WO2023045750A1 - Primer group and kit for simultaneous detection of multiple mutations of nine genes related to congenital adrenal hyperplasia - Google Patents

Abstract

The present invention relates to a primer group, a kit and a method for simultaneous detection of multiple mutations of nine genes related to congenital adrenal hyperplasia. The kit comprises the following reagents: (1) a reagent for multiplex PCR amplification; and (2) a reagent for constructing a three-generation sequencing library. The method comprises the following steps: (1) preparing a sample of a subject; (2) performing multiplex PCR amplification on 9 genes (CYP21A2, CYP21A1P, CYP11B1, CYP11B2, CYP17A1, HSD3B2, StAR, POR and CYP11A1) in the sample; (3) constructing a three-generation sequencing library; and (4) sequencing and analyzing gene mutation types.

Description

Primer set and kit for simultaneous detection of multiple mutations in 9 genes related to congenital adrenal hyperplasia technical field

The invention relates to a primer set and a kit for simultaneously detecting multiple mutations of nine genes related to congenital adrenal hyperplasia by using a three-generation long-read sequencing platform, as well as a related method.

Background technique

Congenital Adrenal Hyperplasia (CAH) is a group of autosomal recessive genetic diseases caused by enzyme defects in the synthesis of adrenal cortex hormones. According to the different types of enzyme defects, CAH can be divided into 21-Hydroxylase deficiency (21-OHD), 11β-Hydroxylase deficiency (11β-OHD), 17α-Hydroxylase deficiency 17α-Hydroxylase deficiency (17α-OHD), 3β-hydroxysteroid dehydrogenase deficiency (3β-Hydroxysteroid dehydrogenase type 2deficiency, 3β-HSD), congenital adrenal lipoid hyperplasia (Lipoid CAH), cell Pigment P450 oxidoreductase deficiency (Cytochrome P450oxidoreductase deficiency, POR deficiency), cholesterol side chain cleavage enzyme deficiency (Cholesterol Side-Chain Cleavage Enzyme Deficiency, SCC deficiency), respectively caused by CYP21A2, CYP11B1, CYP17A1, HSD3B2, StAR, POR and Mutations in these seven genes, CYP11A1, cause ¹ . Among them, 21-OHD is the most common, accounting for about 90-95% of CAH, 11β-OHD accounts for about 5-8%, 17α-OHD and 3β-HSD each account for about 1% or less than 1%, and the other three types are relatively rare ^1,2 .

According to the severity of the clinical phenotype, 21-OHD can be divided into salt wasting (SW), simple virilizing (SV) and atypical CAH (nonclassic CAH, NCCAH). Salt type and simple virilizing type are collectively referred to as typical CAH. The human CYP21A2 gene that causes 21-OHD is located in the HLA class III gene region of 6p21.3, with a length of about 3.2kb and 10 exons and 9 introns. The homology of the exons and introns of the CYP21A2 gene and the corresponding pseudogene CYP21A1P were 98% and 96%, respectively. Compared with CYP21A2, there are 10 mutations in CYP21A1P that will lead to loss of gene function, including c.92C>T(p.P30L), c.293-13C/A>G(In2G), c.332_339del(p.G110Efs) , c.518T>A(p.I172N), E6Cluster(c.710T>A(p.I236N), c.713T>A(p.V237E), c.719T>A(p.M239K)), c. 845T>G(p.V281L), c.923dup(p.L307fs), c.955C>T(p.Q318X), c.1069C>T(p.R356W), c.1360C>T(p.453S) ³ . As shown in Figure 1, the telomere-side gene string RP1-C4A-CYP21A1P-TNXA and the centromere-side homologous gene string RP2-C4B-CYP21A2-TNXB were connected in series to form a double RCCX pattern. The high homology of RCCX patterns makes it possible for unequal crossover or recombination to occur during mitosis or meiosis. About 70% of CYP21A2 gene mutations are due to pathogenic point mutations caused by gene conversion with the pseudogene CYP21A1P. 20-25% of CYP21A2 gene mutations are due to unequal crossover leading to large fragment deletions of 30kb, including 9 kinds of CYP21A1P/CYP21A2 chimeric CH1-CH9 large fragment deletions caused by gene recombination between CYP21A1P and CYP21A2, and large fragment deletions caused by TNXA and Genetic recombination between TNXBs resulted in large CH1-CH3 deletions in three TNXA/TNXB chimeras3 ^. TNXA/TNXB mosaicism will lead to the deletion of the entire CYP21A2 gene, and the exchange of some exons of the TNXB gene with TNXA, resulting in loss of function, causing CAH-X. About 10% of the CAH population has CAH-X, an abnormality of connective tissue development consistent with the hyperactive Ehlers-Danlos syndrome (EDS) phenotype. Unequal crossover by homologous recombination can also generate three or more RCCX patterns, possibly associated with the p.Q318X point mutation ⁴ . At present, the most commonly used method for molecular detection of 21-OHD is to detect large fragment deletions or copy number gains through MLPA, combined with Sanger sequencing to specifically detect point ^mutations in the true gene CYP21A25. However, there is a complicated recombination relationship between CYP21A2 and CYP21A1P, that is, the characteristic base sequence of the pseudogene CYP21A1P will exist on the true gene CYP21A2, and the characteristic sequence of the true gene CYP21A2 will also exist on the pseudogene CYP21A1P, which will interfere with MLPA detection. The specificity of the needle will also interfere with the specificity of PCR amplification primers and sequencing primers during Sanger sequencing, which will lead to missed diagnosis and misdiagnosis in actual ^{detection5,6,7} . Long-segment PCR with amplification primers designed at both ends of the CYP21A1P and CYP21A2 homology regions is conducive to the specific amplification of CYP21A2 fragments, or CYP21A1P-CYP21A2 chimeras, combined with next-generation sequencing (Next-generation sequencing, NGS), can specifically detect true A point mutation in a gene. However, this method needs to construct an NGS sequencing library for each fragment, ^which is not compatible with other gene detection, the process is cumbersome, and it cannot detect multiple RCCX patterns8,9,10.

The causative gene CYP11B1 of 11β-OHD is located on chromosome 8q24.3 and consists of 9 exons and 8 introns. The mutations leading to the loss of CYP11B1 function are mainly nonsense mutations and missense mutations, mainly distributed in the coding region. CYP11B1 forms a chimeric gene, CYP11B2/CYP11B1, with its homologous gene CYP11B2 approximately 40 kb apart, resulting in glucocorticoid-repressible hyperaldosteronism; rare CYP11B2/CYP11B1 chimeric gene types may also cause CAH ^1,11 . 17α-OHD, 3β-HSD, Lipoid CAH, POR deficiency, and SCC deficiency are relatively rare. Current studies have found that the mutation types of the disease-causing genes CYP17A1, HSD3B2, StAR, POR, and CYP11A1 are mainly point ^mutations1 .

At present, methods based on qPCR, MLPA, Sanger sequencing or next-generation sequencing can realize the point mutation detection of CYP21A2 gene copy number and most CAH-related genes, but the detection mainly has the following limitations:

1. It is impossible to simultaneously detect all mutation types of all genes related to CAH in the same system;

2. Due to the possibility of multiple recombinations between the pseudogene CYP21A1P and the true gene CYP21A2, it will affect the combination of MLPA probes and the design of Sanger sequencing primers, which will lead to a certain degree of missed detection and false detection;

3. Unable to deeply analyze the recombination mode and haplotype of multiple RCCX patterns;

4. When two or more mutations exist at the same gene locus, existing methods cannot distinguish between cis and trans mutations.

Contents of the invention

In view of this, the present invention simultaneously detects multiple mutations of 9 genes related to CAH based on multiple PCR amplification and three-generation sequencing. Multiplex PCR amplification can simultaneously amplify point mutations, structural variations, and copy number mutations of 9 CAH-related genes (CYP21A2, CYP21A1P, CYP11B1, CYP11B2, CYP17A1, HSD3B2, StAR, POR, and CYP11A1) in a single reaction tube. The third-generation sequencing platform with read length and length measurement has the characteristics of read length and length measurement, which can realize accurate, rapid and high-throughput detection of CAH-related gene mutations. The method involved in the invention is easy to operate, the quality of the multiplex PCR and the third-generation library is reliable and the repeatability is strong, and it is beneficial to the application of the third-generation sequencing technology in clinical detection.

The purpose of the present invention is to solve the current problems of incomplete coverage of CAH pathogenic genes, difficulty in distinguishing between true and false genes of CYP21A2 and CYP21A1P, difficulty in detecting the copy number of the RCCX module, and inability to determine whether the mutation is linked, which will lead to missed and false detections in clinical practice. . Simultaneously amplify 12 fragments of 9 pathogenic genes related to CAH by multiplex PCR and prepare a third-generation sequencing library to achieve the goal of comprehensive, accurate and rapid detection of multiple mutations of CAH genes in multiple samples.

First of all, according to the first aspect of the present invention, the present invention relates to a primer set for simultaneously amplifying multiple mutations of 9 genes related to adrenal hyperplasia, said primer set comprising one or more pairs of primers as follows: CYP21A2 -F and CYP21A2-R, CYP21A1P-F and CYP21A1P-R, CYP11B1-F and CYP11B1-R, CYP11B1-F and CYP11B2-R, CYP17A1-F and CYP17A1-R, HSD3B2-F and HSD3B2-R, StAR-F and StAR-R, POR-F1 and POR-R1, POR-F2 and POR-R2, POR-F3 and POR-R3, CYP11A1-F1 and CYP11A1-R1, and CYP11A1-F2 and CYP11A1-R2 (primer positions are shown in the figure 1).

Wherein, the CYP21A2-F and CYP21A2-R are respectively located upstream and downstream of the genome hg38chr6:32,038,415-32,046,127; CYP21A1P-F and CYP21A1P-R are respectively located upstream and downstream of the genome hg38chr6:32,005,630-32,013,273;分别位于基因组hg38chr8:142,872,357-142,879,825的上下游，CYP11B1-F和CYP11B2-R分别位于基因组hg38chr8:142,872,357-142,917,843的上下游；CYP17A1-F和CYP17A1-R分别位于基因组hg38chr10:102,830,531-102,837,472的上下游； HSD3B2-F and HSD3B2-R are respectively located in the upstream and downstream of the genome hg38chr1:119,414,931-119,422,620; POR-F1 and POR-R1 are respectively located in the upstream and downstream of the genome hg38chr7:75,953,989-75,954,180; POR-F2 and POR-R2 are located in the genome hg38chr7: Upstream and downstream of 75,972,413-75,972,461; POR-F3 and POR-R3 are located upstream and downstream of genome hg38chr7:75,979,451-75,986,481; CYP11A1-R2 are respectively located upstream and downstream of the genome hg38chr15:74,367,317-74,365,752.

The primers can amplify the entire entire sequence within the primer range on the genome, including any type of mutant sequence within the primer range. Preferably, the amplification product of each primer is less than 15Kb. Preferably, degenerate base primers are used if there is a SNP at the primer position.

In a specific embodiment, wherein said primer sequence is shown in SEQ ID NO:1-23 in table 1.

Table 1: Primer sequences

Primer sequence number	Primer name	Primer sequence (5'-3')
SEQ ID NO:1	CYP21A2-F	CGGACACTATTGCCTGCACAGTTG
SEQ ID NO:2	CYP21A2-R	CTGCTGTGCCTGGCTATAGCAAGC
SEQ ID NO:3	CYP21A1P-F	TGAAATTCCCCAATCCTTACTTTTTGTC
SEQ ID NO:4	CYP21A1P-R	AGAAGAATGAGAGCCACTGGCCTTC
SEQ ID NO:5	CYP11B1-F	GTGTGGAAGCCTGCACCTGGATATC
SEQ ID NO:6	CYP11B1-R	GAGATGAATAATCCAAGGCTCTTGG
SEQ ID NO:7	CYP11B2-R	TGTCAAAAACCCACAGCATGTTGACC
SEQ ID NO:8	CYP17A1-F	AAGTTCCAAAGCCTTGACTCCTGAG
SEQ ID NO:9	CYP17A1-R	GTGCTCAATAAAATCGGTGTTGAAAG
SEQ ID NO:10	HSD3B2-F	GCCAAGACTCTTTATCACACTGTGG

SEQ ID NO:11	HSD3B2-R	GCCCCTGTTGCCTTCTGTATGAAG
SEQ ID NO:12	StAR-F	GGAGTTTCTGAAGACAAGGGCTAG
SEQ ID NO:13	StAR-R	TCCTGATGAGCGTGTGTACCAGTG
SEQ ID NO:14	POR-F1	TCTTGCGGTGATTACGTAGGTGCAGA
SEQ ID NO:15	POR-R1	ACTGCCTCCATTTAGCAGGTGAGGAA
SEQ ID NO:16	POR-F2	TCAGAGGTGGCTAGGGAGTGAGAAGT
SEQ ID NO:17	POR-R2	AGTGTGGGTGAACCTTGAACACGTTG
SEQ ID NO:18	POR-F3	AGCAGGGACTTGAGCATCCTTGGATT
SEQ ID NO:19	POR-R3	AGGCTTCGTGCAGTTTCTCCAGTACT
SEQ ID NO:20	CYP11A1-F1	CAGAAAGGAGCAGGACTTGGGACAGA
SEQ ID NO:21	CYP11A1-R1	AGCAGTGACATGAAAGTGTGCCATGG
SEQ ID NO:22	CYP11A1-F2	AGGCCCTAGGTTTTGGTCACACTCTC
SEQ ID NO:23	CYP11A1-R2	GCAGGAGTGGGAGGAGAAAGCACTAT

In a preferred embodiment, the primer set that can simultaneously amplify nine gene mutations can simultaneously detect at least: the large fragment deletion caused by the recombination of the CYP21A1P and CYP21A2 genes, and the large fragment caused by the recombination of the TNXA and TNXB genes Deletions, and the gene copy number increase corresponding to these deletions; large fragment deletions caused by the recombination of CYP11B1 and CYP11B2 genes; 951 point mutations on the CYP21A2 gene shown in Table 2; 138 point mutations on the CYP11B1 gene 114 kinds of point mutations on the HSD3B2 gene as shown in Table 4; 128 kinds of point mutations on the CYP17A1 gene as shown in Table 5; 136 kinds of point mutations on the StAR gene as shown in Table 6; 248 kinds of point mutations on the POR gene shown in Table 7; 62 kinds of point mutations on the CYP11A1 gene shown in Table 8.

Among them, the point mutations and structural variations at the gene loci described in this article can be queried in LOVD, ClinVar and references; see Table 2-8 for detailed mutation information.

Table 2: 951 point mutations in CYP21A2 gene that can be detected

Table 3: Detectable 138 point mutations in the CYP11B1 gene

Table 4: Detectable 114 point mutations of HSD3B2 gene

Table 5: 128 point mutations in CYP17A1 gene that can be detected

Table 6: 136 point mutations in StAR gene that can be detected

c.-70G>T	c.158G>T	c.375G>A	c.577C>T	c.772C>T	c.*768G>A
c.-16C>T	c.161G>T	c.411C>T	c.624C>T	c.779T>C	c.*796A>G
c.8_9del	c.177C>T	c.429A>G	c.629_630del	c.784del	c.*817C>T
c.33del	c.178+1G>C	c.433G>A	c.650G>C	c.791A>G	c.*818G>A
c.42C>A	c.178+2dup	c.441G>A	c.650+7C>A	c.792G>A	c.*880C>T
c.58A>T	c.178+7G>A	c.465+20A>G	c.650+8G>A	c.801dup	c.*897C>T
c.64+1G>A	c.178+9T>C	c.466-11T>A	c.650+13G>T	c.811del	c.*913C>T
c.64+1G>T	c.179-14G>A	c.466-5G>A	c.651-1G>C	c.814C>T	c.*930C>T
c.64+2T>C	c.179-2A>G	c.481G>A	c.653C>T	c.820C>T	c.*948del
c.64+9T>C	c.189G>A	c.484A>C	c.661G>A	c.824T>C	c.*965_*967dup
c.76C>T	c.197_198CT	c.487G>C	c.677del	c.*88G>C	c.*967del
c.102G>A	c.219G>A	c.489T>C	c.687G>A	c.*93C>T	c.*981A>G
c.108C>T	c.229C>T	c.504C>T	c.693T>G	c.*116T>G	c.*987A>G
c.120G>A	c.289_291AAG	c.505G>A	c.695del	c.*187T>C	c.*1122T>A
c.125dup	c.290del	c.544C>T	c.714del	c.*230A>G	c.*1384del
c.135del	c.296_297AG	c.545G>A	c.716_732del	c.*348C>T	c.*1472C>T
c.141G>A	c.306+10G>A	c.545G>T	c.719del	c.*395G>A	c.*1473G>A
c.144G>A	c.307-1G>A	c.556A>G	c.720G>T	c.*456C>T	c.*1513C>G
c.149_157del	c.312T>C	c.559G>A	c.731G>A	c.*550A>C	c.*1524A>G
c.153G>A	c.315G>C	c.562C>T	c.745-1G>C	c.*556A>G	c.*1543C>A
c.157C>G	c.324G>A	c.563G>A	c.745-1_757del	c.*688C>T	c.*1557A>G
c.158G>C	c.361C>T	c.569C>T	c.749G>A	c.*698C>A	c.*5285C>T
the	the	c.574C>T	c.759G>A	c.*699C>G	1-BP DEL,261T

Table 7: Detectable 248 point mutations of POR gene

Table 8: Detectable 62 point mutations of CYP11A1 gene

c.23C>T	c.280G>A	c.438C>T	c.589G>C	c.835del	c.1099A>T
c.25C>T	c.288G>A	c.440G>A	c.625+2dup	c.915C>G	c.1158-5C>T
c.86G>A	c.358C>T	c.451C>T	c.625+15A>G	c.937T>C	c.1158-4G>A
c.93G>A	c.366C>T	c.508_509del	c.650A>C	c.939C>T	c.1164C>T
c.106G>A	c.371C>T	c.534C>T	c.665T>C	c.940G>A	c.1167C>T
c.149A>G	c.391C>T	c.535G>A	c.753C>G	c.968T>A	c.1201G>A
c.235G>A	c.417C>T	c.555C>T	c.757G>C	c.999G>A	c.1244T>A
c.261G>A	c.422T>G	c.566C>T	c.809_814dup	c.1057C>T	c.1290C>T
c.269+4A>G	c.425+1G>A	c.567G>A	c.829+3G>C	c.1073C>T	c.1294C>T
c.270-9C>T	c.426-47G>A	c.573C>T	c.830-14C>G	c.1076C>T	c.1295C>T

the

the

the

the

c.1091A>G

c.1402G>A

In a preferred embodiment, the primer set of the present invention can simultaneously detect and detect pseudogene CYP21A1P-TNXA, true gene CYP21A2-TNXB and true and false gene recombination products CYP21A1P-CYP21A2-TNXB, CYP21A2-CYP21A1P-TNXA and CYP21A2-TNXA Copy number; also detects mutations resulting from recombination between the CYP11B1 and CYP11B2 genes.

In one embodiment, DNA of 5-50nt different sequences can be added at the 5' end of the primers, i.e. DNA barcode (Barcode), used to distinguish different samples; preferably, the 5' end Barcode of F and R primers Can be the same or different, those skilled in the art can choose according to needs.

In a preferred experimental scheme, the primer set is used for multiplex PCR to amplify 12 fragments of 9 genes; it can also be used to detect whether different mutations in a single amplified gene fragment are linked.

The primer set of the present invention can be used for multiple primer PCR amplification including CAH-related pathogenic gene fragments of mutation types within the range of all primers. Combined with the subsequent PacBio or Nanopore sequencing platform, it can detect the mutation types of all gene fragments within the primer range.

According to the second aspect of the present invention, a kit that can simultaneously detect multiple mutations of 9 genes related to CAH is provided, including the following reagents:

(1) Reagents for multiplex PCR amplification;

(2) Reagents for constructing third-generation sequencing libraries.

In one embodiment, the reagents for multiplex PCR amplification include DNA polymerase, reaction buffer and primer set.

In a preferred embodiment, the primer set in the kit is selected from one or more primer pairs in the following 23 primers:

CYP21A2-F and CYP21A2-R, CYP21A1P-F and CYP21A1P-R, CYP11B1-F and CYP11B1-R, CYP11B1-F and CYP11B2-R, CYP17A1-F and CYP17A1-R, HSD3B2-F and HSD3B2-R, StAR- F and StAR-R, POR-F1 and POR-R1, POR-F2 and POR-R2, POR-F3 and POR-R3, CYP11A1-F1 and CYP11A1-R1, and CYP11A1-F2 and CYP11A1-R2 (primer positions are as follows Figure 1).

Wherein, the CYP21A2-F and CYP21A2-R are respectively located upstream and downstream of the genome hg38chr6:32,038,415-32,046,127; CYP21A1P-F and CYP21A1P-R are respectively located upstream and downstream of the genome hg38chr6:32,005,630-32,013,273;分别位于基因组hg38chr8:142,872,357-142,879,825的上下游，CYP11B1-F和CYP11B2-R分别位于基因组hg38chr8:142,872,357-142,917,843的上下游；CYP17A1-F和CYP17A1-R分别位于基因组hg38chr10:102,830,531-102,837,472的上下游； HSD3B2-F and HSD3B2-R are respectively located in the upstream and downstream of the genome hg38chr1:119,414,931-119,422,620; POR-F1 and POR-R1 are respectively located in the upstream and downstream of the genome hg38chr7:75,953,989-75,954,180; POR-F2 and POR-R2 are located in the genome hg38chr7: Upstream and downstream of 75,972,413-75,972,461; POR-F3 and POR-R3 are located upstream and downstream of genome hg38chr7:75,979,451-75,986,481; CYP11A1-R2 are respectively located upstream and downstream of the genome hg38chr15:74,367,317-74,365,752. The primers can amplify the entire entire sequence within the primer range, including any type of mutant sequence within the primer range.

Preferably, the amplification product of each primer is less than 15Kb. Preferably, degenerate base primers are used if there is a SNP at the primer position.

In a preferred embodiment, wherein said primer sequence is shown in SEQ ID NO:1-23 in table 1.

In a preferred embodiment, DNA (Barcode) of 5-50nt different sequences can be added to the 5' end of the primer in the kit to distinguish different samples; preferably, the 5' end of the F and R primers The terminal Barcodes can be the same or different, and those skilled in the art can choose according to needs.

In one embodiment, for the kit, the PCR amplification product can be purified or not purified before the next step reaction, and those skilled in the art can choose according to needs.

In another embodiment, in the kit, the reagents for constructing a three-generation sequencing library include end repair enzymes, adapters, ligases, DNA purification magnetic beads, reaction buffers and exonucleases.

In a preferred embodiment, the kit can at least simultaneously detect: large fragment deletions caused by CYP21A1P and CYP21A2 gene recombination, large fragment deletions caused by TNXA and TNXB gene recombination, and gene copies corresponding to these deletions The large fragment deletion caused by the recombination of CYP11B1 and CYP11B2 genes; 951 kinds of point mutations on the CYP21A2 gene as shown in Table 2; 138 kinds of point mutations on the CYP11B1 gene as shown in Table 3; 114 point mutations on the HSD3B2 gene; 128 point mutations on the CYP17A1 gene as shown in Table 5; 136 point mutations on the StAR gene as shown in Table 6; 248 on the POR gene as shown in Table 7 62 kinds of point mutations on the CYP11A1 gene as shown in Table 8.

Among them, the point mutations and structural variations at the gene loci described in this article can be queried in LOVD, ClinVar and references; see Table 2-8 for detailed mutation information.

In a preferred embodiment, said kit can simultaneously detect pseudogene CYP21A1P-TNXA, true gene CYP21A2-TNXB and true and false gene recombination products CYP21A1P-CYP21A2-TNXB, CYP21A2-CYP21A1P-TNXA and CYP21A2-TNXA copy number; can also detect mutations caused by recombination between the CYP11B1 and CYP11B2 genes.

In a preferred experimental scheme, the primer set is used for multiplex PCR to amplify 12 fragments of 9 genes; it can also be used to detect whether different mutations in a single amplified gene fragment are linked.

In a specific embodiment, wherein for said kit, multiplex PCR amplification is accomplished in a single reaction tube.

In a preferred embodiment, the third-generation sequencing is selected from PacBio sequencing of Pacific Biosciences or Nanopore sequencing of ONT.

In a specific embodiment, blunt-end ligation or TA ligation can be used for PacBio library adapter ligation.

In a specific embodiment, the PacBio universal blunt-end linker sequence is 5'-pATCTCTCTCTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT-3' (SEQ ID NO: 24), which forms a blunt-end stem-loop adapter adapter by annealing. DNA (Barcode) with different sequences of 5-50 nt can be added to the stem to form adapter adapters with different Barcodes. PacBio libraries with different Barcodes can be mixed together for sequencing.

In a specific embodiment, the PacBio universal TA linker sequence is 5'-pATCTCTCTCTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGATT-3' (SEQ ID NO: 25), which forms a blunt-end stem-loop adapter adapter by annealing. DNA (Barcode) with different sequences of 5-50 nt can be added to the stem to form adapter adapters with different Barcodes. PacBio libraries with different Barcodes can be mixed together for sequencing.

In one embodiment, PacBio adapters can be provided with or without Barcode. Preferably, the PacBio linker has a Barcode designed by PacBio Company or a Barcode designed by itself, which can be selected by those skilled in the art according to needs.

In a preferred embodiment, the PacBio library is matched to the Pacific Biosciences sequencing platform.

In a preferred embodiment, the reagents for constructing the three-generation Nanopore library include end repair enzymes, adapters, ligases, DNA purification magnetic beads, 80% ethanol and reaction buffer.

In one embodiment, the adapter ligation of the Nanopore library can use blunt end ligation or TA ligation.

In one embodiment, the Nanopore linker can be with or without Barcode. Preferably, the Nanopore connector has a Barcode designed by ONT or a self-designed Barcode, which can be selected by those skilled in the art according to needs.

In a preferred embodiment, the Nanopore library is matched with the ONT company's sequencing platform.

The third aspect of the present invention provides a system for simultaneously detecting multiple mutations of 9 genes related to congenital adrenal hyperplasia, including the following parts:

(1) Collection module: capable of obtaining subject samples;

(2) Amplification module: multiplex PCR amplifies 9 genes in the sample, the genes are CYP21A2, CYP21A1P, CYP11B1, CYP11B2, CYP17A1, HSD3B2, StAR, POR and CYP11A1;

(3) Library construction module: construct a third-generation sequencing library;

(4) Sequencing module: sequence and analyze gene mutation types;

The primer set used for multiplex PCR amplification is the primer set described above in the present invention.

In some embodiments, in the amplification module of the system, the multiplex PCR amplification is completed in a single reaction tube.

In some embodiments, the third-generation sequencing is selected from PacBio sequencing of Pacific Biosciences or Nanopore sequencing of Oxford Nanopore Technologies (ONT).

In another aspect, the present invention provides a method for simultaneously detecting multiple mutations of 9 genes related to congenital adrenal hyperplasia, comprising the following steps:

(1) Preparation of subject samples;

(2) multiplex PCR amplification of 9 genes in the sample, the genes being CYP21A2, CYP21A1P, CYP11B1, CYP11B2, CYP17A1, HSD3B2, StAR, POR and CYP11A1;

(3) Construction of a third-generation sequencing library;

(4) Sequencing and analyzing the type of gene mutation.

In one embodiment, the multiplex PCR primer set used in the method of the invention is selected from the primer sets as described above. Preferably, 5-50 nt DNA (Barcode) of different sequences can be added to the 5' end of the above-mentioned primers to distinguish different samples.

In a preferred embodiment, the Barcodes of the 5' ends of the F and R primers can be the same or different, and those skilled in the art can choose according to needs.

In a preferred embodiment, the method described herein can at least simultaneously detect: large fragment deletions caused by CYP21A1P and CYP21A2 gene recombination, large fragment deletions caused by TNXA and TNXB gene recombination, and gene copy numbers corresponding to these deletions increase; large fragment deletions caused by recombination of CYP11B1 and CYP11B2 genes; 951 point mutations on the CYP21A2 gene as shown in Table 2; 138 point mutations on the CYP11B1 gene as shown in Table 3; HSD3B2 as shown in Table 4 114 kinds of point mutations on the gene; 128 kinds of point mutations on the CYP17A1 gene as shown in Table 5; 136 kinds of point mutations on the StAR gene as shown in Table 6; 248 kinds on the POR gene as shown in Table 7 Point mutation; 62 kinds of point mutations on the CYP11A1 gene as shown in Table 8.

Among them, the point mutations and structural variations at the gene loci described in this article can be queried in LOVD, ClinVar and references; see Table 2-8 for detailed mutation information.

In a preferred embodiment, wherein said method can simultaneously detect pseudogene CYP21A1P-TNXA, true gene CYP21A2-TNXB and true and false gene recombination products CYP21A1P-CYP21A2-TNXB, CYP21A2-CYP21A1P-TNXA and CYP21A2-TNXA Copy number; also detects mutations resulting from recombination between the CYP11B1 and CYP11B2 genes.

In a preferred experimental scheme, the primer set is used for multiplex PCR to amplify 12 fragments of 9 genes; it can also be used to detect whether different mutations in a single amplified gene fragment are linked.

In a preferred embodiment, wherein said method, multiplex PCR amplification is accomplished in a single reaction tube.

In one embodiment, wherein the sample is selected from a biological sample or gDNA extracted from a sample. The biological sample is selected from cultured cell lines, blood, amniotic fluid, villi, gametes, blastocyst cells, joint fluid, urine, sweat, saliva, feces, cerebrospinal fluid, ascites, pleural effusion, bile or pancreatic fluid, etc.

In a specific embodiment, the third-generation sequencing of the method is selected from PacBio sequencing of Pacific Biosciences or Nanopore sequencing of ONT.

In one embodiment, blunt-end ligation or TA ligation can be used for PacBio library adapter ligation.

In one embodiment, the PacBio universal blunt-end linker sequence is 5'-pATCTCTCTCTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT-3' (SEQ ID NO: 24), which forms a blunt-end stem-loop adapter adapter by annealing. DNA (Barcode) with different sequences of 5-50 nt can be added to the stem to form adapter adapters with different Barcodes. PacBio libraries with different Barcodes can be mixed together for sequencing.

In one embodiment, the PacBio universal TA linker sequence is 5'-pATCTCTCTCTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGATT-3' (SEQ ID NO: 25), which forms a blunt-ended stem-loop adapter adapter by annealing. DNA (Barcode) with different sequences of 5-50 nt can be added to the stem to form adapter adapters with different Barcodes, and PacBio libraries with different Barcodes can be mixed together for sequencing.

In one embodiment, PacBio adapters can be provided with or without Barcode. In a preferred embodiment, the PacBio linker has a Barcode designed by PacBio Company or a Barcode designed by itself. Those skilled in the art can choose as needed.

In a preferred embodiment, the PacBio library is matched to the Pacific Biosciences sequencing platform.

In a preferred embodiment, the reagents for constructing the three-generation Nanopore library include end repair enzymes, adapters, ligases, DNA purification magnetic beads, 80% ethanol and reaction buffer.

In one embodiment, the adapter ligation of the Nanopore library can use blunt end ligation or TA ligation.

In one embodiment, the Nanopore linker can be with or without Barcode, and those skilled in the art can choose according to their needs. Preferably, the Nanopore connector has a Barcode designed by ONT or a self-designed Barcode, which can be selected by those skilled in the art according to needs.

In a preferred embodiment, the Nanopore library is matched with the ONT company's sequencing platform.

The method of the present invention based on the specific combination of long-fragment multiplex PCR amplification and third-generation high-throughput sequencing can realize the simultaneous detection of a variety of nine pathogenic genes related to CAH in multiple samples with high specificity, accuracy and speed. mutation.

The excellent technical effects of the method and kit of the present invention mainly lie in the following aspects:

(1) Wide detection range. The invention can simultaneously detect the mutations of all genes related to CAH found in current research. Including large fragment deletions caused by CYP21A1P and CYP21A2 gene recombination, large fragment deletions caused by TNXA and TNXB gene recombination, and gene copy number increase corresponding to these deletions; large fragment deletions caused by CYP11B1 and CYP11B2 gene recombination; 951 CYP21A2 genes 138 point mutations in CYP11B1 genes; 114 point mutations in HSD3B2 genes; 128 point mutations in CYP17A1 genes; 136 point mutations in StAR genes; 248 point mutations in POR genes; 62 A point mutation in the CYP11A1 gene. At the same time, due to the characteristics of the third-generation sequencing read length measurement, the present invention can also detect whether different mutations are linked.

(2) Single-tube detection of multiple mutation types. The traditional method needs to set up a detection system for each mutation type, but the present invention simultaneously detects multiple mutations in a reaction primer system, including SNV, Indel, gene recombination and copy number variation.

(3) The rate of false detection and missed detection is low. At present, the common method for detecting CYP21A2, the most common causative gene of CAH, is MLPA combined with Sanger sequencing. Since the homology between the true gene CYP21A2 and the pseudogene CYP21A1P exceeds 96%, and multiple recombinations will occur between the genes, the characteristic sites between the true and false genes are not specific, which will interfere with the Sanger sequencing results. However, the present invention directly amplifies the full-length fragments of CYP21A1, CYP21A1P and recombinant genes without the risk of false detection or missed detection.

(4) Sample diversification. Templates for PCR can be peripheral blood, dried blood spots or extracted genomic DNA, or human cell lines or other specific tissues.

(5) High-throughput detection. Three-generation sequencing can realize 384 kinds of Barcode connectors, and actually more kinds of Barcode connectors can be designed according to needs. Or use the double Barcode of the primer with Barcode and the adapter with Barcode to achieve more Barcode combinations. The high-throughput characteristics of the third-generation sequencing platform determine that high-throughput sample detection can be achieved.

(6) High precision. PacBio's dumbbell-shaped library can be read for multiple rounds during sequencing, and the base accuracy of the corrected sequencing results is greater than 99%. Moreover, PacBio's sequencing errors are random, and the accuracy of base correction by sequencing depth is greater than 99.9%. Therefore, gene mutations within the detection range of the primers can be accurately interpreted.

(7) The detection time is flexible. The Nanopore platform can generate data within minutes, and start data analysis within minutes or hours according to the actual data volume requirements. When the requirements for detection timeliness are relatively high, the Nanopore platform has a time advantage.

Description of drawings

Figure 1: Schematic diagram of multiplex PCR primer design.

Figure 2: DNA gel electrophoresis images of different samples amplified according to the multiplex PCR method in Example 1.

Figure 3A to Figure 3E: PacBio sequencing results of representative CAH-related gene mutation samples, in which Figure 3A is the CYP21A2 point mutation sample; Figure 3B is the CYP21A2 large fragment deletion sample; Figure 3C is the CYP21A2 multi-copy sample; Figure 3D is the HSB3D point Mutation samples; Figure 3E is a CYP17A1 point mutation sample.

Detailed ways

Embodiment 1: Utilize the multiplex PCR method of the present invention to amplify CAH-associated gene mutation

Prepare the reaction system according to Table 9 below to amplify peripheral blood, dried blood spots and genomic DNA samples.

Table 9: Reaction system

On the PCR instrument, perform pre-amplification according to the conditions shown in Table 10 below:

Table 10: Reaction Program

After the amplification was completed, 5 ul of each sample was taken and detected on a 1% DNA gel. The results are shown in FIG. 2 , using different samples as templates, CAH-related genes can be effectively amplified.

Example 2: Construction of a PacBio sequencing library using the multiplex PCR method involved in the present invention

Step 1: Multiplex PCR Amplification

Prepare the reaction system according to the following table 11, and amplify the peripheral blood samples of different types of CAH-related gene mutations:

Table 11: PCR system

On the PCR instrument, perform pre-amplification according to the conditions shown in Table 12 below:

Table 12: PCR program

After the amplification is completed, put the amplification product into a centrifuge, centrifuge at 10000rpm for 20min. After the centrifugation, place it horizontally, take 4 μL of the supernatant and add it to a new tube.

Step 2: Construct the PacBio sequencing library

Prepare reaction system according to following table 13:

Table 13: Reaction System

On the PCR instrument, react according to the following conditions: 37°C for 20 minutes; 25°C for 15 minutes; 65°C for 10 minutes. After the reaction is complete, add 0.5 μL Exonuclease III (NEB, Cat#M0206L) and 0.5 μL Exonuclease VII (NEB, Cat#M0379L), and continue to react at 37°C for 1 hour. Purify twice with 0.6x Ampure PB magnetic beads (PacBio, Cat#100-265-900) according to the manufacturer's instructions, and finally elute the DNA with 10uL Elution Buffer. The resulting DNA eluate is the target DNAPacBio sequencing library. DNA concentration was determined on a Qubit 3 Fluoromter (ThermoFisher, Cat#Q33216) with Qubit dsDNA HS reagent (ThermoFisher, Cat#Q32851). When there are multiple sample PacBio sequencing libraries, equal amounts of libraries can be mixed together to prepare a mixed library.

Step 3: PacBio on-machine sequencing and analysis

According to the total concentration and molar concentration of the library, react an appropriate volume of the library with the binding reagent (PacBio, Cat#101-820-200) and primers (PacBio, Cat#100-970-100) to prepare the final machine-readable library . Representative sequencing results are shown in Figure 3, Figure 3A CYP21A2 point mutation samples, Figure 3B CYP21A2 large fragment deletion samples, Figure 3C CYP21A2 multi-copy samples, Figure 3D HSB3D point mutation samples, Figure 3E CYP17A1 point mutation samples.

Example 3: Detection and verification of CAH-related gene mutations

The heel blood of 14 subjects and the peripheral blood genomic DNA of 11 subjects were collected from Hunan Jiahui Genetics Specialized Hospital as 25 cases of verification samples. With reference to Example 2, the primer set (and kit) of the present invention was used to simultaneously Multiple mutations in 9 gene loci related to CAH were detected. At the same time, the copy number of CYP21A2 gene was detected by MLPA method, and the point mutation of related genes was detected by Sanger sequencing. The results obtained by using the present invention are compared with the control results, the results are shown in Table 14, and the results of 25 samples are completely consistent.

Table 14: Detection results of CAH-related gene mutations

Therefore, the specificity and sensitivity of the results detected by the method of the present invention can reach 100% after comparing with the MLPA combined with PCR-Sanger sequencing method. Moreover, among the 25 samples, 10 samples have determined the range of large fragment deletions through the method of the present invention, or clarified the cis-trans relationship between different mutation points.

It should be noted that although some features of the present invention have been clarified through the above examples, they cannot be used to limit the present invention. For those skilled in the art, the present invention can have various modifications and changes. The reaction reagents and reaction conditions involved in the multiplex PCR reaction and the construction of the third-generation sequencing library can be adjusted and changed according to specific needs. Therefore, for those skilled in the art, without departing from the idea and principle of the present invention, some simple replacements can also be made, and these should be included in the protection scope of the present invention.

references

[1]Fady Hannah-Shmouni,Wuyan Chen,Deborah P Merke.Endocrinol Metab Clin North Am.Genetics of Congenital Adrenal Hyperplasia.2017Jun;46(2):435-458.doi:10.1016/j.ecl.2017.01.008

[2] National Health Commission Clinical Laboratory Center for Newborn Inherited Metabolic Disease Screening External Quality Evaluation Committee. Expert consensus on laboratory testing techniques for screening and diagnosis of neonatal congenital adrenal hyperplasia. Chinese Journal of Laboratory Medicine, Volume 42, Issue 12, December 2019.

[3]Merke DP,Auchus RJ.Congenital Adrenal Hyperplasis Due to21-Hydroxylase Deficiency.N Engl J Med.2020Sep24;383(13):1248-1261.doi:10.1056/NEJMra1909786.

[4]Maria I New 1, Moolamannil Abraham, Brian Gonzalez, Miroslav Dumic, Maryam Razzaghy-Azar, David Chitayat, Li Sun, Mone Zaidi, Robert C Wilson, Tony Yuen. Genotype-phenotype correlation in1, 507families with congenital parenal hyperingper to 21-hydroxylase deficiency.Proc Natl Acad Sci U S A.2013Feb 12;110(7):2611-6.doi:10.1073/pnas.1300057110.

[5] Duarte Pignatelli, Berta L Carvalho, Aida Palmeiro, Alberto Barros, Susana G Guerreiro, Djuro Macut. The Complexities in Genotyping of Congenital Adrenal Hyperplasia: 21-Hydroxylase Deficiency. Front Endocrinol (Lausanne:). 420J; doi:10.3389/fendo.2019.00432.

[6]Paola Concolino. Issues with the Detection of Large Genomic Rearrangements in Molecular Diagnosis of 21-Hydroxylase Deficiency. Mol Diagn Ther.2019Oct; 23(5):563-567.doi:10.1007/s40291-z-415

[7] Wuyan Chen, Zhi Xu, Annie Sullivan, Gabriela P Finkielstain, Carol Van Ryzin, Deborah P Merke, Nazli B McDonnell. Junction site analysis of chimeric CYP21A1P/CYP21A2 genes in 21-hydroxylase. (2):421-30.doi:10.1373/clinchem.2011.174037.

[8] Hsien-Hsiung Lee. Mutational analysis of CYP21A2 gene and CYP21A1P pseudogene: long-range PCR on genomic DNA. Methods Mol Biol. 2014; 1167:275-87.doi:10.1007/978-1-4939-1935-6_ .

[9]Christopher N Greene,Suzanne K Cordovado,Daniel P Turner,Lisa M Keong,Dorothy Shulman,Patricia W Mueller.Novel method to characterize CYP21A2 in Florida patients with congenital adrenal hyperplasia and commercially available cell lines.Mol Genet Metab Rep.2014 Aug 8; 1:312-323.doi:10.1016/j.ymgmr.2014.07.002.

[10] Wencui Wang, Rulai Han, Zuwei Yang, Sichang Zheng, Haorong Li, Zhihan Wan, Yan Qi, Shouyue Sun, Lei Ye, Guang Ning. Targeted gene panel sequencing for molecular diagnosis of congenital adrenal hyperplasia. J Bio M Steroid .2021 Apr 14;211:105899.doi:10.1016/j.jsbmb.2021.105899.

[11] M Hampf, N T Dao, N T Hoan, R Bernhardt. Unequal crossing-over between aldosterone synthase and 11beta-hydroxylase genes causes congenital adrenal hyperplasia. J Clin Endocrinol Metab. 2001 Sep; 86(9): 4445-52 doi:10.1210/jcem.86.9.7820.

Claims (21)

1. A primer set, which is used to simultaneously amplify multiple mutations of 9 genes related to adrenal hyperplasia; wherein the primer set comprises one or more primer pairs as follows:

   CYP21A2-F and CYP21A2-R;

   CYP21A1P-F and CYP21A1P-R;

   CYP11B1-F and CYP11B1-R;

   CYP11B1-F and CYP11B2-R;

   CYP17A1-F and CYP17A1-R;

   HSD3B2-F and HSD3B2-R;

   StAR-F and StAR-R;

   POR-F1 and POR-R1;

   POR-F2 and POR-R2;

   POR-F3 and POR-R3;

   CYP11A1-F1 and CYP11A1-R1; and,

   CYP11A1-F2 and CYP11A1-R2;

   Wherein, the CYP21A2-F and CYP21A2-R are respectively located upstream and downstream of the genome hg38 chr6:32,038,415-32,046,127;

   CYP21A1P-F and CYP21A1P-R are respectively located upstream and downstream of the genome hg38 chr6:32,005,630-32,013,273;

   CYP11B1-F and CYP11B1-R are respectively located upstream and downstream of genome hg38 chr8:142,872,357-142,879,825;

   CYP11B1-F and CYP11B2-R are respectively located upstream and downstream of the genome hg38 chr8:142,872,357-142,917,843;

   CYP17A1-F and CYP17A1-R are respectively located upstream and downstream of the genome hg38 chr10:102,830,531-102,837,472;

   HSD3B2-F and HSD3B2-R are respectively located in the upstream and downstream of the genome hg38 chr1:119,414,931-119,422,620;

   POR-F1 and POR-R1 are respectively located upstream and downstream of genome hg38 chr7:75,953,989-75,954,180;

   POR-F2 and POR-R2 are respectively located in the upstream and downstream of the genome hg38 chr7:75,972,413-75,972,461;

   POR-F3 and POR-R3 are respectively located upstream and downstream of the genome hg38 chr7:75,979,451-75,986,481;

   CYP11A1-F1 and CYP11A1-R1 are located upstream and downstream of genome hg38 chr15:74,337,972-74,348,055, respectively; and,

   CYP11A1-F2 and CYP11A1-R2 are located upstream and downstream of hg38 chr15:74,367,317-74,365,752 in the genome, respectively.
2. The primer set according to claim 1, wherein the primer set can simultaneously detect multiple mutations in the primer range, and the mutations at least include:

   Large fragment deletions caused by CYP21A1P and CYP21A2 gene recombination, large fragment deletions caused by TNXA and TNXB gene recombination, and gene copy number increase corresponding to these deletions; large fragment deletions caused by CYP11B1 and CYP11B2 gene recombination; as shown in Table 2 951 kinds of point mutations on the CYP21A2 gene; 138 kinds of point mutations on the CYP11B1 gene as shown in Table 3; 114 kinds of point mutations on the HSD3B2 gene as shown in Table 4; 128 kinds of point mutations on the CYP17A1 gene as shown in Table 5 136 kinds of point mutations on the StAR gene as shown in Table 6; 248 kinds of point mutations on the POR gene as shown in Table 7; 62 kinds of point mutations on the CYP11A1 gene as shown in Table 8.
3. The primer set according to claim 1, wherein the primers CYP21A2-F, CYP21A2-R, CYP21A1P-F, CYP21A1P-R, CYP11B1-F, CYP11B1-R, CYP11B2-R, CYP17A1-F, CYP17A1-R, HSD3B2-F, HSD3B2-R, StAR-F, StAR-R, POR-F1, POR-R1, POR-F2, POR-R2, POR-F3, POR-R3, CYP11A1-F1, CYP11A1-R1, CYP11A1- The sequences of F2 and CYP11A1-R2 are respectively shown in SEQ ID NO: 1-23.
4. The primer set according to any one of claims 1-3, wherein the primers add 5-50nt DNA of different sequences at the 5' end, i.e. DNA barcodes, for distinguishing different samples.
5. The primer set according to any one of claims 1-3, wherein the primer set can be used to detect whether different mutations in the amplified product fragments are linked.
6. A kit capable of simultaneously detecting multiple mutations of 9 genes related to adrenal hyperplasia, comprising the following reagents:

   (1) Reagents for multiplex PCR amplification;

   (2) Reagents for constructing third-generation sequencing libraries;

   Wherein the 9 genes related to adrenal hyperplasia are CYP21A2, CYP21A1P, CYP11B1, CYP11B2, CYP17A1, HSD3B2, StAR, POR and CYP11A1;

   The reagents for multiplex PCR amplification include the primer set according to any one of claims 1-3.
7. The kit according to claim 6, wherein multiple mutations of 9 genes related to adrenal hyperplasia can be detected simultaneously, and said mutations at least include:

   Large fragment deletions caused by CYP21A1P and CYP21A2 gene recombination, large fragment deletions caused by TNXA and TNXB gene recombination, and gene copy number increase corresponding to these deletions; large fragment deletions caused by CYP11B1 and CYP11B2 gene recombination; as shown in Table 2 951 kinds of point mutations on the CYP21A2 gene; 138 kinds of point mutations on the CYP11B1 gene as shown in Table 3; 114 kinds of point mutations on the HSD3B2 gene as shown in Table 4; 128 kinds of point mutations on the CYP17A1 gene as shown in Table 5 136 kinds of point mutations on the StAR gene as shown in Table 6; 248 kinds of point mutations on the POR gene as shown in Table 7; 62 kinds of point mutations on the CYP11A1 gene as shown in Table 8.
8. The kit according to claim 6, wherein the kit is used to detect whether different mutations in the same amplified fragment are linked.
9. The kit according to claim 6, wherein the reagents for multiplex PCR amplification also include DNA polymerase and reaction buffer.
10. The kit according to claim 9, wherein the reagents for constructing a three-generation sequencing library include adapters, ligase, DNA purification magnetic beads, reaction buffer and exonuclease.
11. The kit according to claim 6, wherein said multiplex PCR amplification is completed in a single reaction tube.
12. The kit according to claim 6, wherein the third-generation sequencing is selected from the PacBio sequencing of Pacific Biosciences or the Nanopore sequencing of Oxford Nanopore Technologies (ONT).
13. A system for simultaneously detecting multiple mutations in 9 genes related to congenital adrenal hyperplasia, including the following parts:

    (1) Collection module: capable of obtaining subject samples;

    (2) Amplification module: multiplex PCR amplifies fragments of 9 genes in the sample, the genes are CYP21A2, CYP21A1P, CYP11B1, CYP11B2, CYP17A1, HSD3B2, StAR, POR and CYP11A1;

    (3) Library construction module: construct a third-generation sequencing library;

    (4) Sequencing module: sequence and analyze gene mutation types;

    Wherein the primer set for multiplex PCR amplification is the primer set according to any one of claims 1-3.
14. The system of claim 13, wherein the multiplex PCR amplification is accomplished in a single reaction tube.
15. The system according to claim 13, wherein the third-generation sequencing is selected from the PacBio sequencing of Pacific Biosciences or the Nanopore sequencing of Oxford Nanopore Technologies (ONT).
16. A method for simultaneously detecting multiple mutations of 9 genes related to congenital adrenal hyperplasia, comprising the following steps:

    (1) Preparation of subject samples;

    (2) multiplex PCR amplification of fragments of 9 genes in the sample, the 9 genes being CYP21A2, CYP21A1P, CYP11B1, CYP11B2, CYP17A1, HSD3B2, StAR, POR and CYP11A1;

    (3) Construction of a third-generation sequencing library;

    (4) Sequencing and analyzing the type of gene mutation;

    Wherein the primer set for multiplex PCR amplification is the primer set according to any one of claims 1-3.
17. The method according to claim 16, characterized in that the mutations of 9 genes related to adrenal hyperplasia are detected at the same time, and the mutations at least include one or more of the following:

    Nine large fragment deletions from CH-1 to CH-9 caused by CYP21A1P and CYP21A2 gene recombination, three large fragment deletions from CH-1 to CH-3 caused by TNXA and TNXB gene recombination, and the gene copies corresponding to these deletions The large fragment deletion caused by the recombination of CYP11B1 and CYP11B2 genes; 951 kinds of point mutations on the CYP21A2 gene as shown in Table 2; 138 kinds of point mutations on the CYP11B1 gene as shown in Table 3; 114 point mutations on the HSD3B2 gene; 128 point mutations on the CYP17A1 gene as shown in Table 5; 136 point mutations on the StAR gene as shown in Table 6; 248 on the POR gene as shown in Table 7 62 kinds of point mutations on the CYP11A1 gene as shown in Table 8.
18. The method according to claim 16, wherein the method utilizes a combination method of sequencing sequence, haplotype and reads ratio to analyze the copy numbers of the true gene CYP21A2, the pseudogene CYP21A1P and the true and false fusion genes.
19. The method according to claim 16, wherein the method is used to detect whether different mutations within the same amplified fragment are linked.
20. The method of claim 16, wherein the multiplex PCR amplification is performed in a single reaction tube.
21. The method according to claim 16, wherein the third-generation sequencing is selected from the PacBio sequencing of Pacific Biosciences or the Nanopore sequencing of Oxford Nanopore Technologies (ONT).

Images