCGACCTG 서열번호 33 NPYFPGFDL 서열번호 109
14563 2.06E-03 0.2% 30 GTGTGGATCTGGGAGCTGAACATGCACGAC 서열번호 34 VWIWELNMHD 서열번호 110
14450 2.04E-03 0.2% 21 ATGCCTTGGTACGCTGACCTG 서열번호 35 MPWYADL 서열번호 111
14342 2.02E-03 0.2% 27 AGCCTGCACAGCGACGACAAAGCTTGG 서열번호 36 SLHSDDKAW 서열번호 112
11102 1.57E-03 0.2% 21 CCTGCTTGGCTGGAGGGCCTG 서열번호 37 PAWLEGL 서열번호 113
10514 1.48E-03 0.1% 27 AACCCTTTCTACCCTGGCTTCGACCTG 서열번호 38 NPFYPGFDL 서열번호 114
10504 1.48E-03 0.1% 30 GTGTGGGACAACAAACGCTGGCTGCACGTG 서열번호 39 VWDNKRWLHV 서열번호 115
10465 1.48E-03 0.1% 27 AACCCTTACTTCCCTGGCTACGACCTG 서열번호 40 NPYFPGYDL 서열번호 116
10402 1.47E-03 0.1% 27 AAATGGGACGGCCGCGGCATCCACAAA 서열번호 41 KWDGRGIHK 서열번호 117
10221 1.44E-03 0.1% 27 GTGTGGGTGACCGGCAGCGCTCACCAC 서열번호 42 VWVTGSAHH 서열번호 118
9730 1.37E-03 0.1% 27 AGCATGTGGACCGACCCTATGGCTCAC 서열번호 43 SMWTDPMAH 서열번호 119
9488 1.34E-03 0.1% 27 ACCTGGGACGGCAACGGCGCTCACTTC 서열번호 44 TWDGNGAHF 서열번호 120
9213 1.30E-03 0.1% 27 CCTCCTTGGCTTATGGACTTCGAGGGC 서열번호 45 PPWLMDFEG 서열번호 121
8599 1.21E-03 0.1% 30 ATCTGGGACAAAGACCGCAAAATGCACCAC 서열번호 46 IWDKDRKMHH 서열번호 122
8199 1.16E-03 0.1% 27 AGCATCTGGACCGACCCTATGGCTCAC 서열번호 47 SIWTDPMAH 서열번호 123
7777 1.10E-03 0.1% 27 GTGTGGGTGACCGGCAGCCCTCACGAC 서열번호 48 VWVTGSPHD 서열번호 124
7651 1.08E-03 0.1% 21 CCTCCTTGGCTGGAGGGCTTC 서열번호 49 PPWLEGF 서열번호 125
7281 1.03E-03 0.1% 27 AACCCTTACTACCCTGGCTTCGACCTG 서열번호 50 NPYYPGFDL 서열번호 126
6531 9.22E-04 0.1% 27 AGCCAGCACAGCGACGACAAAGCTTGG 서열번호 51 SQHSDDKAW 서열번호 127
6333 8.94E-04 0.1% 21 ATGCCTTGGTTCGCTGACCTG 서열번호 52 MPWFADL 서열번호 128
6305 8.90E-04 0.1% 27 AGCTGGGATGGCAAAGGCGCTCACTTC 서열번호 53 SWDGKGAHF 서열번호 129
6295 8.88E-04 0.1% 27 AAATGGGACGGCCGCGGCATGCACATC 서열번호 54 KWDGRGMHI 서열번호 130
6235 8.80E-04 0.1% 27 AACCCTTTCTACCCTGGCTACGACCTG 서열번호 55 NPFYPGYDL 서열번호 131
6205 8.76E-04 0.1% 27 AACTGGGACGGCCGCGGCATGCACAAA 서열번호 56 NWDGRGMHK 서열번호 132
6187 8.73E-04 0.1% 27 AAATGGGACGGCCGCGGCATCCACAAC 서열번호 57 KWDGRGIHN 서열번호 133
6171 8.71E-04 0.1% 21 CCTTACTGGCTGGAGGGCCTG 서열번호 58 PYWLEGL 서열번호 134
5917 8.35E-04 0.1% 30 GTGTGGCTGGAGGCTCAGAAACTGCACTAC 서열번호 59 VWLEAQKLHY 서열번호 135
5908 8.34E-04 0.1% 27 CCTGAGTGGCTGGACGTGGGCGGCTGG 서열번호 60 PEWLDVGGW 서열번호 136
5699 8.04E-04 0.1% 27 AACCCTTACTACCCTGGCTACGACCTG 서열번호 61 NPYYPGYDL 서열번호 137
5680 8.02E-04 0.1% 21 CCTCCTTGGCTGTACGACTTC 서열번호 62 PPWLYDF 서열번호 138
5515 7.78E-04 0.1% 27 ACCTGGGACGGCAACGGCCCTCACTTC 서열번호 63 TWDGNGPHF 서열번호 139
5286 7.46E-04 0.1% 27 AGCTGGGACGGCAAAGGTGCTCACTTC 서열번호 64 SWDGKGAHF 서열번호 140
4331 6.11E-04 0.1% 27 CCTATGCACATGGAGCTGGAGAACCAG 서열번호 65 PMHMELENQ 서열번호 141
4246 5.99E-04 0.1% 21 CCTCCTTGGCTGCACGACCTG 서열번호 66 PPWLHDL 서열번호 142
4141 5.84E-04 0.1% 27 AGCATGTGGAGCGACCCTATGGCTGAC 서열번호 67 SMWSDPMAD 서열번호 143
4067 5.74E-04 0.1% 28 AAAGTGAGCGAGCTGCGCTGTGCCTAGC 서열번호 68 KVSELRCA*- 서열번호 144
4044 5.71E-04 0.1% 27 TTCCTGAACAGCGAGATGCTGCACGAG 서열번호 69 FLNSEMLHE 서열번호 145
4043 5.71E-04 0.1% 27 ACCTGGGACGGCAACGGCGCTCACTAC 서열번호 70 TWDGNGAHY 서열번호 146
4016 5.67E-04 0.1% 27 AACTGGGACGGCCGCGGCATGCACAAC 서열번호 71 NWDGRGMHN 서열번호 147
4007 5.65E-04 0.1% 26 GACCAGTGGGCAGCATCGAGAAAGAC 서열번호 72 DQWAASRK- 서열번호 148
3858 5.44E-04 0.1% 27 AGCATGTGGAGCGACCCTAGGGCTCAC 서열번호 73 SMWSDPRAH 서열번호 149
3740 5.28E-04 0.1% 27 GAGCCTTGGTGGATCCAGCTGGTGGAC 서열번호 74 EPWWIQLVD 서열번호 150
3648 5.15E-04 0.1% 27 ATGTTCAACATCGTGAAATGGGCTTAC 서열번호 75 MFNIVKWAY 서열번호 151
3632 5.13E-04 0.1% 27 CCTATGCACATGGTGCTGGAGAACCAG 서열번호 76 PMHMVLENQ 서열번호 152
<파지 디스플레이 라이브러리 스크리닝을 위한 푸조박테리아 준비>
파지 디스플레이 방법을 이용하여, 푸조박테리아에 선택성을 갖는 M13 박테리오파지를 선별 및 분리하고자 하였다. 총 9종의 푸조박테리아를 준비하였다. 이 중 PD-B70 (Fusobacterium nucleatum subspecies vincentii), PD-B2298 (Fusobacterium nucleatum subspecies nucleatum), PD-B3771 (Fusobacterium nucleatum subspecies animalis), 및 PD-C387 (Fusobacterium nucleatum subspecies nucleatum) 는 환자로부터 유래된 푸조박테리아이며, ATCC-25586 (Fusobacterium nucleatum subspecies nucleatum), ATCC-23726 (Fusobacterium nucleatum subspecies nucleatum), ATCC-51191 (Fusobacterium nucleatum subspecies animalis), ATCC-10953 (Fusobacterium nucleatum subspecies polymorphum) 및 ATCC-49256 (Fusobacterium nucleatum subspecies vincentii)은 ATCC (American Type Culture Collection) 에서 상업적으로 이용되는 푸조박테리아 하위종이다.
상기 푸조박테리아들을 Gifu Anaerobic Media (GAM) broth 에 18시간 동안 37°C로 유지되는 혐기성 챔버에서 배양하였다. 배양한 배양액 10 mL을 1500 х g로 10분간 원심분리하여, 세포 펠렛 (cell pellet) 을 얻은 후 12% [w/v] skim milk powder, 1% [v/v] dimethyl sulfoxide, and 1% [v/v] glycerol로 구성된 용액에 재현탁 시켰다. 이후 저온동결건조기를 이용하여 박테리아 현탁액을 동결건조시켜 분말화하였으며, 사용 전까지 4°C 냉장고에 보관하였다.
<푸조박테리아에 선택성을 갖는 펩타이드 선별을 위한 phage 라이브러리 스크리닝>
라이브러리 스크리닝을 위하여, 동결건조 된 푸조박테리아를 증류수 (ddH2O) 에 녹인 후 OD600 에서 흡광도를 측정을 하였다. 9종의 푸조박테리아를 1:1 비율(equal amount)로 혼합한 후 스크리닝을 위한 혼합물을 플레이트에 도포하였다. Trico-C9 peptide 라이브러리 (약 8.60 x 1010)를 이용하여 파지 디스플레이 스크리닝을 진행하였다. 본 발명에서 사용된 라이브러리는 M13 박테리오파지의 게놈 중에 외피단백질(coat protein)의 일종인 p3를 생산하는 유전자 말단에 9개의 서열인 펩타이드가 발현되도록 만들어진 것이다. 먼저 푸조박테리아와 M13 박테리오파지 라이브러리를 반응시킨 후 결합되지 않은 박테리오파지 제거는 0.05% Tween 20이 포함된 인산완충용액으로 6회 씻어 주었다. 1차 결합된 0.2 M Glycine-HCl (pH 2.2) 용액으로 용출 되었고, 중성화를 위하여 Tris-HCl (pH 9.0)이 첨가되었다. 2차 패닝은 8회 세척, 3차 패닝은 10회 세척, 4차 패닝은 15회 세척을 진행하였으며, 용출은 상기 기술한 방법과 동일하게 진행되었다. 총 4회의 패닝(panning)을 수행하였으며, round 3 내지 round 4에서 푸조박테리아에 선택적인 단일클론(monoclone) 들을 선별을 하였다. 이 후 가장 큰 양성(positive)를 보이는 단일클론 들에 대해서 농축(enrichment)을 진행하였다. 상기 과정을 통하여 푸조박테리아에 선택적인 박테리오파지 후보군을 선별하였으며, DNA 시퀀싱을 통하여 아미노산 서열을 확인하였다.
실시예 2. 푸조박테리아에 고특이적 고선택적인 펩타이드를 포함하고 있는 박테리오파지의 푸조박테리아에 대한 결합력 확인
나아가, 본 발명의 발명자들은 전술한 과정에 의하여 도출된 박테리오파지 펩타이드를 ELISA를 통하여 검증하고자 하였다. 이에, 도 4a 내지 4e를 참조하면, 본 발명의 일 실시예에 따른 본 발명의 이용된 푸조박테리아에 선택성을 갖는 박테리오파지 펩타이드의 결합력 및 선택성에 대한 ELISA 검증 결과가 도시된다.
도 4a는 본 발명의 일 실시예에 따른 본 발명의 박테리오파지의 검증을 위한 박테리오파지 펩타이드의 서열번호 1 내지 7의 염기서열을 포함하는 클론 1 내지 7의 염기서열 및 이로부터 번역되는 아미노산 서열을 나타낸다.
도 4b는 박테리오파지 펩타이드의 서열번호 1 내지 7의 염기서열을 포함하는 클론 1 내지 7 염기서열을 클로닝하기 위한 pCD-TriC9 phagemid 의 벡터맵을 나타낸다.
도 4c는 pCD-TriC9 phagemid의 클로닝을 통한 서열번호 1 내지 7의 염기서열 PCR 결과를 나타낸다.
도 4a 내지 4c를 참조하면, 본 발명의 박테리오파지의 검증을 위하여, 서열번호 1, 2, 3, 4, 5, 6 및 7의 염기서열의 5' 말단 및 3'말단에 SfiI 및 NotI 제한 부위를 도입하여 클론 (clone) 1 내지 7을 제작하였다 (도 4a). 이를 도 4b의 pCD-TriC9 phagemid에 도입하였다 (도 4b). 나아가, 서열번호 1, 2, 3, 4, 5, 6 및 7의 클로닝 결과를 PCR로 확인하였다 (도 4c).
도 4d는 도 4a 내지 도 4c에서 클로닝한 서열번호 1, 2, 3, 4, 5, 6 및 7의 유전자로부터 번역된 펩타이드, 즉 서열번호 77, 78, 79, 80, 81, 82 및 83의 펩타이드의 푸조박테리아에 대한 결합 친화력 (binding affinity)을 ELISA로 측정한 결과이다.
도 4e는 도 4a 내지 도 4c에서 클로닝한 서열번호 1, 2, 3, 4, 5, 6 및 7의 유전자로부터 번역된 펩타이드, 즉 서열번호 77, 78, 79, 80, 81, 82 및 83 펩타이드의 9종의 푸조박테리아 종류에 따른 결합친화력을 시험한 ELISA 시험 결과를 도시한 것이다.
도 4d를 참조하면, 클론 1 내지 7 모두 1 이상의 결합친화도(binding affinity)를 갖는 것으로 나타나며, 이 중 서열번호 5 (서열번호 81)가 가장 높은 것으로 나타난다.
나아가, 도 4e를 참조하면, 9종의 푸조박테리아 종류에 따른 클론 1 내지 7 모두 1종 이상의 각기 다른 푸조박테리아에 결합 친화도를 갖는 것으로 나타난다.
이에, 본 발명의 일 실시예에 따른 본 푸조박테리아에 선택성을 갖는 박테리오파지의 서열번호 77 내지 83의 펩타이드는 푸조박테리아를 높은 친화력으로 표적할 수 있으며, 이에 따라, 암을 포함하는 다양한 질병에서 유해균으로 알려진 푸조박테리아를 정확하게 표적하여 제거할 수 있다.
더욱이, 본 발명의 일 실시예에 따른 본 푸조박테리아에 선택성을 갖는 박테리오파지의 서열번호 77 내지 83의 펩타이드는 푸조박테리아 제거 뿐만 아니라, 전술한 바와 같이 높은 친화력으로 표적할 수 있음에 따라, 푸조박테리아의 존재 유무를 높은 신뢰도로 검출할 수 있다.
이에, 본 발명의 일 실시예에 따른 본 푸조박테리아에 선택성을 갖는 박테리오파지의 펩타이드가 진단 키트로서 이용될 경우, 푸조박테리아에 감염된 암세포의 분포 및 전이 유무를 확인할 수 있다.
<ELISA를 활용한 결합력 측정 방법>
9종의 푸조박테리아 혼합물 또는 푸조박테리아 9종 각각을 플레이트에 코팅시키고, 비특이적 결합을 방지하기 위해 5% BSA 용액을 사용을 하여 블록킹 반응을 진행하였다. 각각의 선별된 M13 박테리오파지를 푸조박테리아가 코팅되어 있는 플레이트에 반응시켰다. 0.1% Tween 20이 포함된 인산완충용액으로 3회 세척 해준 후, M13-HRP 항체와 반응을 시켰다. 반응 플레이트를 0.1% Tween 20이 포함된 인산완충용액으로 3회 세척해주고, TMB color 용액을 이용하여 반응시켰다. 1M 황산 (H2SO4) 으로 반응을 정지시켰고, OD450에서 흡광도를 측정하여 결합력을 비교하였다.
실시예 3. 형광표지인자가 결합된 박테리오파지 펩타이드를 활용한 푸조박테리아 검출 효능 확인
도 5a 내지 도 5i 는 형광표지인자가 결합된 서열번호 77 내지 83의 펩타이드를 활용한 박테리아 검출 효능을 도시하는 도면이다.
도 5a를 참조하면, 앞서 실시예 1에서 박테리아 검출 효능이 높은 서열번호 1 내지 7의 염기서열로부터 번역된 서열번호 77 내지 83의 7개 펩타이드 서열을 선정하여 형광표지인자인 Fluorescein isothiocyanate (FITC)가 결합된 Clone-1 내지 Clone-7의 펩타이드 7 종류를 합성하였다. 합성 방법은 제한되지 않으며, 공지의 다양한 펩타이드와 물질의 합성 방법이 이용될 수 있다. 이하의 항암제와 본 발명의 일 실시예에 따른 펩타이드의 결합도 FITC와 동일한 방법으로 결합될 수 있다.
이어서, 도 5a의 Clone-1 내지 Clone-7의 펩타이드 7 종류를 9종의 푸조박테리아가 도포된 각각의 웰 플레이트에 도포 처리하고 각 웰(well)의 푸조박테리아와 결합한 펩타이드양을 측정함으로써 Clone-1 내지 Clone-7의 펩타이드와 푸조박테리아 9종 과의 결합력을 추론하였다.
도 5b 내지 도 5h 에서 X축의 25586N 은 ATCC-25586 (Fusobacterium nucleatum subspecies nucleatum), 23726N 은 ATCC-23726 (Fusobacterium nucleatum subspecies nucleatum), 10953P 는 ATCC-10953 (Fusobacterium nucleatum subspecies polymorphum), 49256V 는 ATCC-49256 (Fusobacterium nucleatum subspecies vincentii), 51191A 는 ATCC-51191 (Fusobacterium nucleatum subspecies animalis), B70 은 PD-B70 (Fusobacterium nucleatum subspecies vincentii), C387 은 PD-C387 (Fusobacterium nucleatum subspecies nucleatum), B2298 은 PD-B2298 (Fusobacterium nucleatum subspecies nucleatum), B3771은 PD-B3771 (Fusobacterium nucleatum subspecies animalis)을 의미한다.
다시 도 5b 내지 도 5h 를 참조하면, Clone-1 내지 Clone-7의 펩타이드와 9종의 푸조박테리아의 결합력은 FITC 형광광도값 50 내지 250 범위에서 검출 가능한 것으로 나타났다.
도 5i 는 도 5b 내지 도 5h 에서의 FITC 형광광도값을 음영의 강도를 달리하여 표시한 것이다.
이에, 본 발명의 일 실시예에 따른 본 푸조박테리아에 선택성을 갖는 박테리오파지의 서열번호 77 내지 83의 펩타이드는 형광표지인자가 결합되어 푸조박테리아 및 인접한 암 세포들 표적할 수 있다.
나아가, 본 발명의 일 실시예에 따른 본 푸조박테리아에 선택성을 갖는 박테리오파지의 서열번호 77 내지 83의 펩타이드는 상기 형광물질 이외에도 다양한 항암제가 결합될 수 있다.
즉, 본 발명에 따른 펩타이드는 약물을 암 조직에 선택적으로 전달하는 지능형 약물 전달체로서 사용될 수 있다. 본 발명의 펩타이드를 종래 공지의 약물과 연결하여 암 치료에 이용한다면 본 발명의 펩타이드에 의해 약물이 암 조직 및 암 세포에만 선택적으로 전달되기 때문에 약물의 효력을 증가시킬 수 있고 동시에 정상조직에 미치는 약물의 부작용을 현저히 줄일 수 있다.
이에 따라, 전달되는 약물로서는 화학적 항암치료제가 이용될 수 있으며, 본 발명의 일 실시예에 따른 펩타이드와의 결합은 FITC와 같은 형광 물질의 결합과 유사 또는 동일한 방법으로 수행될 수 있다.
예를 들어, 화학적 항암치료제는 류코보린(Leucovorin), 레바미솔(Levamisole), 이로노테칸(Irinotecan), 옥살리플라틴(Oxaliplatin), 카페시타빈(Capecitabin), 또는 우라실/테가푸르(Uracil/Tegafur) 중 적어도 하나가 이용될 수 있으나, 이에 제한되는 것은 아니며, 푸조박테리아가 형성되어 있는 암에서 이용될 수 있는 화학적 항암치료제 즉, 도세탁셀(Docetaxel), 시스플라틴(cis-platin), 캠토세신(camptothecin), 파클리탁셀(paclitaxel), 타목시펜(Tamoxifen), 아나스테로졸(Anasterozole), 글리벡(Gleevec), 5-플루오로우라실(5- FU), 플록슈리딘(Floxuridine), 류프로리드(Leuprolide), 플로타미드(Flutamide), 졸레드로네이트 (Zoledronate), 독소루비신(Doxorubicin), 빈크리스틴(Vincristine), 젬시타빈(Gemcitabine), 스트렙토조토신 (Streptozocin), 카보플라틴(Carboplatin), 토포테칸(Topotecan), 벨로테칸(Belotecan), 비노렐빈(Vinorelbine), 히도록시우레아(hydroxyurea), 니트로소우레아(nitrosourea), 발루비신(Valrubicin), 레티노익산 (retinoic acid) 계열, 메소트렉세이트(Methotrexate), 메클로레타민(Meclorethamine), 클로람부실 (Chlorambucil), 부술판(Busulfan), 독시플루리딘(Doxifluridine), 빈블라스틴(Vinblastin), 마이토마이신 (Mitomycin), 프레드니손(Prednisone), 테스토스테론(Testosterone), 미토산트론(Mitoxantron), 아스피린 (aspirin), 살리실레이트(salicylates), 이부프로펜(ibuprofen), 나프로센(naproxen), 페노프로펜 (fenoprofen), 인도메타신(indomethacin), 페닐부타존(phenyltazone), 시클로포스파미드(cyclophosphamide), 메클로에타민(mechlorethamine), 덱사메타손(dexamethasone), 프레드니솔론(prednisolone), 셀레콕시브 (celecoxib), 발데콕시브(valdecoxib), 니메슐리드(nimesulide), 다우노루비신(daunorubicin), 액티노마이신-D(actinomycin-D), 에토포사이드(etoposide), 테니포사이드(teniposide), 비산트렌(bisantrene), 호모해링토닌(homoharringtonine), 부설판(busulfan), 클로람부실(chlorambucil), 멜팔란 (melphalan), 니트로겐 무스타드(nitrogen mustard), 코르티손(cortisone) 및 코르티코스테로이드 (corticosteroid) 등을 모두 포함할 수 있다.
<형광표지인자가 결합된 박테리오파지 펩타이드와 푸조박테리아와의 결합력 측정 방법>
푸조박테리아들을 Gifu Anaerobic Media (GAM) broth 에 18시간 동안 37°C 온도가 유지되는 혐기성 챔버에서 배양하였다. 배양액을 3000 хg로 10분간 원심분리하여, 세포 펠렛 (cell pellet)을 획득하였고 인산완충용액 (PBS)로 3회 세척하였다. 푸조박테리아를 pH 9.6의 탄산염-중탄산염 (carbonate-bicarbonate) 완충액에 현탁시킨 후 OD600 에서 흡광도를 측정하였다. 웰(well)당 OD600값이 0.1이 되도록 희석액을 준비하였고, 96-웰 플레이트에 100 μL씩 분주하였다. 박테리아를 플레이트에 흡착시키기 위하여, 37℃ 배양기에 넣어 플레이트를 건조시켰다. 플레이트에 흡착되지 않은 푸조박테리아를 제거는 0.05% Tween 20이 포함된 인산완충용액으로 5회 세척하였다. 이후 1% BSA 용액을 사용하여 펩타이드의 비특이적인 결합을 방지하는 블록킹 반응을 상온에서 1시간동안 진행하였다. FITC가 결합되어 있는 펩타이드는 웰(well)당 처리 되는 최종농도가 100 μM 이 되도록 제조되었으며, 블록킹 반응 후 푸조박테리아가 코팅되어 있는 플레이트에 처리하여 4℃에서 밤새 반응시켰다. 0.05% Tween 20이 포함된 인산완충용액으로 3회 세척을 한 후, ELISA에서 형광 (ex 480nm / em 525nm) 을 측정하였다.
본 발명의 일 실시예에 따른 본 푸조박테리아에 선택성을 갖는 박테리오파지 펩타이드의 이용
도 6 내지 8은, 본 발명에서 이용되는 박테리오파지의 구조에 대한 개략도가 도시된다.
먼저, 도 6를 참조하면, 본 발명의 일 실시예에 따른 본 푸조박테리아에 선택성을 갖는 박테리오파지 펩타이드는 M13 박테리오파지의 외피단백질 P3 부위에 표현되어 푸조박테리아를 특이적으로 인식(표적)할 수 있다. 한편, P3를 제외한 P8 및 P9는 다양한 물질이 결합(cross-linked)될 수 있다.
보다 구체적으로, 도 7을 참조하면, 본 발명에서 이용되는 박테리오파지는 P8 및 P9에 양친매성 가교제(Phage-guided bioorthogonal targeting)가 사용되어, 다양한 조성물이 결합될 수 있다. 예를 들어, P8 및 P9 부위에 결합될 수 있는 조성물로서, 화학적 항암치료제가 이용될 수 있으며, 화학적 항암치료제는 덱스트란 (Dextran) 과 같은 수용성 고분자에 의하여 포장된 다음, 가교제로 연결되어 박테리오파지의 P8 및 P9 부위에 결합될 수 있다. 이때, 화학적 항암치료제는 류코보린(Leucovorin), 레바미솔(Levamisole), 이로노테칸(Irinotecan), 옥살리플라틴(Oxaliplatin), 카페시타빈(Capecitabin), 또는 우라실/테가푸르(Uracil/Tegafur) 중 적어도 하나가 이용될 수 있으나, 이에 제한되는 것은 아니며, 푸조박테리아가 형성되어 있는 암에서 이용될 수 있는 화학적 항암치료제 즉, 도세탁셀(Docetaxel), 시스플라틴(cis-platin), 캠토세신(camptothecin), 파클리탁셀(paclitaxel), 타목시펜(Tamoxifen), 아나스테로졸(Anasterozole), 글리벡(Gleevec), 5-플루오로우라실(5- FU), 플록슈리딘(Floxuridine), 류프로리드(Leuprolide), 플로타미드(Flutamide), 졸레드로네이트 (Zoledronate), 독소루비신(Doxorubicin), 빈크리스틴(Vincristine), 젬시타빈(Gemcitabine), 스트렙토조토신 (Streptozocin), 카보플라틴(Carboplatin), 토포테칸(Topotecan), 벨로테칸(Belotecan), 비노렐빈(Vinorelbine), 히도록시우레아(hydroxyurea), 니트로소우레아(nitrosourea), 발루비신(Valrubicin), 레티노익산 (retinoic acid) 계열, 메소트렉세이트(Methotrexate), 메클로레타민(Meclorethamine), 클로람부실 (Chlorambucil), 부술판(Busulfan), 독시플루리딘(Doxifluridine), 빈블라스틴(Vinblastin), 마이토마이신 (Mitomycin), 프레드니손(Prednisone), 테스토스테론(Testosterone), 미토산트론(Mitoxantron), 아스피린 (aspirin), 살리실레이트(salicylates), 이부프로펜(ibuprofen), 나프로센(naproxen), 페노프로펜 (fenoprofen), 인도메타신(indomethacin), 페닐부타존(phenyltazone), 시클로포스파미드(cyclophosphamide), 메클로에타민(mechlorethamine), 덱사메타손(dexamethasone), 프레드니솔론(prednisolone), 셀레콕시브 (celecoxib), 발데콕시브(valdecoxib), 니메슐리드(nimesulide), 다우노루비신(daunorubicin), 액티노마이신-D(actinomycin-D), 에토포사이드(etoposide), 테니포사이드(teniposide), 비산트렌(bisantrene), 호모해링토닌(homoharringtonine), 부설판(busulfan), 클로람부실(chlorambucil), 멜팔란 (melphalan), 니트로겐 무스타드(nitrogen mustard), 코르티손(cortisone) 및 코르티코스테로이드 (corticosteroid) 등을 모두 포함할 수 있다.
나아가, 가교제(linker)의 반응기로는 싸이올기(thiol) 또는 아민기(amine)를 포함하여, 박테리오파지의 P8 및 P9에 아마이드 결합이 형성될 수 있는 다양한 반응기를 모두 포함할 수 있다.
더 나아가, 박테리오파지의 경우, 세포 내 (intracellular)까지 도달이 가능하다. 이에, 본 발명의 일 실시예에 따른 본 푸조박테리아에 선택성을 갖는 박테리오파지 펩타이드를 포함하는 박테리오파지가 전술한 화학항암치료제를 더 포함할 경우, 암세포의 내부까지 침입이 가능하여, 약물 전달 효율성이 보다 향상될 수 있으며, 이에 따라, 항암 치료의 효과 또한 증진될 수 있다.
또한, 본 발명의 일 실시예에 따른 본 푸조박테리아에 선택성을 갖는 박테리오파지 펩타이드를 포함하는 박테리오파지는 화학적 항암치료제뿐만 아니라, 유전자 약물을 더 포함할 수 있다. 예를 들어, 유전자 약물은 암세포의 Bcl-2 Antagonist X (Bax), B-cell lymphoma 2 (BCl-2), Focal adhesion kinase, Matrix metalloproteinase, Vascular endothelial growth factor (VEGF), Fatty acid synthase, Multiple drug resistance protein(MDR), Harvey rat sarcoma viral oncogene homolog (H-Ras), Kirsten-rat sarcoma viral oncogene homolog (K-Ras), Polo Like Kinase 1(PLK-1), Transforming growth factor beta (TGF-βSignal Transducer And Activator Of Transcription 3 (STAT3), Epidermal growth factor receptor (EGFR), Protein kinase C alpha (PKC-α), Epstein-Barr virus, human papillomavirus E6 (HPV E6), BCR-ABL fusion gene 및 Telomerase로 이루어진 군에서 선택된 1종 이상의 단백질을 타겟으로 하는 짧은 간섭 RNA (small interfering RNA, siRNA) 및 단일 가이드 RNA (single guide RNA, sgRNA)일 수 있으나, 이에 제한되는 것은 아니다. 이에, 본 발명의 일 실시예에 따른 본 푸조박테리아에 선택성을 갖는 박테리오파지 펩타이드를 포함하는 박테리오파지는 암세포 내에 유전자 약물을 전달함으로써, 암세포의 유전자를 변형시키고 이에 따른, 항암효과를 초래할 수 있다.
또한, 본 발명의 일 실시예에 따른 본 푸조박테리아에 선택성을 갖는 박테리오파지 펩타이드를 포함하는 박테리오파지는 유전자 가위 (CRISPR-Cas9)가 적용될 수 있다. 예를 들어, 도 8을 참조하면, 본 발명의 일 실시예에 따른 본 푸조박테리아에 선택성을 갖는 박테리오파지 펩타이드를 포함하는 박테리오파지는 유전자가위가 도입되어 박테리오파지의 DNA에 암세포에 살상력을 가지는 DNA 서열이 포함될 수 있으며, 이에 따라, 박테리오파지가 주입될 경우, 암세포에 살상력을 가지는 DNA 서열이 푸조박테리아 내부 또는 푸조박테리아가 존재하는 다양한 암세포 내로 주입되어, 이의 단백질이 발현될 수 있다.
이에, 본 발명의 일 실시예에 따른 본 푸조박테리아에 선택성을 갖는 박테리오파지 펩타이드를 포함하는 박테리오파지는 암세포에 직접적인 유전자 변형을 야기시켜, 항암효과를 가질 수 있다.
이상 첨부된 도면을 참조하여 본 발명의 실시 예들을 더욱 상세하게 설명하였으나, 본 발명은 반드시 이러한 실시 예로 국한되는 것은 아니고, 본 발명의 기술사상을 벗어나지 않는 범위 내에서 다양하게 변형 실시될 수 있다. 따라서, 본 발명에 개시된 실시 예들은 본 발명의 기술 사상을 한정하기 위한 것이 아니라 설명하기 위한 것이고, 이러한 실시 예에 의하여 본 발명의 기술 사상의 범위가 한정되는 것은 아니다. 그러므로, 이상에서 기술한 실시 예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다. 본 발명의 보호 범위는 아래의 청구범위에 의하여 해석되어야 하며, 그와 동등한 범위 내에 있는 모든 기술 사상은 본 발명의 권리범위에 포함되는 것으로 해석되어야 할 것이다.
[이 발명을 지원한 국가연구개발사업]
[과제고유번호]1711118087
[과제번호]2020R1F1A1066973
[부처명]과학기술정보통신부
[과제관리(전문)기관명]한국연구재단
[연구사업명]개인기초연구(과기정통부)(R＆D)
[연구과제명]대장암 조직 종양 미세 환경에서 푸조 박테리아 감염이 면역 분자 프로파일링에 미치는 영향 연구
[기여율]34/100
[과제수행기관명]연세대학교
[연구기간]20200601 ~ 20210228
[이 발명을 지원한 국가연구개발사업]
[과제고유번호]1711114441
[과제번호]2019R1C1C1006709
[부처명]과학기술정보통신부
[과제관리(전문)기관명]한국연구재단
[연구사업명]개인기초연구(과기정통부)(R＆D)
[연구과제명]종양 유래 엑소좀 DNA의 메틸화 구조 및 후성 유전학적 특성과 임상적 효용성 규명
[기여율]33/100
[과제수행기관명]연세대학교
[연구기간]20200301 ~ 20210228
[이 발명을 지원한 국가연구개발사업]
[과제고유번호]1345323642
[과제번호]2019R1A6A3A01096180
[부처명]교육부
[과제관리(전문)기관명]한국연구재단
[연구사업명]이공학학술연구기반구축(R＆D)
[연구과제명]박테리오파지 및 크리스퍼 유전자 가위를 활용한 대장암 유발 유해균 표적기술 개발 및 임상적 효용성 연구
[기여율]33/100
[과제수행기관명]연세대학교
[연구기간]20200901 ~ 20210831

Claims (14)

  1. 서열번호 77 내지 서열번호 83 으로 이루어진 군에서 선택되는 아미노산 서열로 이루어진 펩타이드를 포함하고, 상기 펩타이드는 푸조박테리아를 표적으로 하는, 푸조박테리아 표적 펩타이드.
  2. 제1 항에 있어서,
    상기 펩타이드는,
    M13 박테리오파지의 외피단백질(major coat protein) P3에 표현되는 것인, 푸조박테리아 표적 펩타이드.
  3. 제1 항 또는 제2 항에 기재된 서열번호 77 내지 서열번호 83 으로 이루어진 군에서 선택되는 아미노산 서열을 암호화하는 서열번호 1 내지 7의 염기서열 중 하나를 포함하는, 발현 벡터.
  4. 제3 항에 있어서,
    상기 발현 벡터는 파지미드(phagemid) 벡터인 것인, 발현 벡터.
  5. 제3 항에 기재된 발현 벡터로 형질전환된 형질전환체.
  6. 서열번호 77 내지 83 으로 이루어진 군에서 선택되는 아미노산 서열로 이루어진 푸조박테리아 표적 펩타이드를 포함하는, 암 진단용 조성물.
  7. 제6 항에 있어서,
    상기 푸조박테리아 표적 펩타이드는, 발색효소, 방사성동위원소, 발색단(chromophore), 발광물질, 형광물질(fluorescer), 상자성입자(super paramagnetic particles) 및 초상자성입자(ultrasuper paramagnetic particles)로 이루어진 군에서 선택되는 하나로 표지된 것인, 암 진단용 조성물.
  8. 제6 항에 있어서,
    푸조박테리아가 감염된 결장암, 흑색종, 췌장암, 간암, 위암, 대장암, 폐암, 난소암, 유방암, 및 자궁경부암 중 적어도 하나의 암세포를 표적하여 진단하는, 암 진단용 조성물.
  9. 서열번호 77 내지 서열번호 83 으로 이루어진 군에서 선택되는 아미노산 서열로 이루어진 푸조박테리아 표적 펩타이드를 포함하는, 약물 전달 조성물.
  10. 제9 항에 있어서,
    상기 약물은,
    상기 푸조박테리아 표적 펩타이드와 물리적 또는 화학적으로 결합된 것이며, 푸조박테리아가 감염된 암세포를 치료하는 항암제인 것인, 약물 전달 조성물.
  11. 제10 항에 있어서,
    상기 항암제는,
    푸조박테리아가 감염된 결장암, 흑색종, 췌장암, 간암, 위암, 대장암, 폐암, 난소암, 유방암, 및 자궁경부암 중 적어도 하나의 암세포를 표적하여 치료하는, 약물 전달 조성물.
  12. 상기 항암제는,
    류코보린(Leucovorin), 레바미솔(Levamisole), 이로노테칸(Irinotecan), 옥살리플라틴(Oxaliplatin), 카페시타빈(Capecitabin), 우라실/테가푸르(Uracil/Tegafur), 도세탁셀(Docetaxel), 시스플라틴(cis-platin), 캠토세신(camptothecin), 파클리탁셀(paclitaxel), 타목시펜(Tamoxifen), 아나스테로졸(Anasterozole), 글리벡(Gleevec), 5-플루오로우라실(5- FU), 플록슈리딘(Floxuridine), 류프로리드(Leuprolide), 플로타미드(Flutamide), 졸레드로네이트 (Zoledronate), 독소루비신(Doxorubicin), 빈크리스틴(Vincristine), 젬시타빈(Gemcitabine), 스트렙토조토신 (Streptozocin), 카보플라틴(Carboplatin), 토포테칸(Topotecan), 벨로테칸(Belotecan), 비노렐빈(Vinorelbine), 히도록시우레아(hydroxyurea), 니트로소우레아(nitrosourea), 발루비신(Valrubicin), 레티노익산 (retinoic acid) 계열, 메소트렉세이트(Methotrexate), 메클로레타민(Meclorethamine), 클로람부실 (Chlorambucil), 부술판(Busulfan), 독시플루리딘(Doxifluridine), 빈블라스틴(Vinblastin), 마이토마이신 (Mitomycin), 프레드니손(Prednisone), 테스토스테론(Testosterone), 미토산트론(Mitoxantron), 아스피린 (aspirin), 살리실레이트(salicylates), 이부프로펜(ibuprofen), 나프로센(naproxen), 페노프로펜 (fenoprofen), 인도메타신(indomethacin), 페닐부타존(phenyltazone), 시클로포스파미드(cyclophosphamide), 메클로에타민(mechlorethamine), 덱사메타손(dexamethasone), 프레드니솔론(prednisolone), 셀레콕시브 (celecoxib), 발데콕시브(valdecoxib), 니메슐리드(nimesulide), 다우노루비신(daunorubicin), 액티노마이신-D(actinomycin-D), 에토포사이드(etoposide), 테니포사이드(teniposide), 비산트렌(bisantrene), 호모해링토닌(homoharringtonine), 부설판(busulfan), 클로람부실(chlorambucil), 멜팔란 (melphalan), 니트로겐 무스타드(nitrogen mustard), 코르티손(cortisone) 및 코르티코스테로이드 (corticosteroid)로 이루어진 군에서 선택되는, 약물 전달 조성물.
  13. 제9 항에 있어서,
    상기 항암제는,
    상기 푸조박테리아 표적 펩타이드와 물리적 또는 화학적으로 결합된 것이며, 푸조박테리아가 감염된 암세포를 치료하는 유전자 약물인 것인, 약물 전달 조성물.
  14. 제13 항에 있어서,
    상기 유전자 약물은,
    암세포의 Bcl-2 Antagonist X (Bax), B-cell lymphoma 2 (BCl-2), Focal adhesion kinase, Matrix metalloproteinase, Vascular endothelial growth factor (VEGF), Fatty acid synthase, Multiple drug resistance protein(MDR), Harvey rat sarcoma viral oncogene homolog (H-Ras), Kirsten-rat sarcoma viral oncogene homolog (K-Ras), Polo Like Kinase 1(PLK-1), Transforming growth factor beta (TGF-βSignal Transducer And Activator Of Transcription 3 (STAT3), Epidermal growth factor receptor (EGFR), Protein kinase C alpha (PKC-α), Epstein-Barr virus, human papillomavirus E6 (HPV E6), BCR-ABL fusion gene 및 Telomerase로 이루어진 군에서 선택된 1종 이상의 단백질을 타겟으로 하는 짧은 간섭 RNA (small interfering RNA, siRNA) 및 단일 가이드 RNA (single guide RNA, sgRNA)로 이루어진 군에서 선택되는, 약물 전달 조성물.
PCT/KR2022/015317 2021-10-08 2022-10-11 푸조박테리아 표적 펩타이드, 이를 포함하는 암 진단용 조성물 및 약물 전달 조성물 WO2023059172A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0133821 2021-10-08
KR20210133821 2021-10-08

Publications (1)

Publication Number Publication Date
WO2023059172A1 true WO2023059172A1 (ko) 2023-04-13

Family

ID=85803614

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/015317 WO2023059172A1 (ko) 2021-10-08 2022-10-11 푸조박테리아 표적 펩타이드, 이를 포함하는 암 진단용 조성물 및 약물 전달 조성물

Country Status (2)

Country Link
KR (1) KR20230051420A (ko)
WO (1) WO2023059172A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140033309A (ko) * 2010-10-04 2014-03-18 브리티쉬 콜롬비아 캔써 에이전시 브랜치 위장 암을 진단하기 위해 위장의 샘플에서의 푸소박테리움의 검출
CN106591488A (zh) * 2017-02-23 2017-04-26 武汉艾米森生命科技有限公司 一种检测粪便中具核梭杆菌的核酸组合及其应用与试剂盒
US11060148B2 (en) * 2012-10-16 2021-07-13 Dana-Farber Cancer Institute, Inc. Diagnosing and treating colorectal cancer

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140033309A (ko) * 2010-10-04 2014-03-18 브리티쉬 콜롬비아 캔써 에이전시 브랜치 위장 암을 진단하기 위해 위장의 샘플에서의 푸소박테리움의 검출
US11060148B2 (en) * 2012-10-16 2021-07-13 Dana-Farber Cancer Institute, Inc. Diagnosing and treating colorectal cancer
CN106591488A (zh) * 2017-02-23 2017-04-26 武汉艾米森生命科技有限公司 一种检测粪便中具核梭杆菌的核酸组合及其应用与试剂盒

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DONG XUE, PAN PEI, ZHENG DI-WEI, BAO PENG, ZENG XUAN, ZHANG XIAN-ZHENG: "Bioinorganic hybrid bacteriophage for modulation of intestinal microbiota to remodel tumor-immune microenvironment against colorectal cancer", SCIENCE ADVANCES, vol. 6, no. 20, 15 May 2020 (2020-05-15), XP093055418, DOI: 10.1126/sciadv.aba1590 *
MACHERA SEBASTIAN J., NIEDZIÓŁKA-JÖNSSON JOANNA, SZOT-KARPIŃSKA KATARZYNA: "Phage-Based Sensors in Medicine: A Review", CHEMOSENSORS, vol. 8, no. 3, pages 61, XP055912211, DOI: 10.3390/chemosensors8030061 *

Also Published As

Publication number Publication date
KR20230051420A (ko) 2023-04-18

Similar Documents

Publication Publication Date Title
Liu et al. Tumor-targeting peptides from combinatorial libraries
Burrus et al. The current ICE age: biology and evolution of SXT-related integrating conjugative elements
McGuire et al. In vitro selection of a peptide with high selectivity for cardiomyocytes in vivo
Ng et al. Genomics and metagenomics of colorectal cancer
EP1800133A1 (en) Methods for antibody library screening
WO2017171410A1 (ko) 황색포도상구균의 감수성 예측용 바이오마커 및 이의 용도
WO2016153185A1 (ko) 암 줄기세포의 증식억제용 항암기능성 펩타이드 및 그 용도
CN108640976B (zh) 一种与人结肠癌细胞特异性结合的多肽
WO2019154103A1 (zh) 一种肿瘤靶向的新型多肽及其用途
CN104650190A (zh) 肝癌细胞表面特异性结合的多肽
Ma et al. Screening of a specific peptide binding to esophageal squamous carcinoma cells from phage displayed peptide library
WO2023059172A1 (ko) 푸조박테리아 표적 펩타이드, 이를 포함하는 암 진단용 조성물 및 약물 전달 조성물
US9822148B2 (en) EGFR-binding peptide
Li et al. Using phage as a platform to select cancer cell-targeting peptides
Klein et al. Transcription factors activate genes through the phase-separation capacity of their activation domains
CN111018951B (zh) 一种靶向三阴性乳腺癌细胞的多肽及其应用
CN110746489B (zh) 一种特异性靶向三阴乳腺癌的多肽及其应用
CA2579937C (en) Methods for antibody library screening
CN110950931B (zh) 一种特异性靶向三阴性乳腺癌干细胞的多肽及其应用
KR20230065933A (ko) 진단 이미징을 위한 조작된 미생물
Bakhshinejad et al. Identification of a novel tumor-binding peptide for lung Cancer through in-vitro panning
De et al. Isolation of a Mycoplasma-specific binding peptide from an unbiased phage-displayed peptide library
WO2022035222A1 (ko) 암세포 유래 엑소좀에 선택적으로 결합하는 펩타이드 및 이의 용도
WO2024123048A1 (ko) Strep-tag 결합물질에 대한 결합능을 가지는 융합단백질을 암호화하는 유전자 구조물 및 이를 함유하는 발현벡터, 재조합 균주 및 항암 조성물
CN110231484A (zh) 一种检测表达癌胚抗原细胞的方法及其应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22878993

Country of ref document: EP

Kind code of ref document: A1