WO2023036957A1

WO2023036957A1 - Use of faecalibacterium to treat a respiratory viral infection

Info

Publication number: WO2023036957A1
Application number: PCT/EP2022/075158
Authority: WO
Inventors: Elodie MONCHATRE-LEROY; Franck Boue; Evelyne PICARD-MEYER; Alexandre SERVAT; Marine WASNIEWSKI; Jean-Marc CHATEL; Philippe Langella; Véronique ROBERT; Florian CHAIN; Harry SOKOL; Loïc CHOLLET; Corinne Grangette; François TROTTEIN
Original assignee: Institut National de Recherche pour l’Agriculture, l’Alimentation et l’Environnement; Agence Nationale De Securite Sanitaire De L’Alimentation, De L’Environnement Et Du Travail; Institut National Des Sciences Et Industries Du Vivant Et De L'environnement (Agroparistech); Assistance Publique - Hopitaux De Paris (Aphp); Sorbonne Universite; Institut Pasteur De Lille (Ipl); INSERM (Institut National de la Santé et de la Recherche Médicale); Centre National De La Recherche Scientifique; Universite De Lille
Priority date: 2021-09-10
Filing date: 2022-09-09
Publication date: 2023-03-16

Abstract

The present invention relates to bacteria of the genus Faecalibacterium, in particular bacteria of the species F. Prausnitzii or bacteria of the species F. duncaniae, for use in the prevention or treatment of an infection in a subject with a respiratory virus, preferably a human respiratory virus.

Description

Description Title: Use of Faecalibacterium to treat respiratory virus infection Technical field The present invention relates to the field of the treatment of respiratory virus infections. PRIOR ART Respiratory viruses include many viruses which infect cells of the respiratory tract, which cause respiratory disease symptoms and which are transmitted primarily through the respiratory secretions of infected individuals. Respiratory viruses are the most frequent causative agents that cause pathologies in humans and animals. In humans and animals, respiratory virus infections have a global impact on morbidity and mortality. Thus, a plurality of respiratory viruses commonly circulate among men of all ages with high efficiency of human-to-human transmission. These are in particular the following viruses: (i) human respiratory syncytial virus (HRSV), (ii) human parainfluenza virus (HPIV), (iii) human respiratory virus (HRV), (iv) Aleutian disease (ADV), (v) human coronavirus (HCoV), (vi) severe acute respiratory syndrome coronavirus (SARS-CoV 1 and 2), (vii) human metapneumovirus (HPMV), (viii) human bocavirus (HBoV) or (ix) influenza virus (IAV) (Boncristiani et al., 2009, Encyclopedia of microbiology: 500-518; doi: 10.1016/B978-01237944-5.00314-X). Regarding the immune response against viral infection, there is a growing body of evidence indicating the critical role of the gut microbiota in the homeostasis of the immune system, which encompasses the immune response against viruses, including including against respiratory viruses. Within the intestinal microbial communities, Bacteroidetes and Firmicutes are predominant. The predominant microbial communities in the intestine and in the lungs are similar. The gut microbiota affects pulmonary immunity due to an established dialogue between the gut microbiota and the gut and lungs, which is sometimes referred to as the gut-lung axis. This gut-lung axis, which is bidirectional, encompasses the passage of endotoxins, metabolites and hormones in the circulating blood, and connects the intestinal niche to the lungs. It is known that the gut microbiota can be significantly altered during a variety of respiratory disorders caused by a wide range of airborne pathogens, particularly pathogenic viruses (Dumas et al., 2018, Cell Microbiol, 20 :e12966). In particular, a reduction in the diversity of the intestinal microbiota has been shown in subjects infected with various respiratory viruses, this reduction in the diversity of the microbiota being associated with increased mortality. This increased mortality observed in respiratory virus infections has been associated with a failure of the immune response characterized by the increased production of interferon gamma, IL-6 and CCL2, and by a reduced number of Treg cells in intestine and lungs (Grayson et al., 2018, Front Immunol, Vol. 9: 1587). Similarly, mouse models of influenza virus and respiratory syncitial virus (RSV) altered the diversity of the gut microbiota, with a decrease in the abundance of Firmicutes phyla (Rangelova et al., 2019, Ann Surg doi:10.1097 SLA.0000000000003301 [Epub ahead of print]; Zhang et al., 2020, Frontiers in Microbiology, Vol. 11: Art. 301:1-14). It was observed by He et al. (2002, Canad J Infect Dis, Vol. 2021: 1-10) a low abundance of F. prausnitzii, particularly in people infected with the COVID 19 virus. These authors believe that F. prausnitzii would have a potential ability to reduce inflammation and to prevent the occurrence of gastrointestinal co-morbidities, particularly in patients infected with the COVID-19 virus. These authors report the existence of studies which would have shown a correlation between a low abundance of F. prausnitzii and an increased incidence of metabolic inflammatory diseases. It is thus proposed that the anti-inflammatory effects of F. prausnitzii could lead to the prevention and alleviation of symptoms caused by infection with the COVID-19 virus, at least in combination with medicinal agents. Patent documents US 2018/0264053 and US 2021/0077541 propose compositions comprising various combinations of bacteria for the purpose of preventing or treating inflammatory diseases. The PCT application published under the number WO 2021/146523 describes solid dosage forms allowing an improved oral release of bacteria and agents of bacterial origin, which can be used in particular, because of their anti-inflammatory properties, in the treatment of viral infections. Various mechanisms having the effect of reducing an immune response are common to the various respiratory viruses, which includes viruses inducing severe acute respiratory distress syndrome (such as the MERS-CoV and SARS-CoVs viruses) or even other RNA viruses such as respiratory syncitial virus (RSV), parainfuenza virus 3 (HIPV3) and Influenza virus (IAV) (Blanco-Melo et al., 2020, Cell, Vol. 181: 1036-1045). Preventive treatments against infection by various respiratory viruses are known, mainly in the form of vaccines. Given the rate of hospitalizations due to infection by respiratory viruses, and also the large number of deaths found in subjects infected by these viruses, there is a need for the identification of therapeutic treatments, alternative or improved compared to treatments known therapies. Moreover, there does not currently seem to be any effective therapeutic treatment against some of these respiratory viruses, in particular for the treatment of an infection by a SARS-CoV-2 virus. Also, as with the influenza virus, antiviral agents must be administered soon after infection to be effective. This constraint makes it difficult to identify suitable molecules. Many trials have aimed to identify, among the many known antiviral agents, active agents against SARS-CoV-2, but without success until today. According to other strategies, in the absence of active agents directly on the viral particles, certain agents have been used for the purpose of reducing certain deleterious physiological consequences of an infection by the SARS-CoV-2 virus, such as (i ) dexamethasone, for the purpose of modulating lung damage due to inflammation and thus reduce the progression of respiratory distress syndrome and the occurrence of death, (ii) immunosuppressive antibodies such as tocilizumab or sarimumab, or even (iii) kinase inhibitors, for the purpose of controlling downstream inflammation. There remains a need for prophylactic or therapeutic treatments for infections by a respiratory virus, alternative or improved compared to the known treatments. Summary of the Invention This disclosure relates to bacteria of the genus Faecalibacterium, which includes bacteria of the species Faecalibacterium prausnitzii and Faecalibacterium duncaniae, for their use for the prevention or treatment of an infection of a subject, whether human or animal, by a respiratory virus, preferably by a human respiratory virus. Thus, the present description relates to bacteria chosen from bacteria of the species F. prausnitzii and bacteria of the species F. duncaniae for their use for the prevention or treatment of an infection of a subject, that he either human or animal, by a respiratory virus preferably by a human respiratory virus. In certain embodiments, these bacteria of the genus Faecalibacterium are useful for the prevention or treatment of infection of a subject by a respiratory virus causing severe acute respiratory distress syndrome, which includes infection by a respiratory virus of human preference. In certain embodiments, said bacteria of the genus Faecalibacterium belong to strain A2-165. In certain other embodiments, said bacteria of the Faecalibacterium genus belong to strain I-4574, deposited at the CNCM (National Collection of Microorganism Cultures) on December 7, 2011 by INRA (National Institute for Agronomic Research), which has since been called INRAE (National Research Institute for Agriculture, Food and the Environment). In certain embodiments, said respiratory virus is chosen from (i) a human respiratory syncitial virus (HRSV), (ii) a human parainfluenza virus (HPIV), (iii) a human rhinovirus (HRV), (iv) a virus Aleutian disease (ADV), (v) human coronavirus (HCoV), (vi) human metapneumovirus (HPMV), (vii) human bocavirus (HBoV), (viii) human parainfluenza virus (HIPV) (ix ) human influenza virus (IAV), (x) rotaviruses, (xi) caliciviruses, (xii) toroviruses, (xiii) adenoviruses, (xiv) BHV and ADV herpesviruses and (xv) pestiviruses . In certain embodiments, said virus is a SARS-CoV respiratory virus, preferably a SARS-CoV-2 respiratory virus. In certain other embodiments, said virus is a human influenza virus (IAV). In certain embodiments, these bacteria of the genus Faecalibacterium are useful for reducing the subject's viral load of said respiratory virus, preferably the subject's lung load of said respiratory virus. In certain embodiments, said bacteria, said bacteria of the Faecalibacterium genus are included in a composition, in association with at least one physiologically acceptable excipient. In certain embodiments, said Faecalibacterium bacteria are included in a composition in a form suitable for nasal, oral or rectal administration. In certain embodiments, said oral composition is selected from the group consisting of a food product, a beverage, a pharmaceutical product, a nutraceutical, a food additive, a food supplement and a dairy product. In certain embodiments, said bacteria of the genus Faecalibacterium are included in a composition in a form suitable for administration of 10 ³ to 10 ¹¹ colony forming units. Brief description of the drawings Figure 1 represents the viral load of SARS-CoV-2 virus in hamsters, four days after infection. On the ordinate, the viral load expressed as the number of copies of the SARS-CoV-2 virus genome per µL. On the abscissa, the groups of animals, from right to left (i) control animals infected with SARS-CoV-2 not treated with F. prausnitzii and (ii) animals infected with SARS-CoV-2 and treated with F. prausnitzii. The difference is statistically significant with a P value of 0.0006. Figure 2 represents the viral load of SARS-CoV-2 virus in hamsters, four days after infection. On the ordinate, the viral load expressed as the number of SARS-CoV-2 virus particles per mL. On the abscissa, the groups of animals, from right to left (i) control animals infected with SARS-CoV-2 not treated with F. prausnitzii and (ii) animals infected with SARS-CoV-2 and treated with F. prausnitzii. The difference is statistically significant with a P value of 0.01. Figure 3 represents the weight loss induced by viral infection by IAV in 8-week-old male C57BL/6J mice, either in kinetics after infection (Fig. 3A) or at D7 post-infection (Fig. 3B) . The results obtained in three groups of animals are represented: a control group not infected with the virus (Uninfected group), a control group infected with IAV but not treated (IAV infected group) and a group infected with IAV and having received a treatment of F. prausnitzii according to the invention (group IAV F. prausnitzii A2.165). Figure 3A: Abscissa: days. Y-axis: % of the initial weight of the mice. Figure 3B: Abscissa: from left to right: Uninfected group, IAV infected group and IAV F. prausnitzii A2.165 group. Y-axis: % weight loss of mice. FIG. 4 represents the viral load evaluated in number of copies of the genome of IAV by specific qRT-PCR (Taqman). The data is shown in linear (Fig. 4A) or logarithmic (Fig. 4B) value. The results obtained in three groups of animals are represented: a control group not infected with the virus (Uninfected group), a control group infected with IAV but not treated (IAV infected group) and a group infected with IAV and having received a treatment of F. prausnitzii according to the invention (group IAV F. prausnitzii A2.165). Figure 4A: Abscissa: from left to right: Uninfected group, IAV infected group and IAV F. prausnitzii A2.165 group. Y-axis: Copy number of IAV (M1 gene). Figure 4B: Abscissa: from left to right: Uninfected group, IAV infected group and IAV F. prausnitzii A2.165 group. Y-axis: Number of copies of IAV (M1 gene) in Log ₁₀ . ***: p<0.001; ****: p<0.0001 FIG. 5 represents the clinical score evaluated by histological analyzes on lung sections stained with hematoxylin and eosin (H&E). This analysis shows a significant drop (*: p< 0.05) in total scores (Fig. 5A), mainly due to a significant drop (*: p< 0.05) in the percentage of lung lesions (Fig 5B), as well as a drop significant vascular inflammation score (p=0.09) (FIG. 5C), in mice treated with the F. prausnitzii A2-165 strain (IAV F. prausnitzii A2.165 group). The same groups as previously indicated are represented. Abscissa for Figures 5A, 5B and 5C: from left to right: Uninfected group, IAV infected group and IAV F. prausnitzii A2.165 group. Ordered for 5A: total scores. Ordered for 5B: percentage of lesions. Ordered for 5C: Scores. Figure 6 represents the expression of genes coding for Interferon beta (Ifnb - Figure 6A) and genes induced by interferon gamma (Mx1 and Isg15 - respectively Figures 6B and 6C), genes linked to viral infection, assessed by qRT-PCR. The same groups as previously indicated are represented. Abscissa for Figures 6A, 6B and 6C: from left to right: Uninfected group, IAV infected group and IAV F. prausnitzii A2-165 group. Ordinate for 6A: Relative expression in Ifnb. Ordered for 6B: Relative expression in Mx1. Ordered for 6C: Relative expression in Isg15. Figure 7 shows the expression of pro-inflammatory genes encoding two chemokines involved in the recruitment of inflammatory cells: MCP1/CCL2 (Figure 7A) and CXCL2 (Figure 7B), assessed by qRT-PCR. The same groups as previously indicated are represented. Abscissa for Figures 7A and 7B: from left to right: Uninfected group, IAV infected group and IAV F. prausnitzii A2-165 group. Ordered for 7A: Relative expression in Mcp1/Ccl2. Ordered for 7B: Relative expression in Cxcl2. Figure 8 represents the weight loss induced by viral infection by IAV in 8-week-old male C57BL/6J mice, either in kinetics after infection (Fig. 8A) or at D7 post-infection (Fig. 8B) . The results obtained in four groups of animals are represented: a control group not infected with the virus (Uninfected group), a control group infected with IAV but not treated (IAV infected group), a group infected with IAV and having received a treatment of live F. prausnitzii A2-165 according to the invention (live IAV F. prausnitzii A2-165 group) and a group infected with IAV and having received a treatment of inactivated (pasteurized) F. prausnitzii A2-165 according to the invention (group IAV F. prausnitzii A2-165 pasteurized). Figure 8A: Abscissa: days post infection. Y-axis: % of the initial weight of the mice. Figure 8B: Abscissa: from left to right: Uninfected group, IAV infected group, live IAV F. prausnitzii A2-165 group and IAV infected group, pasteurized IAV F. prausnitzii A2-165 group. Y-axis: % weight loss of mice. FIG. 9 represents the viral load evaluated in number of copies of the genome of IAV by specific qRT-PCR (Taqman). The data is shown in linear (Fig. 9A) or logarithmic (Fig. 9B) values. (****=p<0.001;**=p<0.01) of viral load compared to animals which did not receive F. prausnitzii. The results obtained in four groups of animals are represented: a control group not infected with the virus (Uninfected group), a control group infected with IAV but not treated (IAV infected group), a group infected with IAV and having received a treatment of live F. prausnitzii A2-165 according to the invention (group IAV F. prausnitzii A2.165 live) and a group infected with IAV and having received a treatment of pasteurized F. prausnitzii A2-165 according to the invention (group IAV F. prausnitzii A2.165 pasteurized). Figure 9A: Abscissa: from left to right: Uninfected group, IAV infected group, live IAV F. prausnitzii A2.165 group and pasteurized IAV F. prausnitzii A2.165 group. Y-axis: Copy number of IAV (M1 gene). Figure 9B: Abscissa: from left to right: Uninfected group, IAV infected group, live IAV F. prausnitzii A2.165 group and pasteurized IAV F. prausnitzii A2.165 group. Y-axis: Number of copies of IAV (M1 gene) in Log ₁₀ . Figure 10 represents the weight loss induced by viral infection by IAV in 8-week-old male C57BL/6J mice, either in kinetics after infection (Fig. 10A) or at D7 post-infection (Fig. 10B) . The results obtained in three groups of animals are represented: a control group not infected with the virus (Uninfected group), a control group infected with IAV but not treated (IAV infected group) and a group infected with IAV and having received a treatment of F. prausnitzii I-4574 according to the invention (group IAV F. prausnitzii I-4574). Figure 10A: Abscissa: days post infection. Y-axis: % of the initial weight of the mice. Figure 10B: Abscissa: from left to right: Uninfected group, IAV infected group and IAV F. prausnitzii I-4574 group. Y-axis: % weight loss of mice. FIG. 11 represents the viral load evaluated in number of copies of the genome of IAV by specific qRT-PCR (Taqman). The data is shown in linear (Fig. 11A) or logarithmic (Fig. 11B) values. (**=p<0.01) of viral load compared to animals which did not receive F. prausnitzii. The results obtained in three groups of animals are represented: a control group not infected with the virus (Uninfected group), a control group infected with IAV but not treated (IAV infected group) and a group infected with IAV and having received a treatment of F. prausnitzii I-4574 according to the invention (group IAV F. prausnitzii I-4574). Figures 11A and 11B: Abscissa: from left to right: Uninfected group, IAV infected group and IAV F. prausnitzii I-4574 group. Y-axis Figure 11A: Copy number of IAV (M1 gene). Y-axis Figure 11B: Number of copies of IAV (M1 gene) in Log ₁₀ . Figure 12 represents the expression of the genes coding for Interferon gamma (Ifng - Figure 12A) and Interferon beta (Ifnb - Figure 12B) and of the gene induced by interferon gamma (Isg15 Figures 12C), gene linked to viral infection, assessed by qRT-PCR. The same groups as previously indicated are represented. Abscissa for Figures 12A, 12B and 12C: from left to right: Uninfected group, IAV infected group and IAV F. prausnitzii I-4574 group. Ordered for 12A: Relative expression in Ifng. Ordered for 12B: Relative expression in Ifnb. Ordered for 12C: Relative expression in Isg15. Figure 13 shows the expression of pro-inflammatory genes: Il6 (Figure 13A), MCP1/CCL2 (Figure 13B) and CXCL2 (Figure 13C), assessed by qRT-PCR. The same groups as previously indicated are represented. Abscissa for Figures 13A, 13B and 13C: from left to right: Uninfected group, IAV infected group and IAV F group. prausnitzii I-4574. Ordered for 13A: Relative expression in Mcp1/Ccl2. Ordered for 13B: Relative expression in Mcp1/Ccl2. Ordered for 13C: Relative expression in Cxcl2. Detailed description The inventors have shown that the supply of bacteria of the genus Faecalibacterium, in particular bacteria of the species Faecalibacterium prausnitzii (also called F. prausnitzii in the present description) to subjects infected with a respiratory virus, in particular subjects infected with a SARS-CoV-2 virus and in subjects infected with the influenza virus, causes a very significant reduction in the viral load of the subject, in particular a very significant reduction in the pulmonary viral load of the subject. In addition, it is shown that an intake of bacteria of the genus Faecalibacterium, in particular of bacteria of the species F. prausnitzii, prior to infection by a respiratory virus, in particular prior to infection by a SARS-CoV- 2, allows a reduced viral load of the subject who is subsequently infected, in particular allows a reduced pulmonary viral load of the subject who is subsequently infected, in comparison with a subject infected under the same conditions with said respiratory virus but who has not received said contribution of bacteria of the genus Faecalibacterium. The reduced viral load that is observed is illustrated both (i) by a decrease in the number of copies of the viral genome and (ii) by a decrease in the number of viral particles, particularly in the lungs. The inventors have also shown that the supply of bacteria of the genus Faecalibacterium, in particular bacteria of the species F. prausnitzii, makes it possible to reduce, in a subject, the presence or the extent of pulmonary lesions caused by an infection of the subject by a respiratory virus, such as SARS-CoV-2 or Influenza. It is also shown in the examples that the supply of bacteria of the genus Faecalibacterium, in particular bacteria of the species F. prausnitzii, makes it possible to reduce, in a subject, the vascular inflammation caused by an infection of the subject by a virus respiratory, such as SARS-CoV-2 or Influenza. The inventors have also shown that the intake of bacteria of the genus Faecalibacterium, in particular bacteria of the species F. prausnitzii, especially in subjects infected with a respiratory virus such as SARS-CoV-2 or Influenza, induces an increase in level of expression of genes involved in the anti-viral response of the host, such as the following genes: (i) the Ifng gene encoding interferon gamma, (ii) the Ifnb gene encoding interferon beta, (iii) the IfnI3 gene encoding interferon lambda 3, (iv) the Mx1 gene encoding the Mx1 protein binding to GTP and which is induced by interferon, (v) the Isg15 gene which is stimulated by interferon or (vi) the STAT1 gene which is activated by type 1 interferons. To the applicant's knowledge, the direct effect on a viral infection of bacteria of the genus Faecalibacterium, and in particular the effect of these bacteria on the viral load, and even more particularly on the viral load of a respiratory virus, nor on their effects on lesions, in particular on the lungs, of an infection by a respiratory virus, have never been shown in the state of the art. The present invention relates to bacteria of the genus Faecalibacterium for their use in the prevention or treatment of an infection of a subject by a respiratory virus, which includes an infection by a respiratory virus, preferably human. The bacteria of the genus Faecalibacterium can be chosen from bacteria of the species F. prausnitzii and bacteria of the species F. duncaniae. The present invention relates to bacteria of the genus Faecalibacterium for their use, as an antiviral agent, for the prevention or treatment of an infection of a subject by a respiratory virus, which includes an infection by a respiratory virus preferably human. The bacteria of the genus Faecalibacterium can be chosen from bacteria of the species F. prausnitzii and bacteria of the species F. duncaniae. It relates to the use of bacteria of the genus Faecalibacterium for the prevention or treatment of an infection of a subject by a respiratory virus, which includes an infection by a respiratory virus, preferably human. It relates to the use of bacteria of the genus Faecalibacterium for the prevention or treatment, as an antiviral agent, of an infection of a subject by a respiratory virus, which includes an infection by a respiratory virus preferably human. It relates to the use of bacteria of the genus Faecalibacterium for the manufacture of a medicament for the prevention or treatment of an infection of a subject by a respiratory virus, which includes an infection by a respiratory virus, preferably human . It relates to the use of bacteria of the genus Faecalibacterium for the manufacture of a medicament for the prevention or treatment, as an antiviral agent, of an infection of a subject by a respiratory virus, which includes a infection with a respiratory virus, preferably human. It relates to a method for preventing or treating an infection of a subject by a respiratory virus, which includes an infection by a respiratory virus, preferably human, comprising a step during which it is brought to the subject bacteria of the genus Faecalibacterium. It relates to a method for preventing or treating an infection of a subject by a respiratory virus, which includes an infection by a respiratory virus, preferably human, comprising a step during which it is brought to the subject bacteria of the genus Faecalibacterium in as an antiviral agent. The present invention relates to bacteria of the genus Faecalibacterium for reducing damage to the body, in particular for reducing lung damage, caused by infection of a subject with a respiratory virus, which preferably includes infection with a respiratory virus human. It relates to the use of bacteria of the genus Faecalibacterium for reducing the lesions of the organism, in particular for reducing the pulmonary lesions, caused by an infection of a subject by a respiratory virus, which includes an infection by a virus preferably human respiratory. It relates to the use of bacteria of the genus Faecalibacterium for the manufacture of a medicament for reducing the lesions of the organism, in particular for reducing the lesions of the lungs, caused by an infection of a subject by a respiratory virus, this which includes infection with a respiratory virus, preferably human. It relates to a method for reducing damage to the body, in particular for reducing lung damage, caused by an infection of a subject by a respiratory virus, which includes an infection by a respiratory virus, preferably human, comprising a step during which it is brought about bacteria of the genus Faecalibacterium. By prevention or treatment of "an infection of a subject" by a respiratory virus, is meant according to the present description a prophylactic or therapeutic effect on the level of infection by a respiratory virus when the infection occurs, And more particularly a prophylactic or therapeutic effect on the level of viral load of the subject, after the occurrence of an infection by a virus, here a respiratory virus. By “subject”, according to the description, is meant a subject chosen from among humans and animals. Animals include non-human mammals that belong to the group of production, livestock or companion animals, such as a canid, a felid or an equine. Most preferably, a subject is a human being. By "human virus" is meant a virus having the capacity to infect a human subject. By “non-human virus”, is meant a virus having the capacity to infect a non-human subject, that is to say an animal. It is specified that some of the viruses of interest for the present description are both human viruses and non-human viruses, such as for example MERS-CoV. By "antiviral agent" is meant an agent capable of reducing the viral load of a subject, which includes that the antiviral agent is capable of (i) reducing the number of copies of the viral genome and/or (ii) reducing the number of viral particles in the infected subject's body, which includes in the infected subject's lung tissue. F. prausnitzii is a major member of the phylum Firmicutes and is among the most abundant commensal bacteria in the microbiota of the healthy human large intestine. F. prausnitzii is, in particular, known to be one of the most abundant butyrate-producing bacteria in the human digestive tract, the short-chain fatty acid butyrate being very important in the physiology of the intestine, systemic functions and beneficial effects on human health (Macfarlane and Macfarlane (2011), J. Clin. Gastroenterol. 45 Suppl: S120-7). Very recently, changes in the classification of bacteria of the genus Faecalibacterium have been proposed, the proposed new classification being based on the characteristics of the bacterial genome (Sakamoto et al., 2022, International Journal of Systematic and Evolutionary Microbiology, Vol. 72: 005379 – Doi: 10.1099//jsem.0.005379). In this context, for example, it is proposed that the bacterium Faecalibacterium prausnitzii A2-165 be classified as Faecalibacterium duncaniae. Within the meaning of the present description, the bacteria F. prausnitzii include the bacteria which were classified as belonging to the species F. prausnitzii on the date of September 10, 2021. The bacteria of the genus Faecalibacterium, in particular the bacteria of the species F prausnitzii, include those referenced in the PCT application published under the number WO 2016/075294, which includes the bacteria deposited according to the Budapest Treaty in the Microorganism Cultures Collection of the Institut Pasteur under the accession numbers I- 4542, I-4544, I-4540, I-4574, I-4543, I-4575, I-4573, I-4644 and I-4546. Bacteria of the genus Faecalibacterium, in particular bacteria of the species F prausnitzii also include strains deposited with the American Type Culture Collection (ATCC) under ATCC accession number 27768. Bacteria of the genus Faecalibacterium may be bacteria of the A2-165 strain deposited at the German Collection for Cell Cultures and Microorganisms (DMSZ) under the accession number DSM 17677. The bacteria of the genus Faecalibacterium can be live bacteria, inactivated bacteria or dead bacteria. In certain embodiments, the bacteria of the genus Faecalibacterium are live bacteria. By "live bacteria" is meant according to the present description, bacteria capable of multiplying, under appropriate conditions. In certain other embodiments, the bacteria of the genus Faecalibacterium are inactivated bacteria or dead bacteria. According to the present description, "inactivated" bacteria are not capable, at least transiently, which includes permanently, of forming colonies in culture, under appropriate culture conditions. According to the present description, "dead" bacteria are bacteria which are no longer, permanently and definitively, capable of forming colonies in culture, under appropriate culture conditions. Inactivated bacteria or dead bacteria may have intact or at least partially ruptured membrane walls. Inactivated bacteria can be prepared by exposing the bacterial cells to irradiation, for example by ionizing radiation, by inactivation heat, by acid or base inactivation, by inactivation by exposure to air or oxygen, or by freeze-drying. Each of these methods of inactivating bacteria is well known to those skilled in the art. Inactivation by irradiation can be carried out by exposing the bacteria to gamma radiation, to X-rays, or even by exposure to UV radiation. Bacteria inactivated by freeze-drying can be reactivated and recultured. Thermal inactivation can be carried out by incubating bacteria of the genus Faecalibacterium for a prolonged period, for example at least two hours, at 170° C. Thermal inactivation can also be carried out by autoclaving, by subjecting the bacteria of the genus Faecalibacterium to a temperature of 121°C for a period of at least 20 minutes and at an atmospheric pressure of 2 bar. Also encompassed are thermal inactivation processes such as pasteurization or tyndallization. Alternatively, heat inactivation can be achieved by subjecting bacteria of the genus Faecalibacterium to freezing temperature for an extended period of time. Inactivation by pH can be achieved by incubating bacteria of the genus Faecalibacterium for an extended period of time in low or high pH, for example for 30 min at pH 2. Inactivation by exposure to air can be achieved because bacteria of the genus Faecalibacterium, in particular Faecalibacterium prausnitzii, are extremely oxygen-sensitive (EOS) organisms. The process can be carried out by incubating the bacterium in question for a certain time in an atmosphere of air. The present description also encompasses not only the use of bacteria of the genus Faecalibacterium, but also the use of a bacterial extract or a bacterial lysate obtained from bacteria of the genus Faecalibacterium, for each of the uses of bacteria of the genus Faecalibacterium which is described in this description. An extract or lysate which is suitable for the uses specified in the present description can be prepared from the bacteria of the genus Faecalibacterium, at the end of the growth phase. A bacterial strain which is suitable for a use specified in this description can be used in the form of a lysate. Within the meaning of the invention, a "lysate" commonly designates a material obtained after destruction or dissolution of biological cells by a phenomenon known as cell lysis, thus giving rise to the release of the intracellular biological constituents naturally contained in the cells of the bacterium under consideration. In the context of the present description, the term “lysate” is used without preference to designate the entire lysate obtained by lysis of the bacterium under consideration or only a fraction thereof. The lysate used is therefore totally or partially formed of the intracellular biological constituents and of the constituents of the cell walls and membranes of the bacteria. Within the meaning of the present description, the term “fraction” designates more particularly fragments of said bacterium. In a particular embodiment, a lysate according to the present description can be the whole lysate obtained by lysis of the bacterial strains considered. This cell lysis can be carried out by various known techniques, such as osmotic shock, thermal shock, by exposure to ultrasound, or alternatively under mechanical stress of the centrifugation type. In particular, a lysate according to the present description can be obtained by ultrasonic disintegration of a medium comprising bacteria of the genus Faecalibacterium, in particular bacteria of the species F. pausnitzii or of the species F. duncaniae, in suspension in order to to release cytoplasmic fractions, cell wall fragments and metabolic products. All components in their natural distribution are then stabilized in a weakly acidic aqueous solution. It is specified that the techniques above, illustrated for bacteria of the genus Faecalibacterium, can also be used to kill or inactivate bacteria of other species, likely to be combined with Faecalibacterium, in particular with F. prausnitzii or F. duncaniae, in a composition of interest specified in the present description. The respiratory viruses are preferably chosen from respiratory viruses causing severe acute respiratory distress syndrome. Respiratory viruses include (i) respiratory viruses infecting human subjects and (ii) respiratory viruses infecting non-human subjects, i.e. animals and more especially non-human mammals, such as for example, without being limiting, cattle, sheep, pigs, canines, felines or even horses. The respiratory viruses, including human respiratory viruses, can be chosen, by way of non-limiting examples, from (i) a human respiratory syncytial virus (HRSV), (ii) a human parainfluenza virus (HPIV), (iii) human rhinovirus (HRV), (iv) Aleutian disease virus (ADV), (v) human coronavirus (HcoV), (vi) human metapneumovirus (HPMV), (vii) human bocavirus (HboV), (viii) human parainfluenza virus (HIPV), (ix) human influenza virus (IAV), (x) rotaviruses, (xi) caliciviruses, (xii) toroviruses, (xiii) adenoviruses, ( xiv) BHV and ADV herpesviruses and (xv) pestiviruses. The rotaviruses can be chosen from the RVA, RGB, RVC and RVH viruses. The calicivirus can be chosen from novoviruses and sapoviruses. The pestiviruses can be chosen from the BVDV and CSFV viruses. The coronaviruses are selected from (i) coronaviruses infecting human subjects and (ii) coronaviruses infecting non-human subjects, which includes non-human mammals. Those skilled in the art can refer in particular to the review article by Khbou et al. (2021, Vet Med Sci, Vol. 7: 322-347). The coronaviruses infecting non-human subjects can be chosen, by way of non-limiting examples, from (i) bovine coronaviruses, such as bovine coronavirus (BcoV), (ii) coroonaviruses infecting buffaloes, such as Bubaline coronavirus (BuCoV), (iii) coronaviruses infecting camels, such as Middle East respiratory syndrome coronavirus (MERS-CoV), (iv) coronaviruses infecting horses, such as Equine coronavirus (EcoV), (v) coronaviruses infecting rabbits, such as Rabbit coronavirus (RbCoV), (vi) coronaviruses infecting porcines, such as Porcine hemagglutinating encephalomyelitis virus (PHEV), Transmissible gastroenteritis virus (TGEV), Porcine respiratory coronavirus (PRCV), Swine acute diarrhoea syndrome coronavirus (SADS-CoV), Porcine epidemic diarrhoea virus (PEDV) and Porcine delatocoronavirus (PDCov), (vii) coronaviruses infecting chickens, such as Infectious bronchitis virus (IBV), (viii) the coronaviruses s infecting dolphins, such as Bottlenoise whale (BdCoV), (ix) coronaviruses infecting whales, such as Beluga whale (BWCoV) and (x) coronaviruses infecting seals. The human coronaviruses are chosen in particular from (i) a Middle East respiratory syndrome coronavirus (MERS-CoV), and (ii) a coronavirus responsible for severe acute respiratory syndrome (SARS-CoV). The SARS-CoV respiratory viruses can be chosen from SARS-CoV-1 viruses and SARS-CoV-2 viruses. They are preferably SARS-CoV-2 respiratory viruses. The respiratory viruses can be chosen from Influenza viruses, preferably a human Influenza virus. The Influenza virus can be a virus of one of the types A, B or C and is preferentially a type A Influenza virus (also called “IAV” in the present description). It may be an Influenza virus of type A, of a subtype chosen from A(H1N1) and A(H3N2). It may be a type B Influenza virus, of a subtype chosen from B (Victoria) and B (Yamagata). The species of respiratory viruses, preferably the species of human respiratory viruses, encompass the different strains, sometimes referred to as “variants”, of said viruses. By way of illustration, the viruses of the SARS-CoV-2 type encompass the different strains, sometimes referred to as “variants”, of these viruses. Similarly, an Influenza virus belonging to a given subtype, is classified according to a subclassification in clades (groups), then in subclades (subgroups). By way of illustration, a type A Influenza virus (IAV) can be classified in the A(H1N1) subtype, then in the 68.1 clade and finally in the 68.1.A subclade. Similarly, strains of type A Influenza virus (IAV) can be classified in the A(H3N2) subtype. The invention relates to bacteria of the genus Faecalibacterium for their use for the prevention or treatment of an infection of a subject with a respiratory virus, preferably with a human respiratory virus, to reduce the subject's viral load of said respiratory virus during the infection. The bacteria of the genus Faecalibacterium can be chosen from bacteria of the species F. prausnitzii and bacteria of the species F. duncaniae. The invention relates to the use of bacteria of the genus Faecalibacterium for the manufacture of a medicament for the prevention or treatment of an infection of a subject by a respiratory virus, preferably by a human respiratory virus, to reduce the burden virus of the subject into said respiratory virus during the infection. The invention relates to a method for the prevention or treatment of an infection of a subject by a respiratory virus, to reduce the viral load of the subject during the infection, comprising a step of supplying said subject with bacteria of the genus Faecalibacterium. The invention also relates to a prophylactic or therapeutic method for obtaining a reduced viral load in a subject when he is infected with a respiratory virus, said method comprising a step of supplying said subject with bacteria of the genus Faecalibacterium. By “viral load” of a subject within the meaning of the present description, is meant a quantity of virus present in a tissue and/or an organ of said subject. Preferably, within the meaning of the present description, the subject's viral load consists of a quantity of virus present in the pulmonary tissue and/or in the pulmonary fluid of said subject. Within the meaning of the present description, a quantity of virus can be expressed (i) in number of copies of viral genome or (ii) in number of infectious viral particles. As is known, the number of viral genome copies can be determined according to a method comprising a step of amplification of the viral RNA, preferably according to the RT-PCR technique, as illustrated in the examples. As is known, the number of infectious viral particles can be determined using a viral particle titration method comprising a step of infecting cells sensitive to said virus. The results can be expressed in TCID50/mL, ie in the quantity of virus necessary to cause the infection of 50% of the susceptible cells. Within the meaning of the present description, the viral load of a subject is reduced when a decrease of at least 5 times, better still of at least 10 times, the reference viral load is measured, compared to a reference value . For example, a reduction in the viral load of a subject in a respiratory virus is attested when a reduction of at least 5 times the number of copies of the genome of said virus, better still of at least 10 times the number of copies of the genome of said virus is measured, relative to a reference value. Also, a reduction in the viral load of a subject in a respiratory virus is attested when a decrease of at least 5 times the number of particles of said virus, better still at least 10 times the number of particles of said virus, is measured, relative to a reference value. As illustrated in the examples, a supply of bacteria of the genus Faecalibacterium has the property, in a subject infected with a respiratory virus, in particular infected with a SARS-CoV-2 virus, of reducing the viral load by more than 10 times. , compared with a subject who did not receive a supply of bacteria of the genus Faecalibacterium, whether this viral load is expressed (i) as a number of copies of the viral genome or (ii) as a number of viral particles. Compositions The present invention also relates to a composition comprising, in a physiologically acceptable medium, at least bacteria of the genus Faecalibacterium, in particular bacteria of the species F prausnitzii or bacteria of the species F. duncaniae. Preferably, a composition according to the present description has a formulation suitable for its administration intranasally, orally or rectally. Suitable Faecalibacterium bacteria are described elsewhere in this specification. In certain embodiments of a composition according to the description, the chosen strain of Faecalibacterium, in particular of F. prausnitzii or of F. duncaniae, is used as the only bacterial strain present in the composition. In certain embodiments, a combination of several strains of Faecalibacterium, in particular of F. prausnitzii or of F. duncaniae, are the only bacterial strains present in the composition. In certain other embodiments of a composition according to the description, Faecalibacterium bacteria, in particular F. prausnitzii or F. duncaniae, are combined with bacteria from one or more other probiotic bacterial strains, which includes other commensal probiotic bacterial strains. Non-limiting examples of probiotics include strains of bacteria belonging to the following genera: Bifidobacterium, Lactobacillus, Lactococcus, Enterococcus, Streptococcus, and three yeasts Kluyveromyces, Saccharomyces, Candida and combinations thereof. The probiotics may be chosen from the group consisting of the following bacterial species: Bifidobacterium longum, Bifidobacterium lactis, Bifidobacterium breve, Bifidobacterium infantis, Bifidobacterium adolescentis, Lactobacillus acidophilus, Lactobacillus casei (from now on Lacticaseibacillus casei), Lactobacillus paracasei (from now on Lacticaseibacillus paracasei), Lactobacillus salivarius (now Ligilactobacillus salivarius), Lactobacillus lactis (now Lactobacillus delbrueckii subsp. Lactis), Lactobacillus rhamnosus (now Lacticaseibacillus rhamnosus), Lactobacillus johnsonii, Lactobacillus plantarum (now Lactiplantibacillus plantarum subsp. Plantarum), Lactococcus lactis, Enterococcus faecium, Sac cerevisiae, Saccharomyces boulardii or their mixtures, preferably chosen from the group consisting of Bifidobacterium longum NCC3001 (ATCC BAA-999), Bifidobacterium longum NCC2705 (CNCM 1-2618), Bifidobacterium longum N CC490 (CNCM 1-2170), Bifidobacterium lactis NCC2818 (CNCM I-3446), Bifidobacterium breve strain A, Lactobacillus paracasei NCC2461 (CNCM 1-2116), Lactobacillus johnsonsii NCC533 (CNCM 1-1225), Lactobacillus rhamnosus GG (ATCC53103), Lactobacillus rhamnosus NCC4007 (CGMCC 1.3724), Enterococcus faecium SF 68 (NCC2768; NCIMB10415), Faecalibacterium prausnitzii and their combinations. In certain embodiments, a composition according to the present description is combined, for example in a kit, with one or more other agents useful for the treatment of an infection of a subject by a SARS-CoV-2 virus. These embodiments include those in which a composition according to the present description is combined, for example in a kit, with one or more antibodies directed against a SARS-CoV-2 virus. These embodiments also encompass those in which a composition according to the present description is combined, for example in a kit, with one or more anti-viral agents. In some embodiments, the composition also includes one or more prebiotics. The term "prebiotic" is used in its conventional sense in the state of the art. Prebiotics consist of food substances that promote the growth of probiotic bacteria, including bacteria included in the microbiota. Non-limiting examples of prebiotics include: oligosaccharides optionally containing fructose, galactose, mannose; dietary fibers, in particular fermentable fibers, soy fibers; inulin; and their combinations. The preferred prebiotics are fructo-oligosaccharides (FOS), galacto-oligosaccharides (GOS), isomalto-oligosaccharides (IMO), xylo-oligosaccharides (XOS), arabino-xylo-oligosaccharides (AXOS), mannan-oligosaccharides (MOS), soy oligosaccharides, glycosylsucrose (GS), lactosucrose (LS), lactulose (LA), palatinose-oligosaccharides (PAO), malto-oligosaccharides, resistant starches, gums and/or hydrolysates thereof, pectins and/or hydrolysates thereof, or combinations thereof. In some embodiments, the composition further comprises one or more vitamins. The vitamins can be folic acid, vitamin B12 and vitamin B6, especially folic acid, and vitamin B12, especially folic acid. In some embodiments, the composition includes one or more vitamins that are fat-soluble, for example, one or more of vitamin A, vitamin D, vitamin E, and vitamin K. In some embodiments, the composition includes a or more polyphenols, such as flavanols, flavanones, flavonols, hydroxycinnamic acids and anthocyanins. In some embodiments, the composition further includes one or more minerals. The minerals can be selected from sodium, potassium, chloride, calcium, phosphate, magnesium, iron, zinc, copper, selenium, manganese, fluorine, iodine, chromium or molybdenum. Minerals are usually added in the form of salt. The minerals can be added alone or in combination. In certain embodiments, a composition according to the present description generally comprises carriers or vehicles. "Carriers" or "vehicles" refer to materials suitable for administration and include any material known in the state of the art, such as, for example, any liquid, gel, solvent, liquid diluent, solubilizing agent or the like, which is non-toxic and which does not interact with the components of the composition in a deleterious manner. Examples of nutritionally acceptable carriers include, for example, water, saline solutions, alcohols, silicones, waxes, petrolatum, vegetable oils, polyethylene glycols, propylene glycol, liposomes, sugars, gelatin, lactose, amylose, magnesium stearate, talc, surfactants, silicic acid, viscous paraffin, oil of perfume, monoglycerides and diglycerides of fatty acids, esters of petroleum fatty acids, hydroxymethylcellulose, polyvinylpyrrolidone, etc. In some embodiments, the composition further includes any other ingredient or excipient known to be employed in the type of composition in question. Non-limiting examples of such ingredients include: proteins, amino acids, carbohydrates, oligosaccharides, lipids, nucleotides, nucleosides, other vitamins, minerals and other micronutrients. In certain embodiments, the composition contains a source of carbohydrates, for example in the form of prebiotics, or prebiotics when they are present in the composition. Any carbohydrate source commonly found in infant formula, such as lactose, sucrose, maltodextrin, starch, and mixtures thereof, may be used, although the preferred carbohydrate source is lactose. In certain embodiments, a composition according to the present description consists of a nutritional composition, for example a nutritional composition whose constitution is adapted to feed a human subject or else a non-human mammalian subject. Most preferably, in these embodiments, the composition is a nutritional composition for a human subject. Advantageously, a composition according to the invention, intended for oral administration, can be provided with a coating resistant to gastric juice, in order to ensure that the bacterial strain of the invention comprised in said composition can cross the damaged stomach. Release of the bacterial strain may thus occur for the first time in the upper intestinal tract. In certain embodiments, the nutritional composition is selected from whole food compositions, food supplements, nutraceutical compositions and the like. The composition of the present description can be used as a food ingredient and/or food ingredient for human subjects or non-human mammalian subjects. The food ingredient can be in the form of a solution or a solid, depending on the use and/or the mode of application and/or the mode of administration. As used herein, the term "food" refers to liquid (i.e. beverages), solid or semi-solid dietary compositions, in particular total food compositions (food replacement) , who does not require no additional supply of nutrients or dietary supplement compositions. Dietary supplement compositions do not completely replace the supply of nutrients by other means. As used herein, the term "food ingredient" encompasses a formulation that is or can be added to functional foods or foodstuffs as a dietary supplement. By "nutritional" or "nutraceutical" or "functional" food is meant a food material which contains ingredients having beneficial effects on health or capable of improving physiological functions. By "food supplement" is meant a food material intended to supplement a normal diet. A food supplement is a concentrated source of nutrients or other substances having a nutritional or physiological effect, when taken alone or in combination in small amounts. As used herein, "functional food" is used to designate food materials and corresponding products to which importance is attributed not only because of their nutritional and taste value but also because of the presence of ingredients having beneficial physiology. In some embodiments, the composition is a fermented dairy product or milk-based product, which is preferably administered or ingested orally one or more times per day. Fermented milk products include milk products, such as (but not limited to) desserts, yoghurts, yoghurt drinks, cottage cheese, kefir, fermented milk drinks, buttermilk , cheeses, salad dressings, low-fat spreads, cream cheese, soy drinks, ice cream, etc. Alternatively, in certain embodiments, the nutritional and/or nutritional supplement compositions may be non-dairy or unfermented dairy products. Unfermented dairy products can include ice cream, nutrition bars and seasonings, and others. Non-dairy products may include powdered drinks and nutrition bars, etc. Products can be made using known methods, such as adding an effective amount of F. prausnitzii bacteria, or a combination of bacteria including F. prausnitzii bacteria to a food base, such as skimmed milk or milk or a milk-based composition, and carry out a fermentation according to any known technique. In some embodiments, the composition is a beverage which may be a functional beverage or a therapeutic drink, thirst quencher or conventional drink. By way of example, the composition according to the present description can be used as an ingredient for soft drinks, a fruit juice or a drink comprising whey proteins, teas, cocoa drinks, milk drinks, yoghurts including drinkable yoghurts, cheeses, ice creams, popsicles and desserts, confectionery, cookies, cakes and cake mixes, snacks, healthy foods and beverages, frostings, acidified soy beverage/juice, aseptic/tapped chocolate beverage, bar mixes, powdered beverage mixes, calcium fortified soy milk and chocolate, calcium fortified coffee beverage. In some embodiments, the composition includes any other ingredient or excipient known to be employed in the type of composition in question. Non-limiting examples of such ingredients include: proteins, amino acids, carbohydrates, oligosaccharides, lipids, prebiotics or probiotics, nucleotides, nucleosides, other vitamins, minerals and other micronutrients. In certain other embodiments, F. prausnitzii bacteria, optionally in combination with probiotic bacteria of one or more other strains, are administered to the subject in the form of a pharmaceutical composition, which composition may consist of a product Live Biotherapeutic product (LBP) type reference: Front Med (Lausanne) Rouanet et al. 2020 Jun 19; 7: 237. Doi: 10.3389/fmed.2020.00237. For example, the bacteria of interest can be combined with pharmaceutically acceptable excipients, and optionally sustained release matrices, such as biodegradable polymers, to form therapeutic compositions. The terms "pharmaceutically" or "pharmaceutically acceptable" refer to molecular entities and compositions which do not produce an adverse, allergic or other reaction when administered to a mammal, in particular a human, as the case may be. A pharmaceutically acceptable carrier or excipient means a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation aid of any type. In the pharmaceutical compositions of the present description for administration particularly by the oral or rectal route, the active ingredient or the combination of active ingredients active ingredients, can be administered in unit dosage form, in mixture with conventional pharmaceutical carriers, to animals and humans. Suitable unit dosage forms include (i) oral dosage forms such as tablets, gel capsules, powders, granules and oral suspensions or solutions, including sublingual and orally, (ii) intranasally such as aerosols and (iii) rectally such as suppositories. The pharmaceutical composition must be stable under the conditions of manufacture and storage and must be preserved from the contaminating action of exogenous microorganisms, such as pathogenic bacteria and fungi. As used herein, the term "therapeutically effective amount", when used, is an equivalent term that refers to the amount of a therapy (e.g., prophylactic or therapeutic agent) that is sufficient to reduce the severity and/or duration of a disease, ameliorate one or more of its symptoms, prevent the progression of a disease or cause regression of a disease, or which is sufficient to result in the prevention of development, recurrence, onset, or progression of a disease or one or more of its symptoms, or to enhance or enhance the prophylactic and/or therapeutic effect(s) of another therapy (e.g., another therapeutic agent) useful for treating a disease. Typically, in a pharmaceutical composition according to the present description, the F. prausnitzii bacteria are present in an amount sufficient to induce a reduction in the viral load of a respiratory virus in the subject treated, when this subject is infected with said respiratory virus, relative to the expected viral load in a subject who has not received said F. prausnitzii bacteria. In a composition according to the description, whether it is a nutritional or food composition, where appropriate a food supplement, or whether it is a pharmaceutical composition, the bacteria or bacteria, in particular F. prausnitzii bacteria can be in various forms, for example in liquid form or in powder form. The bacteria or bacteria, in particular the F. prausnitzii bacteria, can be in freeze-dried form. The quantity of Faecalibacterium bacteria, in particular of F. prausnitzii or of F. duncaniae, which is supplied to the subject may be variable, depending on the physiological state of said subject, and in particular depending on whether the bacteria are administered for a prophylactic purpose or in a therapeutic purpose. The quantity of F. prausnitzii bacteria which must be provided to said subject can easily be adapted by those skilled in the art. In preferred embodiments, whether the composition is a nutritional composition or a pharmaceutical composition, the composition comprises an amount of bacteria of the genus Faecalibacterium which is suitable for daily intake, preferably daily oral intake, of at least 10 ⁷ colony forming units (or "CFU" for "Colony Forming Units"). In these preferred embodiments, the daily intake, in particular the daily oral intake, of bacteria of the genus Faecalibacterium is at most 10 ¹¹ colony forming units (or “CFU” for “Colony Forming Units”). Thus, in certain preferred embodiments, the composition comprises an amount of bacteria of the Faecalibacterium genus ranging from 10 ⁷ colony-forming units to 10 ¹¹ colony-forming units. In embodiments in which the composition further comprises other probiotic bacteria, the amount of such probiotic bacteria is determined by one skilled in the art based on his general knowledge. The amount of these other probiotic bacteria can vary from 10 ³ to 10 ¹³ other probiotic bacteria. In the embodiments in which the bacteria are inactivated, dead, or in the form of a bacterial extract or a bacterial lysate, the amount of daily intake is the equivalent of the amount of bacteria corresponding to the appropriate number of CFUs specified above. In certain embodiments, a composition according to the present description generally comprises carriers or vehicles. "Carriers" or "vehicles" refer to materials suitable for administration and include any material known in the state of the art, such as, for example, any liquid, gel, solvent, liquid diluent, solubilizing agent or the like, which is non-toxic and which does not interact with the components of the composition in a deleterious manner. Examples of nutritionally acceptable carriers include, for example, water, saline solutions, alcohols, silicones, waxes, petrolatum, vegetable oils, polyethylene glycols, propylene glycol, liposomes, sugars, gelatin, lactose, amylose, magnesium stearate, talc, surfactants, silicic acid, viscous paraffin, oil of perfume, monoglycerides and diglycerides of fatty acids, esters of petroleum fatty acids, hydroxymethylcellulose, polyvinylpyrrolidone, etc. In other embodiments of a composition according to the present description, as indicated elsewhere, said composition is in the form of a pharmaceutical composition comprising one or more pharmaceutically acceptable excipients. Such a pharmaceutical composition can be presented in the form of a package comprising a plurality of dosage units. The term "dosage unit" is used in its conventional sense in pharmacy (eg one pill, one capsule, one tablet, the contents of one ampoule, etc.). Uses This description relates to the prophylactic uses and the therapeutic uses of a composition as defined in the present application, against an infection of a subject by a respiratory virus, in particular against a infection of a human subject by a respiratory virus. The compositional characteristics, including of a prophylactic composition and a therapeutic composition, including in various embodiments, are described in detail in this description, which includes the amounts of active ingredient(s). ), especially the quantities of bacteria of the genus Faecalibacterium, in particular of bacteria of the species F. prausnitzii or of bacteria of the species F. duncaniae, included in these compositions. In certain embodiments, a prophylactic composition and a therapeutic composition according to the present description may have a qualitative and quantitative constitution in active ingredients and in excipient(s) which is identical, the only distinction being that the "prophylactic" composition is administered, as a preventive measure, to a subject not infected with a respiratory virus, whereas the same composition, this time qualified as “therapeutic”, is administered to a subject who is infected with a respiratory virus. In certain embodiments, a composition in accordance with the present description, optionally in the form of a dietary supplement composition, is formulated for daily administration, for example for daily administration in one or two doses, for example at meal times. In certain embodiments, a composition according to the present description, in particular a prophylactic composition according to the present description, is administered to the subject chronically, for a long period of time, for example for several months or even for several years. , for the purpose of mitigating the consequences of the possible occurrence of an infection by a respiratory virus, for example by a SARS-CoV-2 virus or else by an Influenza virus, in particular an Influenza virus of type A (IAV). In certain embodiments, a composition according to the present description, in particular a therapeutic composition according to the present description, is administered to a subject infected with a respiratory virus, (i) until the disappearance of the symptoms caused by the infection with said respiratory virus or (ii) until the presence of said respiratory virus in said subject becomes undetectable The invention is described below in more detail by means of the following examples which are presented by way of illustration uniquely. Examples Example 1: Effect of F. prausnitzii on the viral load of a respiratory virus A. Materials and Methods A.1. Treatment protocol 6-week-old female hamsters of the RjHan:AURA line obtained from Janvier Lab were used for the experiment. The hamsters were separated into two groups. A first group of hamsters was inoculated with the SARS-CoV-2 virus (UCN1 strain/GISAID identifier EPI_ISL_911513), by intranasal injection of a dose of 10 ⁴ TCID ₅₀ of the virus. A second group of hamsters was treated by oral administration of F. prausnitzii at the rate of a daily quantity of F. prausnitzii of 10 ⁹ colony forming units (CFUs), during the 5 days preceding infection with SARS-CoV- 2, then for 4 days following inoculation with the SARS-CoV-2 virus. On D6, the hamsters were inoculated with the SARS-CoV-2 virus (UCN1 strain), by intranasal injection of a dose of 10 ⁴ TCID ₅₀ of the virus, as for the first group. The animals of the two groups were sacrificed on D4 following the inoculation of the SARS-CoV-2 virus. A.2. Viral load measurement protocols The evaluation of the viral load of the SARS-CoV-2 virus was carried out using lung samples taken from the animals on the day of their sacrifice. Detection of the SARS-CoV-2 viral genome was performed using a real-time PCR method. The detection of the SARS-COV-2 viral genome is based on the amplification of the E gene (position 26141-26253) by TaqMan RT-qPCR using a pair of nucleotide primers and a TaqMan probe described by Corman and para. (2020), The following method was carried out: - The viral RNA is extracted from 140 µL of clarified supernatant of organ tissue homogenate (diluted to 1/ ^50th ) (ie lung) or from a volume of 140 µL of biological fluids (ie oropharyngeal swab diluted in a volume of 500 µL of DMEM medium containing 1% antibiotics). The extraction of the viral RNA is carried out using the commercial kit Qiagen Viral RNA mini kit (Qiagen, France) according to the manufacturer's instructions. The following nucleotide primers and the TaqMan probe were used: - E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT (SEQ ID NO. 1) - E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA (SEQ ID NO. 2) - E_Sarbeco_P1 ACACTAGCCATCCTTACTGCGCTCG [5']'am [3']BHQ-1 ( SEQ ID NO.3). The primer pairs and the TaqMan probe have been described by Corman et al. Eurosurveillance; PMID:31992387. The primers allow amplification of the E gene (112-pB amplicon, position 26141-26253). TaqMan RT-qPCR was performed in a total volume of 25 µL TaqMan RT-qPCR assays were performed in a total volume of 25 µL containing 2.' μL of extracted RNA, 12.5 µL of 2x reaction mix, 1 µL of 225 mM MgCl (Invitrogen), 4.' µL of RNase-free water, 2 µL of each of the primers (10 µM), 0.25 µL of probe (10 µM) and 0.25 µL of enzyme (Quantitect Probe RT-mix). All assays were performed on the Rotor Gene Q MDx real-time thermal cycler (Qiagen, Courtaboeuf, France). Amplification was performed under the following thermocycling conditions: 50°C for 30 min for reverse transcription, followed by 95°C for 15 min and then 45 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 30 s. Negative and positive controls were included in each PCR. A standard curve was produced for each test in the following manner: production of a range of 5 dilutions to 1/ ^10th from a calibrated SARS COV-2 RNA titrating 4.10^6' copies/µL of RNA. The Ct threshold of 0.05 was used as a reference for each RT-qPCR test. The efficiency, the slope and the correlation coefficient (R ² ) were determined with the Rotor Gene software. All PCR reactions were performed in duplicate. The titration of the SARS-CoV-2 viral strain was carried out by infecting cells sensitive to the virus according to the following method: The titration of the infectious viral particles is carried out on 96-well microplates. A suspension of VeroE6 cells, sensitive to the SARS-CoV-2 virus, was prepared in DMEM medium containing 10% fetal bovine serum (FCS) and 1% antibiotics (penicillin/streptomycin/amphotericin B) so as to obtain a final concentration of 1.10 ⁵ cells per ml. This cell suspension was seeded, in each well of the microplate, 24 hours before the inoculation of the samples. The microplates were incubated at 37°C in an oven containing 5% CO2. Twenty-four hours later, a first dilution of the sample to 1/10 is carried out in so-called "complete" medium, that is to say DMEM supplemented with fetal calf serum (10%) and a mixture penicillin/streptomycin (1%). Then from this diluted sample, serial dilutions of factor 4 are carried out in complete medium. The microplates containing the cell suspension are taken from the oven. Medium was removed from each well and immediately 50 µL of the 1/10 diluted suspension and serial quarter dilutions of each sample were added to each well in 6 replicates. After adding the inoculum, the plate was incubated at 37°C with 5% CO2 for one hour. Six uninfected wells were used as an independent negative control. One hour later, the microplate wells were filled with complete DMEM medium. After 3-4 days post-inoculation, plates were read under a white light microscope. Viral infection of susceptible cells by the SARS-CoV-2 virus causes cytopathic effects. The titer of the virus present in the samples, expressed in TCID50/mL, was determined using the Spe rman-Kärber formula: [Math 1]

d ns which: - log10 (dilution50) = logarithm of the dilution where there is 50% of positive signal, i.e. 50% of lysis plaques - x0 = - (log10 of the lowest dilution with all the wells negative) - d = log10 of the dilution step - ri = number of negative wells - ni = number of C replicates. Results The results are presented in each of Figures 1 and 2. The results of Figures 1 and 2 show a statistically significant decrease of the viral load in the animals of the second group which was treated with F. prausnitzii, by comparison with the animals of the second group which did not receive F. prausnitzii, that the viral load be evaluated in number of copies of the genome of SARS-CoV-2 or in number of infectious virus particles. Example 2: Effect of F. prausnitzii on infection by the influenza virus (IAV H3N2) A. Materials and Methods A.1. Treatment protocol 8-week-old C57BL/6J male mice obtained from Janvier (Le Genest-St-Isle, France) were used for the experiment. The animals were separated into three groups. A first group of mice (n=5) received only the excipient (PBS-glycerol 16%) throughout the procedure and was not infected (MOCK control). A second group (n=8) received the excipient (PBS-glycerol 16%) and was inoculated after 5 days of treatment with the IAV virus (H ₃ N ₂ Strain Scotland/20/74), by intranasal injection of a dose of 50 PFU of virus per mouse. A third group of mice (n=10) was treated by oral (intragastric) administration of F. prausnitzii A2.165 at the rate of a daily quantity of F. prausnitzii of 5 x 10 ⁹ colony forming units (CFUs) in buffer PBS-glycerol 16%, the 5 days preceding the infection. The mice were infected with the H ₃ N ₂ virus (Scotland/20/74 strain) by intranasal injection of a dose of 50 PFU of the virus. Treatment with F. prausnitzii was continued for 7 days after infection, until sacrifice. Weight was monitored daily after infection. A.2. Protocols for measuring the viral load The evaluation of the viral load of the IAV virus was carried out using lung samples taken from the animals on the day of their sacrifice. The measurement of the number of copies of the genome of the IAV virus was carried out according to the specific qRT-PCR method (Taqman method). The RNA was extracted from the lungs by grinding in RA1 buffer (Macherey Nagel) containing 1% β-mercaptoethanol. The RNA was retrotranscribed into cDNA by specific reverse transcription using primers recognizing the M1 region of the IAV virus (5ʹ-TCT AAC CGA GGT CGA AAC GTA-3ʹ - SEQ ID NO. 4). ) and SuperScript® II reverse transcriptase (Invitrogen). The PCR is carried out using TaqMan Universal PCR Master Mix (Applied Biosystems) and specific primers for the M1 region of IAV (sense: 5ʹ- AAG ACC AAT CCT GTC ACC TCT GA-3 – SEQ ID NO. 5ʹ anti-sense: 5ʹ-CAA AGC GTC TAC GCT GCA GTC C-3ʹ - SEQ ID NO. 6), and a specific TaqMan probe (marked FAM, TAMRA (5ʹ-TTT GTG TTC ACG CTC ACC GTG CC-3ʹ - SEQ ID NO. 7). The amplification was carried out on the Quantstudio 5 (Applied Biosystems). The number of copies was evaluated using a range of plasmids containing the gene of interest. A.3 Gene expression measurement protocol The expression of the different genes was carried out from lung samples taken from the animals on the day of their sacrifice.The expression of the genes was carried out according to the method by specific qRT-PCR (Sybergreen method). RNA was extracted from the lungs by grinding in RA1 buffer (Macherey Nagel) containing 1% β-mercaptoethanol. RNA was reverse-transcribed into cDNA using the High capacity RNA-t kit o-cDNA kit (Applied Biosystems). The qPCR was carried out using the Power SYBR green PCR master Mix (Applied Biosystems) and specific probes for each gene) and the amplification is carried out on the Quantstudio 5 (Applied Biosystems). The expression was related to that of a housekeeping gene (Gapdh) and compared (Expression relative to the expression obtained in uninfected control mice. C. Results C1. Impact of the F. prausnitzii A2-165 strain The impact of the reference strain F. prausnitzii A2-165 was first evaluated. The results are shown in each of Figures 3, 4, 5 and 6 and represent the average of 4 separate experiments. Figure 3 shows the weight loss induced by viral infection, either in kinetics after infection (Fig. 3A) or at D7 post-infection (Fig. 3B). The infected mice progressively lose weight to reach a significant weight loss compared to the uninfected animals (p<0.001). A significant decrease in weight loss (p<0.01) is observed in animals treated with F. prausnitzii A2-165, compared to animals which did not receive F. prausnitzii. Figure 4 shows the viral load evaluated in number of copies of the genome of IAV by specific qRT-PCR (Taqman). The data is shown in linear (Fig. 4A) or logarithmic (Fig. 4B) value. As expected, the viral load is significant in the infected mice (p<0.0001). The animals which have been treated with F. prausnitzii A2-165 show a very significant reduction (p<0.001) in the viral load compared to the animals which have not received F. prausnitzii. Figure 5 shows the clinical score evaluated by histological analyzes on lung sections stained with hematoxylin and eosin (H&E). This analysis shows a significant drop (p<0.05) in total scores (Fig. 5A), mainly due to a significant drop (p<0.05) in the percentage of lung lesions (Fig 5B), as well as a significant drop in the score d vascular inflammation (p=0.09) (FIG. 5C), in mice treated with the F. prausnitzii A2-165 strain. Figure 6 shows the expression of the genes encoding interferon gamma (Ifng) and of the genes induced by interferon gamma (Mx1 and Isg15) evaluated by qRT-PCR. This analysis shows that treatment with F. prausnitzii A2-165 limits the expression of these genes, induced by viral infection, which correlates with the decrease in viral load. Figure 7 shows the expression of pro-inflammatory genes encoding two chemokines involved in the recruitment of inflammatory cells (MCP1/CCL2 and CXCL2). This analysis shows that treatment with F. prausnitzii A2-165 limits significantly the expression of these genes, indicating that the treatment limits the inflammation at the pulmonary level. C2. Impact of the inactivation of the strain F. prausnitzii A2-165 Secondly, the impact of the reference strain F. prausnitzii A2-165 was compared with that of the same pasteurized strain (treatment of 30 minutes at 100 °C). The results are shown in each of Figures 7, 8 and 9 and represent the average of 2 separate experiments. Figure 8 shows the weight loss induced by viral infection, either in kinetics after infection (Fig. 8A) or on D7 post-infection (Fig. 8B). The infected mice progressively lose weight to reach a significant weight loss compared to the uninfected animals (p<0.0001). A similar decrease in weight loss is observed in animals treated with live or inactivated F. prausnitzii A2-165 strain, compared to animals that did not receive F. prausnitzii, however the effect is not significant. (p=NS). Figure 9 shows the viral load evaluated in number of copies of the genome of IAV by specific qRT-PCR (Taqman). The data is shown in linear (Fig. 9A) or logarithmic (Fig. 9B) values. As expected, the viral load is significant in the infected mice (p<0.0001). Animals which have been treated with live F. prausnitzii strain A2-165 show a significant decrease (p<0.01) in viral load compared to animals which have not received F. prausnitzii. A similar decrease is observed with the pasteurized strain A2-165. C3. Impact of the F. prausnitzii I-4574 strain The impact of another strain of F. prausnitzii, the I-4574 strain from the Micalis collection, was evaluated. The results are presented in each of Figures 10, 11, 12 and 13. Figure 10 shows the weight loss induced by viral infection, either in kinetics after infection (Fig.10A) or at D7 post-infection ( Fig.10B). The infected mice progressively lose weight to reach a significant weight loss compared to the uninfected animals (p<0.001). A similar decrease in weight loss is observed in animals treated with the two strains F. prausnitzii A2-165 and I-4574, administered live, compared to animals which did not receive F. prausnitzii. Figure 11 shows the viral load evaluated in number of copies of the genome of IAV by specific qRT-PCR (Taqman). The data is shown in linear (Fig. 11A) or logarithmic (Fig. 11B) values. As expected, the viral load is significant in infected mice (p < 0.01). The animals which have been treated with the F. prausnitzii I-4574 strain show a significant decrease (p<0.01) in the viral load compared to the animals which have not received F. prausnitzii. Figure 12 shows the expression of the genes encoding Interferon gamma (Ifng) and beta (Ifnb) and the gene induced by interferon gamma (Isg15) evaluated by qRT-PCR. This analysis shows that treatment with F. prausnitzii I-4574 significantly reduces the expression of interferons and, at the limit of significance, the expression of Isg15 (p=0.09) induced by the viral infection, which is correlated with decreased viral load. Figure 13 shows the expression of pro-inflammatory genes (Il6, Mcp1/Ccl2, Cxcl2) evaluated by qRT-PCR. This analysis shows that the treatment with F. prausnitzii I-4574 significantly reduces the expression of these genes (p<0.05-0.01), only the expression of Cxcl2 being at the limit of significance (p=0.09).

Claims

1. Bacteria of the genus Faecalibacterium for their use in the prevention or treatment of an infection of a subject by a respiratory virus, preferably by a human respiratory virus.

2. Bacteria of the genus Faecalibacterium for their use according to claim 1, for the prevention or treatment of an infection of a subject by a respiratory virus causing severe acute respiratory distress syndrome, preferably by a human virus.

3. Bacteria of the genus Faecalibacterium for their use according to one of claims 1 or 2, said bacteria being chosen from bacteria of the species F. prausnitzii and bacteria of the species F. duncaniae.

4. Bacteria of the genus Faecalibacterium for their use according to one of claims 1 and 2, said bacteria belonging to the strain A2-165 or to the strain deposited with the CNCM under the accession number CNCM 1-4574 on December 7 2011.

5. Bacteria of the genus Faecalibacterium for their use according to one of claims 1 to 4, said respiratory virus being chosen from (i) a human respiratory syncytial virus (HRSV), (ii) a human parainfluenza virus (HPIV), (iii ) human rhinovirus (HRV), (iv) Aleutian disease virus (ADV), (v) human coronavirus (HCoV), (vi) human metapneumovirus (HPMV), (vii) human bocavirus (HBoV) , (viii) human parainfluenza virus (HIPV) (ix) human influenza virus (IAV), (x) rotaviruses, (xi) caliciviruses, (xii) toroviruses, (xiii) adenoviruses, ( xiv) BHV and ADV herpesviruses and (xv) pestiviruses.

6. Bacteria of the Faecalibacterium genus for their use according to one of claims 1 to 4, said virus being a SARS-CoV respiratory virus, preferably a SARS-CoV-2 respiratory virus.

7. Bacteria of the genus Faecalibacterium for their use according to one of claims 1 to 4, said virus being a human Influenza virus.

8. Bacteria of the genus Faecalibacterium for their use according to one of claims 1 to 4, for reducing the subject's viral load of said respiratory virus, preferably the subject's lung load of said respiratory virus.

9. Bacteria of the genus Faecalibacterium for their use according to claim 8, said respiratory virus being a SARS-CoV-2 virus.

10. Bacteria of the species F. prausnitzii for their use according to claim 8, said respiratory virus being a human Influenza virus.

11. Bacteria of the genus Faecalibacterium for their use according to one of claims 1 to 8, said bacteria being included in a composition, in combination with at least one physiologically acceptable excipient.

12. Bacteria of the genus Faecalibacterium for use according to one of claims 1 to 11, said bacteria being included in a composition in a form suitable for nasal, oral or rectal administration.

13. Bacteria of the Faecalibacterium genus for their use according to one of claims 1 to 12, said oral composition being chosen from the group consisting of a food product, a drink, a pharmaceutical product, a nutraceutical, a food additive, a dietary supplement and a dairy product.

14. Bacteria of the genus Faecalibacterium for its use according to one of claims 1 to 13, said bacteria being included in a composition in a form suitable for administration of 10 ⁷ to 10 ¹¹ colony-forming units (cfu).