WO2023034808A1 - Mixed lineage kinase inhibitors and methods of use - Google Patents

Mixed lineage kinase inhibitors and methods of use Download PDF

Info

Publication number
WO2023034808A1
WO2023034808A1 PCT/US2022/075678 US2022075678W WO2023034808A1 WO 2023034808 A1 WO2023034808 A1 WO 2023034808A1 US 2022075678 W US2022075678 W US 2022075678W WO 2023034808 A1 WO2023034808 A1 WO 2023034808A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound
lzk
cell
mlk
cancer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2022/075678
Other languages
English (en)
French (fr)
Inventor
John F. BROGNARD
Rolf E. Swenson
Amy L. FUNK
Carolyn W. HITKO
Katherine M. NYSWANER
Knickole L. BERGMAN
Venkatareddy SABBASANI
Eric Lindberg
Steven D. CAPPELL
Meghri KATERJI
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
US Department of Health and Human Services
Original Assignee
US Department of Health and Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by US Department of Health and Human Services filed Critical US Department of Health and Human Services
Priority to KR1020247010519A priority Critical patent/KR20240055041A/ko
Priority to EP22777538.4A priority patent/EP4395899A1/en
Priority to US18/688,126 priority patent/US20250032489A1/en
Priority to CN202280073643.1A priority patent/CN118251387A/zh
Priority to AU2022340743A priority patent/AU2022340743A1/en
Priority to JP2024513749A priority patent/JP2024533121A/ja
Priority to CA3229861A priority patent/CA3229861A1/en
Publication of WO2023034808A1 publication Critical patent/WO2023034808A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445Non condensed piperidines, e.g. piperocaine
    • A61K31/4523Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/4545Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a six-membered ring with nitrogen as a ring hetero atom, e.g. pipamperone, anabasine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/498Pyrazines or piperazines ortho- and peri-condensed with carbocyclic ring systems, e.g. quinoxaline, phenazine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/04Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
    • C07D401/12Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D401/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D403/00Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/04Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings directly linked by a ring-member-to-ring-member bond
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D405/00Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/14Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing three or more hetero rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D471/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04Ortho-condensed systems
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D471/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/08Bridged systems
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D487/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/04Ortho-condensed systems
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D487/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/08Bridged systems

Definitions

  • This invention concerns mixed lineage kinase inhibitors, and methods for using the inhibitors.
  • HNSCC head and neck squamous cell carcinoma
  • Treatment options for HNSCC patients are primarily limited to surgery, radiotherapy, platinum-based chemotherapy, or combinations thereof.
  • Cetuximab a monoclonal antibody targeting EGFR, is the only approved targeted therapy for HNSCC (Bonner et al. , NEJM 2006, 364:567-578; Vermorken et al. , NEJM 2008, 359: 1116-1127).
  • cetuximab a monoclonal antibody targeting EGFR
  • Lung squamous cell carcinoma accounts for one-third of all lung cancer cases.
  • LSCC Lung squamous cell carcinoma
  • genomic sequencing the identification of oncogenic drivers in LSCC has remained challenging, and actionable alterations are unknown in the majority of LSCC patients (Gold et al., Clin Cancer Res 2012, 18(11):3002-7; Gandara et al., Clin Cancer Res 2015, 21 (10):2236-43).
  • no targeted therapies have been approved to treat LSCC, and treatment still relies on chemotherapy or radiotherapy.
  • TNBC triple-negative breast cancer
  • TNBC is characterized by an absence of estrogen and progesterone receptors, as well as a lack of HER2 overexpression. Intrinsic and acquired resistance to chemotherapy leads to high rates of relapse and poor outcomes (Mehlich et al.). Hence, there is a need for new therapies.
  • the disclosed inhibitor is a compound, or a stereoisomer, tautomer, or pharmaceutically acceptable salt thereof, having a general formula I:
  • each bond represented by - is a single or double bond as needed to satisfy valence requirements.
  • the -X ⁇ R 5 )- moiety is -C(R 5 )-, -C(R 5 )-C(H)-, -C(H)-C(R 5 )-, -C(R 5 )-N-, -N-C(R 5 )-, or -N(R 5 )-.
  • X 2 is N or C.
  • X 3 is N or CH.
  • One or two of X1X 3 comprises N.
  • X 4 is CH or S.
  • X 5 is -N(H)- or absent.
  • Y 1 is CR 1 ) or N.
  • Y 2 is C(R 2 ) or N.
  • Y 3 is C(R 3 ) or N.
  • Y 4 is N or C(R 6 ).
  • Y 5 is C(R 7 ) or N.
  • Y 6 is C(R 8 ) or N.
  • One or two of Y ⁇ Y 6 are N, and at least one of Y 1 - Y 3 or Y 6 is other than C(H).
  • Two, three, or four of Y 7 -Y 10 independently are N or N(R 9 ), and the others of Y 7 -Y 10 are C(R 10 ).
  • R 1 is cyano, perhaloalkyl, H, alkyl, or perhaloalkoxy.
  • R 2 is H, alkoxy, perhaloalkyl, perhaloalkoxy, haloalkoxy, haloalkyl, cyano, alkyl, cyanoalkyl, amino, heteroarylalkoxy, heteroalkyl, amido, halo, alkenyl, or haloalkenyl, or R 1 and R 2 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring.
  • R 3 is H, amino, alkylamino, aminoalkyl, alkoxy, or -N(H)C(O)R' where R' is alkyl, or R 2 and R 3 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring.
  • R 4 is aliphatic, azaalkyl, aryl, or amino.
  • R 5 is aliphatic, heteroaliphatic, or alkylamino.
  • R 6 and R 7 independently are H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano.
  • R 8 is H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano or R 8 and R 1 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring.
  • Each R 9 independently is H or alkyl.
  • Each R 10 independently is H, alkyl, or cyano.
  • a pharmaceutical composition includes at least one compound as disclosed herein, and at least one pharmaceutically acceptable carrier.
  • a method of inhibiting MLK activity includes contacting a cell expressing an MLK with an effective amount of a compound disclosed herein, thereby inhibiting MLK activity.
  • the MLK may be MLK1 (MAP3K9), MLK2 (MAP3K10), MLK3 (MAP3K11), MLK4 (MAP3K21), DLK (MAP3K12), LZK (MAP3K13), ZAK1 (MAP3K20), or any combination thereof.
  • inhibiting MLK activity inhibits cell cycle progression, reduces c-MYC expression, inhibits c-Jun N-terminal kinase (JNK) pathway signaling, inhibits PI3K/AKT pathway signaling, inhibits cyclin dependent kinase 2 (CDK2) activity, or any combination thereof.
  • the cell may be characterized by amplification of chromosome 3q, amplification of chromosome llq, overexpression of a mitogen-activated protein kinase kinase kinase (MAP3K), overexpression of an extracellular signal-regulated kinase (ERK), or any combination thereof.
  • MAP3K mitogen-activated protein kinase kinase kinase
  • ERK extracellular signal-regulated kinase
  • the cell is a head and neck squamous cell carcinoma (HNSCC) cell, a lung squamous cell carcinoma (LSCC) cell, a hepatocellular carcinoma cell, an ovarian cancer cell, a small cell lung cancer cell, a neuroendocrine prostate cancer cell, an esophageal cancer cell, or a breast cancer cell.
  • HNSCC head and neck squamous cell carcinoma
  • LSCC lung squamous cell carcinoma
  • hepatocellular carcinoma cell an ovarian cancer cell
  • small cell lung cancer cell a neuroendocrine prostate cancer cell
  • an esophageal cancer cell an esophageal cancer cell
  • breast cancer cell breast cancer cell.
  • contacting the cell with the compound comprises administering a therapeutically effective amount of the compound, or an amount of a pharmaceutical composition comprising the therapeutically effective amount of the compound, to a subject.
  • the subject may have a disease or condition characterized at least in part by MLK overexpression.
  • the disease or condition is cancer, such as HNSCC, LSCC, hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, esophageal cancer, or breast cancer.
  • Administering the therapeutically effective amount of the compound, or the amount of the pharmaceutical composition may decrease viability of the cancer cells, inhibit tumor growth, or a combination thereof.
  • FIG. 1 is the structure of GNE-3511.
  • FIGS. 2A-2C show that GNE-3511 inhibited LZK activity, as monitored by downstream JNK phosphorylation from 100 nM to 5 pM at 24 hours (2A) and at 250 nM for up to 72 hours (2B);
  • FIG. 2C is a graphical representation of the data.
  • FIG. 3 shows RT-PCR analysis of CAL33 TR LZK WT or 240S cell lines with tetracycline-inducible expression of LZK.
  • FIG. 4 shows that GNE-3511 250 nM, inhibited LZK activity toward JNK within 15 minutes.
  • FIG. 5 shows that GNE-3511 decreased in vitro phosphorylation of MKK7, a direct downstream target of LZK.
  • FIGS. 6A and 6B are a series of images (6A) and a bar graph (6B) showing that GNE-3511 suppressed clonogenic growth after 14 days in head and neck squamous cell carcinoma (HNSCC) cell lines with amplified MAP3K13 (CAL33 and BICR56) with only mild effects on clonogenic growth in the control HNSCC cell line (MSK921) or the immortalized normal human bronchial epithelial cell line (BEAS-2B).
  • HNSCC head and neck squamous cell carcinoma
  • MSK921 control HNSCC cell line
  • BEAS-2B immortalized normal human bronchial epithelial cell line
  • FIGS. 7A and 7B are a bar graph (7 A) and images (7B) showing that LZK inhibition with GNE-3511 at 500 nM reduced clonogenic growth of lung squamous cell carcinoma (LSCC) cell lines with 3q amplification (LK2 and NCLH520).
  • LSCC lung squamous cell carcinoma
  • FIG. 8 is a graph showing that GNE-3511 treatment significantly reduced cell viability in CAL33 and BICR56 cells for 72 hours.
  • FIG. 9 shows that a drug-resistant mutant form of LZK, Q240S, maintained catalytic activity in the presence of GNE-3511, as assessed by downstream JNK phosphorylation.
  • FIG. 10 shows that one-hour GNE-3511 treatment specifically inhibited LZK activity, as observed with the rescue of JNK signaling by the overexpression of the LZK Q240S drug-resistant mutant in 293 T cells.
  • FIG. 11 shows that GNE-3511 suppressed HNSCC viability in a 72-hour MTS assay in CAL33 and BICR56 cell lines that harbor amplified MAP3K13 and viability was rescued by expression of LZK Q240S .
  • FIG. 12A is a graph of mean tumor volume ⁇ SEM;
  • FIG. 12B is a bar graph showing average tumor volume at the end of treatment, mean tumor volume ⁇ SEM, Student’s /-test, *p ⁇ 0.05;
  • FIG. 12C is tumor images at the end of the study.
  • Mean tumor volumes ⁇ SEM are shown. Average tumor volume at the end of treatment. Mean ⁇ SEM; Student’s /-test; *p ⁇ 0.05.
  • FIGS. 15A and 15B are images of immunohistochemistry (IHC) staining of an apoptotic marker, cleaved caspase 3, in CAL33 xenografts for teach treatment group (15A), and quantification of the cleaved caspase-3 staining revealing an increase in the apoptotic marker with GNE-3511 treatment compared to the control in tumors (15B).
  • IHC immunohistochemistry
  • FIG. 16 is a graph representing percentage of the HNSCC PDX models with amplification of each gene on chromosome 3; the genes were ordered by gene start point along chromosome 3; MAP3K13 is marked with a cross; the line is the regression line by loss method.
  • FIG. 17 shows RT-PCR analysis of the CAL33, BICR56, and MSK921 cell lines with dox-inducible knockdown of LZK.
  • FIG. 18 shows copy number (CN) profiles of fifty-eight HNSCC PDX mouse models on chromosome 3 obtained from the NCI PDMR; the heatmap color indicates the log2 ratio of copy numbers.
  • FIG. 19 shows a boxplot of MAP3K13 gene expression in fifty-eight PDX models with different MAP 3 KI 3 copy numbers.
  • FIG. 20 is RPPA assay results identifying decreased c-MYC levels in CAL33 and BICR56 cells depleted of LZK for 48 hours.
  • FIG. 21 is a series of Western blots of c-MYC abundance in CAL33 and BICR56 cells depleted of LZK for 48 hours.
  • FIG. 22 is a series of Western blots of cell cycle component abundance in CAL33 cells depleted of LZK for 48 hours
  • FIG. 23 is a Western blot showing that treatment with MG132 (10 pM) for six hours rescued decreases in c-MYC levels in CAL33 and BICR56 cells depleted of LZK for 48 hours.
  • FIG. 24 is a Western blot showing that treatment of CAL33 cells with GNE-3511 decreased c-MYC abundance for up to 72 hours.
  • FIG. 25 is a Western blot showing that LZK Q240S expression rescued loss in c-MYC levels in CAL33 cells treated with GNE-3511.
  • FIG. 26 is a graph showing inhibition of LZK activity by several disclosed analogs, as monitored by downstream JNK phosphorylation.
  • FIG. 27 is a Western blot comparison of GNE-3511 and LZK inhibitor 2 showing that LZK inhibitor 2 is a potent LZK inhibitor at 100 nM.
  • FIG. 28 shows that LZK inhibitor 2 maintained JNK pathway inactivation for 72 hours at 250 nM.
  • FIG. 29 shows that LZK signaling activity was suppressed with LZK inhibitor 2 (250 nM) at five minutes.
  • FIG. 30 shows that LZK inhibitor 2 inhibited JNK signaling at lower concentrations than GNE-3511 for one hour.
  • FIGS. 31A and 3 IB are images showing that LZK inhibitor 2 suppressed clonogenic growth of HNSCC cells harboring amplified MAP3K13 (CAL33, BICR56, and Detroit 562) FIG. 31A) and quantification revealing a significant decrease in growth in all three cell lines. Mean ⁇ SEM; Student’s /-test; **p ⁇ 0.01, *p ⁇ 0.05 (FIG. 3 IB).
  • FIG. 32 is images showing that LZK inhibitor 2 (1 pM) significantly decreased LSCC cell growth in LK2 and NCLH520 cell lines.
  • FIG. 33 is a graph showing that LZK Q240S drug-resistant mutant expression rescued decreases in viability in CAL33 cells treated with LZK inhibitor 2.
  • FIG. 34 is a Western blot showing that LZK Q240S drug-resistant mutant expression during treatment with LZK inhibitor 2 (250 nM) rescued JNK signaling.
  • FIGS. 35-39 are bar graphs showing that several disclosed MLK inhibitors (1 pM, 1 hour) decreased phospho- JNK levels in CAL33 cells with induced expression of LZK with doxycycline using an ELISA assay. Inhibitors are initially screened for efficacy compared to GNE-3511 control.
  • FIGS. 40-42 are graphs showing dose-dependent inhibition of LZK by three disclosed MLK inhibitors.
  • FIG. 43 is a graph showing that esophageal squamous cell carcinoma (ESCC) cells with the 3q amplicon are sensitive to GNE-3511.
  • ESCC esophageal squamous cell carcinoma
  • FIG. 44 is images of a soft agar assay confirming that ESCC cells with the 3q amplicon are sensitive to GNE-3511.
  • FIG. 45 is images of a colony formation assay confirming that ESCC cells with the 3q amplicon are sensitive to GNE-3511.
  • FIG. 46 is images of a colony formation assay showing that ESCC cells with a drug resistant mutant form of LZK are resistant to GNE-3511.
  • FIG. 47 is images of a colony formation assay confirming that ESCC cells with the 3q amplicon are sensitive to two disclosed MLK inhibitors.
  • FIG. 48 is a Western blot showing that ESCC cells with a drug resistant mutant form of LZK are resistant to a disclosed MLK inhibitor.
  • FIG. 49 is images of a colony formation assay showing that ESCC cells with a drug resistant mutant form of LZK are resistant to a disclosed MLK inhibitor.
  • FIG. 50 is images of a colony formation assay showing that ESCC cells are very sensitive to two disclosed MLK inhibitors.
  • SEQ ID NO: 1 is an exemplary nucleotide sequence for an LZK Q240S forward primer.
  • SEQ ID NO: 2 is an exemplary nucleotide sequence for an LZK Q240S verse primer.
  • SEQ ID NO: 3 is an exemplary nucleotide sequence for an LZK K195M forward primer.
  • SEQ ID NO: 4 is an exemplary nucleotide sequence for an LZK K195M reverse primer.
  • SEQ ID NO: 5 is an exemplary nucleotide sequence for a Xbal to start of LZK forward primer.
  • SEQ ID NO: 6 is an exemplary nucleotide sequence for a Notl to end of LZK reverse primer.
  • SEQ ID NO: 7 is an exemplary nucleotide sequence for a T7 promoter primer.
  • SEQ ID NO: 8 is an exemplary nucleotide sequence for a BGH reverse primer.
  • SEQ ID NO: 9 is an exemplary nucleotide sequence for a Xbal to LZK kinase domain forward primer.
  • SEQ ID NO: 10 is an exemplary nucleotide sequence for a Xbal to LZK end kinase domain reverse primer.
  • SEQ ID NO: 11 is an exemplary nucleotide sequence for a Notl to LZK end zipper domain reverse primer.
  • SEQ ID NO: 12 is an exemplary nucleotide sequence for a Notl to LZK end stop codon reverse primer.
  • SEQ ID NO: 13 is an exemplary nucleotide sequence for a MAP3K13 forward primer
  • SEQ ID NO: 14 is an exemplary nucleotide sequence for a MAP3K13 reverse primer
  • SEQ ID NO: 15 is an exemplary nucleotide sequence for an ACTB forward primer
  • SEQ ID NO: 16 is an exemplary nucleotide sequence for an ACTB reverse primer
  • SEQ ID NO: 17 is an exemplary nucleotide sequence for a GAPDH forward primer
  • SEQ ID NO: 18 is an exemplary nucleotide sequence for a GAPDH reverse primer
  • SEQ ID NO: 19 is an exemplary DNA sequence encoding an shRNA.
  • SEQ ID NO: 20 is an exemplary DNA sequence encoding an shRNA.
  • MLKs are implicated in head and neck squamous cell carcinoma (HNSCC), lung squamous cell carcinoma (LSCC), hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, esophageal cancer, and breast cancer.
  • HNSCC head and neck squamous cell carcinoma
  • LSCC lung squamous cell carcinoma
  • HNSCC head and neck squamous cell carcinoma
  • LSCC lung squamous cell carcinoma
  • LZK has also been shown to regulate c-MYC protein stability in hepatocellular carcinoma and is required to maintain growth of hepatocellular carcinoma cells (Zhang et al., Cell Death & Differentiation 2020, 27:420-433). Furthermore, LZK is amplified in 20% of ovarian cancers, 25% of small cell lung cancers, 20% of neuroendocrine prostate cancer, and 20% of esophageal adenocarcinomas, implicating LZK as a driver in these additional cancers. MLK3 is amplified in 10% of head and neck cancers harboring the llq amplicon. MLK4 is a driver in 25% of triple- negative breast cancers harboring MAP3K21 (MLK4) amplification.
  • MLK4 is a driver in 25% of triple- negative breast cancers harboring MAP3K21 (MLK4) amplification.
  • LZK Leucine zipper-bearing kinase
  • MAPK3K13 Leucine zipper-bearing kinase
  • DLK MAPK3K12
  • LZK regulates c-MYC (Soth et 2018/0057507 Al; Soth et al., US 10,093,664 B2) and PI3K/AKT pathways in a kinase-dependent manner. Moreover, the c-MYC and PI3K/AKT pathways are implicated in a wide variety of cancers. Preventing the upregulation of these pathways by LZK inhibition is of broad interest to cancer researchers.
  • LZK can directly phosphorylate the MAP2Ks (MAP kinase kinases) MKK7 and MKK4, leading to JNK (c-Jun N-terminal kinase) pathway activation (Ikeda et al., J Biochem 2001, 130:773-781).
  • Amplified endogenous LZK does not activate the JNK pathway in HNSCC (Edwards et al., Cancer Res 2017, 77:4961-4972; Ikeda et al.).
  • overexpressed LZK leads to JNK pathway activation, which can be used as a readout to assess catalytic inhibitors of LZK (Edwards et al.).
  • MLK4 is a serine- threonine kinase that phosphorylates JNK, p38 MAPK, and extracellular signal-regulated kinase (ERK) signaling pathways (Marusiak et al., Oncogene 2019, 38:2860-2875). MLK4 can directly phorphorylate MEK, leading to activation of the ERK pathway (Id). MLK4 also regulates activation of transcription factor NF-KB (Id). MLK4 is overexpressed in 23% of invasive breast cancers, particularly triple-negative breast cancer (TNBC) (Id). MLK4 also promotes TNBC chemoresistance by regulating the pro-survival response to DNA-damaging therapies (Mehlich et al. , Cell Death and Disease 2021, 12:1111).
  • TNBC triple-negative breast cancer
  • MLK3 is another serine-threonine kinase, which is implicated in the NF-KB, ERK, JNK, and p38 MAP kinase pathways (Brancho et al., Mol Cell Biol 2005, 3670-3681). MLK3 signaling is implicated in several cancers, such as head and neck cancers harboring the llq amplicon.
  • Some examples of the disclosed compounds inhibit MLK activity, thereby decreasing the viability of cancer cells and/or suppressing tumor growth in vivo.
  • inhibiting LZK activity decreases the viability of cancer cells with amplified MAP3K13 and/or suppresses tumor growth in vivo.
  • the oncogene c-MYC identified as a downstream target that is regulated by catalytic activity of LZK.
  • some implementations of the disclosed compounds may suppress LZK kinase-dependent stabilization of MYC and activation of the PI3K/AKT pathway.
  • some examples of the disclosed compounds promote almost complete cell death in cell line-based models of head and neck squamous cell carcinoma (HNSCC) and significant levels of cell death in lung squamous cell carcinoma (LSCC) models.
  • HNSCC head and neck squamous cell carcinoma
  • LSCC lung squamous cell carcinoma
  • exemplary routes of administration include, but are not limited to, oral, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, intravenous, intraosseous, intracerebroventricular, intrathecal, and intratumoral), sublingual, rectal, transdermal, intranasal, vaginal and inhalation routes.
  • Aliphatic A substantially hydrocarbon-based compound, or a radical thereof (e.g., C6Hn, for a hexane radical), including alkanes, alkenes, alkynes, including cyclic (monocyclic, bicyclic, and polycyclic) versions thereof, and further including straight- and branched-chain arrangements, and all stereo and position isomers as well.
  • an aliphatic group contains from one to twenty-five carbon atoms; for example, from one to fifteen, from one to ten, from one to six, or from one to four carbon atoms.
  • An aliphatic chain may be substituted or unsubstituted.
  • an aliphatic group can either be unsubstituted or substituted.
  • a substituted aliphatic group includes at least one sp 3 -hybridized carbon or two sp 2 -hybridized carbons bonded with a double bond or at least two sp-hybridized carbons bonded with a triple bond.
  • substituents include, but are not limited to, alkyl, alkenyl, alkynyl, alkoxy, alkylamino, alkylthio, acyl, aldehyde, amide, amino, aminoalkyl, aryl, arylalkyl, carboxyl, cyano, cycloalkyl, dialkylamino, halo, haloaliphatic, heteroaliphatic, heteroaryl, heterocycloaliphatic, hydroxyl, oxo, sulfonamide, sulfhydryl, thioalkoxy, or other functionality.
  • Alkoxy A radical (or substituent) having the structure -OR, where R is a substituted or unsubstituted aliphatic group. Methoxy (-OCH3) is an exemplary alkoxy group. In a substituted alkoxy, R is alkyl substituted with a non-interfering substituent. R may be linear, branched, cyclic, or a combination thereof (e.g., cyclopropylmethoxy).
  • Alkyl A hydrocarbon radical or substituent having a saturated carbon chain.
  • the chain may be cyclic, branched or unbranched.
  • an alkyl group can either be unsubstituted or substituted. Examples, without limitation, of alkyl groups include methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl and decyl.
  • the term lower alkyl means the chain includes 1-10 carbon atoms.
  • alkenyl and alkynyl refer to hydrocarbon groups having carbon chains containing one or more double or triple bonds, respectively.
  • Alkylamino A an amino group with an alkyl substituent, e.g., -N(H)R or -N(R)R', where R and R' are alkyl groups, and the bond to the remainder of the molecule is through the nitrogen atom.
  • the alkyl portion may be straight, branched, or cyclic.
  • Alkylaryl An alkyl-substituted aryl group.
  • Amino A chemical functional group -N(R)R' where R and R' are independently hydrogen, alkyl, heteroalkyl, haloalkyl, aliphatic, heteroaliphatic, aryl (such as optionally substituted phenyl or benzyl), heteroaryl, alkylsulfano, or other functionality.
  • a “primary amino” group is -NH2.
  • “Mono-substituted amino” or “secondary amino” means a radical -N(H)R substituted as above and includes, e.g., methylamino, (l-methylethyl)amino, phenylamino, and the like.
  • Di-substituted amino or “tertiary amino” means a radical -N(R)R' substituted as above and includes, e.g., dimethylamino, methylethylamino, di(l-methylethyl)amino, and the like.
  • Amino acid An organic acid containing both a basic amino group (-NH2) and an acidic carboxyl group (-COOH).
  • the 25 amino acids that are protein constituents are a-amino acids, i.e., the -NH2 group is attached to the carbon atom next to the -COOH group.
  • amino acid also encompasses D-amino acids and non-naturally occurring amino acids, e.g., amino acids such as ornithine and 2,4-diaminobutyric acid.
  • Aminoalkyl A alkyl group including at least one amino substituent, wherein the bond to the remainder of the molecule is through a carbon atom of the alkyl group.
  • the alkyl portion may be straight, branched, or cyclic.
  • Aryl A monovalent aromatic carbocyclic group of, unless specified otherwise, from 6 to 15 carbon atoms having a single ring (e.g., phenyl) or multiple fused rings in which at least one ring is aromatic (e.g., quinoline, indole, benzodioxole, pyridine, pyrimidine, pyrazole, benzopyrazole, thiazole, isoxazole, oxazole, triazole, and the like), provided that the point of attachment is through an atom of an aromatic portion of the aryl group and the aromatic portion at the point of attachment contains only carbons in the aromatic ring.
  • aromatic e.g., quinoline, indole, benzodioxole, pyridine, pyrimidine, pyrazole, benzopyrazole, thiazole, isoxazole, oxazole, triazole, and the like
  • Aryl groups are monocyclic, bicyclic, tricyclic or tetracyclic. Unless expressly referred to as “unsubstituted aryl,” an aryl group can either be unsubstituted or substituted.
  • Arylalkyl An aryl-substituted alkyl group, e.g., benzyl, wherein the bond to the remainder of the molecule is through a carbon atom of the alkyl group.
  • Azaalkyl A heteroalkyl group including a nitrogen heteroatom.
  • the heteroalkyl group may be straight, branched, or cyclic.
  • An azaalkyl group is attached to the remainder of the molecule via the nitrogen heteroatom. Unless expressly referred to as “unsubstituted azaalkyl,” an azaalkyl group can either be unsubstituted or substituted.
  • Derivative A compound that is derived from a similar compound or a compound that can be imagined to arise from another compound, for example, if one atom is replaced with another atom or group of atoms.
  • the latter definition is common in organic chemistry. In biochemistry, the word is used for compounds that at least theoretically can be formed from the precursor compound.
  • KD Dissociation constant
  • DLK Dual leucine zipper-bearing kinase.
  • ESCC Esophageal squamous cell carcinoma.
  • Excipient A physiologically inert substance that is used as an additive in a pharmaceutical composition.
  • an excipient may be incorporated within particles of a pharmaceutical composition, or it may be physically mixed with particles of a pharmaceutical composition.
  • An excipient can be used, for example, to dilute an active agent and/or to modify properties of a pharmaceutical composition.
  • excipients include but are not limited to polyvinylpyrrolidone (PVP), tocopheryl polyethylene glycol 1000 succinate (also known as vitamin E TPGS, or TPGS), dipalmitoyl phosphatidyl choline (DPPC), trehalose, sodium bicarbonate, glycine, sodium citrate, and lactose.
  • PVP polyvinylpyrrolidone
  • DPPC dipalmitoyl phosphatidyl choline
  • trehalose sodium bicarbonate
  • glycine sodium citrate
  • lactose lactose
  • Heteroaliphatic An aliphatic compound or group having at least one carbon atom in the chain and at least one heteroatom, i.e., one or more carbon atoms has been replaced with a non-carbon atom, typically nitrogen, oxygen, phosphorus, silicon, or sulfur.
  • Heteroaliphatic compounds or groups may be substituted or unsubstituted, branched or unbranched, cyclic or acyclic, and include "heterocycle", “heterocyclyl”, “heterocycloaliphatic", or "heterocyclic” groups.
  • Heteroalkyl refers to an alkyl or cycloalkyl radical having at least one carbon atom in the chain and containing at least one heteroatom, such as N, O, S, or S(O) n (where n is 1 or 2). Unless expressly referred to as “unsubstituted aliphatic,” an aliphatic group can either be unsubstituted or substituted.
  • Heteroaryl An aromatic compound or group having at least one heteroatom, i.e., one or more carbon atoms in the ring has been replaced with a non-carbon atom, typically nitrogen, oxygen, phosphorus, silicon, or sulfur. Unless expressly referred to as “unsubstituted heteroaryl,” a heteroaryl group can either be unsubstituted or substituted.
  • Heterocyclic refers to a closed-ring compound, or radical thereof as a substituent bonded to another group, particularly other organic groups, where at least one atom in the ring structure is other than carbon, and typically is oxygen, sulfur and/or nitrogen. Unless expressly referred to as “unsubstituted heterocyclic,” a heterocyclic group can either be unsubstituted or substituted.
  • HNSCC Head and neck squamous cell carcinoma.
  • IAP Inhibitor of apoptosis protein. Includes cIAP - cellular IAP 1, and xIAP - X-linked IAP.
  • LSCC Lung squamous cell carcinoma.
  • LZK Leucine zipper-bearing kinase, a regulator of neuronal degeneration, e.g., following neuronal injury and/or in neurodegenerative diseases.
  • MAP3K Mitogen-activated kinase kinase kinase
  • MLK Mixed lineage kinase, a family of serine/threonine protein kinases that regulate signaling by p38 mitogen-activated protein kinase (MAPK) and c-Jun amino-terminal kinase (JNK) pathways.
  • MLKs include MLK1 (MAP3K9), MLK2 (MAP3K10), MLK3 (MAP3K11), DLK (MAP3K12), LZK (MAP3K13), and ZAK1 (MAP3K20), among others.
  • pharmaceutically acceptable A substance that can be taken into a subject without significant adverse toxicological effects on the subject.
  • pharmaceutically acceptable form means any pharmaceutically acceptable derivative or variation, such as stereoisomers, stereoisomer mixtures, enantiomers, solvates, hydrates, isomorphs, polymorphs, pseudomorphs, neutral forms, salt forms, and prodrug agents.
  • compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compositions and additional pharmaceutical agents are conventional.
  • Remington The Science and Practice of Pharmacy, The University of the Sciences in Philadelphia, Editor, Lippincott, Williams, & Wilkins, Philadelphia, PA, 21 st Edition (2005), describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compositions and additional pharmaceutical agents.
  • the nature of the carrier will depend on the particular mode of administration being employed.
  • parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
  • the pharmaceutically acceptable carrier may be sterile to be suitable for administration to a subject (for example, by parenteral, intramuscular, or subcutaneous injection).
  • pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
  • the pharmaceutically acceptable carrier is a non-naturally occurring or synthetic carrier.
  • the carrier also can be formulated in a unit-dosage form that carries a preselected therapeutic dosage of the active agent, for example in a pill, vial, bottle, or syringe.
  • compositions A biologically compatible salt of a compound that can be used as a drug, which salts are derived from a variety of organic and inorganic counter ions well known in the art and include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like; and when the molecule contains a basic functionality, salts of organic or inorganic acids, such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, oxalate, and the like.
  • Pharmaceutically acceptable acid addition salts are those salts that retain the biological effectiveness of the free bases while formed by acid partners that are not biologically or otherwise undesirable, e.g., inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, as well as organic acids such as acetic acid, trifluoroacetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, benzene sulfonic acid (besylate), cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-loluenesul Ionic acid, salicylic acid and the like.
  • inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid
  • Pharmaceutically acceptable base addition salts include those derived from inorganic bases such as sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like.
  • Exemplary salts are the ammonium, potassium, sodium, calcium, and magnesium salts.
  • Salts derived from pharmaceutically acceptable organic non-toxic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, methylglucamine, theobromine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins, and the like.
  • salts of primary, secondary, and tertiary amines substituted amines including naturally occurring substituted amines, cyclic amines
  • Exemplary organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.
  • Stereoisomers Isomers that have the same molecular formula and sequence of bonded atoms, but which differ only in the three-dimensional orientation of the atoms in space.
  • Subject An animal (human or non-human) subjected to a treatment, observation or experiment. Includes both human and veterinary subjects, including human and non-human mammals, such as rats, mice, cats, dogs, pigs, horses, cows, and non-human primates. In some aspects, the subject has cancer, such as head and neck squamous cell carcinoma or lung squamous cell carcinoma.
  • Substituent An atom or group of atoms that replaces another atom in a molecule as the result of a reaction.
  • the term “substituent” typically refers to an atom or group of atoms that replaces a hydrogen atom, or two hydrogen atoms if the substituent is attached via a double bond, on a parent hydrocarbon chain or ring.
  • the term “substituent” may also cover groups of atoms having multiple points of attachment to the molecule, e.g., the substituent replaces two or more hydrogen atoms on a parent hydrocarbon chain or ring. In such instances, the substituent, unless otherwise specified, may be attached in any spatial orientation to the parent hydrocarbon chain or ring.
  • substituents include, for instance, alkyl, alkenyl, alkynyl, alkoxy, alkylamino, alkylthio, acyl, aldehyde, amido, amino, aminoalkyl, aryl, arylalkyl, arylamino, carbonate, carboxyl, cyano, cycloalkyl, dialkylamino, halo, haloaliphatic (e.g., haloalkyl), haloalkoxy, heteroaliphatic, heteroaryl, heterocycloaliphatic, hydroxyl, oxo, sulfonamide, sulfhydryl, thio, and thioalkoxy groups. Substituents can be further substituted, unless expressly stated otherwise or context dictates otherwise.
  • a fundamental compound such as an aryl or aliphatic compound, or a radical thereof, having coupled thereto one or more substituents, each substituent typically replacing a hydrogen atom on the fundamental compound.
  • substituents typically replacing a hydrogen atom on the fundamental compound.
  • a substituted aryl compound may have an aliphatic group coupled to the closed ring of the aryl base, such as with toluene.
  • a long-chain hydrocarbon may have a hydroxyl group bonded thereto.
  • Tautomers Constitutional isomers of organic compounds that differ only in the position of the protons and electrons, and are interconvertible by migration of a hydrogen atom. Tautomers ordinarily exist together in equilibrium.
  • Therapeutically effective amount or dose An amount sufficient to provide a beneficial, or therapeutic, effect to a subject or a given percentage of subjects.
  • Treating or treatment With respect to disease, either term includes (1) preventing the disease, e.g., causing the clinical symptoms of the disease not to develop in an animal that may be exposed to or predisposed to the disease but does not yet experience or display symptoms of the disease, (2) inhibiting the disease, e.g., arresting the development of the disease or its clinical symptoms, or (3) relieving the disease, e.g., causing regression of the disease or its clinical symptoms.
  • ZAK Zipper sterile-a motif kinase
  • the disclosed mixed lineage kinase (MLK) inhibitors include compounds, or stereoisomers, tautomers, or pharmaceutically acceptable salts thereof, having a general formula I: where each bond represented by - is a single or double bond as needed to satisfy valence requirements.
  • Ring A is a monocyclic or bicyclic heteroaryl ring. In some aspects, Ring A is , where each bond represented by s a single or double bond as needed to satisfy valence requirements.
  • the - X 1 ( R 5 )- moiety is -C(R 5 )-, -C(R 5 )-C(H)-, -C(H)-C(R 5 )-, -C(R 5 )-N-, -N-C(R 5 )-, or -N(R 5 )-.
  • X 2 is N or C.
  • X 3 is N or C(H). One or two of X ⁇ X 3 comprises N.
  • X 4 is C(H) or S.
  • X 5 is -N(H)- or absent.
  • Y 1 is QR 1 ) or N.
  • Y 2 is C(R 2 ) or N.
  • Y 3 is C(R 3 ) or N.
  • Y 4 is N or C(R 6 ).
  • Y 5 is C(R 7 ) or N.
  • Y 6 is C(R 8 ) or N.
  • One or two of Y 1 - Y 6 are N. If two of Y 1 -Y 6 are N, the nitrogens may not be immediately adjacent to one another. At least one of Y 1 -Y 3 or Y 6 is other than C(H).
  • Two, three or four of Y 7 -Y 10 independently are N or N (R 9 ) and the others of Y 7 -Y 10 are C(R 10 ); the nitrogen atoms may be immediately adjacent one another or separated by at least one carbon atom.
  • two of Y 7 -Y 10 independently are N or N(R 9 ), and the other two of Y 7 -Y 10 are C(R 10 ).
  • R 1 is cyano, perhaloalkyl, H, alkyl, or perhaloalkoxy.
  • R 2 is H, alkoxy, perhaloalkyl, perhaloalkoxy, haloalkoxy, haloalkyl, cyano, alkyl, cyanoalkyl, amino, heteroarylalkoxy, heteroalkyl, amido, halo, alkenyl, or haloalkenyl, or R 1 and R 2 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring.
  • R 3 is H, amino, alkylamino, aminoalkyl, alkoxy, or -N(H)C(O)R' where R' is alkyl, or R 2 and R 3 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring.
  • R 4 is aliphatic, azaalkyl, aryl, or amino.
  • R 5 is aliphatic, heteroaliphatic, or alkylamino.
  • R 6 and R 7 independently are H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano.
  • R 8 is H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano or R 8 and R 1 together with the atoms to which they are attached form a 5- or 6-membered aryl heteroaryl ring.
  • Each R 9 independently is H or alkyl.
  • Each R 10 independently is H, alkyl, or cyano.
  • the halogen may be fluorine.
  • each substituent may be substituted or unsubstituted unless otherwise specified or unless context indicates otherwise (e.g., a cyano group is not substituted).
  • the compound has a general formula I A or IB: where each bond represented by - is a single or double bond as needed to satisfy valence requirements.
  • Y 4 may be N. In some aspects, Y 1 and Y 4 are N. In any of the foregoing or following aspects, at least one of Y 1 -Y 3 or Y 6 may be other than C(H).
  • R 1 is cyano, perhaloalkyl, H, alkyl, or perhaloalkoxy.
  • exemplary R 1 groups include, but are not limited to, cyano, -H, -OCF3, or -CF3.
  • R 1 is cyano, -H, or -OCF3.
  • R 2 is H, alkoxy, perhaloalkyl, perhaloalkoxy, haloalkoxy, haloalkyl, cyanoalkyl, alkyl, cyano, amino, heteroarylalkoxy, heteroalkyl, amido, halo, alkenyl, or haloalkenyl, or R 1 and R 2 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring.
  • the alkyl or alkoxy portion of R 2 is C 1 -C 6 alkyl or alkoxy.
  • R 2 may be methoxy, fluoromethoxy, or trifluoromethoxy.
  • At least a portion of the alkyl portion of R 2 is cycloalkyl, such as cyclopropyl or bicyclo [l.l.l]pentyl.
  • the alkyl or alkoxy portion may be halogenated.
  • R 2 is fluorinated.
  • Exemplary R 2 groups include, but are not limited to -CH3, -OCH3, -OCF3, -CF3,-CN, -H, -OCHF2,
  • R 1 and R 2 together with the atoms to which they are attached form a 5- or 6-membered aryl heteroaryl ring.
  • ring A is
  • R 3 is H, amino, alkylamino, aminoalkyl, alkoxy, or -N(H)C(O)R' where R' is alkyl, or R 2 and
  • R 3 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring.
  • R 3 is H, -NH2, -N(H)C(O)CH3, methyl, , or
  • R 2 and R 3 together with the atoms to which they are attached form a 5- or
  • ring A is
  • ring A is where Y 1 is C(H) or N, Y 2 is C(R 2 ), Y 3 is C(R 3 ), Y 4 is
  • Y 6 is C(H).
  • Y 1 and Y 4 are N.
  • ring A is where Y 1 is C(H) or N, Y 2 is C(R 2 ), Y 3 is C(R 3 ), Y 4 is N, and Y 5 is C(H).
  • R 2 is alkyl, H, alkoxy, perhaloalkyl, perhaloalkoxy, haloalkoxy, haloalkyl, cyano, or cyanoalkyl
  • R 3 is H, amino, alkylamino, or aminoalkyl.
  • the halogen is fluorine.
  • R 6 -R 8 independently are H, alkyl, alkoxy, perhaloalkyl, perhaloalkoxy, or cyano. In some aspects, R 6 -R 8 are H, methyl, -OCH3, -CF3, -OCF3, or -CN. In certain implementations, R 6 -R 8 are H. In some implementations, Y 4 is N and R 6 is therefore absent. Ring A binds to remainder of the compound through Y 5 or Y 6 . Thus, either R 7 or R 8 will be absent.
  • Each R 9 independently is H or alkyl. In some aspects, each R 9 independently is H or methyl.
  • Each R 10 independently is H, alkyl, or cyano. In some implementations, R 10 independently is H, methyl, or cyano.
  • aliphatic, heteroaliphatic, or azaalkyl groups may be straight, branched, cyclic, or any combination thereof.
  • ring A is: where R 11 and R 12 are H, alkyl, perhaloalkyl, alkoxy, perhaloalkoxy, cyano, or amino.
  • ring A is:
  • the compound has a structure according to formula IC, ID, IE, or
  • -X ⁇ R 5 )- is -C(R 5 )-, -C(R 5 )-C(H)-, -C(H)-C(R 5 )-, -C(R 5 )-N-, -N-C(R 5 )-, or -N(R 5 )-.
  • -X ⁇ R 5 )- is -C(H)-C(R 5 )-.
  • the compound has formula IC, R 1 is cyano or perhaloalkyl, and R 2 and R 3 are H. R 1 may be cyano or trifluoromethyl. In certain aspects, R 1 is cyano. In certain implementations, the compound has formula IC, R 1 is H, and R 1 and R 2 together with the atoms to which they are bound form a 5- or 6-membered aryl or heteroaryl ring.
  • the compound has formula ID, R 3 is H and R 2 is other than H. In some aspects, the compound has formula ID, and R 2 and R 3 are other than H. In some aspects, the compound has formula ID, R 2 is H, and R 3 is other than H. In certain implementations, the compound has formula ID, and R 2 and R 3 together with the atoms to which they are bound form a 5- or 6-membered aryl or heteroaryl ring.
  • the compound has formula IE, R 2 is H, alkyl, alkoxy, amino, or cyano, R 3 is
  • R 8 is H or alkyl.
  • the alkyl or alkoxy is methyl or methoxy, respectively.
  • the compound has formula IF, R 2 is haloalkyl, perhaloalkyl, alkoxy, haloalkoxy, perhaloalkoxy, cyano, or H, R 3 is amino, aminoalkyl, or alkylamino, and R 7 is H or alkyl. In certain implementations, R 7 is H, R 3 is -NH2, and R 2 is -CF 3 , -CN,
  • R 3 may be H, amino, aminoalkyl, or alkylamino
  • R 2 may be alkyl, alkoxy, haloalkoxy, perhaloalkoxy, perhaloalkyl, haloalkyl, or cyano.
  • R 2 is -CH3 and R 3 is -H.
  • R 3 is -NH2, or where R 4 is aliphatic, azaalkyl, aryl, or amino.
  • R 5 is aliphatic, heteroaliphatic, aminoalkyl, or alkylamino.
  • R 4 is C1-C5 alkyl, azacycloalkyl, heterocycloalkyl, or -N(R)R' where R and R' are independently hydrogen, alkyl, or heteroalkyl.
  • the azacycloalkyl or heterocycloalkyl is fused or spiro azabicycloalkyl or heterobicycloalkyl.
  • the azabicycloalkyl may be an azabicyclo[3.2.0]heptan-3-yl or azabicyclo[3.1.0]hexan-3-yl.
  • R 4 is 3, 3 -difluoro- 1-pyrrolidinyl, isopropyl, 2-methylpropyl, cyclopropylmethyl, or
  • R 5 is alkyl, heteroalkyl, alkylamino, or azaalkyl.
  • R 5 comprises a cycloalkyl moiety, a cycloheteroalkyl moiety, a azacycloalkyl moiety, or any combination thereof.
  • R 5 is fused or spiro bicycloalkyl, aliphatic, or heteroaliphatic.
  • Z is -C(O)CH3, H, methyl, ethyl, isopropyl, 2-methylpropyl, cyclopropyl, cyclopropylmethyl, cyclobutyl, cyclopentyl, cyclohexyl,
  • n is an integer from 1 to 10,
  • Z is -C(O)CH3. In some aspects, has a stereochemistry
  • R 5 is ” ⁇ NHZ where Z is -C(O)CH3. In another implementation, R 5 is where Z is -C(O)CH3. In some implementations, R 5 is , -(CH 2 )3N(CH 3 )2, or
  • the compound is:
  • R 4 is isopropyl, -C(H)(OH)-C(CH3)2, cyclopropyl, or
  • R 1 is -CN or -CF3;
  • R 2 is -OCH3, -OCF3, -CF3,-CN, -OCHF2,
  • R 11 and R 12 independently are -CF3, -CN, -H, -OCH3, or -OCF3. and Z are as previously defined.
  • the compound is
  • R 4 is where R a and R b together with the atoms to which they are bound form a fused cycloaliphatic or heterocycloaliphatic ring, or R a is cycloaliphatic and R b is -H, or R 4 is or where R a is cycloaliphatic or heterocycloaliphatic.
  • R 2 is alkyl, such as methyl.
  • Exemplary cycloaliphatic and heterocycloaliphatic R 4 groups include, but are not limited to fused and spiro is N(H), or (ii) R 3 is H, aminoalkyl, alkoxy, ; or R'C(O)N(H)- where R' is alkyl, or (iii) R 2 is alkoxy, cyanoalkyl, amino, or heteroarylalkoxy, or (iv) one of R 1 and R 7 is other than -H, or (v) only one of X'-X 4 comprises N, or (vi) X 3 is C(H), or (vii) X 4 is S, or (vi) -X ⁇ R 5 )- is -C(R 5 )-C(H)-, -C(H)-C(R 5 )-, -C(R 5 )-N-, or -N-C(R 5 )-, or (viii) R 1 and R 2 together with the atoms to which they are
  • ring A is where R 3 is amino or alkylamino and is , then (i) X 5 is N(H), or (ii) R 1 is cyano, perhaloalkyl, or perhaloalkoxy, or (iii) R 2 is cyano, cyanoalkyl, amino, or heteroalkylalkoxy, or (iv) R 7 is perhaloalkyl, perhaloalkoxy, or cyano, or (v) R 4 is aryl, or (vi) R 1 and R 2 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring, or (viii) R 2 and R 3 together with the atoms to which they are attached form a 5- or 6-membered aryl or heteroaryl ring.
  • R 4 is not methyl or azacycloalkyl, or (iii) R 5 is In some aspects, if X 5 is N(H), and ring A is
  • X 5 is absent and then R 5 is not In some aspects, if X 5 is absent and then R 5 is not In some aspects, if X 5 is absent and
  • X 5 is N(H) an or (ii) Y 4 is not N, or (iii) R 2 is not -H, -CN, or -CF3, or (iv) R 1 is not -H, -CN, or -CF3.
  • R 4 is not cycloalkyl or heterocycloalkyl
  • Y 4 is not N
  • R 1 is not -CN, or (iv) one of R 2 , R 3 , and R 8 is other than
  • Ring A is and X 5 is N(H)
  • R 5 is not
  • Exemplary MLK inhibitors include the compounds shown in Tables 1-17, as well as other stereoisomers, tautomers, and pharmaceutically acceptable salts thereof. Table 1
  • the MLK inhibitor may exhibit membrane permeability and/or water solubility. Permeability and solubility are related to the topological polar surface area (TPSA) and molecular weight of the MLK inhibitor.
  • TPSA topological polar surface area
  • a desirable solubility may be provided by molecules having a TPSA of > 0.1 x MW (or TPSA/MW ratio > 0.1) (see, e.g., Maple et al., Med Chem Commun 2019, 10:1755-1764).
  • water solubility is enhanced by forming the MLK inhibitor as a common salt (e.g., acetates, oxalates, methane sulfonates), or from common acids such as hydrochloric acid or sulfuric acid.
  • a common salt e.g., acetates, oxalates, methane sulfonates
  • common acids such as hydrochloric acid or sulfuric acid.
  • a desirable permeability may be provided by molecules having a TPSA of ⁇ 140 (Ibid.).
  • the MLK inhibitor has a TPSA of from 0.1 x MW to 140.
  • the MLK inhibitor may have an MLK dissociation constant KD of less than 200 nM, less than 150 nM, less than 100 nM, less than 75 nM, less than 50 nM, less than 25 nM, less than 10 nM, or even less than 5 nM .
  • the MLK inhibitor may be an LZK inhibitor that selectively binds to LZK over dual leucine zipper kinase (DLK).
  • DLK dual leucine zipper kinase
  • the LZK inhibitor may exhibit at least 2-fold selectivity towards LZK over DLK, as evidenced by the ratio of the LZK and DLK dissociation constants KD.
  • the LZK inhibitor exhibits at least 2-fold selectivity, at least 3-fold selectivity, at least 5-fold selectivity, at least 10-fold selectivity, at least 25-fold selectivity, at least 50-fold selectivity, at least 100-fold selectivity, or even at least 150-fold selectivity for LZK over DLK.
  • compound 207 has an LZK KD of ⁇ 1 nM and exhibits 180-fold selectivity for LZK over DLK.
  • compositions comprising one or more of the disclosed MLK inhibitors.
  • a pharmaceutical composition comprises a compound as disclosed herein and a pharmaceutically acceptable excipient.
  • the compounds described herein can be used to prepare therapeutic pharmaceutical compositions.
  • the compounds may be added to the compositions in the form of a salt or solvate.
  • administration of the compounds as salts may be appropriate.
  • pharmaceutically acceptable salts are organic acid addition salts formed with acids that form a physiological acceptable anion, for example, tosylate, methanesulfonate, acetate, citrate, malonate, tartrate, succinate, benzoate, ascorbate, a-ketoglutarate, and b-glycerophosphate.
  • Suitable inorganic salts may also be formed, including hydrochloride, halide, sulfate, nitrate, bicarbonate, and carbonate salts.
  • compositions may be obtained using procedures known to persons of ordinary skill in the art, for example by reacting a sufficiently basic compound, such as an amine, with a suitable acid to provide a physiologically acceptable ionic compound.
  • a sufficiently basic compound such as an amine
  • SUBSTITUTE SHEET (RULE 26) example, sodium, potassium or lithium) or alkaline earth metal (for example, calcium) salts of carboxylic acids can also be prepared by analogous methods.
  • the compounds of the formulas described herein can be formulated as pharmaceutical compositions and administered to a mammalian host, such as a human or veterinary patient, in a variety of forms.
  • the forms can be specifically adapted to a chosen route of administration, e.g., oral or parenteral administration, by intravenous, intramuscular, topical or subcutaneous routes.
  • the compounds described herein may be systemically administered in combination with a pharmaceutically acceptable vehicle, such as an inert diluent or an assimilable edible carrier.
  • a pharmaceutically acceptable vehicle such as an inert diluent or an assimilable edible carrier.
  • compounds can be enclosed in hard or soft shell gelatin capsules, compressed into tablets, or incorporated directly into the food of a patient's diet.
  • Compounds may also be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
  • Such compositions and preparations typically contain at least 0.1% of active compound.
  • the percentage of the compositions and preparations can vary and may conveniently be from about 2% to about 60% of the weight of a given unit dosage form.
  • the amount of active compound in such therapeutically useful compositions is such that an effective dosage level can be obtained.
  • the tablets, troches, pills, capsules, and the like may also contain one or more of the following excipients: binders such as gum tragacanth, acacia, com starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as com starch, potato starch, alginic acid and the like; and a lubricant such as magnesium stearate.
  • binders such as gum tragacanth, acacia, com starch or gelatin
  • excipients such as dicalcium phosphate
  • a disintegrating agent such as com starch, potato starch, alginic acid and the like
  • a lubricant such as magnesium stearate.
  • a sweetening agent such as sucrose, fmctose, lactose or aspartame; or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring, may be added.
  • the unit dosage form When the unit dosage form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier, such as a vegetable oil or a polyethylene glycol. Various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For instance, tablets, pills, or capsules may be coated with gelatin, wax, shellac or sugar and the like.
  • a symp or elixir may contain the active compound, sucrose or fmctose as a sweetening agent, methyl and propyl parabens as preservatives, a dye and flavoring such as cherry or orange flavor. Any material used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts employed.
  • the active compound may be incorporated into sustained-release preparations and devices.
  • the active compound may be administered intravenously or intraperitoneally by infusion or injection.
  • Solutions of the active compound or its salts can be prepared in water, optionally mixed with a nontoxic surfactant.
  • Dispersions can be prepared in glycerol, liquid polyethylene glycols, triacetin, or mixtures thereof, or in a pharmaceutically acceptable oil. Under ordinary conditions of storage and use, preparations may contain a preservative to prevent the growth of microorganisms.
  • compositions suitable for injection or infusion can include sterile aqueous solutions, dispersions, or sterile powders comprising the active ingredient adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes.
  • the ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage.
  • the liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions, or by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thiomersal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers, or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by agents delaying absorption, for example, aluminum monostearate and/or gelatin.
  • Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filter sterilization.
  • methods of preparation can include vacuum drying and freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile-filtered solutions.
  • Useful dosages of the compounds described herein can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art; for example, see U.S. Patent No. 4,938,949 (Borch et al.).
  • the amount of a compound, or an active salt or derivative thereof, required for use in treatment will vary not only with the particular compound or salt selected but also with the route of administration, the nature of the condition being treated, and the age and condition of the patient, and will be ultimately at the discretion of an attendant physician or clinician. IV. Methods of Use
  • a method of inhibiting MLK activity includes contacting a cell expressing an MLK with an effective amount of a compound as disclosed herein, thereby inhibiting MLK activity.
  • the MLK is MLK1 (MAP3K9), MLK2 (MAP3K10), MLK3 (MAP3K11), MLK4 (MAP3K21), DLK (MAP3K12), LZK (MAP3K13), ZAK1 (MAP3K20), or any combination thereof.
  • the MLK is LZK, MLK3, or MLK4.
  • the MLK is LZK.
  • inhibiting MLK activity may further inhibit cell cycle progression, reduce c-MYC expression, inhibit c-Jun N-terminal kinase (JNK) pathway signaling, inhibit PI3K/AKT pathway signaling, inhibit cyclin dependent kinase 2 (CDK2) activity, inhibit extracellular signal-regulated kinase (ERK) pathway signaling, NF-KB signaling, or any combination thereof.
  • JNK c-Jun N-terminal kinase
  • CDK2 cyclin dependent kinase 2
  • ERK extracellular signal-regulated kinase
  • the inhibition or reduction is at least 10%, at least 25%, at least 50%, or at least 75% compared to the cell cycle progression, c-MYC expression, JNK pathway signaling, PI3K/AKT pathway signaling, CDK2 activity, ERK pathway signaling, or NF-KB signaling in the absence of the MLK inhibitor.
  • the cell may be characterized by amplification of chromosome 3q, amplification of chromosome llq, overexpression of a mitogen-activated protein kinase kinase kinase (MAP3K), or any combination thereof.
  • the MAP3K is MAP3K13 or MAP3K21.
  • the cell may be a cancer cell.
  • MLKs have been implicated in head and neck squamous cell carcinoma (HNSCC), a lung squamous cell carcinoma (LSCC), esophageal squamous cell carcinoma (ESCC), hepatocellular carcinoma , ovarian cancer, small cell lung cancer, and neuroendocrine prostate cancer.
  • HNSCC head and neck squamous cell carcinoma
  • LSCC lung squamous cell carcinoma
  • ESCC esophageal squamous cell carcinoma
  • ovarian cancer ovarian cancer
  • small cell lung cancer small cell lung cancer
  • neuroendocrine prostate cancer hepatocellular carcinoma
  • MLK3 is an amplified driver in about 10% of head and neck cancers harboring the 1 Iq amplicon.
  • MLK4 has been described as a novel driver in 25% of triple negative breast cancers harboring amplification in MAP3K21.
  • the cell is an HNSCC cell, an LSCC cell, a hepatocellular carcinoma cell, an ovarian cancer cell, a small cell lung cancer cell, a neuroendocrine prostate cancer cell, an esophageal cancer cell (e.g., an esophageal squamous cell carcinoma (ESCC) cell or an esophageal adenocarcinoma cell), or a breast cancer cell (e.g., a triple negative breast cancer (TNBC) cell).
  • the cell is an HNSCC, LSCC, ESCC, or TNBC cell.
  • contacting the cell with the compound may comprise administering a therapeutically effective amount of the compound, or an amount of a pharmaceutical composition comprising the therapeutically effective amount of the compound, to a subject.
  • the subject may be identified as a subject that may benefit from MLK inhibition.
  • the subject has a disease or condition characterized at least in part by MLK overexpression.
  • the MLK is LZK, MLK3, or MLK4.
  • the MLK is LZK.
  • the disease or condition is cancer.
  • the cancer is HNSCC, LSCC, hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, esophageal cancer (e.g., esophageal squamous cell carcinoma or esophageal adenocarcinoma), or breast cancer (e.g., TNBC).
  • the cancer is HNSCC, LSCC, ESCC, or TNBC.
  • administering the therapeutically effective amount of the compound, or the amount of the pharmaceutical composition may decrease viability of the cancer cells, inhibit tumor growth, or a combination thereof.
  • the viability is decreased or the tumor growth is inhibited by at least 10%, at least 25%, at least 50%, or at least 75% compared to viability or tumor growth in the absence of the MLK inhibitor.
  • the compound or pharmaceutical composition may be administered to the subject through any suitable route.
  • the compound or pharmaceutical composition is administered to the subject by the oral route or in a single bolus delivery, via continuous delivery (for example, continuous transdermal, mucosal or intravenous delivery) over an extended time period, or in a repeated administration protocol (for example, by an hourly, daily or weekly, repeated administration protocol).
  • the compound or pharmaceutical composition is administered to the subject by injection.
  • the therapeutically effective dosages of the agents can be provided as repeated doses within a prolonged prophylaxis or treatment regimen that will yield clinically significant results to alleviate one or more symptoms or detectable conditions associated with a targeted condition as set forth herein.
  • Determination of effective dosages in this context is typically based on animal model studies followed up by human clinical trials and is guided by administration protocols that significantly reduce the occurrence or severity of targeted disease symptoms or conditions in the subject.
  • Suitable models in this regard include, for example, murine, rat, avian, porcine, feline, non-human primate, and other accepted animal model subjects known in the art.
  • effective dosages can be determined using in vitro models. Using such models, only ordinary calculations and adjustments are required to determine an appropriate concentration and dose to administer a therapeutically effective amount of the compound (for example, amounts that are effective to elicit a desired immune response or alleviate one or more symptoms of a targeted disease).
  • an effective amount or effective dose of the agents may simply inhibit or enhance one or more selected biological activities correlated with a disease or condition, as set forth herein, for either therapeutic or diagnostic purposes.
  • the actual dosages of the agents will vary according to factors such as the disease indication and particular status of the subject (for example, the subject’s age, size, fitness, extent of symptoms, susceptibility factors, and the like), time and route of administration, other drugs or treatments being administered concurrently, as well as the specific pharmacology of the agent for eliciting the desired activity or biological response in the subject. Dosage regimens can be adjusted to provide an optimum prophylactic or therapeutic response.
  • a therapeutically effective amount is also one in which any toxic or detrimental side effects of the agent is outweighed in clinical terms by therapeutically beneficial effects.
  • a non-limiting range for a therapeutically effective amount of a compound according to any one of formulas I- IV within the methods and formulations of the disclosure is 0.001 mg/kg body weight to 100 mg/kg body weight, such as 0.01 mg/kg body weight to 20 mg/kg body weight, 0.01 mg/kg body weight to 10 mg/kg body weight 0.05 mg/kg to 5 mg/kg body weight, or 0.1 mg/kg to 2 mg/kg body weight.
  • Dosage can be varied by the attending clinician to maintain a desired concentration at a target site (for example, systemic circulation). Higher or lower concentrations can be selected based on the mode of delivery, for example, trans -epidermal or oral delivery versus intravenous or subcutaneous delivery. Dosage can also be adjusted based on the release rate of the administered formulation, for example, of sustained release oral versus injected particulate or transdermal delivery formulations, and so forth.
  • the therapeutically effective amount may be administered at intervals for a period of time effective to provide a therapeutic effect, e.g., decreased cancer cell viability and/or tumor growth inhibition.
  • the intervals are once daily.
  • the therapeutically effective amount may be divided into two or more doses administered at intervals in a 24-hour period.
  • the effective period of time is from one day to several months, such as from one day to 12 months, three days to six months, seven days to three months, 7-30 days, or 7-14 days. In certain aspects, the effective period of time may be even longer than 12 months, such as a period of years.
  • R 3 is H, aminoalkyl, alkoxy, , or R'C(O)N(H)- where R' is alkyl, or (iii) R 2 is alkoxy, cyanoalkyl, amino, or heteroarylalkoxy, or (iv) one of R 1 and R 7 is other than -H, or (v) only one of X ⁇ X 4 comprises N, or (vi) X 3 is C(H), or (vii) X 4 is S, or (vi) -X ⁇ R 5 )- is -C(R 5 )-C(H)-, -C(H)-C(R 5 )-, -C(R 5 )-N-, or -N-C(R 5 )-, or (viii) R 1 and R 2 together with the atoms to which they are attached form a 5- or 6-membered substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl ring,
  • ring A is where R 3 is amino or alkylamino and then (i) X 5 is N(H), or (ii) R 1 is cyano, perhaloalkyl, or perhaloalkoxy, or (hi) R 2 is cyano, cyanoalkyl, amino, or heteroalkylalkoxy, or (iv) R 7 is perhaloalkyl, perhaloalkoxy, or cyano, or (v) R 4 is aryl, or (vi) R 1 and R 2 together with the atoms to which they are attached form a 5- or
  • R 2 and R 3 together with the atoms to which they are attached form a 5- or 6-membered substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl ring,
  • R 4 is not methyl or substituted or unsubstituted azacycloalkyl, or (hi) R 5 i
  • R 5 is substituted or unsubstituted alkyl
  • R 11 and R 12 are H, alkyl, perhaloalkyl, alkoxy, perhaloalkoxy, cyano, or amino.
  • R 2 is -CF 3 , -OCF 3 , -OCHF 2 , -OCH 3 , -CN, or -H
  • R 11 is -CF 3 , -OCF 3 , -CN, or -H. isopropyl, 2-methylpropyl, cyclopropyl, cyclopropylmethyl, or -C(H)(OH)-C(CH3)2.
  • Z is alkoxy, H, aliphatic, or heteroaliphatic.
  • n is an integer from 1 to 10
  • R 11 and R 12 are H, alkyl, perhaloalkyl, alkoxy, perhaloalkoxy, cyano, or amino.
  • R 8 is -OCF3, -CN, -CH3, or H; and R 11 and R 12 independently are -CF3, -CN, -H,
  • R 2 is -CF 3 , -CN, -H, -OCH 3 , -OCHF 2 , -OCF 3 , and
  • a pharmaceutical composition comprising a compound according to any one of clauses 1-11 and at least one pharmaceutically acceptable carrier.
  • a method of inhibiting leucine zipper-bearing kinase (LZK) activity comprising: contacting a cell expressing LZK with an effective amount of a compound according to any one of clauses 1-11, thereby inhibiting LZK activity.
  • LZK leucine zipper-bearing kinase
  • the cell is a head and neck squamous cell carcinoma (HNSCC) cell, a lung squamous cell carcinoma (LSCC) cell, a hepatocellular carcinoma cell, an ovarian cancer cell, a small cell lung cancer cell, a neuroendocrine prostate cancer cell, or an esophageal cancer cell.
  • HNSCC head and neck squamous cell carcinoma
  • LSCC lung squamous cell carcinoma
  • hepatocellular carcinoma cell an ovarian cancer cell
  • small cell lung cancer cell a neuroendocrine prostate cancer cell
  • esophageal cancer cell esophageal cancer cell.
  • LZK cDNA was prepared from RNA extracted from 293T cells, attB flanking regions were added by PCR, and the BP Clonase reaction was used to insert LZK into pDONR221. From here, the Invitrogen Gateway system was used for cloning into destination vectors. FLAG-tagged (pReceiver-M12, GeneCopoeia) destination vector was converted into Gateway destination vector for use in transient overexpression assays. The pLenti6.3/TO/V5-DEST vector was used to generate stable overexpression.
  • the drug-resistant construct for LZK was a Q240S mutation that was introduced using a Site-Directed Mutagenesis Kit (Stratagene).
  • oligonucleotides are listed below in Table 18. 293T cells were transiently transfected using Lipofectamine 2000 (Invitrogen), according to the manufacturer’s protocol, with OptiMEM (Gibco). ApcDNA3.1(+) vector (Invitrogen) was used as an empty vector control where required.
  • the CDK2 sensor vector CSII-pEFla-DHB(aa994-1087)-mVenus and the nuclear marker vector CSII-pEFla-H2B-mTurquoise were described previously (Spencer et al., Cell 2013, 155:369-383).
  • CAL33 German Collection of Microorganisms and Cell Cultures [DSMZ], obtained Oct. 2012) and 293T (American Type Culture Collection [ATCC], July 2012) cells were maintained in DMEM (Sigma- Aldrich) supplemented with 10% tetracycline-tested fetal bovine serum (FBS) (Atlanta Biologicals), 1% penicillin-streptomycin (Gibco), and 2 mM GlutaMAX (Gibco).
  • FBS tetracycline-tested fetal bovine serum
  • Ibco penicillin-streptomycin
  • 2 mM GlutaMAX Gibco
  • MSK921 Memorial Sloan Kettering Cancer Center, July 2014
  • BEAS-2B ATCC, Oct. 2012
  • LK2 Japanese Collection of Research Bioresources [JCRB] Cell Bank, Feb. 2015
  • NCI-H520 ATCC cells were maintained in RPMI 1640 (Quality Biological) with 10% tetracycline-tested FBS, 2 mM GlutaMAX, and 1% penicillin-streptomycin. Detroit 562 cells (ATCC, Nov.
  • STR Short Tandem Repeat
  • MSK921 The 3q status of all HNSCC and immortalized control cell lines was verified in-house. All cell lines were used in experiments for fewer than 20 passages (10 weeks) after thawing, before a fresh vial was taken from freeze. Cell lines in use were confirmed to be mycoplasma-negative using a Visual-PCR Mycoplasma Detection Kit (GM Biosciences). Generation of doxycycline-inducible knockdown cell lines
  • CAL33 and BICR56 inducible knockdown cells were generated by SIRION Biotech.
  • MSK921 was generated in-house using lentiviral particles provided by SIRION (generated by transfection of 293TN cells with expression vectors and lentiviral packaging plasmids). Transduction occurred at MOI 5 with 8 pg/mL polybrene. After 24 hours, medium was replaced with fresh medium containing puromycin (Invitrogen) to select for cells that had been effectively transduced.
  • shRNA sequences were CGGAATGAACCTGTCTCTGAA (shl) and GATGTAGATTCTTCAGCCATT (sh2).
  • the lentiviral expression plasmid was pCLVi(3G)-MCS-Puro, which expresses a doxycycline-responsive transactivator and the shRNA from the same vector. Expression of the transactivator is constitutive, while shRNA expression depends on a doxycycline-inducible promoter. Binding doxycycline to the transactivator allows it to bind the doxycycline-inducible promoter and promote shRNA expression. Doxycycline (Sigma- Aldrich) was used at 1 pg/mL to induce LZK knockdown.
  • the ViraPower HiPerform T-REx Gateway Expression System (Invitrogen) was used to generate cells with tetracycline-inducible expression of LZK.
  • wild-type (WT) or drug-resistant mutant (Q240S) LZK (cloned into pLenti6.3/TO/V5-DEST vector) and pLenti3.3/TR (for tetracycline repressor expression) were transfected into 293FT cells using Lipofectamine 2000 to generate lentiviral stock.
  • Cell lines were generated by antibiotic selection (blasticidin [Gibco] and geneticin [Gibco]).
  • Doxycycline Sigma- Aldrich was used at 1 pg/mL to induce LZK expression.
  • RT-PCR was performed using a SuperScript III One-Step RT-PCR kit (Invitrogen). Primers used were as follows: AACTGATTCGAAGGCGCAGA (LZK forward; SEQ ID NO: 13), GGGCGTTTTCCAAGAGAGGA (LZK reverse; SEQ ID NO: 14), GGCACCACACCTTCTACAATG (p-actin forward; SEQ ID NO: 15), GTGGTGGTGAAGCTGTAGCC (p-actin reverse; SEQ ID NO: 16), CCATGGAGAAGGCTGGGG (GAPDH forward; SEQ ID NO: 17), GTCCACCACCCTGTTGCTGTA (GAPDH reverse; SEQ ID NO: 18).
  • the cycling conditions for PCR were as follows: cDNA synthesis and pre-denaturation (one cycle at 55 °C for 30 minutes followed by 94 °C for two minutes), PCR amplification (25 cycles of denaturing at 94 °C for 15 seconds, annealing at 55 °C for 30 seconds, and extension at 68 °C for 60 seconds), and a final extension at 68 °C for five minutes using C1000 TOUCH CYCLER w/48W FS RM (Bio-Rad). PCR products were resolved on 2% agarose gel and visualized with Nancy-520 (Sigma- Aldrich) DNA gel stain under ultraviolet light using ChemiDocTM MP Imaging System (Bio-Rad).
  • GNE-3511 (#19174) was purchased from Cayman Chemical or from Synnovator (#SYNNAA108230) in large quantities for the mouse studies.
  • MG132 (#S2619) was purchased from Selleck Chemicals.
  • Pevonedistat or MLN4924 (#HY-70062) was purchased from MedChemExpress. All compounds were dissolved in DMSO (Fisher), and DMSO was used as the vehicle control in the cell-based assays.
  • cells were plated in six-well or 35-mm plates for 24 hours, after which doxycycline was added or treatment with specific inhibitor was administered using 5% FBS media for 48 hours. After appropriate treatment time, cells were washed with ice-cold phosphate-buff ered saline without Ca and Mg (Quality Biological) and then lysed on ice with RIPA buffer (50 mM NaCl, 1.0% IGEPAL® CA-630, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0) (Sigma- Aldrich) supplemented with protease inhibitor tablet (Sigma- Aldrich) and phosphatase inhibitor cocktails 2 and 3 (Sigma- Aldrich) followed by centrifugation at 15,000 rpm for 10 minutes at 4 °C.
  • RIPA buffer 50 mM NaCl, 1.0% IGEPAL® CA-630, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0
  • Protein concentrations were determined from the cell lysate by using 660 nm Protein Assay Reagent (Pierce). Cell extracts were denatured, subjected to SDS- PAGE, transferred to PVDF membranes (Bio-Rad) and blocked for 2 hours using 5% bovine serum albumin (BSA) in phosphate-buffered saline and 0.1% Tween® 20 (PBS-T). The membranes were incubated with the specific antibodies overnight in 5% BSA/PBST at 4 °C followed by a 1 hour incubation with the appropriate horseradish peroxidase-conjugated secondary antibodies and signal was detected by chemiluminescence (Thermo Fisher). The antibodies are listed in Table 19.
  • Cells were seeded in 10 cm dishes, at 6 x 10 5 for CAL33 and BICR56, and 6.25 x 10 5 for MSK921, before addition of doxycycline (to induce LZK knockdown) the following day.
  • Cells were lysed on ice with lx Triton X-100 cell lysis buffer (#9803, Cell Signaling Technology) supplemented with protease and phosphatase inhibitors (Roche Applied Science, #05056489001 and 04906837001, respectively) and 1.5 mM MgCh, 48 hours after induction with doxycycline. Cell lysates were centrifuged, and the supernatant was collected.
  • Protein concentration was measured using 660 nm Protein Assay Reagent (Pierce), and adjusted to 2 mg/mL. Then 4x reducing sodium dodecyl sulfate (SDS) sample buffer was added (40% glycerol, 8% SDS, and 0.25 M Tris HC1, pH 6.8, with 10% P-mercaptoethanol added before use), and the samples were incubated at 80 °C for three minutes. Lysates from three independent experiments were sent for RPPA analysis.
  • SDS sodium dodecyl sulfate
  • a Cell Titer 96 AQueous One Solution Cell Proliferation Assay (Promega) was used for MTS assays following the manufacturer’s protocol. In brief, 5,000 cells were plated in triplicate in 96-well plates and treated with drug compounds 24 hours later using 5% FBS media. Doxycycline was added where appropriate, and cells were incubated for 72 hours. MTS was added, cells were incubated for two hours, and absorbance was measured at 490 nm using iMarkTM Microplate Absorbance Reader (Bio-Rad). Graphs display percent cell viability relative to the DMSO-treated control sample. EC50 values were determined using GraphPad Prism 8.
  • Crystal violet assays were used to assess relative cell growth and survival after treatment with specific compounds.
  • cells were plated in triplicate in 12-well plates for 24 hours before drug treatments were added using 10% FBS media. The plates were incubated for 14 days, with the media and drug being replaced every 48 hours. The cells were then washed with phosphate-buffered saline and fixed in ice-cold methanol before being stained with 0.5% crystal violet (Sigma- Aldrich) in 25% methanol.
  • GST glutathione S-transferase
  • MKK7 human inactive MKK7 pure protein
  • SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis
  • a PathScan® Phospho-SAPK/JNK (Thrl83/Tyrl85) Sandwich ELISA Assay was used for ELISA assays following the manufacturer’s protocol. In general, 500,000 cells were plated and treated with doxycycline the following day where appropriate and incubated at 37 °C for 48 hours. Cells were treated with the drug compound or control in 5% FBS media for 1 hour. After appropriate treatment time, cells were lysed on ice with lx Cell Lysis Buffer (Cell Signaling Technology) supplemented with phosphatase and protease inhibitors (Sigma).
  • Tumor fragments from HNSCC patients containing amplified MAP3K13 were obtained from theNIH PDMR, #391396-364-R, or from Crown Biosciences San Diego, #HN5120.
  • Tumor pieces at approximately 2 x 2 x 2 mm 3 from an HNSCC patient containing amplified MAP3K13 were implanted subcutaneously with Matrigel (Coming) in the mice according to the SOP50101 Implantation and Cry opreservation of Tissue for PDX Generation protocol from the NIH Patient-Derived Models Repository (PDMR).
  • PDMR NIH Patient-Derived Models Repository
  • Five NSG mice were used for initial implantation of the cryopreserved tumor fragments. Body weights and tumor size were measured twice weekly. The tumors were harvested when they reached approximately 1 ,000 mm 3 and were used to generate the PDX mouse model to test GNE-3511.
  • passage one of the fresh PDX tumor fragments were implanted into NSG mice using the protocol stated previously.
  • mice Twenty NSG mice were used (10 for vehicle control and 10 for GNE-3511 treatment). Body weights and tumor sizes were measured twice weekly until tumors reached approximately 150-200 mm 3 , at which point the mice were randomly assigned to treatment cohorts with control or GNE-3511 for approximately 4-8 weeks. The study endpoints were over 20% body weight loss, tumor volume exceeding 2.0 cm 3 in diameter, or significant (greater than 80%) tumor regression observed with treatment.
  • the GNE- 3511 was dissolved with 60% PEG 300 MW, 3 eq of 0.1 M HC1, saline (vehicle) and administered daily via intratumoral injection at 50 mg/kg. Body weights and tumor sizes were measured twice weekly. At the endpoint of each study, tumors were harvested, cleaned, weighed, and photographed for analysis.
  • RNA-seq data was processed to get gene expression data (Li et al. , BMC Bioinformatics 2011, 12( 1 ) : 323).
  • fifty-eight PDX head and neck models were performed by WES and RNA-seq bioinformatics analysis.
  • each PDX model it includes multiple (4 > PDX) samples.
  • FPKM Fragments Per Kilobase Million
  • Method A A 4-substituted 2,6-dichloropyridine (3 mmol) is combined with 5.25 mmol (1.75 equiv) of 3,3-difluoropyrrolidine hydrochloride in dioxane (e.g., 8 mL) in a microwave vial. Diisopropylethylamine (9 mmol, 3 equiv) is added and the sealed vial is heated with stirring at 130 °C for 16 h. The cooled reaction is then diluted with 50 mL water and extracted with 3 x 35 mL ethyl acetate. The combined organic layers are dried over Na2SC>4 and concentrated under reduced pressure. The resulting residue is purified by flash chromatography eluting with a gradient of ethyl acetate in dichloromethane.
  • Method B The 4-substituted 2-(difluoropyrrolidin-l-yl)-6-chloropyridine (e.g., 145 pmol) is combined with the desired 2-aminoheterocycle (1.77 pmol, 1.22 equiv), 2-dicyclohexylphosphino-2',6'-di-isopropoxy-l,l'-biphenyl palladium (II) phenethylamine chloride (8.5 mg, 11.6 pmol, 0.08 equiv), and potassium tert-butoxide (24.5 mg, 218 pmol, 1.5 equiv).
  • the reaction vial is sealed, then evacuated and back-filled with argon 3 x.
  • reaction Upon completion, the reaction is diluted with 25 mL of ethyl acetate and washed with 40 mL of NH4CI. The aqueous layer is extracted with 2 x 25 mL of ethyl acetate; the combined organic layers are dried over Na2SC>4 and concentrated under reduced pressure. The desired material is purified by flash chromatography eluting with a gradient of methanol in dichloromethane and used in Method B.
  • R groups include, but are not limited to, l-acetylpiperidin-4-yl, piperidin-4-yl, l-ethylpiperidin-4-yl, l-oxetan-3-ylpiperidin-4-yl, 1 -(polyethylene glycol)piperidin-4-yl, l-isopropylpiperidin-4-yl, l-cyclopentylpiperdin-4-yl, 4-(l-cyclopropylmethyl)piperidin-4-yl, azetidin-3-yl, l-acetylazetidin-3-yl, l-ethylazetidin-3-yl, N-oxetan-3-yl-3-azetidinyl, l-(polyethyleneglycol-azetidin-3-yl, l-isopropylazetidin-3-yl, l-cyclopentylazetidin-3-
  • Het Exemplary heterocycles include, but are not limited to, pyridin-2-amine, pyrimidin-2-amine, pyrimidin-4-amine, pyrazin-2-amine, quinoxaline-2-amine, lH-pyrrolo-[3,2-c]pyridin-6-amine, 5-methoxypyrazin-2-amine, 5-methylpyrazin-2-amine, 6-methylpyrazin-2-amine, 3-methylpyrazin-2-amine, 5-cyanopyrazin-2-amine, l-methyl-lH-imidazole-4-carbonitrile 1 -methyl- lH-pyrazol-3-yl, lH-pyrazol-3-yl, and l-methyl-lH-imidazol-5-yl: l-(4-(2-Chloro-6-(3,3-difluoropyrrolidin-l-yl)pyridin-4-yl)piperidin-l-yl)ethan-l-one.
  • a dual leucine zipper kinase (DLK) inhibitor, GNE-3511 was evaluated for inhibition of LZK catalytic activity.
  • LZK and DLK have greater than 90% homology within their kinase domains, and GNE-3511 was also reported to inhibit the catalytic activity of LZK (Patel et al. , J Med Chem 2015, 58:401-418).
  • GNE-3511 FIG. 1
  • dox doxycycline
  • GNE-3511 is a potent LZK inhibitor in cells, as measured by inhibition of downstream JNK pathway activation (FIGS. 2A-C, 3, 4). Similar results were observed in vitro (FIG. 5).
  • LK2 and NCI-H520 lung squamous cell carcinoma (LSCC) cells were treated with 500 nM GNE-3511. A 45% and 55% reduction in colony formation was observed, respectively, which indicates that additional squamous cell carcinomas rely upon LZK to maintain viability (FIG. 7). A significant decrease in viability in the CAL33 and BICR56 cells in short-term MTS assays was also observed, with an IC50 of 687.7 ⁇ 114.1 nM and 410.5 ⁇ 59.6 nM, respectively (FIG. 8). IC50 values were calculated with GraphPad Prism 8.
  • kinase inhibitors are promiscuous compounds that will often target additional kinases, and GNE-3511 was initially developed as a DLK inhibitor.
  • a drug-resistant mutant form of LZK Q240S was generated that maintains catalytic activity in the presence of the drug, as assessed by JNK pathway activation (FIGS. 9, 10).
  • Q240S maintains catalytic activity in the presence of GNE-3511, as assessed by downstream JNK phosphorylation.
  • FIG. 10 shows that one-hour GNE-3511 treatment specifically inhibits LZK, as observed with the rescue of JNK signaling by the overexpression of the LZK Q240S drug-resistant mutant in 293T cells.
  • FIGS. 12A-12C Evaluation of GNE-3511 in a patient-derived xenograft mouse model of 3q-amplified HNSCC demonstrated that 50 mg/kg GNE-3511 can significantly suppress HNSCC tumor growth in vivo with almost complete tumor regression and no detectable tumors in 3 mice (FIGS. 12A-12C; ****p ⁇ 0.0001, two-way ANOVA.).
  • FIGS. 12A-12C Evaluation of GNE-3511 in a patient-derived xenograft mouse model of 3q-amplified HNSCC demonstrated that 50 mg/kg GNE-3511 can significantly suppress HNSCC tumor growth in vivo with almost complete tumor regression and no detectable tumors in 3 mice (FIGS. 12A-12C; ****p ⁇ 0.0001, two-way ANOVA.).
  • Mean tumor volumes ⁇ SEM are shown. Average tumor volume at the end of treatment. Mean ⁇ SEM; Student’s /-test; *p ⁇ 0.05. Similar results were observed with 100 mg/kg GNE-3511 treatment in a CAL33-based xenograft mouse model of HNSCC (FIG. 14; mean ⁇ SEM, ****p ⁇ 0.0001, two-way ANOVA).
  • Immunohistochemistry (IHC)staining revealed an increase in cleaved caspase-3 expression in the GNE-3511 treated tumors compared to control (FIGS. 15A and 15B; mean ⁇ SEM, Student’s t-test, *p ⁇ 0.001). The study was terminated early due to toxicity at this concentration and dosing regimen (100 mg/kg, b.i.d., five days on/two days off) and decreases in body weight of the inhibitor treated mice were observed.
  • GNE- 3511 was further evaluated in vivo utilizing a daily administration of a lower dose (50 mg/kg, q.b.)in a patient-derived xenograft mouse model of 3q-amplified HNSCC (PDX model: 391396-364-R.
  • PDX model: 391396-364-R a patient-derived xenograft mouse model of 3q-amplified HNSCC
  • GNE-3511 significantly suppressed HNSCC PDX tumor growth in vivo with almost complete tumor regression and no detectable tumors in three mice (FIGS. 12A-12C), with no effect on body weights of the mice.
  • FIG. 18 shows copy number (CN) profiles of fifty-eight HNSCC PDX mouse models on chromosome 3 obtained from the NCI PDMR. Each row indicates the copy number profile of one PDX model.
  • FIG. 19 shows a boxplot of MAP3K13 gene expression in fifty-eight PDX models with different MAP3K13 copy numbers.
  • Y-axis indicates the MAP3K13 gene expression in average fragments per kilobase million (FPKM). Each black dot indicates one PDX model.
  • FIG. 20 is RPAA assay results identifying decreased c-MYC levels in CAL33 and BICR56 cells depleted of LZK for 48 hours.
  • FIG. 21 is Western blots of c-MYC abundance in cells depleted of LZK for 48 hours.
  • FIG. 22 is Western blots showing expression levels of several cell cycle components (Myc, CKD4, CDK6, Cyclin DI, CDK2, Cyclin El, Cyclin A2, Cyclin Bl, CDK1, p27, and GAPDH) in CAL33 cells depleted of LZK for 48 hours.
  • LZK catalytic inhibition would suppress c-MYC expression
  • CAL33 cells were treated with 500 nM GNE-3511 and c-MYC expression was monitored over time.
  • the LZK inhibitor resulted in a reduction in c-MYC levels that was subsequently maintained for 72 hours (FIG. 24).
  • expression of the LZK Q240S drug-resistant mutant rescued the loss of c-MYC expression, indicating that LZK catalytic activity is essential to maintain c-MYC stability in HNSCC cells with amplified MAP3K13 (FIG. 25).
  • LZK has both kinase-dependent and kinase-independent functions that promote cancer.
  • a set of 8 inhibitors was prepared and evaluated for efficacy.
  • the compounds had a general structure: where the heterocycle was (compound 98, Analog (compound 99, Analog 5), (Analog 8).
  • LZK inhibitor 1 is a poor LZK inhibitor in cells.
  • LZK inhibitor 2 was a potent LZK inhibitor that suppressed LZK activity at 100 nM, similar to treatment with GNE-3511, out to 72 hours (FIGS. 27-30).
  • LZK inhibitor 2 suppressed colony formation in 3q amplicon-positive HNSCC cells - CAL33, BICR56, and Detroit 562 cells (FIGS. 31A, 3 IB), and LSCC cells - LK2 and NCI-H520 cells (FIG. 32). Drug-induced reductions in CAL33 cell viability were rescued by LZK Q240S drug-resistant mutant expression (FIG.
  • FIG. 34 shows that LZK Q240S drug-resistant mutant expression during treatment with LZK inhibitor 2 (250 nM) also rescued JNK signaling.
  • LZK inhibitor 2 250 nM
  • FIGS. 35-37 Compound 107 was particularly effective.
  • Three additional analogs also were evaluated:
  • Phospho-JNK levels were determined after incubation of doxycycline-induced CAL33 cells with 1 pM LZK inhibitor for 1 hour. The results are shown in FIGS. 38 and 39. Compound 164 was more effective than GNE-3511, while compound 161, compound 162, compound 159 had similar activity.
  • FIGS. 40-42 show dose-dependent inhibition of LZK by compound 164, compound 161, and compound 162, respectively.
  • Preparative HPLC was performed using an Agilent 1200 series system and a 30 mm x 150 mm Xbridge C18 column (Waters), eluting with gradients of 20->80% solvent B (MeCN, 0.05% TFA) in solvent A (water, 0.05%TFA). Flash chromatography was performed on a Teledyne Isco Combiflash Rf+. HRMS data was acquired on a Waters XEVO G2-XS QTOF running MassLynx version 4.1.
  • the vial was sealed, then evacuated and backfilled with Ar 3x. Dry dioxane (1.5 mL) was added, and the reaction was heated at 90 C for 20 h in the micro wave. The reaction was filtered through Celite, the residue was rinsed with 3 x 2 mL ethyl acetate, and the filtrate was concentrated under reduced pressure.
  • KD values were measured by Eurofins DiscoveRx using the Kd- Elect system.
  • PAMPA Parallel artificial membrane permeability assay
  • the 3.1.0 compound (198) was not quite twice as potent as the parent (107) for LZK; however, (198) also demonstrated twofold selectivity for LZK over DLK, which is a four-fold increase in selectivity over (107).
  • the dimethyl analog (199) did not show particularly enhanced potency but was selective for LZK over DLK by more than tenfold.
  • FIG. 43 An MTS assay (FIG. 43) showed that ESCC with the 3q amplicon (OVCAR5, KYSE30, and KYSE70 cells) are sensitive to the known LZK inhibitor GNE-3511, compared to control ESCC cells lacking amplified LZK (KYSE410 and OE19 cells). The results were confirmed with a soft agar assay (FIG. 44) and a colony formation assay (FIG. 45). ESCC cells expressing a drug resistant mutant form of LZK (LZK Q240S ) were resistant to GNE-3511, as shown in a colony formation assay (FIG. 46).
  • LZK Q240S a drug resistant mutant form of LZK
  • ESCC cells (OVCAR5) were sensitive to compounds 161 and 164 as shown in a colony formation assay (FIG. 47).
  • ESCC cells expressing the drug resistant mutant LZK Q240S were resistant to compound 161, as shown in the Western blot and colony formation assay of FIGS. 48 and 49.
  • a colony formation assay with compounds 207, 216, and 219 showed that ESCC cells (OVCAR5 and KYSE70) were extraordinarly sensitive to treatment with compounds 216 and 219 (FIG. 50).
  • a subject identified as having a disease or condition characterized at least in part by overexpression of LZK is administered a therapeutically effective amount of a pharmaceutical composition comprising an LZK inhibitor as disclosed herein.
  • the subject is identified as having cancer, such as HNSCC, LSCC, ESCC, hepatocellular carcinoma, ovarian cancer, small cell lung cancer, neuroendocrine prostate cancer, or esophageal cancer cell (e.g., esophageal adenocarcinoma).
  • the subject has cancer and identified as having upregulated levels of LZK expression.
  • the subject may be administered the therapeutically effective amount of the pharmaceutical composition at periodic intervals for an effective period of time to mitigate at least one sign or symptom of the disease or condition.
  • the subject may be administered the therapeutically effective amount of the pharmaceutical composition once daily or in divided doses over the course of a day, such as 2-3 divided doses per day.
  • the pharmaceutical composition is administered by any suitable route including, but not limited to, parenterally (e.g., intravenously, intramuscularly, subcutaneously), orally, or topically.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
PCT/US2022/075678 2021-09-01 2022-08-30 Mixed lineage kinase inhibitors and methods of use Ceased WO2023034808A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
KR1020247010519A KR20240055041A (ko) 2021-09-01 2022-08-30 혼합 계통 키나제 억제제 및 억제제의 사용 방법
EP22777538.4A EP4395899A1 (en) 2021-09-01 2022-08-30 Mixed lineage kinase inhibitors and methods of use
US18/688,126 US20250032489A1 (en) 2021-09-01 2022-08-30 Mixed lineage kinase inhibitors and methods of use
CN202280073643.1A CN118251387A (zh) 2021-09-01 2022-08-30 混合谱系激酶抑制剂及其使用方法
AU2022340743A AU2022340743A1 (en) 2021-09-01 2022-08-30 Mixed lineage kinase inhibitors and methods of use
JP2024513749A JP2024533121A (ja) 2021-09-01 2022-08-30 混合系統キナーゼ阻害薬および使用方法
CA3229861A CA3229861A1 (en) 2021-09-01 2022-08-30 Mixed lineage kinase inhibitors and methods of use

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163239797P 2021-09-01 2021-09-01
US63/239,797 2021-09-01

Publications (1)

Publication Number Publication Date
WO2023034808A1 true WO2023034808A1 (en) 2023-03-09

Family

ID=83447780

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/075678 Ceased WO2023034808A1 (en) 2021-09-01 2022-08-30 Mixed lineage kinase inhibitors and methods of use

Country Status (8)

Country Link
US (1) US20250032489A1 (cg-RX-API-DMAC7.html)
EP (1) EP4395899A1 (cg-RX-API-DMAC7.html)
JP (1) JP2024533121A (cg-RX-API-DMAC7.html)
KR (1) KR20240055041A (cg-RX-API-DMAC7.html)
CN (1) CN118251387A (cg-RX-API-DMAC7.html)
AU (1) AU2022340743A1 (cg-RX-API-DMAC7.html)
CA (1) CA3229861A1 (cg-RX-API-DMAC7.html)
WO (1) WO2023034808A1 (cg-RX-API-DMAC7.html)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024238570A1 (en) * 2023-05-15 2024-11-21 Aleksia Therapeutics, Inc. Cdk2 inhibitor pyrazolopyrimidine compounds
WO2025188848A1 (en) * 2024-03-06 2025-09-12 Uereka Biosciences, Inc. Lzk inhibitors
WO2026024674A1 (en) 2024-07-22 2026-01-29 Genesis Therapeutics, Inc. Methods of treating skp2-associated cancers

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4938949A (en) 1988-09-12 1990-07-03 University Of New York Treatment of damaged bone marrow and dosage units therefor
WO2012020786A1 (ja) * 2010-08-11 2012-02-16 日本新薬株式会社 医薬組成物
WO2013174780A1 (en) * 2012-05-22 2013-11-28 F. Hoffmann-La Roche Ag Substituted dipyridylamines and uses thereof
WO2014111496A1 (en) * 2013-01-18 2014-07-24 F. Hoffmann-La Roche Ag 3-substituted pyrazoles and use as dlk inhibitors
WO2014177060A1 (en) * 2013-05-01 2014-11-06 F.Hoffmann-La Roche Ag Biheteroaryl compounds and uses thereof
WO2014177524A1 (en) * 2013-05-01 2014-11-06 F. Hoffmann-La Roche Ag C-linked heterocycloalkyl substituted pyrimidines and their uses
WO2015091889A1 (en) * 2013-12-20 2015-06-25 F. Hoffmann-La Roche Ag Pyrazole derivatives and uses thereof as inhibitors of dlk
US20180057507A1 (en) 2016-08-29 2018-03-01 Board Of Regents, The University Of Texas System Inhibitors of dual leucine zipper (dlk) kinase for the treatment of disease
WO2018107072A1 (en) * 2016-12-08 2018-06-14 Board Of Regents, The University Of Texas System Bicyclo[1.1.1]pentane inhibitors of dual leucine zipper (dlk) kinase for the treatment of disease

Patent Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4938949A (en) 1988-09-12 1990-07-03 University Of New York Treatment of damaged bone marrow and dosage units therefor
WO2012020786A1 (ja) * 2010-08-11 2012-02-16 日本新薬株式会社 医薬組成物
WO2013174780A1 (en) * 2012-05-22 2013-11-28 F. Hoffmann-La Roche Ag Substituted dipyridylamines and uses thereof
WO2014111496A1 (en) * 2013-01-18 2014-07-24 F. Hoffmann-La Roche Ag 3-substituted pyrazoles and use as dlk inhibitors
WO2014177060A1 (en) * 2013-05-01 2014-11-06 F.Hoffmann-La Roche Ag Biheteroaryl compounds and uses thereof
WO2014177524A1 (en) * 2013-05-01 2014-11-06 F. Hoffmann-La Roche Ag C-linked heterocycloalkyl substituted pyrimidines and their uses
WO2015091889A1 (en) * 2013-12-20 2015-06-25 F. Hoffmann-La Roche Ag Pyrazole derivatives and uses thereof as inhibitors of dlk
US20180057507A1 (en) 2016-08-29 2018-03-01 Board Of Regents, The University Of Texas System Inhibitors of dual leucine zipper (dlk) kinase for the treatment of disease
WO2018044808A1 (en) * 2016-08-29 2018-03-08 Board Of Regents, University Of Texas System Inhibitors of dual leucine ziper (dlk) kinase for the treatment of disease
WO2018107072A1 (en) * 2016-12-08 2018-06-14 Board Of Regents, The University Of Texas System Bicyclo[1.1.1]pentane inhibitors of dual leucine zipper (dlk) kinase for the treatment of disease
US10093664B2 (en) 2016-12-08 2018-10-09 Board Of Regents, The University Of Texas System Bicyclo[1.1.1]pentane inhibitors of dual leucine zipper (DLK) kinase for the treatment of disease

Non-Patent Citations (26)

* Cited by examiner, † Cited by third party
Title
"Comprehensive genomic characterization of squamous cell lung cancers", NATURE, vol. 489, no. 7417, 2012, pages 519 - 25
"Hawley's Condensed Chemical Dictionary", 2016, JOHN WILEY & SONS, INC.
"Remington: The Science and Practice of Pharmacy", 2005, LIPPINCOTT, WILLIAMS, & WILKINS
BENSEN RYAN ET AL: "New Therapeutic Opportunities for the Treatment of Squamous Cell Carcinomas: A Focus on Novel Driver Kinases", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 22, no. 6, 1 January 2021 (2021-01-01), pages 2831, XP055974373, Retrieved from the Internet <URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7999493/pdf/ijms-22-02831.pdf> DOI: 10.3390/ijms22062831 *
BONNER ET AL., NEJM, vol. 364, 2006, pages 567 - 578
BRANCHO ET AL., MOL CELL BIOL, 2005, pages 3670 - 3681
EDWARDS ET AL., CANCER RES, vol. 77, 2017, pages 4961 - 4972
GANDARA ET AL., CLIN CANCER RES, vol. 21, no. 10, 2015, pages 2236 - 43
GOLD ET AL., CLIN CANCER RES, vol. 18, no. 11, 2012, pages 3002 - 7
IKEDA ET AL., J BIOCHEM, vol. 130, 2001, pages 773 - 781
LI ET AL., BMC BIOINFORMATICS, vol. 12, no. 1, 2011, pages 323
MAPLE ET AL., MED CHEM COMMUN, vol. 10, 2019, pages 1755 - 1764
MARUSIAK ET AL., ONCOGENE, vol. 38, 2019, pages 2860 - 2875
MEHLICH ET AL., CELL DEATH AND DISEASE, vol. 12, 2021, pages 1111
NATURE, vol. 489, 2012, pages 519 - 525
PATEL ET AL., J MED CHEM, vol. 58, 2015, pages 8182 - 8199
PATEL ET AL., J MED. CHEM., vol. 58, 2015, pages 8182 - 8199
PATEL SNAHEL ET AL: "Scaffold-Hopping and Structure-Based Discovery of Potent, Selective, And Brain Penetrant N -(1 H -Pyrazol-3-yl)pyridin-2-amine Inhibitors of Dual Leucine Zipper Kinase (DLK, MAP3K12)", JOURNAL OF MEDICINAL CHEMISTRY, vol. 58, no. 20, 2 October 2015 (2015-10-02), US, pages 8182 - 8199, XP055865211, ISSN: 0022-2623, DOI: 10.1021/acs.jmedchem.5b01072 *
S. M. BERGE ET AL.: "Pharmaceutical Salts", J. PHARM. SCI., vol. 66, 1977, pages 1 - 19, XP002675560, DOI: 10.1002/jps.2600660104
SPENCER ET AL., CELL, vol. 155, 2013, pages 369 - 383
SRISKANDARAJAH ET AL., BMC CANCER, vol. 20, 2020, pages 269
TOYOSHIMA ET AL., PNAS USA, vol. 109, 2012, pages 9545 - 9550
VERMORKEN ET AL., J CLIN ONCOL, vol. 25, 2007, pages 2171 - 2177
VERMORKEN ET AL., NEJM, vol. 359, 2008, pages 1116 - 1127
ZHANG ET AL., CELL DEATH & DIFFERENTIATION, vol. 27, 2020, pages 420 - 433
ZHANG ET AL., CELL DEATH DIFFER, vol. 27, 2020, pages 420 - 433

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024238570A1 (en) * 2023-05-15 2024-11-21 Aleksia Therapeutics, Inc. Cdk2 inhibitor pyrazolopyrimidine compounds
WO2025188848A1 (en) * 2024-03-06 2025-09-12 Uereka Biosciences, Inc. Lzk inhibitors
WO2026024674A1 (en) 2024-07-22 2026-01-29 Genesis Therapeutics, Inc. Methods of treating skp2-associated cancers

Also Published As

Publication number Publication date
AU2022340743A1 (en) 2024-03-14
US20250032489A1 (en) 2025-01-30
KR20240055041A (ko) 2024-04-26
EP4395899A1 (en) 2024-07-10
JP2024533121A (ja) 2024-09-12
CA3229861A1 (en) 2023-03-09
CN118251387A (zh) 2024-06-25

Similar Documents

Publication Publication Date Title
CN109970614B (zh) 作为trka激酶抑制剂的化合物及其用途
KR20250021402A (ko) 헤테로환 화합물 및 이의 용도
AU2011311814B2 (en) Substituted pyridazine carboxamide compounds
AU2022340743A1 (en) Mixed lineage kinase inhibitors and methods of use
KR102603153B1 (ko) C5-아닐리노퀴나졸린 화합물 및 암의 치료에서의 이의 용도
RU2581834C1 (ru) Новое пиперидиновое соединение или его соль
US20220306621A9 (en) SUBSTITUTED IMIDAZO[1,2-a]PYRIDINES AS IRAK 1/4 AND FLT3 INHIBITORS
CN115996907B (zh) 用于癌症治疗的mlh1和/或pms2的抑制剂
BR112021005513A2 (pt) derivados de quinazolina como inibidor de tirosina quinase, composições, métodos de fabricação e uso dos mesmos
WO2018137639A1 (zh) 一种组蛋白甲基转移酶ezh2抑制剂、其制备方法及其医药用途
JP2020532561A (ja) Wdr5タンパク質−タンパク質結合の阻害剤
US20240190838A1 (en) Lzk-targeting degraders and methods of use
CN106536524B (zh) 用于在增殖性疾病的治疗中使用的[1,2,4]三唑并[4,3-b]哒嗪
TW201808948A (zh) 咪唑并[4,5-c]喹啉-2-酮化合物以及它們在治療癌症中之用途
CN117693507A (zh) 抑制剂化合物
IL324619A (en) (hetero)aryl-carbonyl-heterobicyclic compounds as inhibitors of pms2 for cancer and degenerative illnesses
WO2023008577A1 (ja) Ras/Raf結合阻害化合物
EP4729515A1 (en) New acylsulfonamide derivatives and their use for the treatment of cancer
KR20250034312A (ko) Wee1 억제자, 그 제조방법 및 그 용도
WO2025255442A1 (en) Trim21-targeted compounds and uses thereof
CN118772113A (zh) 作为DNA聚合酶Theta抑制剂的含氮杂环化合物
HK1188216B (en) Substitututed 6-amino-pyridazin-3-yl-carboxamide compounds as protein kinase modulators
BR112016026672B1 (pt) Composto 1-((3s,4r)-4-(3-fluorofenil)-1-(2-metoxietil)pirrolidin-3-il)-3-(4-metil-3-(2-metilpirimidin-5-il)-1-fenil-1h-pirazol-5-il)ureia, seu uso, processos para a preparação do mesmo e de sua mistura racêmica e composição farmacêutica que o compreende

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22777538

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 3229861

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2022340743

Country of ref document: AU

Ref document number: AU2022340743

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 18688126

Country of ref document: US

Ref document number: 2024513749

Country of ref document: JP

ENP Entry into the national phase

Ref document number: 2022340743

Country of ref document: AU

Date of ref document: 20220830

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20247010519

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 11202401449Q

Country of ref document: SG

WWE Wipo information: entry into national phase

Ref document number: 2022777538

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022777538

Country of ref document: EP

Effective date: 20240402

WWE Wipo information: entry into national phase

Ref document number: 202280073643.1

Country of ref document: CN