WO2023042888A1 - 認知機能低下、または過体重もしくは肥満症を処置することに用いるための医薬組成物 - Google Patents

認知機能低下、または過体重もしくは肥満症を処置することに用いるための医薬組成物 Download PDF

Info

Publication number
WO2023042888A1
WO2023042888A1 PCT/JP2022/034602 JP2022034602W WO2023042888A1 WO 2023042888 A1 WO2023042888 A1 WO 2023042888A1 JP 2022034602 W JP2022034602 W JP 2022034602W WO 2023042888 A1 WO2023042888 A1 WO 2023042888A1
Authority
WO
WIPO (PCT)
Prior art keywords
mice
hfd
nmda
pharmaceutical composition
subject
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/JP2022/034602
Other languages
English (en)
French (fr)
Japanese (ja)
Inventor
勝吾 石内
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of the Ryukyus NUC
Original Assignee
University of the Ryukyus NUC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of the Ryukyus NUC filed Critical University of the Ryukyus NUC
Priority to JP2023548506A priority Critical patent/JPWO2023042888A1/ja
Priority to US18/692,070 priority patent/US20250281474A1/en
Priority to EP22870035.7A priority patent/EP4403185A4/en
Publication of WO2023042888A1 publication Critical patent/WO2023042888A1/ja
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/54Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame
    • A61K31/549Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame having two or more nitrogen atoms in the same ring, e.g. hydrochlorothiazide
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/444Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring heteroatom, e.g. amrinone
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/13Amines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

  • the present invention relates to pharmaceutical compositions containing antagonists of AMPA receptors for use in treating cognitive decline.
  • the present invention also relates to pharmaceutical compositions comprising antagonists of AMPA receptors for use in treating diseases or conditions associated with NMDA-refractory NMDN receptors in subjects having NMDA-refractory NMDA receptors.
  • the invention further provides pharmaceutical compositions for use in treating overweight and obesity.
  • HFD high-fat diet
  • AMPA receptors (hereinafter also referred to as "AMPAR") are involved in high-speed excitatory synaptic transmission, and play an important role in learning and memory in cooperation with NMDA receptors.
  • the NMDA receptor (hereinafter also referred to as “NMDAR”) is a ligand-gated ion channel belonging to the ionotropic glutamate receptor family.
  • NMDA receptors play an important role in excitatory synaptic transmission, learning and memory.
  • AMPA receptors are expressed on postsynaptic membranes and induce millisecond-order hyperpolarization in the presence of glutamate (or AMPA), but do not have calcium permeability.
  • NMDA receptors are expressed in the post-synaptic membrane and non-synaptic regions, and in the presence of glycine and glutamic acid (or NMDA), are activated with depolarization of the cell membrane to allow cations including calcium ions to flow into the cell.
  • NMDA receptors are normally bound and inactivated by magnesium ions. Magnesium blocks of NMDA receptors are released when the AMPA receptors depolarize and raise the membrane potential of the membrane in which the NMDA receptor resides.
  • NMDA receptors responsive to glycine and glutamate and lags the depolarization of the AMPA receptors in depolarizing the NMDA receptors and increasing intracellular calcium concentration, thereby generating a signal at the postsynaptic membrane.
  • the hippocampus has the lowest firing threshold to stimulation in the brain and plays an important role in acquiring new memories and learning. For example, it is known that Alzheimer's dementia begins with damage to the entorhinal cortex (EC) and is caused by decreased hippocampal function. It can also cause epilepsy due to its low firing threshold. Perampanel is marketed as an AMPA receptor antagonist and is used to treat epilepsy.
  • EC entorhinal cortex
  • Perampanel is marketed as an AMPA receptor antagonist and is used to treat epilepsy.
  • the present invention provides pharmaceutical compositions for use in treating cognitive decline.
  • the present inventors discovered a new phenomenon in which the calcium permeability of AMPA receptors is improved in the presence of AMPA, while the activation of NMDA receptors is suppressed in the presence of NMDA.
  • the inventors have also found that this new phenomenon occurs in overweight and obese subjects, as well as in subjects with cognitive impairment.
  • AMPA receptors are calcium-impermeable, whereas in the examples described later, in the hippocampus of subjects exhibiting overweight and obesity, AMPA in the presence of AMPA It has been demonstrated that the calcium permeability of the receptor is improved and the activation of the NMDA receptor in the presence of NMDA is suppressed, and the control of the AMPA receptor and the NMDA receptor in the hippocampus of the subject is improved. It was shown that something was wrong. Subjects exhibiting overweight and obesity had some degree of cognitive decline.
  • AMPA receptor antagonists can be used to inhibit AMPA receptor-mediated calcium influx to induce NMDA receptor release (ie, NMDA receptor activation).
  • a pharmaceutical composition for use in treating cognitive impairment in a subject comprising an AMPA receptor antagonist (antagonist).
  • the subject has suppressed NMDA receptors in at least one or more regions of the hippocampal body selected from the group consisting of entorhinal cortex (EC), CA1, CA2, CA3, and dentate gyrus (DG);
  • EC entorhinal cortex
  • CA1, CA2, CA3, and dentate gyrus (DG) entorhinal cortex
  • DG dentate gyrus
  • the subject has calcium-permeable AMPA receptors in at least one or more regions of the hippocampus, thereby suppressing activation of NMDA receptors in at least one or more regions of the hippocampus;
  • [4] The pharmaceutical composition according to any one of [1] to [3] above, wherein the subject has cognitive impairment.
  • the cognitive impairment is Alzheimer's dementia.
  • [6] The pharmaceutical composition according to any one of [1] to [5] above, wherein the subject has a body mass index (BMI) of 25 or more.
  • BMI body mass index
  • the pharmaceutical composition according to any one of [1] to [6] above, wherein the subject has a BMI of 30 or more.
  • a pharmaceutical composition comprising: [10] The pharmaceutical composition of any one of [1] to [9] above, wherein the AMPA receptor antagonist is perampanel.
  • [1A] A pharmaceutical composition for use in treating overweight or obesity in a subject with overweight or obesity, the pharmaceutical composition comprising an AMPA receptor antagonist.
  • [2A] The pharmaceutical composition of [1A] above for use in delaying, suppressing, or halting the development of overweight or obesity in a subject with overweight or obesity.
  • [3A] A pharmaceutical composition according to [1A] above for use in reducing body weight in a subject with overweight or obesity.
  • [4A] A pharmaceutical composition according to [1A] or [3A] above for use in reducing food intake in a subject with overweight or obesity.
  • [5A] The pharmaceutical composition according to any one of [1A] to [4A] above, for use in suppressing the development of diabetes, dyslipidemia, and cardiovascular disease in subjects with overweight or obesity. thing.
  • [6A] The pharmaceutical composition of any one of [1A] to [5A] above, wherein the AMPA receptor antagonist is perampanel.
  • Figure 1-1 shows that NMDA receptors are suppressed even in the presence of agonists in the hippocampus of model mice with obesity-induced cognitive decline, that AMPA receptors have calcium permeability in the presence of agonists, and We show that the AMPA receptor antagonist perampanel (PER) restores the interaction of AMPAR and NMDAR in the hippocampus of HFD-fed mice.
  • Panel A shows AMPA (AMPA receptor agonist) and CTZ (uncoupling inhibitor) in the CD feeding group, HFD feeding group, and PER administration + HFD feeding group (hereinafter sometimes referred to as "HFD group with PER"). Fluo-3 fluorescence images of the hippocampus before and after administration when combined with .
  • the right column of panel A is an image showing the difference between the pre-dose image and the post-dose image.
  • Mice were 17 weeks old and HFD-fed and HFD-fed with PER groups were HFD-fed or HFD-fed with PER from 8 to 17 weeks of age.
  • Panels BD show AMPA-dependent changes in normalized F525 (NF525) in hippocampal CA1, CA2, CA3, DG, and EC regions. F525 signals were measured under the conditions of the CD-fed group (panel B), HFD-fed group (panel C), and PER-administered HFD-fed group (panel D), respectively.
  • Panel F shows the Fluo-3 fluorescence images of the hippocampus before and after the application of NMDA and glycine and their difference images in the CD, HFD, and PER-administered HFD-fed groups.
  • Panels GI show NMDA-dependent changes of NF525 in hippocampal CA1, CA2, CA3, DG, EC regions. F525 signals were measured under CD (panel G), HFD (panel H), and HFD with PER treatment (panel I) conditions, respectively.
  • Figure 1-2 shows that in the hippocampus of Alzheimer's dementia model mice (NL and NLGF), AMPA receptors have calcium permeability in the presence of agonists, and that the AMPA receptor antagonist perampanel (PER) is , shows restoring calcium permeability of AMPA receptors in the hippocampus of HFD-fed mice.
  • Figures 1-3 show that NMDA receptors are suppressed even in the presence of agonists in the hippocampus of Alzheimer's disease model mice (NL and NLGF).
  • Panel A shows qRT-PCR expression levels of AMPAR subunits, NMDAR subunits, and ADAR2 in hippocampal regions (CA1, CA3, DG, EC) of CD-, HFD-, and HFD-with-PER groups.
  • Mice were 17 weeks old and HFD-fed and HFD-fed with PER groups were HFD-fed or HFD-fed with PER from 8 to 17 weeks of age.
  • Panel B shows the Ca 2+ permeability index of the hippocampal regions (CA1, CA3, DG, EC) of the CD-fed group, the HFD-fed group, and the HFD-fed group with PER.
  • Panel C shows that cell surface (middle column) and intracellular (right column) GluA1 protein expression in the hippocampal CA3 region of the HFD-fed group was increased and decreased in the HFD-fed group with PER, respectively.
  • Panel D shows the analysis of Q/R editing in hippocampal regions (CA1, CA2, CA3, DG, EC) in CD- and HFD-fed groups. Mice were 17 weeks old and HFD-fed and HFD-fed with PER groups were HFD-fed or HFD-fed with PER from 6 to 17 weeks of age.
  • FIG. 2-2 is a diagram following FIG. 2-1.
  • Panels I and J show representative examples of swimming paths to the phantom platform (left of circle) for probe trials (end of trajectory represents starting point) (Panel I) and probe trials with Cue manipulation ( Panel J) shows the results.
  • Panel K shows the time to goal of the Morris water maze pattern completion test by test day in the CD-fed group, the HFD-fed group, and the HFD-fed group with PER. Mice were 17 weeks old and HFD-fed and HFD-fed with PER groups were HFD-fed or HFD-fed with PER from 6 to 17 weeks of age.
  • FIG. 3 shows morphological changes in the hippocampus in the HFD-fed group and the HFD-fed group with PER.
  • Panel A shows brain coronal sections of BL/6 (16 weeks old), HFD-fed and HFD-fed with PER. A coronal section was obtained by MRI. White asterisks and diamonds indicate expansion of the third and bilateral ventricles in the HFD-fed group.
  • Right bar graph shows mean volume of total intracranial volume (TIV), total gray matter (GM), and whole brain white matter (WM), and total gray matter (GM), and whole brain white matter (WM) versus TIV. Show the ratio.
  • the left Y-axis shows TIV volume (mL) and the right Y-axis shows the volume ratio of GM or WM to TIV, respectively.
  • Panel B shows mean volume per TIV of hippocampus CA1, CA3, DG, EC.
  • Left and right bar graphs show left and right hippocampal results, respectively.
  • the left Y-axis shows the ratio of GM to TIV for CA1, CA3 and DG (GM/TIV), and the right Y-axis shows the ratio of GM to TIV for EC (GM/TIV).
  • Panels C and D show 3D images of the hippocampus of Thy-1 mice (17 weeks old).
  • the cubic box frame in panel C has a length of 4000 ⁇ m, a width of 3000 ⁇ m and a height of 3000 ⁇ m, and each side of the small cube has a length of 400 ⁇ m.
  • Panel D shows the CA1, CA1, The results of observing CA3 and DG are shown.
  • Right bar graph shows cell density in Thy-1+-FYP mouse hippocampal CA1, CA3, DG regions.
  • Panels EG show Golgi staining of the CA1 and DG regions (panel E, top) and percentage of spines of thin, stubby, mushroom type (panel E, bottom); Immunostaining of MAP2 Ab (antibody), anti-GluA1 Ab, and anti-GluA2 Ab (panel F, top); F, bottom panel); BL/6, HFD-fed group, anti-DCX+ staining in the hippocampal DG area of the group fed with PER (G, left panel), number of DCX+ positive cells/HFP (G, right panel).
  • FIG. 4 shows calcium permeable (CP)-AMPA and NMDA receptor interactions, behavioral function, and brain volume in ob/ob mice.
  • Panel A shows AMPA and NMDA receptor function (calcium transport capacity) in the EC, CA1, CA2, CA3, DG regions of obese mice (12 weeks old).
  • An increase in normalized 525 with AMPA + CTZ administration means that AMPA receptors became calcium permeable, and no change in normalized 525 with NMDA + glycine administration means that NMDA receptors are inhibited.
  • Panel B shows the function of AMPA and NMDA receptors in the EC, CA1, CA2, CA3, and DG regions of ob/ob mice (12 weeks old) subjected to PER from 8 to 12 weeks of age.
  • No change in normalized 525 with AMPA + CTZ administration means that AMPA receptors are calcium impermeable, and an increase in normalized 525 with NMDA + glycine administration means that inhibition of NMDA receptors is released. do.
  • Panel C is a graph of AMPA and NMDA receptor function in the EC, CA1, CA2, CA3, and DG regions of ob/ob and PER-treated ob/ob mice. Each factor in FIG. 4 was used at the following concentrations.
  • AMPA 100 ⁇ M
  • CTZ 100 ⁇ M
  • NMDA 50 ⁇ M
  • PER 100 ⁇ M
  • glycine 10 ⁇ M
  • Panel D Ca permeability index of hippocampal regions (CA1, CA2, CA3, DG, EC) of BL6/J mice, ob/ob mice, ob/ob mice subjected to PER (bottom right column) ).
  • Panels EG show the results of behavioral analysis of ob/ob mice and ob/ob mice subjected to PER.
  • Panel E shows the results of the running wheel activity test
  • panel F shows the results of the 5-trial social memory assay
  • panel G shows the results of the pattern-complementary navigation task. Mice were 11 weeks old and PER administration was performed from 6 to 11 weeks. Data are shown as mean ⁇ SE.
  • Panel H shows external appearance of BL6 and ob/ob mice (top), gray matter images extracted from T1-weighted images of BL6 and ob/ob mice (middle), and gray matter volumes of BL6 and ob/ob mice (bottom).
  • Panel I shows the results of Q/R editing analysis of hippocampal regions (CA1, CA2, CA3, DG, EC) of ob/ob mice (Mouse age: 12 weeks, PER administration: 6 weeks to 12 weeks). indicates Bar graphs show the ratio of molecular numbers of edited and non-edited GluA2 subunits.
  • VIC VIC-labeled probe for detecting non-edited sequence
  • FAM FAM-labeled probe for detecting edited sequence
  • Panel J shows anti-MAP2 Ab (antibody ), showing the immunoreactive areas and GluA2/GluA1 ratios of anti-GluA1 Ab and anti-GluA2 Ab. *: p ⁇ 0.05, ***: p ⁇ 0.001.
  • FIG. 5 shows the effect of increased BMI on fluctuations in human memory function and synaptic function.
  • Panel A shows an anatomy of the right hippocampal subregion on a T2-weighted image. CA1-CA3, CA4/DG and cerebellum (SUB) are indicated.
  • Panels C and D show the correlation between the percentage value of the BOLD signal in the right hippocampus CA3 and the percentage of correct answers in the recognition task.
  • Panel E shows the mean percentage of correct answers in the recognition task. The mark is the data of each individual.
  • Panels H to J show left and right CA3 activation maps, BOLD signal changes, and hippocampal memory tasks (New, Lure, Same) in the normal weight group (H), overweight group (I), and obese group (J). shows the percentage of correct answers from left to right.
  • Color bar T value. *: p ⁇ 0.001.
  • FIG. 6 shows the relationship between network connectivity and BMI in humans.
  • Panel A shows DMN maps (upper) and anti-correlation maps to DMN (lower; anti.DMN) of the normal-weight group, overweight group, and obese group. Color bars indicate T values.
  • Panel B shows functional network connectivity of the normal weight group (left column), overweight group (middle column) and obese group (right column). The diameter of each circle indicates the value of betweenness centrality.
  • Panel C shows the mean and standard deviation of betweenness centrality and degree for each node. a. u. : Arbitrary units.
  • FIG. 7 shows functional changes in AMPA and NMDA receptors in the HFD-fed group.
  • Panel A shows functional changes (calcium transport capacity) of AMPA and NMDA receptors in the EC, CA1, CA2, CA3, and DG regions of HFD-fed mice (7 days from 16 to 17 weeks of age).
  • Panel B shows the function of AMPA and NMDA receptors in the EC, CA1, CA2, CA3, DG regions of the HFD-fed group with PER (7 days from week 16 to week 17).
  • Panel C is a graph showing the function of AMPA and NMDA receptors in the EC, CA1, CA2, CA3, and DG regions of the CD-fed group, the HFD-fed group, and the HFD-fed group with PER. *: p ⁇ 0.05, t-test.
  • Panel D shows the inhibitory effect of 1-naphthylacetylspermine (Naspm) (selective antagonist of AMPA receptors) and GYKI (selective non-competitive AMPA receptor antagonist) in the HFD-fed group (HFD-fed for 7 days).
  • Naspm 1-naphthylacetylspermine
  • GYKI selective non-competitive AMPA receptor antagonist
  • FIG. 8 shows the inhibitory effects of Naspm (a Ca 2+ -permeable AMPA receptor [CP-AMPAR] antagonist) and GYKI (a selective non-competitive AMPAR antagonist) in the hippocampus of ob/ob mice (12 weeks old).
  • FIG. 9 shows the results of behavioral analysis of the open field test (panels AC), the elevated plus maze test (panels D, E), and the contextual fear conditioning test (panel F).
  • Total travel time panel A
  • total distance panel B
  • Time panel C
  • mean dwell time panel D
  • mean number of open and closed arm entries panel E
  • mean dwell time (F) are shown.
  • FIG. 10-1 shows (A) the effects of AMPA receptor antagonists on CP-AMPA and NMDA receptor functions in the EC, CA1, CA2, CA3, and DG regions of ob/ob mice.
  • PER 100 ⁇ M
  • Glycine 10 ⁇ M
  • APV 50 ⁇ M
  • Naspm 10 ⁇ M
  • GYKI 100 ⁇ M
  • * p ⁇ 0.05, t-test.
  • 10-1 shows the effect of leptin on NMDA receptor function in (B) ECs of ob/ob mice with PER, CA1, CA2, CA3, DG regions and (C) ECs of HFD-fed group with PER. , CA1, CA2, CA3, DG effects of leptin on NMDA receptor function.
  • PER 100 ⁇ M
  • Glycine 10 ⁇ M
  • APV 50 ⁇ M
  • Naspm 10 ⁇ M
  • GYKI 100 ⁇ M
  • * p ⁇ 0.05, t-test.
  • FIG. 11 shows the results of quantitative analysis of the expression levels of MAP2, GluA1, and GluA2 in the CD-fed group, the HFD-fed group, and the HFD-fed group with PER.
  • FIG. 12 shows immunostaining images of anti-MAP2 Ab, anti-GluA1 Ab, and anti-GluA2 Ab in ob/ob mice and 1-week and 12-week PER-administered ob/ob mice. Bar: 100 ⁇ m. Mice were 17 weeks old and PER administration was performed from 6 to 17 weeks.
  • FIG. 12 shows immunostaining images of anti-MAP2 Ab, anti-GluA1 Ab, and anti-GluA2 Ab in ob/ob mice and 1-week and 12-week PER-administered ob/ob mice. Bar: 100 ⁇ m. Mice were 17 weeks old and PER administration was performed from 6 to 17 weeks.
  • FIG. 13 shows the results of quantitative analysis of MAP2, GluA1, and GluA2 expression in ob/ob mice and 1-week and 12-week PER-treated ob/ob mice. Bar: 100 ⁇ m. Mice were 17 weeks old and PER administration was performed from 6 to 17 weeks.
  • FIG. 14 shows the results of anti-DCX+ staining and DCX+ positive cell count/HFP in the hippocampal DG region of ob/ob mice and 1-week and 12-week PER-administered ob/ob mice. Inset shows DCX+ neuronal progenitor cells. Bar: 100 ⁇ m and 20 ⁇ m (inset). Mice were 17 weeks old and PER administration was performed from 6 to 17 weeks.
  • FIG. 15 T-value maps of gray matter (GM) volume and voxel intensity in the GM region of the dentate gyrus, hypothalamus, somatosensory cortex, and cerebellum of ob/ob mice (11 weeks old) (panels A and B). , and anatomical ROI maps (MRI images) of the hippocampal dentate gyrus, hypothalamus, somatosensory cortex, and cerebellum of CD mice in MRI images (panel C). Bar: 1mm.
  • FIG. 16 shows surface expression levels and intracellular pool levels of hippocampal GluA1 subunits in ob/ob mice.
  • Panel A shows GluA1 surface expression (upper row), intracellular pool amount (middle row) and internal control in ob/ob mice (6 or 17 weeks old, or PER administration group (11 weeks to PER administration)). The expression level of a certain actin (lower row) is shown.
  • Panel B shows the relative expression levels of GluA1 on the cell surface. For the relative expression level, the expression level of GluA1 was normalized by the expression level of actin.
  • Panel C shows the relative expression levels of GluA1 in intracellular pools.
  • FIG. 17 shows the relationship between human whole brain GM volume, body weight, BMI, and age. Panels A and B show representative T1-weighted coronal images of normal weight group (panel A) and obese group (panel B).
  • FIG. 18 shows the relationship between BMI and percentage of correct answers in new tasks and lure tasks.
  • FIG. 18 shows the relationship between BMI and percentage of correct answers in new tasks and lure tasks.
  • FIG. 19 shows the relationship between the volume of each region of the human hippocampus by MRI and overweight or obesity.
  • Panels A to C show the mean of normal weight group (panel A), overweight group (panel B) and obese (panel C) (*: p ⁇ 0.05). The points in the graph are the data of each individual.
  • FIG. 20 shows the volume of each region of the hippocampus of CD-fed and ob/ob mice by volumetric analysis using MRI images.
  • Panel A shows whole brain volumes of CD-fed and ob/ob mice (13 weeks old).
  • Panel B shows body weights of CD-fed and ob/ob mice (13 weeks old).
  • Panel C shows the volume of each region of the left hippocampus of CD-fed and ob/ob mice (13 weeks old).
  • Panel D shows the volume of each region of the right hippocampus of CD-fed and ob/ob mice (13 weeks old).
  • FIG. 21 shows levels of R/Q editing of GluA2 in CD-fed, HFD-fed, HFD-fed with PER, ob/ob, PER-treated ob/ob. The level of R/Q editing was calculated as a ratio of the total number of reads aligned to the R/Q editing site of GluA2.
  • Mice were BL/6J 17 weeks old and fed HFD or HFD with PER from 16 to 17 weeks or from 6 to 17 weeks. PER treatment of ob/ob mice was between 16 and 17 weeks.
  • FIG. 21 shows levels of R/Q editing of GluA2 in CD-fed, HFD-fed, HFD-fed with PER, ob/ob, PER-treated ob/ob.
  • the level of R/Q editing was calculated as a ratio of the total number of reads aligned to the R/
  • Panel 22 shows the quantitative results of Thy1-YFPH+ cells in the hippocampal CA1 region.
  • Panel A shows a whole hippocampal image ( ⁇ 10 ⁇ water immersion objective) of the CD-fed group (17 weeks old). Voxel size was X-axis, 4.013 ⁇ m; Y-axis, 4.013 ⁇ m; Z-axis, 5.016 ⁇ m. A portion surrounded by a square is a cut-out region. Bar: 400 ⁇ m.
  • Panel B is a panel representation of selected cells.
  • Panel C is a 3D reconstruction of the segmented region.
  • Panel D is a Bob filter rendered image (average size, 20 ⁇ m, threshold, 5 ⁇ m).
  • FIG. 23 shows the effect of perampanel administration on cognitive decline in Alzheimer's dementia model mice.
  • FIG. 24 shows photographs of the appearance of wild-type mice, ob/ob mice that are an obesity model, and ob/ob mice administered AMPA receptor antagonists.
  • FIG. 25 shows the effect of AMPA receptor antagonist administration on body weight change in HFD-fed groups with equivalent food intake.
  • Figure 26 shows the effect of antiepileptic treatment on hippocampus and body weight in a 70 year old female with a BMI value of 38. The woman had a foramen magnum and had quadriplegia and respiratory distress. MRI images of the brain 26 weeks after administration (oral administration) of perampanel (PER) as an antiepileptic treatment after tumor excision are shown.
  • PER perampanel
  • FIG. 27 shows the changes in treatment, changes in body weight, and changes in lower extremity Fugl-Meyer assessment score (FMA score) for the 70-year-old woman. BMI decreased to 31 after 26 weeks of PER administration.
  • FIG. 28 shows that NMDA receptor inactivation in the HFD-fed group is calcium ion dependent.
  • FIG. 29 shows the effect of perampanel (PER) administration on the A ⁇ 42/A ⁇ 40 ratio in neurospheres established from Alzheimer's dementia model NL-GF(-/-) mice.
  • Figure 30 shows the effect of perampanel (PER) administration on A ⁇ accumulation in neurospheres established from NL-GF(-/-) mice.
  • Figure 31 shows the effect of perampanel administration on A ⁇ accumulation in hippocampal dentate gyrus (DG) CA1 and cerebral cortex (Cx) in Alzheimer's dementia model mice (NL-GF(-/-)).
  • FIG. 32 shows marked enhancement of epileptiform responses in the CA1 and CA2 regions by biclin (BIC) administration to NL-GF(-/-) mice.
  • FIG. 33 shows the effect of administration of perampanel on epileptiform reactions induced by biclin in NL( ⁇ / ⁇ ) mice.
  • FIG. 34 shows the effects of memantine administration (mema), exercise load (exercise), and perampanel administration (PER) in a novel object recognition test for NL-GF(-/-) mice.
  • FIG. 35 shows the effects of memantine administration (mema), exercise load (exercise), and perampanel administration (PER) in fear conditioning tests on NL-GF(-/-) mice.
  • a "subject" is a mammal, such as a primate, such as a human.
  • Humans are, for example, 0 to 10 years old, 10 to 20 years old, 20 to 30 years old, 30 to 40 years old, 40 to 50 years old, 50 to 60 years old, 60 to 70 years old, from 70 years old 80 years old, and over 80 years old, and can be any age in the above age ranges. Humans can be male or female.
  • cognitive function refers to intellectual functions such as comprehension, judgment, and logic; is understood to include As used herein, a “cognitive dysfunction” is an impairment (or hypofunction, or dysfunction) in higher brain functions, including judgment, calculation, comprehension, learning, orientation, and memory.
  • a “cognitive impairment” can be a memory impairment, which in dementia can manifest as memory impairment such as forgetfulness (eg, working memory decline and working memory impairment).
  • Cognitive impairment is diagnosed in an environment that is suitable for testing cognitive and memory function, or that allows for concentration or concentration.
  • treatment refers to prophylactic treatment and therapeutic treatment.
  • therapeutic treatment means treating, curing, preventing or ameliorating the remission of, or reducing the rate of progression of, a disease or disorder.
  • prophylactic treatment means reducing the likelihood of developing a disease or condition or delaying the onset of a disease or condition.
  • terapéuticaally effective amount means an amount that provides therapeutic or prophylactic treatment.
  • NMDA receptor is a kind of ion channel glutamate receptor present in the post-synaptic membrane, and is also called NMDA glutamate receptor. Ionotropic glutamate receptors present in the post-synaptic membrane are broadly classified into AMPA receptors, kainate receptors, and NMDA receptors according to their pharmacological characteristics. NMDA receptors are considered to be involved in memory, learning, cell death after cerebral ischemia, and the like. NMDA receptors, unlike other ionotropic glutamate receptors, are selectively activated by N-methyl-D-aspartate (NMDA; NMDA receptor agonists).
  • NMDA N-methyl-D-aspartate
  • NMDA receptors are bound to extracellular magnesium ions (Mg 2+ ) at -60 mV to -70 mV, which corresponds to the resting membrane potential, and their channel activity is inhibited.
  • Mg 2+ extracellular magnesium ions
  • the postsynaptic membrane depolarizes (e.g., the membrane potential is positive or greater than -20 mV, e.g., -20 mV to -10 mV)
  • inhibition by magnesium ions is released and NMDA receptors are activated by glutamate in the presence of glycine. and induces the influx of cations from the postsynaptic membrane into the cell, particularly calcium ions (Ca 2+ ), potassium ions (K + ), and sodium ions (Na + ).
  • NMDA receptors undergo post-synaptic membrane depolarization (electrical signal; post-synaptic membrane neural activity) and glutamate stimulation (biochemical signal; pre-synaptic terminal neural activity), resulting in channel activity. express.
  • AMPA receptor is a type of ionotropic glutamate receptor present in the post-synaptic membrane, and is also called AMPA-type glutamate receptor.
  • AMPA receptors are selectively activated by ⁇ -amino-3-hydroxy-5-mesoxazole-4-propionic acid (AMPA; AMPA receptor agonist).
  • AMPA receptors are tetramers containing any four of four subunits: GluA1, GluA2, GluA3, and GluA4. Each subunit has a glutamate acceptor site, and channel activity is believed to be induced when glutamate binds to two or more of the four.
  • AMPA receptors containing GluA2 are calcium-impermeable, whereas AMPA receptors without GluA2 are calcium-permeable (hereinafter, calcium-permeable AMPA receptors are referred to as "CP-AMPA receptors").
  • CP-AMPA receptors calcium-permeable AMPA receptors
  • AMPA receptors, including GluA2 are calcium-impermeable because glutamine (Q) in the M2 domain (second hydrophobic domain) of GluA2 is converted to arginine (R).
  • Q glutamine
  • R arginine
  • the editing from Q to R (Q/Reediting) of GluA2 is due to editing at the mRNA level (post-transcriptional regulation).
  • the conversion from Q to R is achieved by deaminating the second base (adenine) of the codon specifying glutamine in GluA2 mRNA by adenine deaminase and converting it to inosine; It is generated when the inosine is decoded as guanine by tRNA. Since AMPA receptors containing unedited GluA2 are calcium permeable, the calcium impermeability of AMPA receptors is likely due to the above Q to R conversion of GluA2.
  • nucleic acid sequence of human GluA2 is set forth in SEQ ID NO: 1
  • an example of the amino acid sequence of unedited human GluA2 is set forth in SEQ ID NO: 2
  • an example of the amino acid sequence of edited human GluA2 is set forth in SEQ ID NO: 3.
  • the 607th Q in SEQ ID NO: 2 is converted to R by editing. This site is called the Q/R site of GluA2.
  • the AMPA receptor component is known to be faster than the NMDA receptor component.
  • Example nucleic acid sequences of human GluA1, human GluA3, and human GluA4 are set forth in SEQ ID NOs:4, 6, and 8, and example amino acid sequences are set forth in SEQ ID NOs:5, 7, and 9, respectively.
  • the "hippocampus” is the cortex located at the base of the inferior horn of the lateral ventricle in the medial part of the temporal lobe. There is one hippocampus on each side of the brain.
  • the hippocampus is part of the limbic system called the hippocampus, which includes the dentate gyrus, hippocampus, subiculum, presubiculum, parasubiculum, and entorhinal cortex. (entorhinal cortex).
  • the hippocampus is roughly divided into CA1 to CA3 regions. The hippocampus is believed to be involved in various neuropsychiatric disorders such as epilepsy and Alzheimer's dementia.
  • the hippocampus has the lowest seizure threshold in the brain, and in epilepsy animal models much of the electrical activity associated with seizures is recorded from the hippocampus, particularly originating from areas CA2 and CA3.
  • An early symptom of Alzheimer's dementia is the inability to acquire new memories.
  • the entorhinal cortex is where the pathology of Alzheimer's dementia first appears. In Alzheimer's dementia, it is thought that the information processing ability of the hippocampus is deprived due to damage to the entorhinal cortex. Thus, the hippocampus has a low threshold for firing and has important functions in storing and learning new memories.
  • the hippocampus is vulnerable to hypoxia and ischemia, and induces neuronal cell death under hypoxic and ischemic conditions.
  • Neuronal cell death is believed to be due to NMDA receptor-mediated excitotoxicity.
  • the hippocampus is believed to be essential for the formation of explicit memories such as episodic memories. Areas of the temporal lobe cortex involved in memory formation include the entorhinal cortex, the parasubiculum, the presubiculum, the subiculum, the hippocampus (Ammon's horn), and the dentate gyrus. Inactivation of NMDA receptors in the hippocampus causes cognitive impairment, including memory and learning deficits. Alzheimer's disease includes a condition that eventually progresses to Alzheimer's dementia but has no clinical symptoms (preclinical Alzheimer's disease), mild cognitive impairment (MCI) that progresses to Alzheimer's dementia, and Alzheimer's dementia.
  • MCI mild cognitive impairment
  • Alzheimer's disease a decrease in A ⁇ 42 levels in the cerebrospinal fluid, an increase in total tau levels, and an increase in phosphorylated tau levels can be seen from the preclinical stage of Alzheimer's disease.
  • Decreased levels of A ⁇ 42 in the cerebrospinal fluid are thought to reflect accumulation of A ⁇ 42 in the brain.
  • Increased tau accumulation, neurofibrillary tangles, and neuronal loss can lead to mild cognitive impairment.
  • Mild cognitive impairment involves lesions in the perihippocampal region. In Alzheimer's dementia, lesions extend to the cerebral neocortex. Dementia of the Alzheimer's type is characterized, for example, by the presence of senile plaques and/or neurofibrillary tangles.
  • Dementia of the Alzheimer's type can be diagnosed, for example, based on diagnostic criteria according to the American Psychiatric Association Diagnostic and Statistical Handbook, 5th Edition (DSM-5). That is, dementia of the Alzheimer's type can be diagnosed if: A, meets the criteria of major neurocognitive disorder; B, at least two or more cognitive impairments appear insidiously and progress slowly; C. Evidence from family history or genetic testing for the presence of mutations in the Alzheimer's disease-causing gene OR all of the following: Clear evidence of deterioration in memory, learning, and other cognitive functions on detailed medical history and longitudinal neuropsychological testing No other neurodegenerative, cerebrovascular, neurological/psychiatric/systemic disease or condition likely to cause cognitive impairment; D. Clear evidence of deterioration in memory, learning, and other cognitive functions on detailed medical history and neuropsychological testing over time. No other neurodegenerative, cerebrovascular, neurological/psychiatric/systemic diseases or conditions likely to cause cognitive impairment.
  • the term “overweight” refers to humans (especially men and women aged 18 and over) with a Body Mass Index (BMI) of 25 or more and less than 30. BMI is determined by weight (kg)/ ⁇ height (m) ⁇ 2 . The standard BMI value for both adult men and women is about 22.
  • “obesity” refers to humans (particularly adult men and women) with a BMI of 30 or higher. Obesity is classified into obesity class I with a BMI of 30 or more and less than 35, obesity class II with a BMI of 35 or more and less than 40, and obesity class with a BMI of 40 or more according to the standards of the World Health Organization (WHO) (WHO standards). It is roughly divided into III.
  • WHO World Health Organization
  • metabolic syndrome means a BMI of 25 or more, a waist circumference of 85 cm or more for men and 90 cm or more for women, and satisfying two or more of the following (1) to (3).
  • Neutral fat is 150 mg/dL or more, or HDL is less than 40 mg/dL.
  • Systolic blood pressure is 130 mmHg or higher, or diastolic blood pressure is 85 mmHg or higher.
  • Fasting blood sugar is 110 mg/dL or more. Obesity in children can be determined by the degree of obesity.
  • obesity in children is defined as a degree of obesity of +20% or more, an increase in body fat percentage of 25% or more for boys, an increase of 30% or more for girls under the age of 11, and an increase of 30% or more for girls aged 11 and over. For females, it means an increase of 35% or more.
  • the degree of obesity (%) is obtained by (current body weight ⁇ standard body weight for that age)/standard body weight for that age ⁇ 100.
  • Dyslipidemia refers to a condition in which the metabolism of lipids such as triglycerides and cholesterol is abnormal.
  • Dyslipidemia is broadly classified into hyper-LDL-cholesterolemia, hypo-HDL-cholesterolemia, and hyper-triglyceridemia.
  • Hyper-LDL cholesterolemia can be diagnosed based on whether the blood LDL cholesterol level is 140 mg/dL or higher.
  • HypoHDL cholesterolemia can be diagnosed by blood HDL cholesterol levels of less than 40 mg/dL.
  • Hypertriglyceridemia can be diagnosed based on whether the blood triglyceride level is 150 mg/dL or more.
  • Cardiovascular disease refers to a group of diseases in which arteriosclerosis causes narrowing of the inner walls of blood vessels, resulting in insufficient blood supply to organs.
  • Cardiovascular disease includes coronary artery disease, stroke, cerebral infarction, myocardial infarction, and peripheral artery disease. If conditions such as hyperglycemia continue, the inner walls of blood vessels are damaged, and cholesterol accumulates on the walls of the blood vessels. Over time, the buildup increases, constricting the vessel lumen and reducing the blood supply. A decrease in blood flow to the brain can result in a stroke, and a decrease in blood flow to the heart can result in a myocardial infarction. Others can cause coronary artery disease and peripheral artery disease. Dyslipidemia and arteriosclerosis have been cited as risk factors for cardiovascular disease.
  • diabetes is a disease in which hyperglycemia continues chronically due to insufficient action of insulin (for example, lack of insulin or lack of responsiveness to insulin). Diabetes is often accompanied by three major complications: retinopathy, nephropathy, and neuropathy. Diabetes is diagnosed by meeting any of (1) to (3) and (4) below: (1) morning fasting blood glucose ⁇ 126 mg/dL, (2) 75 g fluorescent glucose tolerance test. 2-hour value of 200 mg/dL or higher; (3) Blood glucose level measured regardless of time of 200 mg/dL or higher; (4) HbA1c of 6.5% or higher;
  • AMPA receptors in the presence of glutamate have enhanced calcium permeability
  • NMDA receptors in the presence of glutamate or in the presence of NMDA
  • NMDA-refractory a disease or condition associated with NMDA-refractory in a subject having glutamate (or NMDA)-refractory NMDA receptors (hereinafter also simply referred to as "NMDA-refractory”)
  • a pharmaceutical composition comprising an AMPA receptor antagonist is provided.
  • the hippocampus of NMDA-refractory subjects has NMDA receptors that are suppressed regardless of the membrane potential of postsynaptic membranes in the presence of glycine and NMDA. This results in complete or partial inhibition of NMDA receptors in the hippocampus of NMDA-refractory subjects in the presence of glycine and NMDA, independent of the membrane potential of postsynaptic membranes.
  • suppression of NMDA receptors can be suppression of calcium influx into cells (and preferably suppression of elevation of intracellular calcium concentration) via NMDA receptors.
  • AMPA receptors have acquired agonist-dependent calcium permeability.
  • the disease or condition associated with NMDA refractory can be cognitive impairment, including cognitive decline.
  • cognitive impairment can result from overweight or obesity.
  • cognitive impairment can result from dementia of the Alzheimer's type.
  • BOLD blood oxygen level dependent
  • NMDA-refractory subjects may also have a ratio of BOLD responses during rest (no task) to event-related memory tasks that is less than or equal to a second predetermined ratio, as described below.
  • Elevated BOLD responses suggest hyperactivity of synaptic function, and depression suggests synaptic dysfunction.
  • NMDA unresponsiveness can be assessed by unresponsiveness of brain activity to NMDA administration. In living organisms, when working on a hippocampal function task using functional magnetic resonance imaging (fMRI), the correct answer rate decreases and the BOLD signal becomes persistently low.
  • fMRI functional magnetic resonance imaging
  • the suppression of NMDA receptors by AMPA receptor antagonists suppresses calcium influx from AMPA receptors (especially hippocampal calcium-permeable AMPA receptors).
  • AMPA receptors especially hippocampal calcium-permeable AMPA receptors.
  • subjects exhibiting overweight and obesity may have certain cognitive impairments due to the above-described abnormalities in the regulation of AMPA and NMDA receptors in the hippocampus.
  • the calcium permeability of AMPA receptors is enhanced in the presence of AMPA, while the activation of NMDA receptors is suppressed in the presence of NMDA.
  • a pharmaceutical composition for use in treating cognitive impairment including cognitive decline, hereinafter the same
  • the pharmaceutical composition comprising an AMPA receptor antagonist.
  • AMPA receptor antagonists include competitive antagonists and non-competitive antagonists (eg, allosteric antagonists).
  • a non-competitive antagonist can be preferably used as the AMPA receptor antagonist.
  • AMPA receptor antagonists also include AMPA receptor selective antagonists (eg, AMPA receptor selective competitive antagonists and AMPA receptor selective non-competitive antagonists).
  • AMPA receptor-selective antagonists have a greater inhibitory effect on AMPA receptors than on other ionotropic glutamate receptors such as NMDA receptors and kainate receptors (e.g., IC 50 for AMPA receptors is higher than other 2-fold or less, 3-fold or less, 5-fold or less, 10-fold or less, 30-fold or less, 50-fold or less, 100-fold or less, 300-fold or less, 500-fold or less, 1000-fold or less of the IC 50 for ionotropic glutamate receptors of , 3000 times or less, 5000 times or less, or 10000 times or less).
  • an AMPA receptor selective antagonist can be preferably used.
  • AMPA receptor antagonists include, but are not limited to, 2,3-benzodiazepine compounds, 4-(8-chloro-2-methyl-11H-imidazo[1,2-c][2,3]benzodiazepine-6- Benzenamine (GYKI47261), 1-(4-aminophenyl)-4-methyl-7,8-methylenedioxy-5H-2,3-benzodiazepine (GYKI52466), and 1-(4-aminophenyl)-3- methylcarbamyl-4-methyl-7,8-methylenedioxy-3,4-dihydro-5H-2,3-benzodiazepine (GYKI53655) (Paternain et al., Neuron 1995, 14:185-189), 2, 3-dioxo-6-nitro-1,2,3,4-tetrahydrobenzo[f]quinoxaline-7-sulfonamide (NBQX), 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX), 6 ,
  • 1,2-dihydropyridine compounds such as 3-(2-cyanophenyl)-5-(2-pyridyl)-1-phenyl-1,2- Dihydropyridin-2-one (perampanel; E2007) (US 6,949,571B), 2,3-dihydroxy-6-nitro-7-sulfamoylbenzo(f)quinoxaline, [1,2,3,4,- Tetrahydro-7-morpholin-yl-2,3-dioxo-6-(trifluoromethyl)quinoxalin-1-yl]methylphosphonate, 1-(4-aminophenyl)-4-methyl-7,8-methylene-dioxy -5H-2,3-benzodiazepine or (-) 1-(4-aminophenyl)-4-methyl-7,8-methylene-dioxy-4,5-dihydro-3-methylcarbamoyl-2,3-benzodiazepine , [7-(2-aminophenyl)-4-methyl-7,8-methylene
  • the pharmaceutical compositions of the present disclosure comprise a therapeutically effective amount of an AMPA receptor antagonist. In some aspects, the pharmaceutical compositions of this disclosure comprise a therapeutically effective amount of an AMPA receptor selective antagonist. In some aspects, the pharmaceutical compositions of this disclosure comprise a therapeutically effective amount of one or more selected from the group consisting of GYKI47261, Naspm, and perampanel.
  • the subject is a human.
  • the subject is a human (eg, male or female) 18 years of age or older.
  • the subject is overweight. In one aspect, the subject is obese. In one aspect, the subject has Class I obesity. In one aspect, the subject is obese class II. In some aspects, the subject has Obesity Class III.
  • the subject has cognitive impairment (including cognitive decline). In some embodiments, the subject has dementia and is overweight. In some aspects, the subject has cognitive impairment and is obese selected from the group consisting of obesity classes I-III. In some embodiments, the subject is overweight or obese and has decreased hippocampal memory function of pattern complementation compared to normal subjects. In some embodiments, the subject has cognitive impairment but is not overweight or obese.
  • the cognitive impairment is memory impairment (including deterioration of memory function).
  • the memory impairment can be social memory impairment.
  • the memory impairment can be a reduced ability to complete patterns.
  • the cognitive impairment is a learning disability (including a decline in learning function).
  • the memory impairment can be a memory impairment in social memory.
  • the subject has dementia. In some embodiments, the subject has dementia and is overweight. In some aspects, the subject has dementia and is obese selected from the group consisting of obesity classes I-III. In some embodiments, the subject has dementia but is not overweight or obese.
  • the subject has dementia of the Alzheimer's type. In some embodiments, the subject has dementia of the Alzheimer's type and is overweight. In some aspects, the subject has dementia of the Alzheimer's type and is obese selected from the group consisting of obesity classes I-III. In some embodiments, the subject has dementia of the Alzheimer's type but is not overweight or obese. In certain aspects, the patient with dementia of the Alzheimer's type can be a patient with epilepsy. In some embodiments, a patient with dementia of the Alzheimer's type can be a patient without epilepsy. Epilepsy is a disease that causes repeated epileptic seizures, such as sudden loss of consciousness and unresponsiveness.
  • a subject with cognitive impairment has a lower gray matter volume than that of a healthy subject.
  • central executive network activation is observed in resting brain activity in subjects with cognitive impairment.
  • subjects with cognitive impairment exhibit a connection of the central executive network to the default mode network in resting brain activity.
  • a subject with cognitive impairment exhibits visual network activation in resting brain activity.
  • activation of the central executive network and activation of the visual network is observed in subjects with cognitive impairment.
  • a subject with cognitive impairment has a connection between the saliency network and the cerebellar network in resting brain activity.
  • a subject with cognitive impairment may particularly be a subject with obesity or overweight.
  • the network has been developed as a biomarker of human cognitive function (35). Specifically, the network can be determined by recording a subject's resting brain activity by fMRI and analyzing the connectivity of brain activation (35).
  • a subject with cognitive impairment has a change ratio of BOLD responses in the CA3 region of the hippocampus that is greater than or equal to a first predetermined ratio.
  • the first predetermined ratio is 1.1 times or more, 1.11 times or more, 1.12 times or more, 1.13 times or more, 1.14 times or more, 1.15 times or more, 1.16 times or more, It can be 1.17 times or more, 1.18 times or more, 1.19 times or more, or 1.2 times or more.
  • the upper limit of the first predetermined ratio can be, for example, either 1.3 times or a scaling factor with respect to the first predetermined value indicated above.
  • a subject with cognitive impairment has a ratio of change in BOLD responses in the CA3 region of the hippocampus that is less than a second predetermined value.
  • the second predetermined ratio is 0.9 times or less, 0.89 times or less, 0.88 times or less, 0.87 times or less, 0.86 times or less, 0.85 times or less, 0.84 times or less, It can be 0.83 times or less, 0.82 times or less, 0.81 times or less, or 0.8 times or less.
  • the lower limit of the second predetermined ratio can be, for example, 0.7 times or more, or any of the scaling factors for the second predetermined value indicated above.
  • the ratio of change in BOLD responses is determined by measuring BOLD responses by functional MRI (fMRI) in the presence and absence of the behavioral task.
  • Behavioral tasks include, for example, event-related memory tasks.
  • event-related memory task for example, the same image, a similar image, and a new image can be checked to see if the subject can correctly answer the same image, a similar image, and a new image, respectively.
  • the percentage of correct answers can be measured.
  • the subject has suppressed NMDA receptors in at least one or more regions of the hippocampal formation selected from the group consisting of entorhinal cortex (EC), CA1, CA2, CA3, and dentate gyrus (DG). wherein the activity of NMDA receptors by NMDA is inhibited in at least one or more regions of said hippocampus, and the subject has cognitive impairment.
  • Inhibition of NMDA receptors is inhibition of NMDA receptor activation in the presence of glutamate and glycine (and preferably magnesium ion ions) (ie, under conditions in which NMDA receptors are activated in a physiological environment). Failure to activate NMDA receptors when they should be can result in memory and learning impairments.
  • AMPA receptor antagonists are effective in derepressing NMDA receptors. Then, by releasing the suppression of NMDA receptors, the NMDA receptors regain their original functions, and cognitive impairment can be improved.
  • pharmaceutical compositions comprising AMPA receptor antagonists of this disclosure may be used in combination with NMDA receptor agonists.
  • NMDA receptor agonists include Lapastinel (PCT/US2017/015851).
  • hippocampal formation selected from the group consisting of entorhinal cortex (EC), CA1, CA2, CA3, and dentate gyrus (DG). Having suppressed NMDA receptors in the above regions, whereby NMDA-mediated activation of NMDA receptors is suppressed in at least one or more regions of said hippocampus, and the subject may have cognitive impairment.
  • the calcium permeability of AMPA receptors can be improved by reducing the expression level of GluA2 and/or by reducing Q/R editing of GluA2.
  • GluA2 undergoes post-translational conversion of glutamine at the Q/R site to arginine (subject to Q/R editing).
  • Q/R-edited GluA2 renders AMPA receptors calcium-impermeable upon internalization. If the uptake of Q/R-edited GluA2 into AMPA receptors is inhibited, AMPA receptors acquire calcium permeability and allow calcium to flow into cells in response to glutamate.
  • the subject's hippocampus has a lower GluA2/AMPA receptor ratio than that in a healthy subject.
  • the ratio of unedited form of GluA2 to total GluA2 counts is increased in the subject's hippocampus over that ratio in healthy subjects.
  • the ratio of unedited GluA2 to total GluA2 counts in the CA2 region of the hippocampus of the subject is increased by a predetermined ratio or more over the ratio in healthy subjects.
  • the predetermined ratio is 2 times or more, 3 times or more, 4 times or more, 5 times or more, 6 times or more, 7 times or more, 8 times or more, 9 times or more, 10 times or more, 15 times or more, 20 times or more, 25 times or more. It can be 30 times or more, 35 times or more, 40 times or more, 45 times or more, or 50 times or more.
  • the number of Thy-1-positive neurons in any region selected from the group consisting of CA1, CA2, and CA3 of the hippocampus of the subject is higher than the number of cells in a healthy subject. is also decreasing.
  • any region (e.g., CA1 region) selected from the group consisting of CA1, CA2, and CA3 of the subject's hippocampus dendritic network tropism (specifically, tropism to CA1) ) is lower than the runnability in healthy subjects.
  • the proportion of immature spines in any region of the subject's hippocampal formation eg, DG region
  • AMPA receptor antagonists can ameliorate these situations.
  • a pharmaceutical composition for use in inhibiting suppression of NMDA receptor activation in a subject having a hippocampus that expresses a calcium-permeable AMPA receptor the pharmaceutical composition comprising an AMPA receptor antagonist goods are provided.
  • AMPA receptor antagonists can inhibit glutamate-dependent intracellular calcium transport of AMPA receptors and inhibit suppression of NMDA receptor activation. By inhibiting suppression of NMDA receptor activation, NMDA receptors can induce glutamate and membrane voltage dependent activation.
  • the pharmaceutical composition of the present disclosure may contain the AMPA receptor antagonist in the form of a pharmaceutically acceptable salt.
  • Pharmaceutically acceptable salts include acid addition salts.
  • Acid addition salts include, for example, inorganic acid salts such as hydrochloride, hydrobromide, sulfate, hydroiodide, nitrate and phosphate, or citrate, oxalate, phthalate, Fumarate, maleate, succinate, malate, acetate, formate, propionate, benzoate, trifluoroacetate, methanesulfonate, benzenesulfonate, para-toluenesulfonic acid organic acid salts such as salts and camphorsulfonates;
  • Pharmaceutical compositions of the present disclosure may include the AMPA receptor antagonist in prodrug form.
  • Prodrugs are metabolized in the body and become effective in the body. Prodrugs are often made by esterifying their carboxyl or hydroxy groups. The ester bond is cleaved by esterases present in the body, releasing the active form from the prodrug.
  • Pharmaceutical compositions of the present disclosure may further comprise pharmaceutically acceptable excipients in addition to the AMPA receptor antagonist.
  • Pharmaceutically acceptable additives include excipients, disintegrants, binders, flow agents, lubricants, coating agents, solubilizers, solubilizers, thickeners, and dispersants, depending on the purpose. , stabilizers, sweeteners, flavors and the like can be used.
  • compositions of this disclosure may be formulated for oral or parenteral administration (eg, intravenous administration, etc.).
  • the dosage form is not particularly limited, but examples thereof include tablets, capsules, powders, granules, solutions, suspensions, injections, patches, poultices and the like.
  • Administration can be, for example, by oral administration or parenteral administration (eg, intravenous administration, intracerebroventricular administration, intracerebrospinal administration, etc.).
  • the dose can be, for example, 100-2,000 mg per adult.
  • a method of treating a disease or condition associated with NMDA-refractory in an NMDA-refractory subject or a subject with an NMDA-refractory NMDA receptor comprising administering to the subject a therapeutically effective amount of Methods are provided that include administering an AMPA receptor antagonist.
  • the subject, the disease or condition associated with NMDA refractory, and the AMPA receptor antagonist can each be as described above.
  • An aspect of the present disclosure provides a method of treating cognitive impairment in a subject in need thereof comprising administering to the subject a therapeutically effective amount of an AMPA receptor antagonist.
  • the subject, cognitive impairment, and AMPA receptor antagonist can each be as described above.
  • a method of inhibiting suppression of NMDA receptor activation in a subject having a hippocampus that expresses a calcium-permeable AMPA receptor comprising administering to the subject an effective amount of an AMPA receptor antagonist.
  • Methods are provided that include administering.
  • the subject, cognitive impairment, and AMPA receptor antagonist can each be as described above.
  • An aspect of the present disclosure provides a method of treating a subject with obesity or overweight comprising administering to the subject an effective amount of an AMPA receptor antagonist.
  • An effective amount can be an amount capable of slowing, halting the development of, or ameliorating obesity or overweight.
  • the subject may be on a restricted diet.
  • the subject can be a non-restricted subject.
  • the subject does not or has not been on a diet.
  • the subject undergoes or is undergoing dietary therapy.
  • cognitive impairment may be ameliorated in the subject.
  • obesity or overweight may be ameliorated in the subject.
  • Certain aspects of the present disclosure provide methods of treating a subject with dementia of the Alzheimer's type, comprising administering to the subject a therapeutically effective amount of an AMPA receptor antagonist.
  • a method of treating dementia of the Alzheimer's type in a subject in need thereof comprising administering to the subject a therapeutically effective amount of an AMPA receptor antagonist.
  • the subject can be, for example, a subject with preclinical Alzheimer's disease.
  • a subject can be, for example, a subject with an accumulation of A ⁇ in the brain.
  • a ⁇ accumulation can be assessed by positron emission tomography (PET).
  • PET positron emission tomography
  • the subject can be, for example, one with any of decreased A ⁇ 42 levels, increased total tau levels, and increased phosphorylated tau levels in the cerebrospinal fluid.
  • the subject can be, for example, a subject with mild cognitive impairment, or moderate cognitive impairment, or severe cognitive impairment.
  • the subject can be a subject with neurodegeneration in the hippocampus.
  • the subject can be a subject with neurodegeneration in the cerebral neocortex.
  • the subject can be, for example, a subject with tau accumulation in the brain. Tau accumulation in the brain can be assessed by PET.
  • An aspect of the present disclosure provides an AMPA receptor antagonist for use in the above methods.
  • pharmaceutical compositions comprising AMPA receptor antagonists for use in the above methods can be provided.
  • Certain aspects of the present disclosure provide for the use of AMPA receptor antagonists in the manufacture of a medicament for use in treating diseases or conditions associated with NMDA-refractory subjects in NMDA-refractory subjects. Also provided in certain aspects of the present disclosure is the use of an AMPA receptor antagonist in the manufacture of a medicament for use in treating cognitive impairment in a subject in need thereof. Certain aspects of the present disclosure provide use of an AMPA receptor antagonist in the manufacture of a medicament for use in inhibiting suppression of NMDA receptor activation in a subject having a hippocampus that expresses a calcium-permeable AMPA receptor. be done.
  • the subject, cognitive impairment, and AMPA receptor antagonist can each be as described above.
  • An AMPA receptor antagonist can be used in combination with memantine.
  • Memantine may be in the form of an addition salt, for example an acid addition salt, preferably a hydrochloride salt.
  • memantine can be used in combination, for example, as memantine hydrochloride.
  • combination pharmaceutical products are provided that include an AMPA receptor antagonist and memantine.
  • a combination pharmaceutical product is provided that includes a pharmaceutical composition comprising an AMPA receptor antagonist and a pharmaceutical composition comprising memantine. Combination pharmaceutical products can be used to treat cognitive impairment.
  • mice Male C57BL/6J background mice and ob/ob mice were obtained from CLEA Japan Inc., respectively. and obtained from Japan SLC (3). Female mice were selected because male mice are reported to be more susceptible to HFD-induced body weight gain, metabolic changes, impaired learning and hippocampal synaptic plasticity. The animals were housed 3-4 per cage in a standard 12-hour dark-light cycle room at 25° C. and provided with food and water ad libitum. All animal experiments were conducted in accordance with the guidelines of the University of the Ryukyus Animal Experiment Ethics Committee. Time-series changes in average food consumption and average body weight were monitored in each condition. Human amyloid precursor protein knock-in (APP-KI) mice was provided by Dr.
  • APP-KI Human amyloid precursor protein knock-in
  • CE-2 diet CLEA Japan, Inc., Tokyo
  • the composition of the CE-2 diet was as given in Table 1.
  • the CE-2 diet had a total energy of 339.1 kcal/100 g and crude fat of 4.61%.
  • F2HFD2 feed Oriental Yeast Co., Ltd., Tokyo, Japan
  • F2HFD2 has a total energy of 640 kcal and is composed of 58% lard (wt/wt), 30% fishmeal, 10% skim milk, 2% vitamin-mineral mixture (7.5% carbohydrate, 24.5% protein, corresponding to 60% fat) (7).
  • Other components of F2HFD were similar to CE-2.
  • Groups of 4-week-old mice were administered HFD (F2HFD2 diet). Control mice were fed a low-fat diet (CE-2 diet).
  • Perampanel mice HFD mice were orally administered HydroGel (Clear H2O , Portland, ME 04101, USA) at a dose of 5 mg/kg body weight (HFD treatment group with PER).
  • CE-2 diet (CLEA Japan, Tokyo) was used for ob/ob mice.
  • One HFD mouse and one ob/ob mouse per cage were orally administered PER at a dose of 5 mg/kg body weight (HFD mouse and ob/ob mouse PER administration group), and both groups were administered twice a week.
  • body weight and HydroGel intake were monitored and the dose of PER administered was adjusted to 5 mg/kg/body weight.
  • a wheeled activity wheel cage (MELQUEST, Japan, Model RWC-15) was used to monitor the activity of individual mice. Wheel rotation was monitored and recorded every 10 minutes for 14 days as previously reported (45).
  • the open field test and elevated plus maze open field test were performed as follows. Mice were allowed to move freely for 5 minutes in a space surrounded by 50 cm square and 40 cm high walls (Muromachi Kikai, Japan), and their trajectories were analyzed using the CompACT VAS/DV video tracking system (Muromachi Kikai, Japan). (46).
  • the elevated plus maze test was performed as follows. The space, set at a height of 50 cm from the floor, consisted of two open arms, two closed arms (each 30 cm x 6 cm) and a neutral zone. Mice were placed in the middle of the neutral zone facing the closed arm and allowed to move freely for 3 minutes. The time spent in the open and closed arms and the frequency of visits to different arms were recorded and scored using the CompACT VAS/DV video tracking system (Muromachi Kikai, Japan).
  • Novel Object Recognition Test CD, HFD, HFD with PER treatment mice were handled for 5 minutes each day for 5 days before starting the novel object recognition test.
  • PER means perampanel, an AMPA receptor antagonist.
  • On day 1 they were habituated to a 35 cm square by 25 cm high box for 10 minutes, and on day 2 they were given two identical objects (familiar objects) for 10 minutes.
  • On day 3 one of the familiar objects was replaced with a novel object of different shape and color (Fig. 2F).
  • the mouse behavior was observed with a video camera for 5 minutes, and the video was digitized and stored in a personal computer.
  • the search time for each object was measured by offline analysis (47).
  • a contextual-spatial recall Morris water maze task mediated by a pattern-completion test was performed as previously described (49) using CD, HFD, and HFD with PER-treated mice. All experiments were performed at approximately the same time of day. Mice were transported from the colony to the farm and left undisturbed for 30 minutes prior to experimentation. The test was performed in a rectangular dimly lit room with a 120 cm diameter circular pool (Muromachi Kikai, Tokyo, Japan) filled with opaque water with skim milk (Morinaga, Japan) kept at room temperature. Four large objects, illuminated by floor lamps, hung from the black curtains surrounding the pool as extra-maze cues.
  • a hidden circular platform 10 cm in diameter was placed 1 cm below the surface of the water and trained to find the platform at intervals of approximately 60 minutes, 4 times a day for 12 days.
  • mice were released from four pseudo-randomly assigned starting points (N, S, E, and W) and allowed to swim for 300 seconds. Mice that did not find the platform within 300 seconds were manually guided to the platform and allowed to rest on the platform for 15 seconds.
  • a probe test (P1) was performed on day 13 under full-cue conditions. Mice were released in the center of the pool and allowed to swim without a platform for 300 seconds. Following the probe trials, four training trials were performed in the presence of the platform to avoid memory loss that may have occurred during the probe trials.
  • the 5-trial social test was performed as previously described (19). In summary, CD, HFD, and HFD with PER treated mice were housed individually starting 7 days prior to testing to establish territory superiority. On the day of testing, female mice were presented to the cage of control male mice (Fig. 2G) and given four consecutive 5-minute trials at 10-minute intervals. On the fifth trial, a new female mouse was presented (Fig. 2G) and the social inquiry time was recorded.
  • Contextual Fear Conditioning was applied to published protocols with minor modifications (50). Mice were moved to the animal laboratory and acclimated for at least 30 minutes prior to contextual fear conditioning training. Mice were then placed in a footshock system model MK-450MSQ (Muromachi Kikai Co., Ltd., Japan) and allowed to explore for 2 minutes, followed by 3 electric footshocks (0.8 mA, 2 seconds, 2 minute intervals). gone. After resting for an additional minute, the animal was removed.
  • MK-450MSQ Moromachi Kikai Co., Ltd., Japan
  • MPRAGE three-dimensional (3D)-prepared rapid gradient-echo sequences were acquired as high-resolution 100 ⁇ m isovoxel images for voxel-based morphometry (matrix size: 280 ⁇ 220 ⁇ 220; field of view: 28 ⁇ 22 ⁇ 22 mm, repetition time: 2000 ms, echo time: 1.78 ms, flip angle: 12 degrees, inversion time: 800 ms, echo train length: 13, averaging times: 2).
  • a RARE (rapid acquisition protocol by relaxation enhancement) sequence was used to draw a region of interest on the acquired data image (matrix size: 280 ⁇ 220 ⁇ 220, field of view: 28 ⁇ 22 ⁇ 22 mm; repetition time: 1500 ms; echo time: 25 ms; flip angle: 180°).
  • MPRAGE and RARE images were acquired simultaneously in one scan.
  • For ex vivo mouse MRI data acquisition four PBS-fixed mouse heads were simultaneously placed in the MRI coil. Four mouse brains were confirmed using MRI raw data.
  • GM gray matter
  • DPM8 cerebrospinal fluid
  • the GM images were segmented using the tissue probability map of the SPMMouse toolbox. These segmented GM images enhanced contrast and normalized image deformation. Finally, these images were smoothed using the 200 ⁇ m isotropic Gaussian kernel method (installed on the SPM8 system). Smoothed images were applied for VBM analysis.
  • the volumes of hippocampal subfields (CA1, CA2, CA3, DG and EC) were calculated using ROI files (31,33,51,52).
  • the memory task consisted of 108 photographs of 16 lure sets (similar images), 16 repeat sets (same images), and 44 new items (new images). Participants asked whether the photographic stimulus presented on the display was a new item (new), a repeated identical picture (same), or a picture similar but not the same as the previous picture (lure). was instructed to respond with a button. The subject's button operations during the memory task were recorded on a personal computer, and the rate of correct answers for new, same, and lure was calculated. The percentage of correct answers for each task (new task, similar task, same task) was calculated using the following formula.
  • Correct answer rate (%) number of correct answers to presented tasks / total number of presented tasks x 100
  • the total number of task presentations for the new stimulus was set to 76, and the total number of task presentations for the same stimulus and the lure stimulus was set to 16 for both.
  • Anatomical brain images were obtained using a three-dimensional (3D) spoiled gradient recall (SPGR) sequence (slice thickness in sagittal plane: 1 mm, matrix size: 256 ⁇ 256, field of view: 256 ⁇ 256 mm, repetition time: 6.9 ms, echo time: 3 ms, flip angle: 15°).
  • SPGR spoiled gradient recall
  • a high-resolution T2-weighted fast spin-echo sequence matrix size: 512 ⁇ 512, field of view: 192 ⁇ 192 mm, repeat time: 4300 ms, echo time: 92 ms, in-plane resolution: 0.375 ⁇ 0.375 mm 2 , 23 slices, thickness: 3 mm, space: 0 mm).
  • Image acquisition MRI data for functional connectivity analysis were acquired using a GE Medical Discovery MR 750 3T scanner with a 32-channel head coil. Subjects, lying supine on the scanner bed, immobilized the head and neck with foam padding and a Philadelphia neck collar to minimize head movement. Resting fMRI images were acquired using a single-shot EPI sequence covering the whole brain (42 axial slices, 4 mm thickness, no interslice gap, repetition time 2000 ms, echo time 30 ms, flip angle 70°, Matrix size 64 ⁇ 64, field of view 256 ⁇ 256). A total of 150 volumes were shot in one session. Anatomical brain images were acquired using T1-weighted sagittal 3D SPGR sequences.
  • Image preprocessing and functional network analysis were performed using SPM12 and CONN toolbox 18. b (www.nitrc.org/projects/conn, RRID: SCR_009550 [Whitfield-Gabrieli and Nieto-Castanon, 2012]). Details are as described in the previous report (32). Images were preprocessed in the order of realignment, slice timing correction, coregistration, normalization, smoothing, and segmentation. Noise in the BOLD signal was removed by linear regression of potential confounding effects in the BOLD signal and temporal bandpass filtering (temporal frequency ⁇ 0.008 Hz or >0.09 Hz).
  • the default mode network (DMN) and functional connectivity were analyzed in functional network analysis using the CONN toolbox.
  • regions having a positive correlation with BOLD fluctuations in the posterior cingulate cortex (PCC) and precuneus were calculated as DMN maps.
  • regions having negative correlation with the DMN map were calculated as anti-correlated DMN maps.
  • Mean images of DMN maps and anti-correlated DMN maps for normal-weight, overweight and obese groups were calculated using a one-sample t-test (voxel-level threshold p ⁇ 0.001 (uncorrected), false discovery
  • the cluster-level threshold for the rate [FDR] was set at p ⁇ 0.05 (corrected)).
  • the functional connectivity analysis we computed the graph theory parameters nodes and edges.
  • Correlation coefficients of BOLD signal variation between each ROI were calculated with a seed-based connectivity metric (53) using a 132 ⁇ 132 ROI map (default ROI atlas in CONN toolbox).
  • ROI-to-ROI degree the number of edges any node has between each node
  • betweenness centrality the number of shortest paths of vertices through any pair of two nodes (j, i) in the graph
  • ROI-to-ROI correlation 132 ⁇ 132 matrix established using our 132 ⁇ 132 ROI map.
  • Degree is defined at each node as the number of edges from/to each node.
  • the degree (di) is defined by the following formula.
  • BC i represents a hub connecting other functional modules and nodes (54), and BC i is defined as follows.
  • P j, k is the number of nodes in the shortest path between each pair of nodes (k, j) (the shortest path when passing through an arbitrary node defined with i as a variable), and N is the number of nodes in the ROI map. Total number of nodes in the graph.
  • the average value and number of edges for each node were calculated for each of the normal weight group, overweight group, and obese group.
  • the anterior cingulate cortex, cerebellar lobule CrusI, and the hippocampus, which is related to hippocampal memory function were set as regions of interest as previously reported (32), and the functional connectivity of the three groups was analyzed.
  • a BrainNet viewer https://www.nitrc.org/projects/bnv/) was used to visualize functional connectivity maps for each group (55).
  • Hippocampal brain slices were prepared from 17-18 week old male C57BL/6J background mice and mice were divided into CD groups, HFD groups and PER treatment according to previous reports (56, 57). Alternatively, 12-13 week old ob/ob mice were divided into ob/ob and PER-treated ob/ob groups. After cutting slices (thickness, 300-400 ⁇ m) using a linear slicer (PRO 7N, Dosaka EM, Japan), the hippocampal brain slices were treated with a normal Krebs Ringer (125 mM NaCl, 2.5 mM KCl, 10 mM DCl).
  • Fluorescence intensity (F525) of Fluo-3 was monitored using a photomultiplier tube under a confocal microscope (excitation wavelength 488 nm; LSM5 PASCAL, Carl Zeiss, Germany).
  • Fluo-3 fluorescence images (512 ⁇ 512 pixels) were digitized and stored on a personal computer every 10 seconds for 50 minutes.
  • F525 in each region of CA1, CA2, CA3, DG, and EC is the average value of F525 (value 0 to 5 minutes before application of AMPA or NMDA) under offline analysis (Microsoft Excel, Microsoft Corporation, WA) Normalized (NF525).
  • brain sections were treated with 125 mM NaCl, 2.5 mM KCl, 10 mM D-glucose, 1.25 mM NaH2PO4 , 26 mM NaHCO3 , 2 mM CaCl2, 1 mM MgCl2 , and 2 mL of extracellular solution containing 1 ⁇ M tetrodotoxin was added in a perfusion chamber (35 mm ⁇ -dish, Ibidi GMBH, Graefelfing, Germany) with continuous bubbling with a gas mixture (95% O 2 ; 5% CO 2 ). /min.
  • the concentration of MgCl 2 was 0 mM to prevent Mg 2+ -dependent inhibition of NMDAR (58).
  • the maximum value of NF525 was estimated as the maximum value of NF525 within 5 minutes after application of AMPA (Tocris, Bristol, UK) (100 ⁇ M) or NMDA (Tocris, Bristol, UK) (50 ⁇ M).
  • Cyclothiazide (CTZ) 100 ⁇ M was used to prevent AMPAR desensitization
  • glycine Tocris, Bristol, UK
  • 10 ⁇ M was used to activate NMDAR
  • perampanel Eisai Co, Ltd., Tokyo
  • GYKI GYKI47261
  • AAV (2R)-amino-5-phosphonovaleric acid
  • NASPM 1-Naphthylacetylspermine
  • CA1, CA2, CA3, DG, and EC regions were treated with ice-cold artificial cerebrospinal fluid (ARTCEREB; Otsuka Pharmaceutical Co., Ltd., Tokyo, Japan) supplemented with 2 mM BS3 (Thermo Fisher Scientific, Wilmington, DE, USA). It was added to a filled Eppendorf tube (Eppendorf, Hamburg, Germany). Incubation was performed on ice for 30 minutes. Crosslinking was terminated by quenching the reaction with 100 mM glycine (10 min at 4°C).
  • ARTCEREB Otsuka Pharmaceutical Co., Ltd., Tokyo, Japan
  • 2 mM BS3 Thermo Fisher Scientific, Wilmington, DE, USA
  • Hippocampal subregions were lysed in ice-cold lysis buffer containing protease and phosphatase inhibitors (25 mM HEPES, pH 7.4, 500 mM NaCl, 2 mM EDTA, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 20 mM NaF). , 1 mM sodium orthovanadate, 10 mM sodium pyrophosphate, 1 ⁇ protease inhibitor mixture [Sigma-Aldrich, St Louis, Mo.], and 0.1% Nonidet P-40 [v/v]]). Cloudy and rapidly homogenized by sonication for 5 seconds. Total protein concentration of lysates was determined using the Lowry method (61).
  • Membranes were then incubated overnight at 4° C. with anti-GluA1 (1:1000, Merck Millipore, Burlington, Mass.) and actin (1:5000, Protein Tech, Chicago, IL, USA). Membranes were incubated with HRP-labeled anti-rabbit IgG (1:3,000, Cell Signaling Technology, Danvers, Mass., USA) for 30 minutes and washed extensively again with TBS-T. After immersing the membrane in the chemiluminescent detection substrate Chemi-Lumi One (Nacalai Tesque, Tokyo, Japan) for 1 minute, luminescence was detected using a LuminoGraph1 imaging system (Atto, Tokyo, Japan). The surface and intracellular bands of each lane were analyzed using CS Analyzer (Atto, Tokyo, Japan).
  • Mouse CA1, CA2, CA3, DG, EC regions were isolated and homogenized in disposable BioMasher2TM tubes (Nippi, Nippi, USA) using 0.5 mL of TRIzol RNA isolation reagent (Thermo Fisher Scientific, Wilmington, DE). Tokyo, Japan). Total RNA was extracted from each region separately according to the rest of the TRIzol RNA isolation reagent protocol provided by the manufacturer (Thermo Fisher Scientific, Wilmington, Del.). 1 ⁇ g of total RNA was reverse transcribed using PrimeScript RT Reagent Kit (Takara, Shiga, Japan).
  • Relative expression levels of target genes in each sample were determined using a standard curve and normalized to the expression level of ⁇ -actin in the same samples.
  • the sequences of primers and probes for these genes are shown in Supplementary Table 2.
  • the ratio of mRNA amount of GluA2/(mRNA amount of GluA1+GluA3+GluA4)" was used as a Ca 2+ permeability index.
  • the template for Sanger sequencing of the Sanger sequencing GluA2 editing site is cDNA was amplified and prepared using a forward primer (GAGGAATTTGAAGATGGAAGAGA: SEQ ID NO: 44) and a reverse primer (AGGAGGAGATGATGATGAGAGGGT: SEQ ID NO: 45).
  • PCR products (10%) were confirmed by agarose gel electrophoresis.
  • the PCR products were purified using the innuPREP PCRpure Lite Kit (Analytik Jena, Jena, Germany) according to the manufacturer's instructions prior to direct sequencing.
  • Cycle sequencing was performed using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, CA, USA) and each primer described above. Sanger sequence analysis was performed using ABI3500 (Applied Biosystems, CA, USA) and sequence viewer software 4Peaks.
  • the Q/R editing status of GluA2 was analyzed using a QuantStudio TM 3D digital PCR system equipped with a TaqManTM custom SNP genotyping assay (Thermo Fisher Scientific, Wilmington, Del.). TaqMan probes were synthesized by Thermo Fisher Scientific, and VIC-labeled probes were used to detect unedited (Q) sequences, and FAM-labeled probes were used to detect edited (R) sequences (5′ CATCCTTGCTGCATAAA 3′: SEQ ID NO: 46, 5′ ATCCTTGCCGCATAAA 3′: SEQ ID NO: 47).
  • Mouse forward primer 5' TTGGGATTTTTAATAGTCTCTGGTTTTCCTT 3' (SEQ ID NO: 48) and mouse reverse primer: 5' GACCAACCTTGGCGAAATATCG 3' (SEQ ID NO: 49).
  • 5-50 ng of cDNA was mixed with a digital PCR master mix (Thermo Fisher Scientific, Wilmington, Del.) and the mixed TaqMan probes were loaded onto a QuantStudio TM 3D digital PCR 20K chip (Thermo Fisher Scientific, Wilmington, Del.) using an automated chip loader according to the manufacturer's instructions. , Wilmington, DE, USA).
  • the loaded chip was amplified using the Gene Amp 9700 PCR system (Thermo Fisher Scientific, Wilmington, DE, USA) under the following conditions. 39 cycles of 10 min at 96°C, 2 min at 56°C, 30 sec at 98°C were followed by a final extension step of 2 min at 60°C. After amplification, the chips were imaged using the QuantStudio 3D Instrument (Thermo Fisher Scientific, Wilmington, DE, USA). For chip data analysis, QuantStudio 3D Analysis Suite Cloud Software (Thermo Fisher Scientific, Wilmington, Del.) was used for relative and quantitative data analysis.
  • Golgi staining and image acquisition of the whole hippocampus Four coronal sections (5 mm wide, including the whole hippocampus from dorsal to ventral and medial to lateral) of the mouse brain from Bregma ⁇ 0.94 mm to Bregma ⁇ 4.04 mm were cut. % paraformaldehyde for 2 days and then stained with the Golgi Cox staining system (FD Rapid GolgiStain TM Kit, MD 21041, USA).
  • the impregnated tissue was cut into 100 ⁇ m sections, counterstained with crystal violet, and the total number of 15 ⁇ m spines in the apical dendrites of CA1 and DG and the percentage of morphological spines (thin, stubby, mushroom) were evaluated using Axio. Observer Z1 (Carl Zeiss, Germany) was used.
  • Another set of paraformaldehyde-fixed, 5-mm-wide coronal sections of the brain, including the entire hippocampus, were processed using the passive CLARITY technique (PACT) (62) and analyzed using a 10x clear objective as described in Lightsheet Z. et al.
  • Thy1-YFPH transgenic wild-type mice (Carl Zeiss, Germany) and Thy1-YFPH transgenic wild-type mice (The Jackson Laboratory, stock number: 003709, strain name: B6.Cg-Tg.(Thy1-YFP)16Jrs/J) (63, 64). ), HFD-fed mice, and 3D images of the whole hippocampus of HFD-fed mice with PER treatment were acquired, respectively.
  • the Z-stack function allows you to acquire a series of XY images at different focus positions and create a Z-stack.
  • the specimens yielded dorsal-to-lateral and medial-to-lateral 400 ⁇ m ⁇ 400 ⁇ m 3D datasets of CA1, CA3 and DG, respectively.
  • the gallery view displays images from the Z-stack in chronological order.
  • Mouse brains were perfusion-fixed with 4% paraformaldehyde, embedded in paraffin, cut into 4-micrometer-thick sections, and treated with a monoclonal antibody against DCX (E-6 monoclonal, 1:50, Santa Cruz Biotechnology). Inc, Dallas, USA), MAP2ab (AP-20 monoclonal, 1:100, SIGMA-ALDRICH, St. Louis, USA), GluA1 (AB1540 polyclonal, 1:100, EMD Millipore Corp., Burlington, USA), GluA2 ( AB1768-1 polyclonal, 1:5, EMD Millipore Corp., Burlington, USA) was used for immunohistochemical analysis.
  • DCX E-6 monoclonal, 1:50, Santa Cruz Biotechnology. Inc, Dallas, USA
  • MAP2ab AP-20 monoclonal, 1:100, SIGMA-ALDRICH, St. Louis, USA
  • GluA1 AB1540 polyclonal, 1:100, EMD Millipore Corp., Bur
  • Quantitative Immunostaining Areas by ZEISS ZEN Inicis Software Acquisition of immunostaining areas in each expression area of MAP2, GluA1 and GluA2 was performed using a ZVI format AxioVision (Carl Zeiss, Germany) microscope (20X objective). Generation of data image processing with image segmentation was performed using machine learning with ZEN Inicis software. Over 1000 cells were examined in each group. A one-way analysis of variance was used to test the variance among the three groups, excluding data with 3 SD or more. Then, the following sample numbers were used.
  • the Bonferroni method was used for post hoc testing to analyze significant differences between groups.
  • RNA-seq analysis Sequenced raw RNA-seq fastq reads were analyzed using HISAT2 (v.2.2.0) for mouse GRCm38 (ensemble release 104, http://ftp.ensemble.org/pub/release -104/fasta/mus_musculus/dna/) (65). The average mapping rate for all samples was 94.21% (range 88.70-96.30%). Aligned reads were quantified using Salmon (v.0.14.2) (66) and TPM values were calculated using StringTie (v.2.1.2) (67). Variant calling was performed using GATK package (v.3.8) (70) according to GATK Best Practices for RNAseq short variant discovery (68, 69).
  • RNA-editing levels were calculated as the ratio of the total number of reads aligned to the R/Q editing site of GluA2 (chr3: 80706912) and the number of reads TC converted at this site.
  • HFD stimulates AMPAR-mediated calcium influx in the mouse hippocampus.
  • Direct measurements of intracellular calcium concentration [Ca 2+ ]i) were taken to track hippocampal calcium signaling (Fig. 1A, Supplementary Data Movie 1) in acute brain slices of the hippocampus with HFD.
  • 100 ⁇ M AMPAR with 100 ⁇ M CTZ cyclothiazide; channel desensitizer
  • EC entorhinal cortex
  • CA1 cornu ammonis 1
  • CA2, CA3, and DG dentate gyrus
  • HFD alters the expression of glutamate receptor subunits.
  • AMPAR-mediated [Ca 2+ ]i changes were observed in mice fed HFD for at least 7 days (Fig. 7A, B, C).
  • these mice maintained NMDAR-mediated activation in EC, DG, CA3, CA2, CA1 even when bathing with 50 ⁇ M NMDA plus 10 ⁇ M glycine.
  • these pathological AMPAR-mediated increases in [Ca 2+ ]i were completely abolished by the addition of 100 ⁇ M PER, similarly 100 ⁇ M GYKI47261 (Tocris, UK, Bristol) and Ca 2+ permeabilization.
  • CP-AMPARs Ca 2+ -permeable AMPARs
  • ALS amyotrophic lateral sclerosis
  • 13 neuropathic pain
  • AMPAR- and NMDAR-mediated alteration of calcium dynamics in [Ca 2+ ]i may play an important role in obesity with cognitive decline.
  • AMPAR mediates the fastest rate of excitatory neurotransmission.
  • AMPAR is composed of four subunits GluA1-4 that determine the functional properties of AMPAR channels, and AMPAR diversity is due to the abundance of these subunits.
  • the GluA2 subunit is essentially Ca 2+ impermeable, whereas the other subunits of GluA1, GluA3, and GluA4 are Ca 2+ permeable.
  • the Ca 2+ permeability of AMPARs is regulated by the relative amount of GluA2 expression. That is, an increase in the relative amount of the GluA2 subunit would decrease the Ca 2+ permeability of AMPAR, and a decrease in the relative amount would increase the Ca 2+ permeability of AMPAR.
  • GluA2 is edited at the Q/R site within the reentrant M2 membrane loop region by adenosine deaminase (ADAR2) acting on RNA type 2, involved in the editing of double-stranded RNA from adenosine (A) to inosine (I).
  • ADAR2 adenosine deaminase
  • RNA type 2 involved in the editing of double-stranded RNA from adenosine (A) to inosine (I).
  • qRT-PCR Real-time quantitative reverse transcription-polymerase chain reaction
  • RNA in hippocampal subregions (CA1, CA3, DG, EC) was isolated and quantitative analysis of mRNA for GluA1, GluA2, GluA3, GluA4 for AMPAR, GluN1, GluN2A, GluN2B, GluN2C for NMDAR was performed qRT- Performed by PCR.
  • the results showed significantly elevated expression of GluA1, GluN1, and GluN2B in the CA3 region associated with HFD-fed mice, and elevated expression of GluN2B in the DG (p ⁇ 0.05 each), suggesting HFD with PER.
  • the ratio of GluA2 to other GluA subunits was determined. In addition, the ratio was taken as the Ca 2+ permeability index (Ca 2+ -permeability index).
  • NMDA receptors Activation of NMDA receptors is not required for pattern completion during association in memory retrieval (22), and our data suggest that a change in AMPA receptors to a calcium-permeable form is responsible for the ability of HFD mice to complete pattern completion. It was suggested to play an important role in disability.
  • Golgi staining showed that PER restored the complete runnability loss of the dendritic network in CA1 of HFD mice (Fig. 3E, upper left panel).
  • staining with an anti-MAP2 antibody showed that dendrite motility was lost in the CA1 region, and PER completely restored dendrite motility (Fig. 3E, upper left panel).
  • the CA1 GluA1 immunostaining reaction was significantly enhanced in HFD mice, but was reduced by PER treatment and the GluA2/GluA1 ratio was increased.
  • AD model mice NL-GF mice begin to accumulate A ⁇ in the brain from 8 weeks of age (Nat. Neurosci. 2014 17, 661-4 ).
  • the results of the novel object recognition test of mice at 13 weeks of age were as shown in FIG. As shown in FIG.
  • AD model mice cannot distinguish between mice in the same room and mice in the first meeting, whereas in the perampanel (PER) administration group, mice in the same room and mice in the first meeting have a significant difference. made a distinction between This result indicates that CA induced dysfunction in NL-GF mice, whereas AMPA receptor antagonists suppressed the development of this dysfunction.
  • AMPA receptor antagonists suppressed the development of this dysfunction.
  • Leptin 25,26
  • NMDAR-mediated synaptic transmission plays a role (27).
  • HFD-fed mice generally initially show elevated leptin, one of the hallmarks of obesity, and over time, chronic obesity develops leptin resistance, resulting in an inability to suppress appetite and promote energy expenditure.
  • All of Gyki, Naspm, and PER showed significant inhibitory effects on CP-AMPAR in ob/ob mice in all regions of EC, CA1, CA2, CA3, and DG (Fig. 10-1A ).
  • AMPA was used at 100 ⁇ M
  • CTZ was used at 100 ⁇ M
  • NMDA was used at 50 ⁇ M
  • PER was used at 100 ⁇ M
  • glycine was used at 10 ⁇ M
  • APV was used at 50 ⁇ M
  • Naspm was used at 10 ⁇ M
  • Gyki was used at 100 ⁇ M
  • leptin was used at 100 nM. * indicates p ⁇ 0.05 in the t-test.
  • Ob/ob mice were analyzed as a leptin-deficient obese model and a leptin-resistant obese model. Specifically, we analyzed these leptin-deficient/resistant models on high-resolution MRI, tissue morphology in staining for MAP2, GluA1, GluA2, qRT-PCR, and behavioral analysis. This revealed whether the leptin-deficient/resistant state affected hippocampal morphology (Fig. 4). We demonstrated CP-AMPAR-mediated [Ca 2+ ]i elevations in HFD-fed mice as well (Fig. 1A–E) and in all hippocampal slices (EC, CA1, CA2, CA3, and DG) of ob/ob mice.
  • Ob/ob mice and their littermates with wild-type traits were obtained as offspring of ob+/- mice. These mice were fed ad libitum and some of the ob/ob mice were fed a diet containing 5 mg/kg body weight perampanel from 8 to 12 weeks of age. Appearance and body weight of these mice were compared at 12 weeks of age. The results were as shown in FIG. As shown in FIG. 24, compared to ob/ob mice, perampanel-treated mice were prevented from overweight and exhibited a leaner appearance closer to wild type. This result suggests that administration of perampanel is effective in treating obesity and overweight. In addition, it was suggested that cognitive impairment may lead to an increase in food intake, and that the amount of contact may be suppressed by reducing cognitive impairment by administering an AMPA receptor antagonist.
  • the amount of food fed was uniform (see lower panel of Figure 25)
  • the body weights were monitored. bottom.
  • significant weight loss was observed in the PER-containing HFD-fed group than in the HFD-fed group. This suggested that in overweight or obese subjects, AMPA receptor antagonists produced weight loss effects even without reducing food intake.
  • fMRI behavioral tasks 35, 36 analyze variations in blood oxygenation level dependent (BOLD) response, hippocampal memory function of pattern complementation, and pattern separation ability (formation of distinct representations of similar inputs).
  • BOLD blood oxygenation level dependent
  • hippocampal memory function of pattern complementation hippocampal memory function of pattern complementation
  • pattern separation ability formation of distinct representations of similar inputs.
  • BMI blood oxygenation level dependent
  • the structural network that supports pattern completion is based on CA3 and CA1.
  • a central role for this region in ensemble dynamics (dynamic synchronization) was observed in healthy volunteers (37) (Fig. 5H).
  • the overweight group did not reveal significant cognitive decline compared to the control group (Fig. 5I).
  • a functional connectivity map for each group was generated by seed-based analysis, with the posterior cingulate cortex and precuneus set as default mode networks, and the anterior cingulate cortex and hippocampal memory cerebellar lobule CrusI functioned as regions of interest (35). ).
  • the different network connections among subjects in each classified group are shown in FIG. 6B. Specific alternations between larger networks and centrality mapping associated with disruption of modular autonomy are evident in the overweight and obese groups compared to the normal BMI group, leading to failure of correct memory retrieval. rice field. Independent network formation of the default mode network (DMN), saliency network (SN), affective network (EN), and cerebellar network (CBN) was observed in the normal weight group.
  • DN default mode network
  • SN saliency network
  • EN affective network
  • CBN cerebellar network
  • a Central Enforcement Network (CEN) was added to that of the normal weight group, demonstrating new connectivity between the DMN and CEN. Endogenous connections within ENs and CBNs also increased. Intrinsic connectivity of the CEN and visual network (VN) was enhanced in the obese group, with bilateral insular cortices emerging in the SN. Centrality between the anterior cingulate cortex and cingulate gyrus was enhanced over the other two groups. Connectivity between different functional networks (DMN, SN, CEN, CBN and VN) was enhanced in the obese group. The total number of nodes in the normal-weight, overweight, and obese groups was estimated to be 17, 21, and 23, respectively (Fig. 6B,C).
  • AMPA Receptor Antagonists to Severely Obese Women
  • body weight of a 70-year-old woman with a BMI value of 38 were investigated.
  • Antiepileptic therapy was administered after tumor resection.
  • 2 mg/day (later changed to 4 mg/day) of perampanel was orally administered. Changes in body weight and lower extremity Fugl-meyer assessment score of the woman were observed.
  • the size of the hippocampus was also assessed from MRI of the woman's brain 26 weeks after surgery. The results were as shown in FIG. As shown in FIG. 26, administration of PER clearly increased the size of the hippocampus (see the frame in the upper photograph of the figure). The numerical values were as shown in Table 6 below.
  • AMPA receptor antagonists increased hippocampal volume in women. Furthermore, as shown in Figure 27, the women's body weight decreased steadily after administration of the AMPA receptor antagonist. The results are similar to those shown in Figures 24 and 25.
  • NMDA receptors were inactivated.
  • Expression of calcium ion-dependent NMDA receptors and reactivity to NMDA and glycine were confirmed in mice (2w HFD) fed with HFD for 2 weeks. The results were as shown in panel A of FIG.
  • Brain slices of the 2w HFD group were treated in the presence of 3 ⁇ M BAPTA-AM or under calcium ion-free conditions for 60 minutes, after which the treated brain slices were subjected to calcium ion imaging.
  • addition of NMDA and glycine did not activate NMDA receptors in any brain region, and NMDA receptors were inactivated.
  • D-( ⁇ )-2-amino-5-phosphonovaleric acid (APV) 50 ⁇ M
  • Panel B of FIG. 28 shows a comparison of maximum normalized fluorescence intensity (calcium ion concentration).
  • HFD central role of CP-AMPAR in obesity-related cognitive decline
  • HFD stimulates hippocampal calcium dynamics via AMPAR, subunit structure rearranges from non-CP-AMPAR to CP-AMPAR, and NMDAR calcium signaling was shown to downregulate Ca 2+ influx by altering .
  • Inactivation of transmission by NMDAR function is thought to correspond to cognitive decline.
  • CP-AMPAR caused a decrease in hippocampal size and cell number (particularly CA3), decreased dendritic integrity of CA1, and spine maturation in the DG region. It was found that ingestion of HFD for 7 days or longer affected hippocampal memory circuits via calcium signals. This short-term intake preserved NMDAR-mediated calcium dynamics, but revealed AMPAR-mediated calcium entry in the hippocampus.
  • NMDAR-mediated calcium entry Long-term intake over 8 weeks after weaning completely reduced NMDAR-mediated calcium entry, accompanied by changes in AMPAR-mediated calcium dynamics.
  • AMPAR and NMDAR are involved in high-speed transmission of glutamate-based synapses, are localized in postsynaptic membranes, and play important roles in human cognition such as learning and memory.
  • Inhibition of calcium entry into synapses by NMDARs is regulated by intracellular calcium concentrations regardless of the source of calcium, including AMPARs, voltage-gated calcium channels, internal stores, and NMDARs (9).
  • AMPARs co-localize with NMDARs and mediate excitatory synaptic responses on the tenth millisecond time scale, whereas HFDs increase calcium entry of these receptors and ultimately NMDARs. decreased the magnitude of calcium currents through In addition to inducing synaptic plasticity (LTP/LTD) (36), NMDARs have been reported to play an important role in regulating appetite and food preferences, which can be attributed to gluttony, rebound due to failed dietary restrictions, It is thought to cause a vicious cycle of increased obesity (37), ultimately further accelerating cognitive decline. Attempts to restore neuronal function by activating NMDARs through AMPAR-mediated hyperstimulation have also been shown to promote neuronal injury (72).
  • Altered glutamatergic synaptic transmission affects functional network connectivity in resting fMRI data.
  • High BMI is associated with cognitive impairment in the young (38), and overweight and obesity in the middle-aged. May increase future risk of cognitive decline in old age.
  • HFD induces obesity and causes hypertension, type 2 diabetes, cardiovascular events, and patients with these diseases are at increased risk of cognitive decline (40, 41).
  • Effective treatment and disease control are presumably hampered by the inability to provide adequate lifestyle management, including dietary self-regulation. In medicine, developing effective interventions for cognitive decline associated with obesity is key to better disease management.
  • AMPAR is an Attractive Target for Cognitive Decline
  • a high frequency of occurrence of hydrocephalus was seen among early-onset obese mouse groups.
  • obesity begins in early childhood, from 2 to 6 years old (46), and most children who are obese at that age were also obese in adolescence.
  • Appropriate and effective interventions are urgent challenges for human health and disease.
  • application of HFD with PER treatment restored dysregulated calcium signaling through both AMPARs and NMDARs, and at the same time induced restoration of brain size and behavioral memory capacity. Preventing weight gain due to obesity has health benefits.
  • an AMPA receptor antagonist suppresses the deposition of ⁇ -amyloid.
  • perampanel was used as an AMPA receptor antagonist. It was found to significantly increase the A ⁇ 40 ratio, reduce A ⁇ deposition, and suppress A ⁇ accumulation in the hippocampus and cerebrum of model mice.
  • Biomarkers of Alzheimer's disease include CSF (cerebrospinal fluid) and plasma (plasma) levels of A ⁇ 42/A ⁇ 40 ratio, phosphorylated tau (P-tau) at threonine 181 and 217, neurofilament light (NfL) (Curr Opin Neurol 2021 1 266-274). It has been suggested that the A ⁇ 42/A ⁇ 40 ratio can predict A ⁇ accumulation in PET (Doecke JD et al., Neurology 2020). NL-GF (-/-) mouse hippocampus on embryonic day 17-19 was removed, cultured by the Neurosphere method of Brewer GJ et al. The serum was measured by the EIA method.
  • mice treated with perampanel showed decreased A ⁇ accumulation.
  • AD Alzheimer's disease
  • Epilepsy occurs more frequently in AD patients than in control populations (Pascal E 2012), and the incidence of epilepsy is 7-21% in sporadic AD patients (Amatniek et al., 2012). 2006; Hauser et al., 1986; Mendez and Lim, 2003), increasing to 30% in early-onset familial AD (FAD) (Palop and Mucke, 2009; Larner and Doran, 2006).
  • FAD early-onset familial AD
  • Early insidious hippocampal hyperexcitability was detected in AD patients (Lam AD et al., Nat Med 2017). As shown in FIG.
  • Perampanel inhibits glutamate-induced activation of AMPA receptors on the postsynaptic membrane and is a non-competitive AMPA receptor antagonist for epileptic patients aged 12 years and older with partial-onset seizures (including secondary generalized seizures) during tonic seizures. It is indicated for primary seizures and partial seizures (including secondary generalized seizures) in epileptic patients aged 4 and over. seems to be suitable.
  • AMPA receptor antagonists work with memantine to improve cognitive function of dementia subjects. Memantine and exercise load, memantine and perampanel, or perampanel alone (5 mg/kg or 10 mg/kg) were administered and subjected to behavioral experiments. As behavioral tests, a novel object recognition test and a hippocampal function-dependent fear conditioning test were performed. Memantine is an antagonist of the NMDA receptor, but it has different properties than other NMDA receptor antagonists (see Hokama Y., et al., Neuro Oncology, 2022, noac162). Thus, memantine is a drug that only works when there is an excess of glutamate in the brain. Memantine also acts more favorably on non-synaptic NMDA receptors (extrasynaptic NMDARs) than on synaptic site NMDA receptors (synaptic NMDARs).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Neurosurgery (AREA)
  • Epidemiology (AREA)
  • Neurology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Psychiatry (AREA)
  • Hospice & Palliative Care (AREA)
  • Child & Adolescent Psychology (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/JP2022/034602 2021-09-15 2022-09-15 認知機能低下、または過体重もしくは肥満症を処置することに用いるための医薬組成物 Ceased WO2023042888A1 (ja)

Priority Applications (3)

Application Number Priority Date Filing Date Title
JP2023548506A JPWO2023042888A1 (https=) 2021-09-15 2022-09-15
US18/692,070 US20250281474A1 (en) 2021-09-15 2022-09-15 Pharmaceutical composition for treating cognitive decline or for treating overweightness or obesity
EP22870035.7A EP4403185A4 (en) 2021-09-15 2022-09-15 PHARMACEUTICAL COMPOSITION INTENDED FOR USE IN THE TREATMENT OF EITHER THE DECLINE OF COGNITIVE FUNCTIONS OR OVERWEIGHT OR OBESITY

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
JP2021150246 2021-09-15
JP2021-150246 2021-09-15
JP2022-128639 2022-08-12
JP2022128639 2022-08-12

Publications (1)

Publication Number Publication Date
WO2023042888A1 true WO2023042888A1 (ja) 2023-03-23

Family

ID=85602989

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2022/034602 Ceased WO2023042888A1 (ja) 2021-09-15 2022-09-15 認知機能低下、または過体重もしくは肥満症を処置することに用いるための医薬組成物

Country Status (4)

Country Link
US (1) US20250281474A1 (https=)
EP (1) EP4403185A4 (https=)
JP (1) JPWO2023042888A1 (https=)
WO (1) WO2023042888A1 (https=)

Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
LU73068A1 (https=) 1974-07-27 1976-07-01
EP0283959A1 (en) 1987-03-23 1988-09-28 Novo Nordisk A/S Heterocyclic compounds and their preparation and use
WO1992007847A1 (fr) 1990-11-06 1992-05-14 Yamanouchi Pharmaceutical Co., Ltd. Derive de pyrazine fusionnee
WO1995012594A1 (fr) 1993-11-05 1995-05-11 Rhone-Poulenc Rorer S.A. 7H-IMIDAZO(1,2-a)PYRAZINE-8-ONE ANTAGONISTES DU RECEPTEUR NMDA
WO1995021842A1 (en) 1994-02-11 1995-08-17 Novo Nordisk A/S Heterocyclic compounds and their preparation and use
WO1996010023A1 (en) 1994-09-27 1996-04-04 Yamanouchi Pharmaceutical Co., Ltd. 1,2,3,4-tetrahydroquinoxalindione derivative
WO1996015100A1 (en) 1994-11-09 1996-05-23 Novo Nordisk A/S Heterocyclic compounds, their preparation and use
US5639751A (en) 1990-12-21 1997-06-17 Cyogyszerkutato Intezet Kft N-acyl-2,3-benzodiazepine derivatives for treating acute and chronic neurodegenerative disorders
WO1997032858A1 (en) 1996-03-05 1997-09-12 Fujisawa Pharmaceutical Co., Ltd. Quinoxaline derivatives as glutamate receptor antagonists
WO1998017652A1 (de) 1996-10-18 1998-04-30 Boehringer Ingelheim Pharma Kg Oxadiazole, verfahren zu ihrer herstellung sowie ihre verwendung als arzneimittel
WO1999006408A1 (en) 1997-07-31 1999-02-11 Gyógyszerkutató Intézet Kft. New 2,3-benzodiazepine derivatives
WO1999007707A1 (en) 1997-08-12 1999-02-18 EGIS Gyógyszergyár Rt. 8-SUBSTITUTED-9H-1,3-DIOXOLO/4,5-h//2,3/BENZODIAZEPINE DERIVATIVES, AS AMPA/KAINATE RECEPTOR INHIBITORS
WO2003082332A1 (en) 2002-03-29 2003-10-09 Yamanouchi Pharmaceutical Co., Ltd. Remedy for glioblastoma
US6949571B2 (en) 2000-06-12 2005-09-27 Eisai Co., Ltd. 1,2-dihydropyridine compounds, process for preparation of the same and use thereof
WO2005094797A2 (en) * 2004-03-05 2005-10-13 Novartis Ag Use of ampa-receptor antagonists for treating dementia
JP2008538216A (ja) * 2005-04-04 2008-10-16 エーザイ・アール・アンド・ディー・マネジメント株式会社 神経変性疾患および認知症のためのジヒドロピリジン化合物
JP2010520154A (ja) * 2007-03-05 2010-06-10 エーザイ・アール・アンド・ディー・マネジメント株式会社 神経変性疾患のためのampaレセプターアンタゴニストおよびnmdaレセプターアンタゴニスト
WO2011076946A2 (en) * 2009-12-24 2011-06-30 Universidad Del País Vasco Methods and compositions for the treatment of alzheimer

Patent Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
LU73068A1 (https=) 1974-07-27 1976-07-01
EP0283959A1 (en) 1987-03-23 1988-09-28 Novo Nordisk A/S Heterocyclic compounds and their preparation and use
WO1992007847A1 (fr) 1990-11-06 1992-05-14 Yamanouchi Pharmaceutical Co., Ltd. Derive de pyrazine fusionnee
US5639751A (en) 1990-12-21 1997-06-17 Cyogyszerkutato Intezet Kft N-acyl-2,3-benzodiazepine derivatives for treating acute and chronic neurodegenerative disorders
WO1995012594A1 (fr) 1993-11-05 1995-05-11 Rhone-Poulenc Rorer S.A. 7H-IMIDAZO(1,2-a)PYRAZINE-8-ONE ANTAGONISTES DU RECEPTEUR NMDA
WO1995021842A1 (en) 1994-02-11 1995-08-17 Novo Nordisk A/S Heterocyclic compounds and their preparation and use
WO1996010023A1 (en) 1994-09-27 1996-04-04 Yamanouchi Pharmaceutical Co., Ltd. 1,2,3,4-tetrahydroquinoxalindione derivative
WO1996015100A1 (en) 1994-11-09 1996-05-23 Novo Nordisk A/S Heterocyclic compounds, their preparation and use
WO1997032858A1 (en) 1996-03-05 1997-09-12 Fujisawa Pharmaceutical Co., Ltd. Quinoxaline derivatives as glutamate receptor antagonists
WO1998017652A1 (de) 1996-10-18 1998-04-30 Boehringer Ingelheim Pharma Kg Oxadiazole, verfahren zu ihrer herstellung sowie ihre verwendung als arzneimittel
WO1999006408A1 (en) 1997-07-31 1999-02-11 Gyógyszerkutató Intézet Kft. New 2,3-benzodiazepine derivatives
WO1999007707A1 (en) 1997-08-12 1999-02-18 EGIS Gyógyszergyár Rt. 8-SUBSTITUTED-9H-1,3-DIOXOLO/4,5-h//2,3/BENZODIAZEPINE DERIVATIVES, AS AMPA/KAINATE RECEPTOR INHIBITORS
US6949571B2 (en) 2000-06-12 2005-09-27 Eisai Co., Ltd. 1,2-dihydropyridine compounds, process for preparation of the same and use thereof
WO2003082332A1 (en) 2002-03-29 2003-10-09 Yamanouchi Pharmaceutical Co., Ltd. Remedy for glioblastoma
WO2005094797A2 (en) * 2004-03-05 2005-10-13 Novartis Ag Use of ampa-receptor antagonists for treating dementia
JP2008538216A (ja) * 2005-04-04 2008-10-16 エーザイ・アール・アンド・ディー・マネジメント株式会社 神経変性疾患および認知症のためのジヒドロピリジン化合物
JP2010520154A (ja) * 2007-03-05 2010-06-10 エーザイ・アール・アンド・ディー・マネジメント株式会社 神経変性疾患のためのampaレセプターアンタゴニストおよびnmdaレセプターアンタゴニスト
WO2011076946A2 (en) * 2009-12-24 2011-06-30 Universidad Del País Vasco Methods and compositions for the treatment of alzheimer

Non-Patent Citations (81)

* Cited by examiner, † Cited by third party
Title
1. VALLADOLID-ACEBES, P. STUCCHI, V. CANO, M. S. FERNANDEZ-ALFONSO, B. MERINO, M. GIL-ORTEGA, A. FOIE, L. MORALES, M. RUIZ-GAYO, N, NEUROBIOL. LEARN. MEM., vol. 95, 2011, pages 80 - 85
A. C. BOUDREAUJ. M. REIMERSM. MILOVANOVICM. E. WOLF, J. NEUROSCI., vol. 27, 2007, pages 10621 - 10635
A. E. DORRJ. P. LERCHS. SPRINGN. KABANIR. M. HENKELMAN, NEUROIMAGE, vol. 42, 2008, pages 60 - 69
A. MCKENNAM. HANNAE. BANKSA. SIVACHENKOK. CIBULSKISA. KERNYTSKYK. GARIMELLAD. ALTSHULERS. GABRIELM. DALY, GENOME RES., vol. 20, 2010, pages 1297 - 1303
A. ROZOVN. BUMASHEV, CELL CALCIUM, vol. 60, 2016, pages 407 - 414
A. SHIROMA, M. NISHIMURA, H. NAGAMINE, T. MIYAGI, Y. HOKAMA, T. WATANABE, S. MURAYAMA, M. TSUTSUI, D. TOINITIAGA, S. ISHIUCHI, CEREBELLUM, vol. 15, 2016, pages 645 - 662
A. V. WITTE, T. KÖBE, A. GRANNKE, J. P. SCHUCHARDT, A. HAHN, V. A. TESKY, J. PANTEL, A. FLÖEL, BRAIN MAPP., vol. 37, 2016, pages 4539 - 4549
B. MEIF. LIY. GUZ. CUIJ. Z. TSIEN, PLOS ONE, vol. 6, 2011, pages e19326
B. RASHID, S. I. DEV, M. NICOLETTE, F. SCHWARZ, T. FERLAND, F. C. FORTENBAUGH, W. P. MILBERG, R. E. MCGLINCHEY, D. H. SALAT, F. C., BRAIN BEHAV., vol. 9, 2019, pages e01333
BREWER GJ ET AL., NAT PROTOC, vol. 2, 2007, pages 1490 - 1498
C. LIISCHERR. C. MALENKA, COLD SPRING HARB. PERSPECT. BIOL., vol. 4, 2012, pages a005710
C. PORREROP. RUBIO-GARRIDOC. AVENDANOF. CLASCA, BRAIN RES., vol. 1345, 2010, pages 59 - 72
C. T. MONTAGUE, I. S. FAROOQI, J. P. WHITEHEAD, M. A. SOOS, H. RAU, N. J. WAREHAM, C. P. SEWTER, J. E. DIGBY, S. N. MOHAMMED, J. A, NATURE, vol. 397, 1997, pages 903 - 908
CURR OPIN NEUROL, vol. 1, 2021, pages 266 - 274
D. C. OU-YANGP. J. YORKC. J. KLECKV. V. PATEL, J. BONE JOINT SURG. AM., vol. 99, 2017, pages 2027 - 2036
D. KIMJ. M. PAGGIC. PARKC. R. BENNETTS. L. SALZBERG, NAT BIOTECHNOL., vol. 37, 2019, pages 907 - 915
DOECKE JD ET AL., NEUROLOGY, 2020
E. IWAMURAK. YAMADAY. ICHITANI, BEHAV. BRAIN RES., vol. 307, 2016, pages 92 - 99
F. L. HITTIS. A. SIEGELBAUM, NATURE, vol. 508, 2014, pages 88 - 92
G. A. VAN DER AUWERA, M. O. CARNEIRO, C. HARTL, R. POPLIN, G. DELANGEL., A. LEVY-MOONSHINE, T. JORDAN., K. SHAKIR, D. ROAZEN, J. T, CURR. PROTOC. BIOINFORMATICS, vol. 43, 2013
G. FENG, R. H. MELLOR, M. BERNSTEIN, C. KELLER-PECK, Q. T. NGUYEN, M. WALLACE, J. M. NERBONNE, J. W. LICHTMAN, J. R. SANES, NEURON, vol. 28, 2000, pages 41 - 51
G. J. PAZ-FILHO, NEURALPLAST, 2016
H. AGETAA. MURAYAMAR. MIGISHIMAS. KIDAK. TSUCHIDAM. YOKOYAMAK. INOKUCHI, PLOS ONE, vol. 3, 2008, pages 1869
H. LOWRYN. J. ROSEBROUGHA. L. FARRR. J. RANDALL, J. BIOL. CHEM., vol. 193, 1951, pages 265 - 275
H. TAKAGIM. SETOUS. ITO1. YAO, NEURAL.PLAST., 2012, pages 352829
HOKAMA Y. ET AL., NEURO ONCOLOGY, 2022
J. A. FRENCH, C. L. KRAUSS, R. T, WECHSLER, X-F. WANG, B. DIVENTURA, C. BRANDT, E. TRINKA, T. J. O BRIEN, A. LAURENZA, A. PATTEN, , NEUROLOGY, vol. 85, 2015, pages 950 - 957
J. B. TREWEEKK. Y. CHANN. C. FLYTZANISB. YANGB. E. DEVERMANA. GREENBAUMA. LIGNELLC. XIAOL. CAIM. S. LADINSKY, NAT. PROTOC., vol. 10, 2015, pages 1860 - 1896
J. F. GUZOWSKIJ. J. KNIERIMΓ. I. MOSER, NEURON, vol. 44, 2004, pages 581 - 584
J. P. P. ULLMANNC. WATSONA. L. JANKEN. D. KUMIAWAND. C. REUTENS, NEUROIMAGE, vol. 78, 2013, pages 196 - 203
K. A. YAMADA, NEUROBIOLOGY OF DISEASE, vol. 5, 1998, pages 67 - 80
K. CHUNG, J. WALLACE, S-Y. KIM, S. KATYANASUNDAMM, A. S. ANDALMAN, T. J. DAVIDSON, .1. J. MIRZABEKOV, K. A. ZALOCUSKY, J. MATTIS, , NATURE, vol. 497, 2013, pages 332 - 337
K. F. YATESV. SWEATP. L. YAUM. M. TURCHIANOA. CONVIT, ARTERIOSCLER. THROMB. VASE. BIOL., vol. 32, 2012, pages 2060 - 2067
K. L. CONRAD, K. Y. TSENG, J. L. UEJIMA, J. M. REIMERS, L-J. HENG, Y. SHAHAM, M. MARINELLI, M. E. WOLF, NATURE, vol. 454, 2008, pages 118 - 121
L. B. HASSINGA. K. DAHLN. L. PEDERSENB. JOHANSSON, DEMENT. GERIATR. COGN. DISORD., vol. 29, 2010, pages 543 - 552
L. J. SHANLEYA. J. IRVINGJ. HARVEY, J. NEUROSCI., vol. 21, 2001, pages RC186
L. NOWAKP. BREGESTOVSKIP. ASCHERA. HERBETA. PROCHIANTZ., NATURE, vol. 307, 1984, pages 462 - 465
LAM AD ET AL., NAT MED, 2017
L-L. HWANG, C-H. WANG, T-L. LI, S-D. CHANG, L-C. LIN, C-P. CHEN, C-T. CHEN, K-C. LIANG, 1-K. V, OBESITY (SILVER SPRING, vol. 18, 2010, pages 463 - 469
M. A. DEPRISTO, E. BANKS, R, POPLIN, K. V. GARIMELLA, J. R. MAGUIRE, C. HARTL, A. A. PHILIPPAKIS, G. DEL ANGEL, M. A. RIVAS, M. HA, NAT. GENET., vol. 43, 2011, pages 491 - 498
M. ANAI, M. FUNAKI, T. OGIHARA, A. KANDA, Y. ONISHI, H. SAKODA, K. INUKAI, M. NAWANO, Y. FUKUSHIMA, Y. YAZAKI, M. KIKUCHI, Y. OKA,, DIABETES, vol. 48, 1999, pages 158 - 169
M. FOTUHID. DOC. JACK, NAT. REV. NEUROL., vol. 8, 2012, pages 189 - 202
M. GESERICK, M. VOGEL, R. GAUSCHE, T. LIPEK, U. SPIELAU, E. KELLER, R. PFAFFLE, W. KIESS, A. KÖRNER, J. MED., vol. 379, 2018, pages 1303 - 1312
M. KOIKEM. LINOS. OZAWA, NEUROSCI. RES., vol. 29, 1997, pages 27 - 36
M. PERTEA, G. M. PERTEA, C. M. ANTONESCU, T. C. CHANG, J. T. MENDELL, S. L. SATZBERG, BIOTECHNOL., vol. 33, 2015, pages 290 - 295
M. RUBINOVO. SPORNS, NEUROIMAGE, vol. 52, 2010, pages 1059 - 1069
M. XIAJ. WANGY. HE, PLOS ONE, vol. 8, 2013, pages e68910
M.AKAMATSUT. YAMASHITAN. HIROSES. TERAMOTOS. KWAK, SCI. REP., vol. 6, 2016, pages 29649
N. D. OLMOM. RUIZ-GAYO, FRONT. CELL. NEUROSCI., vol. 12, 2018, pages 439
NAT. NEUROSCI., vol. 17, 2014, pages 661 - 4
NEUROPHARMACOLOGY, vol. 37, 1998, pages 1211 - 1222
NEUROPHARMACOLOGY, vol. 61, no. 5-6, 2011, pages 1033 - 47
P. CINGOLANI, A. PLATTS, L. L. WANG, M. COON, T. NGUYEN, L. WANG, S. J. LAND, X. LU, D. M. RUDEN, FLY, vol. 6, 2012, pages 80 - 92
P. G. KOPELMAN, NATURE, vol. 404, 2000, pages 635 - 643
PATERNAIN ET AL., NEURON, vol. 14, 1995, pages 185 - 189
R. BRUSAF. ZIMMERMANND.-S. KOHD. FELDMEYERP. GASSP. N. SEEBURGR. SPRENGEL, SCIENCE, vol. 270, 1995, pages 1677 - 1680
R. K. KHANGURAA. BALIA. S. JAGGI, EUR. J. PHARMACOL., vol. 795, 2017, pages 36 - 42
R. MAZOR, D. FRIEDMANN-MORVINSKI, T. ALSAIGH, Q. KLEIFELD, E. B. KISTLER, L. ROUSSO-NOORI, C. HUANG, J. B. LI, 1. M. VERMA, G. W. , SCI. TRANSL, MED., vol. 10, 2018, pages 6324
R. PATROG. DUGGALM. I. LOVER. A. IRIZARRYC. KINGSFORD, NAT METHODS, vol. 14, 2017, pages 417 - 419
R. USUGIM. NISHIMURAS. ISHIUCHI, BRAIN BEHAV., vol. 10, 2020, pages e01878
S. CULL-CANDYL. KELLYM. FARRANT, CURR. OPIN. NEUROBIOL., vol. 16, 2006, pages 288 - 297
S. E. KANOSKIT. L. DAVIDSON, PHYSIOL. BEHAV., vol. 103, 2011, pages 59 - 68
S. HIBI, K. UENO, S. NAGATO, K. KAWANO, K. ITO, Y. NORIMINE, O. TAKENAKA, T. HANADA, M. YONAGA, J. MED, CHEM., vol. 55, 2012, pages 10584 - 10600
S. ISHIUCHI, K. TSUZUKI, Y. YOSHIDA, N. YAMADA, N. HAGIMURA, H. OKADO, A. MIWA, H. KURIHARA, Y. NAKAZATO, M. TAMURA, T. SASAKI, S., NAT. MED., vol. 8, 2002, pages 971 - 978
S. J. LIUR. S. ZUKIN, TRENDS NEUROSCI., vol. 30, 2007, pages 126 - 134
S. J. SAWIAKN. 1. WOODG. E3. WILLIAMSA. J. MORTONT. A. CARPENTER, NEUROBIOL. DIS., vol. 33, 2009, pages 20 - 27
S. L. HARGRAVES. JONEST. L. DAVIDSON, CURR. OPIN. BEHAV. SCI., vol. 9, 2016, pages 7 14 - 46
S. OZAWA, J. PHYSIOL., vol. 587, 2009, pages 1861 - 1862
S. WHITFIELD-GABRIELIA. NIETO-CASTANON., BRAIN CONNECT., vol. 2, 2012, pages 125 - 141
SAITO ET AL.: "Single App knock-in mouse models of Alzheimer's disease", NAT. NEUROSCI., vol. 17, 2014, pages 661 - 4
See also references of EP4403185A4
T. L. RICHARDST. J. GRABOWSKIP. BOORDK. YAGLEM. ASKRENZ. MESTREP. ROBINSONO. WELKERD. GULLIFORDW. NAGY, NEUROIMAGE CLIN., vol. 8, 2015, pages 408 - 421
T. NAKASHIBAJ. D. CUSHMANK. A. POLKEYC. J. MCBAINM. S. FANSELOWS. TONEGAWA, CELL, vol. 149, 2012, pages 188 - 201
T. SASAKIS. MATSUIT. KITAMURA, INT. J. MOL. SCI., vol. 17, 2016, pages 1081
T. TODAY. NODAG. ITOM. MAEDAT. SHIMIZU, J. BIOMED. BLOTECHNOL., 2011, pages 617974
T. YONEKAWA, M. C. V. MALICDAN, A. CHO, Y. K. HAYASHI, T. NONAKA, T. MINE, T. YAMARNOTO, 1. NISHINO, S. NOGUCHI., BRAIN, vol. 137, 2014, pages 2670 - 2679
T-N. HUANGY. P. HSUEH, BIOPROTOCOL, vol. 4, 2014
VAO, H. TAKAGI, H. AGETA, T. KAL)YO, S. SATO, K. HATANAKA, Y. FUKUDA, T. CHIBA, N. MORONE, S. YUASA, K. INOKUCHI, T. OHTSUKA, G. R, CELL, vol. 130, 2007, pages 943 - 957
W. B. CHWANGK. J. O ' RIORDANJ. M. LEVENSONJ. D. SWEATT, LEARN. MEM., vol. 13, 2006, pages 322 - 328
W. JAGUSTD. HARVEYD. MUNGASM. HAAN, ARCH. NEURAL, vol. 62, 2005, pages 1545 - 1548
Y. ZHANGR. PROENCAM. MAFFEIM. BARONEL. LEOPOLDJ. M. FRIEDMAN, NATURE, vol. 372, 1994, pages 425 - 432

Also Published As

Publication number Publication date
US20250281474A1 (en) 2025-09-11
EP4403185A1 (en) 2024-07-24
JPWO2023042888A1 (https=) 2023-03-23
EP4403185A4 (en) 2025-10-08

Similar Documents

Publication Publication Date Title
Wang et al. Microglial repopulation reverses cognitive and synaptic deficits in an Alzheimer’s disease model by restoring BDNF signaling
JP7323561B2 (ja) 老化に関連した障害を処置するための方法及び組成物
US10555916B2 (en) NMDAR antagonist for the treatment of pervasive development disorders
Tian et al. Interleukin17A promotes postoperative cognitive dysfunction by triggering β-amyloid accumulation via the transforming growth factor-β (TGFβ)/smad signaling pathway
Wei et al. Inhibition of IL-6 trans-signaling in the brain increases sociability in the BTBR mouse model of autism
Xiong et al. NAD+-boosting agent nicotinamide mononucleotide potently improves mitochondria stress response in Alzheimer’s disease via ATF4-dependent mitochondrial UPR
US12576042B2 (en) Methods and compositions for treating neurological conditions
Guo et al. The BBSome regulates mitochondria dynamics and function
Kubota et al. Neural pathways from the central nucleus of the amygdala to the paraventricular nucleus of the hypothalamus are involved in induction of yawning behavior due to emotional stress in rats
Miyagi et al. Altered calcium permeability of AMPA receptor drives NMDA receptor inhibition in the hippocampus of murine obesity models
WO2023042888A1 (ja) 認知機能低下、または過体重もしくは肥満症を処置することに用いるための医薬組成物
WO2023042887A1 (ja) 認知機能低下、または過体重もしくは肥満症を処置することに用いるための医薬組成物
Murray et al. Progressive spread of beta-amyloid pathology in an olfactory-driven amyloid precursor protein mouse model
CN119318706A (zh) Nr3a作为蛋白靶点在筛选或制备预防和/或治疗抑郁样行为的药物中的应用
TW202425995A (zh) 減少與神經退化疾病相關的神經退化的方法
WO2014172490A1 (en) Models for apc related diseases and disorders, methods of diagnosing and treating, and methods for identifying therapeutic agents for treating apc related diseases and disorders
WO2023153055A1 (ja) 精神障害に対する治療薬及びスクリーニング方法
JP7560011B2 (ja) 脳血管状態を治療するためのcftrモジュレーターの使用
US20230142111A1 (en) Compositions and methods for the treatment of pervasive development disorders
Miller Contributions of Dentate Gyrus Cell Types to Associative Learning
Sarkar et al. TIMP-1 enhances Akt and BDNF signaling in neurons to reduce synaptic and cognitive deficits in 5xFAD mouse model of Alzheimer’s
EP4680230A1 (en) Method of treating tuberous sclerosis complex or epilepsy and composition for use therein
Burrows et al. Neuronally-Enriched Exosomal miR-27b Reveals Mechanism for Ibuprofen-Induced Acute Effects on Reward-Related Brain Processing in a Randomized, Placebo-Controlled, Double-Blind Trial
Cheung The Role of Neurexins in Serotonin Signaling and Complex Behaviors
JP2023081768A (ja) 脂肪肝治療剤、医薬組成物、治療方法、及びスクリーニング方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22870035

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2023548506

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2022870035

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022870035

Country of ref document: EP

Effective date: 20240415

WWP Wipo information: published in national office

Ref document number: 18692070

Country of ref document: US