WO2023034582A1 - Rna editing via recruitment of spliceosome components - Google Patents

Rna editing via recruitment of spliceosome components Download PDF

Info

Publication number
WO2023034582A1
WO2023034582A1 PCT/US2022/042486 US2022042486W WO2023034582A1 WO 2023034582 A1 WO2023034582 A1 WO 2023034582A1 US 2022042486 W US2022042486 W US 2022042486W WO 2023034582 A1 WO2023034582 A1 WO 2023034582A1
Authority
WO
WIPO (PCT)
Prior art keywords
rna
nucleotides
composition
molecule
esnrna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2022/042486
Other languages
English (en)
French (fr)
Inventor
David A. Nelles
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tacit Therapeutics Inc
Original Assignee
Tacit Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA3230419A priority Critical patent/CA3230419A1/en
Priority to CN202280073582.9A priority patent/CN118202051A/zh
Priority to MX2024002647A priority patent/MX2024002647A/es
Priority to KR1020247010496A priority patent/KR20240052034A/ko
Priority to AU2022337146A priority patent/AU2022337146A1/en
Priority to IL311101A priority patent/IL311101A/en
Application filed by Tacit Therapeutics Inc filed Critical Tacit Therapeutics Inc
Priority to EP22865613.8A priority patent/EP4396350A4/en
Priority to JP2024513942A priority patent/JP2024533163A/ja
Publication of WO2023034582A1 publication Critical patent/WO2023034582A1/en
Priority to US18/362,698 priority patent/US12152239B2/en
Anticipated expiration legal-status Critical
Priority to US18/911,917 priority patent/US20250051764A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/33Alteration of splicing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/48Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE

Definitions

  • the disclosure provides compositions and methods for replacement of specific RNA sequences in RNA molecules in human cells.
  • the present disclosure provides compositions and methods for replacement of chosen RNA sequences within target RNAs.
  • the present disclosure provides RNA donor molecules used in conjunction with engineered small nuclear RNAs that recruit components of the spliceosome to the RNA donor and promote editing of target RNAs to treat a disease in the context of a human gene therapy.
  • RNA editing has been proposed as a human gene therapeutic but has not experienced success in clinical trials due to low efficiency and limited size and composition of RNA edits. Furthermore, the use of immunogenic proteins to edit RNA and DNA has posed safety issues. The present disclosure describes improvements to RNA editing that could address this long-felt but unmet need.
  • composition comprising an engineered small nuclear RNA that promotes trans-splicing of a target RNA molecule and an RNA donor molecule.
  • the RNA donor molecule comprises a engineered small nuclear RNA domain.
  • the engineered small nuclear RNA molecule is derived or isolated from a human small nuclear RNA gene chosen from a group consisting of Ul, U2, U4, U5, U6, U7, Ul 1, and U12.
  • the engineered small nuclear RNA molecule is derived or isolated from a Ul small nuclear RNA gene or variant of a Ul small nuclear RNA gene and contains an RNA motif that begins less than 16 nucleobases from the 5’ end that is partially or perfectly complementary to the RNA donor molecule. In some embodiments, the engineered small nuclear RNA molecule contains an RNA motif that is partially or perfectly complementary to the RNA donor molecule.
  • the RNA motif is chosen from a group consisting of: 5’-CGAGCTCTCT -3’, 5’-AACGAGCTCT -3’, 5’- CGCAACGAGC-3’, 5’-TATCGCAACG-3’, 5’-AATAATATCG-3’, 5’-TAAGAGAGCT-3’, 5’- AAGAGAGCTC-3’, 5’-AGAGAGCTCGTTGC-3’, 5’-GAGAGCTCGT-3’, 5’- AGAGCTCGTTGCGA-3’, and 5’-GAGCTCGTTG-3’.
  • the engineered small RNA molecule comprises sequences derived or isolated from a U1 small nuclear RNA gene or variant of U1 small nuclear RNA gene.
  • the engineered small RNA molecule comprises sequences derived or isolated from a U1 small nuclear RNA gene and a variant of the U1 small nuclear RNA gene.
  • the variant of the U1 small nuclear RNA gene is chosen from a group consisting of: vU1.4, vUl.l l, vU1.8, vU1.7, vU1.5, vUl .12.
  • the small nuclear RNA molecule comprises RNA, DNA, a DNA/RNA hybrid, a nucleic acid analog, a chemically-modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs.
  • the RNA donor molecule further comprises an untranslated region that enhances translation.
  • the composition further comprises an RNA-binding protein that strengthens the interaction among the RNA donor molecule and the target RNA molecule and increases transsplicing efficiency
  • the engineered small nuclear RNA molecule contains an RNA motif that is at least 4 nucleotides long and is partially or perfectly complementary to a sequence in the RNA donor molecule.
  • the RNA motif is chosen from a group consisting of: 5’-CGAGCTCTCT -3’, 5’-AACGAGCTCT -3’, 5’-CGCAACGAGC-3’, 5’- TATCGCAACG-3’, 5’-AATAATATCG-3’, 5’-TAAGAGAGCT-3’, 5’-AAGAGAGCTC-3’, 5’- AGAGAGCTCGTTGC-3’, 5’-GAGAGCTCGT-3’, 5’-AGAGCTCGTTGCGA-3’, and 5’- GAGCTCGTTG-3’.
  • the RNA donor molecule contains an RNA motif that is at least 4 nucleotides long and is partially or perfectly complementary to a sequence in the RNA donor molecule.
  • the RNA donor molecule further comprises an untranslated region that enhances translation
  • the translation-enhancing element comprises a sequence derived or isolated from the group consisting of: Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE), triplex from MALAT1, the PRE of Hepatitis B virus (HPRE), and an iron response element
  • the composition further comprises an RNA-binding protein that strengthens the interaction among the RNA donor molecule and the target RNA molecule and increases trans-splicing efficiency
  • the RNA donor molecule comprises RNA, DNA, a DNA/RNA hybrid, a nucleic acid analog, a chemically-modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs.
  • the nucleic acid molecule further comprises a heterologous promoter.
  • described herein is a vector comprising the composition of claims disclosed herein.
  • the vector is selected from the group consisting of adeno-associated virus, retrovirus, lentivirus, adenovirus, nanoparticle, micelle, liposome, lipoplex, polymersome, polyplex, and dendrimer.
  • described herein is a cell comprising the vector described herein.
  • described herein is a method for treating a disease comprising administering to a patient in need of a therapeutically effective amount of a treatment comprising the composition described herein or the vector described herein.
  • described herein is a method for correcting a genetic defect in a subject comprising administering to said subject the composition described herein or the vector described herein. In some embodiments, described herein is a method for treating a disease comprising administering to a patient in need of a therapeutically effective amount of a treatment the composition described herein or the vector described herein. In some embodiments, described herein is a method for correcting a genetic defect in a subject comprising administering to said subject the composition described herein or the vector described herein.
  • composition comprising an engineered small nuclear RNA that promotes trans-splicing of a target RNA molecule and an RNA donor molecule, the RNA donor molecule comprising: (a) one or more replacement domains that encode a therapeutic sequence operably linked to; (b) one or more intronic domains that promote RNA splicing of the replacement domain; and (c) one or more antisense domains that promote binding to a target RNA molecule.
  • the RNA donor molecule comprises a engineered small nuclear RNA domain.
  • the engineered small nuclear RNA molecule is derived or isolated from a human small nuclear RNA gene chosen from a group consisting of Ul, U2, U4, U5, U6, U7, U11, and U12.
  • the engineered small nuclear RNA molecule is derived or isolated from a Ul small nuclear RNA gene or variant of a Ul small nuclear RNA gene and contains an RNA motif that begins less than 16 nucleobases from the 5’ end that is partially or perfectly complementary to the RNA donor molecule.
  • the engineered small nuclear RNA molecule contains an RNA motif that is partially or perfectly complementary to the RNA donor molecule.
  • the RNA motif is chosen from a group consisting of 5’-CGAGCTCTCT -3’, 5’- AACGAGCTCT -3’, 5’-CGCAACGAGC-3’, 5’-TATCGCAACG-3’, 5’-AATAATATCG-3’, 5’-TAAGAGAGCT-3’, 5’-AAGAGAGCTC-3’, 5’-AGAGAGCTCGTTGC-3’, 5’- GAGAGCTCGT-3’, 5’-AGAGCTCGTTGCGA-3’, and 5’-GAGCTCGTTG-3’.
  • the engineered small RNA molecule comprises sequences derived or isolated from a U1 small nuclear RNA gene or variant of U1 small nuclear RNA gene.
  • the engineered small RNA molecule comprises sequences derived or isolated from a U1 small nuclear RNA gene and a variant of the U1 small nuclear RNA gene.
  • the variant of the U1 small nuclear RNA gene is chosen from a group consisting of: vU1.4, vUl. l l, vU1.8, vU1.7, vU1.5, vU1.12.
  • the small nuclear RNA molecule comprises RNA, DNA, a DNA/RNA hybrid, a nucleic acid analog, a chemically-modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs.
  • the RNA donor molecule further comprises an untranslated region that enhances translation.
  • the composition further comprises an RNA-binding protein that strengthens the interaction among the RNA donor molecule and the target RNA molecule and increases trans-splicing efficiency
  • the engineered small nuclear RNA molecule contains an RNA motif that is at least 4 nucleotides long and is partially or perfectly complementary to a sequence in the RNA donor molecule.
  • the RNA motif is chosen from a group consisting of: 5’-CGAGCTCTCT -3’, 5’- AACGAGCTCT -3’, 5’-CGCAACGAGC-3’, 5’-TATCGCAACG-3’, 5’-AATAATATCG-3’, 5’-TAAGAGAGCT-3’, 5’-AAGAGAGCTC-3’, 5’-AGAGAGCTCGTTGC-3’, 5’- GAGAGCTCGT-3’, 5’-AGAGCTCGTTGCGA-3’, and 5’-GAGCTCGTTG-3’.
  • the RNA donor molecule contains an RNA motif that is at least 4 nucleotides long and is partially or perfectly complementary to a sequence in the RNA donor molecule.
  • the RNA donor molecule further comprises an untranslated region that enhances translation
  • the translation-enhancing element comprises a sequence derived or isolated from the group consisting of: Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE), triplex from MALAT1, the PRE of Hepatitis B virus (HPRE), and an iron response element
  • the composition further comprises an RNA-binding protein that strengthens the interaction among the RNA donor molecule and the target RNA molecule and increases trans-splicing efficiency
  • the RNA donor molecule comprises RNA, DNA, a DNA/RNA hybrid, a nucleic acid analog, a chemically-modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs.
  • the nucleic acid molecule further comprises a heterologous promoter.
  • described herein is a vector comprising the composition of claims disclosed herein.
  • the vector is selected from the group consisting of: adeno-associated virus, retrovirus, lentivirus, adenovirus, nanoparticle, micelle, liposome, lipoplex, polymersome, polyplex, and dendrimer.
  • described herein is a cell comprising the vector described herein.
  • described herein is a method for treating a disease comprising administering to a patient in need of a therapeutically effective amount of a treatment comprising the composition described herein or the vector described herein.
  • described herein is a method for correcting a genetic defect in a subject comprising administering to said subject the composition described herein or the vector described herein. In some embodiments, described herein is a method for treating a disease comprising administering to a patient in need of a therapeutically effective amount of a treatment the composition described herein or the vector described herein. In some embodiments, described herein is a method for correcting a genetic defect in a subject comprising administering to said subject the composition described herein or the vector described herein.
  • compositions comprising an RNA donor molecule, comprising: (a) one or more replacement domains that encode a therapeutic sequence operably linked to; (b) one or more intronic domains that promote RNA splicing of the replacement domain; and (c) one or more antisense domains that promote binding to a target RNA molecule; and (d) an engineered small nuclear RNA domain that promotes trans-splicing of the RNA donor molecule.
  • the engineered small nuclear RNA domain is located less than 200 bases away from a splice donor site in the RNA donor molecule.
  • the engineered small nuclear RNA domain is isolated or derived from a human small nuclear RNA gene.
  • the human small nuclear RNA gene is chosen from a group consisting of: Ul, U2, U4, U5, U6, U7, U11, and U12.
  • the engineered small nuclear RNA domain is synthetic and binds components of the spliceosome.
  • the engineered small nuclear RNA domain comprises sequences isolated or derived from a variant of the human Ul gene.
  • the engineered small nuclear RNA domain comprises sequences derived from the human Ul small nuclear RNA gene and a variant of the Ul small nuclear RNA gene.
  • the RNA donor molecule further comprises an untranslated region that enhances translation.
  • the composition further comprises an RNA-binding protein that strengthens the interaction among the RNA donor molecule and the target RNA molecule and increases trans- splicing efficiency
  • the engineered small nuclear RNA molecule contains an RNA motif that is at least 4 nucleotides long and is partially or perfectly complementary to a sequence in the RNA donor molecule.
  • the RNA motif is chosen from a group consisting of: 5’-CGAGCTCTCT -3’, 5’-AACGAGCTCT -3’, 5’-CGCAACGAGC-3’, 5’- TATCGCAACG-3’, 5’-AATAATATCG-3’, 5’-TAAGAGAGCT-3’, 5’-AAGAGAGCTC-3’, 5’- AGAGAGCTCGTTGC-3’, 5’-GAGAGCTCGT-3’, 5’-AGAGCTCGTTGCGA-3’, and 5’- GAGCTCGTTG-3’.
  • the RNA donor molecule contains an RNA motif that is at least 4 nucleotides long and is partially or perfectly complementary to a sequence in the RNA donor molecule.
  • the RNA donor molecule further comprises an untranslated region that enhances translation
  • the translation-enhancing element comprises a sequence derived or isolated from the group consisting of Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE), triplex from MALAT1, the PRE of Hepatitis B virus (HPRE), and an iron response element
  • the composition further comprises an RNA-binding protein that strengthens the interaction among the RNA donor molecule and the target RNA molecule and increases trans-splicing efficiency
  • the RNA donor molecule comprises RNA, DNA, a DNA/RNA hybrid, a nucleic acid analog, a chemically-modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs.
  • the nucleic acid molecule further comprises a heterologous promoter.
  • described herein is a vector comprising the composition of claims disclosed herein.
  • the vector is selected from the group consisting of adeno-associated virus, retrovirus, lentivirus, adenovirus, nanoparticle, micelle, liposome, lipoplex, polymersome, polyplex, and dendrimer.
  • described herein is a cell comprising the vector described herein.
  • described herein is a method for treating a disease comprising administering to a patient in need of a therapeutically effective amount of a treatment comprising the composition described herein or the vector described herein.
  • described herein is a method for correcting a genetic defect in a subject comprising administering to said subject the composition described herein or the vector described herein. In some embodiments, described herein is a method for treating a disease comprising administering to a patient in need of a therapeutically effective amount of a treatment the composition described herein or the vector described herein. In some embodiments, described herein is a method for correcting a genetic defect in a subject comprising administering to said subject the composition described herein or the vector described herein.
  • FIGURES 1A-1C illustrate one embodiments of the methods described herein.
  • FIGURE 1A illustrates the concept of human genetic disease where mutated (“defective”) DNA sequences are transcribed into RNA which directly contribute to disease (“RNA pathogenicity”) or indirectly via translation into disease-causing protein (“translation of pathogenic protein”).
  • FIGURE IB illustrates a system composed of a donor RNA and an engineered small nuclear RNA (“esnRNA”). The combination of RNA donor molecule and esnRNA correct mutated RNAs via hybridization of the RNA donor to the target RNA carrying a mutation, followed by association of the esnRNA with the RNA donor, which results in recruitment of spliceosome components and trans-splicing among the RNA donor molecule and the target RNA.
  • FIGURE 1C illustrates the how the components interact. Base pairing among the RNA donor and target RNA bring these molecule in close proximity. Base pairing among the esnRNA and the RNA donor brings spliceosome components in close proximity which promotes a trans- splicing reaction among the target RNA and the RNA donor.
  • FIGURES 2A-2B illustrate two non-limiting embodiments.
  • FIGURE 2A illustrates a version that results in replacement in internal sequences within a target RNA molecule. This embodiment results in retention of the 5’ and 3’ termini of the target RNA while replacing an internal sequence with the RNA donor molecule.
  • FIGURE 2B illustrates that results in replacement of the 5 ’-terminal portion of the target RNA while retaining the 3’ end of the target RNA.
  • FIGURES 3A-3B illustrate two non-limiting embodiments.
  • the esnRNA and the RNA are separate molecules and the esnRNA and RNA donor associate in a manner outlined in FIGURE 1C.
  • the esnRNA is a domain within the RNA donor.
  • the esnRNA sequence acts by the same mechanism where recruitment of spliceosome components to the RNA donor drives trans-splicing among the target RNA and RNA donor.
  • FIGURES 4A-4D illustrate an experiment designed to reveal the importance of the esnRNA in the context of replacement of an internal sequence in a target RNA.
  • FIGURE 4A illustrates the design of a split GFP reporter that carries a N-terminal and a C-terminal portion of GFP (“C-GFP”) but lacks an internal GFP sequence required for fluorescence. In the reporter, this internal GFP sequence is replaced by a short exon with a stop codon that is flanked by introns. The internal sequence is the replacement sequence within the RNA donor molecule that is flanked by one intronic domain and one antisense domain.
  • FIGURE 4B illustrates the activity of the reporter alone so that cis-splicing produces a GFP sequence interrupted by a stop codon therefore producing no GFP signal.
  • FIGURE 4C illustrates the activity of the reporter in the presence of the RNA donor molecule without inclusion of the esnRNA so that similarly cis- splicing occurs primarily and GFP signal is not produced.
  • FIGURE 4D illustrates the activity of the reporter in the presence of the RNA donor molecule with inclusion of esnRNA so that transsplicing occurs primarily and GFP signal is produced.
  • FIGURES 5A-5B illustrate an experiment designed to reveal the importance of the esnRNA in the context of replacement of an 5 ’-terminal sequence in a target RNA.
  • FIGURE 5A illustrates the design of a split GFP reporter that carries a C-terminal portion of GFP (“C-GFP”) but lacks an N-terminal GFP sequence required for fluorescence. In the reporter, this N-terminal GFP sequence is replaced by a short exon that is flanked by introns.
  • the N-terminal sequence (“N-GFP”) is the replacement sequence within an RNA donor molecule that is flanked by one intronic sequence and one antisense domain.
  • FIGURE 5B illustrates the activity of the reporter alone so that cis-splicing produces a GFP sequence lacking the N-terminal portion of GFP therefore producing no GFP signal.
  • FIGURE 5C illustrates the activity of the reporter in the presence of the RNA donor molecule without the esnRNA so that similarly cis-splicing occurs primarily and GFP signal is not efficiently produced.
  • FIGURE 5D illustrates the activity of the reporter in the presence of the RNA donor with inclusion of esnRNA so that trans-splicing occurs primarily and GFP signal is efficiently produced.
  • FIGURE 6A is experimental data that that investigates the importance of specific features of the esnRNA in the context of replacement of specific sequences within a target RNA.
  • Various esnRNAs (lettered A though H) were constructed that are derived from human U1 snRNA but carry mutations on the 5’ end that generate a region that is complementary to the RNA donor molecule.
  • the target of these antisense domains is outlined in FIGURE 6B. Human cells were treated with the RNA donor and various esnRNAs along with a reporter system described in FIGURE 5.
  • esnRNA B and “esnRNA C”) yield the highest GFP signal and therefore the most efficient insertion of the RNA donor molecule into the target RNA.
  • esnRNA C two esnRNAs
  • target site chose is an important factor to achieve efficient esnRNA-directed insertion of RNA donor sequences into the target RNA.
  • “Negative control” refers to an experimental condition where the RNA donor contains no antisense domain that targets the reporter
  • wt esnRNA refers to an experimental condition where the RNA donor does indeed target the reporter but the esnRNA is identical to the unmodified, wildtype human U1 snRNA.
  • FIGURE 7 contains experimental data that investigates the importance of the presence of the esnRNA in the context of replacement of specific sequences within a target RNA.
  • sequenced clones did not align to full length GFP (0 of 23 sequenced clones pictured in the right panel).
  • four clones aligned to full length GFP (4 out of 24 sequenced clones pictured in the right panel).
  • These fully-aligned clones are labeled “clone 1-4”.
  • the sequence of these clones flanking the junction of sequences derived from the RNA donor and from the target RNA reveals perfect alignment among all clones and the expected sequence of full length GFP.
  • FIGURES 8A-8B contains experimental data that investigates the importance of various features of the esnRNA in the context of replacement of specific sequences within a target RNA.
  • Cells were transfected with esnRNA B or various mutated versions of esnRNA B and the reporter system outlined in FIGURE 5 (RNA donor and reporter).
  • the resulting GFP signal indicates that the presence of stem-loop structures within the esnRNA is critical for the activity of the esnRNA. Indeed, removal or mutation of stem-loop structures that recruit spliceosome factors (stem-loop 1, stem -loop 2, or stem-loop 4) reduces the insertion of the RNA donor into the target RNA. Results are depicted in FIGURE 8A. The different mutations are depicted in FIGURE 8B.
  • FIGURES 9A-9B contains experimental data that investigates the importance of the antisense domain within the esnRNA in the context of replacement of specific sequences within a target RNA.
  • Cells were transfected with esnRNA B or various mutated versions of esnRNA B and the reporter system outlined in FIGURE 5 (RNA donor and reporter).
  • the resulting GFP signal indicates that reducing the length of sequence in the esnRNA that is complementary to the RNA donor results in lower GFP signal and therefore less efficient insertion of the RNA donor in the target RNA.
  • esnRNA “+” indicates the presence of an esnRNA that contains a 10-base complementary sequence to the RNA donor.
  • RNA donor “+” indicates the presence of an RNA donor that contains sequences that are complementary to the target RNA while indicates a control RNA donor that is not complementary to the target RNA. Results are depicted in FIGURE 9A. The different mutations are depicted in FIGURE 9B.
  • FIGURE 10 contains experimental data that describes the activity of various esnRNAs in the context of replacement of specific sequences within a target RNA.
  • Various esnRNAs (numbered 1-61 and compared to esnRNA B) were constructed that are derived from U1 snRNA and variants of U1 snRNA. All esnRNAs carry mutations on the 5’ end that generate a region that is complementary to the RNA donor molecule. Human cells were treated with the RNA donor and various esnRNAs along with a reporter system described in FIGURE 5. The resulting GFP signal indicates the efficiency associated with RNA editing. These data indicate that the use of sequences derived from the variants of the U1 snRNA is important means to increase RNA editing efficiency by trans-splicing.
  • RNA technology that enables replacement of arbitrary sequences within specific RNA molecules in living cells.
  • this technology based on RNA trans-splicing, utilizes the naturally-existing spliceosome in human cells to provide the catalytic activity for this trans-splicing process
  • RNA splicing occurs within RNA molecules where exons are concatenated and introns removed from immature messenger RNA molecules (pre-mRNAs) to form mature messenger RNA molecules (mRNAs). This process is referred to as cis-splicing.
  • RNA trans-splicing is a process by which the spliceosome concatenates exons derived from distinct and separate RNA molecules.
  • RNA trans-splicing can insert engineered sequences into a target RNA to impart new activities to the target RNA such as altered RNA stability or altered RNA translation. This feature can be used to increase production of protein by a target RNA. In the broadest sense, this RNA trans-splicing technology can impart arbitrary changes to both coding and non-coding regions of target RNAs.
  • RNA trans-splicing technology which involves the use of a RNA donor molecule and an esnRNA molecule is the first to show RNA-trans-splicing with high efficiency against multiple RNA targets.
  • Highly efficient RNA trans-splicing has three primary advantages over previous RNA trans-splicing systems.
  • this improved efficiency can replace defective RNA sequences at levels sufficient to reconstitute the activity of mutated genes to treat recessive genetic disorders. Indeed, treatment of many recessive gene disorders require at least 15% efficiency, where 100% is complete replacement of a sequence within a Target RNA.
  • this improved efficiency can replace defective RNA sequences at levels sufficient to treat genetic disorders involving a toxic gain of function mutation.
  • RNA trans-splicing technology described herein to modify multiple Target RNAs demonstrates a broadly-applicable and efficient version of this technology. This is a very general capability, with this disclosure providing demonstrations of RNA trans-splicing system that can efficiently replace sequences with multiple target RNAs.
  • esnRNA molecule to form the present technology is a capability that further allows the alteration of both coding and non-coding sequences within target RNAs. By replacing the 5’ or 3’ untranslated regions of Target RNAs with high efficiency, this allows the alteration of RNA behaviors such as translation or turnover. The net result of these effects is increased production of protein from Target RNAs or other downstream effects associated with altered RNA levels.
  • compositions described herein comprise RNA molecules for promoting trans-splicing.
  • described herein is an RNA donor molecule.
  • the RNA donor binds a target RNA molecule and a esnRNA molecule to promote trans-splicing.
  • the RNA donor molecule comprises an esnRNA domain.
  • the RNA donor molecule does not comprise a esnRNA domain.
  • An example is depicted in FIGURE 3A.
  • described herein is an esnRNA molecule and an RNA donor molecule comprising three domains.
  • RNA donor molecule comprises a Replacement Domain. The Replacement Domain may be inserted into a Target RNA molecule via a trans-splicing reaction
  • RNA donor molecule comprises an Antisense Domain which is complementary to a Target RNA.
  • RNA donor molecule comprises an Intronic Domain, which promotes the trans- splicing reaction between RNA donor molecule and the Target RNA.
  • the esnRNA molecule is isolated or derived from a human small nuclear RNA gene but has been altered to contain a sequence that is complementary to the RNA donor molecule.
  • the combination of a trans-splicing RNA donor molecule and a esnRNA that contacts the RNA donor molecule results in replacement of chosen sequences within a target RNA in a manner that is sufficiently efficient to replace disease-causing RNA sequences in human cells to address disease.
  • the disclosure provides compositions and methods for targeting disease-causing RNA molecules in a sequence-specific manner and replacing disease-causing RNA sequences within these RNA molecules with high efficiency.
  • the RNA donor molecule and esnRNA implementations show utility in a variety of contexts including replacement of disease-causing sequences or insertion of engineered sequences into Target RNAs.
  • the engineered sequences can alter the translation or stability of Target RNAs to increase or decrease protein production or Target RNA levels.
  • this disclosure provides vectors, compositions and cells comprising or encoding RNA donor molecule and esnRNA molecule and methods of using the trans-splicing RNA compositions.
  • composition comprising an engineered small nuclear RNA (“esnRNA”) molecule derived or isolated from a human spliceosomal snRNA gene and an RNA donor molecule comprising (a) at least one domain that promotes trans-splicing (“Intronic Domain”), (b) at least one binding domain (“Antisense Domain”) that contains or consists of a sequence complementary to a pre-mRNA present in a human cells (“Target RNA”), and (c) a coding domain that is inserted into the Target RNA via trans-splicing (“Replacement Domain”).
  • esnRNA engineered small nuclear RNA
  • RNA donor molecule comprising (a) at least one domain that promotes trans-splicing (“Intronic Domain”), (b) at least one binding domain (“Antisense Domain”) that contains or consists of a sequence complementary to a pre-mRNA present in a human cells (“Target RNA”), and (c) a coding domain that is inserted into the Target RNA via trans-
  • the esnRNA molecule binds the RNA donor molecule and recruits spliceosome components which promotes trans-splicing among the RNA donor molecule and the Target RNA, therefore inserting the RNA donor molecule sequence into the Target RNA.
  • the present disclosure provides a composition comprising a nucleic acid sequence encoding RNA donor molecule and the esnRNA molecule.
  • the present disclosure provides a composition comprising two nucleic acid sequences encoding the RNA donor molecule and the esnRNA, respectively.
  • RNA molecule that contains two domains (the RNA donor domain and the esnRNA domain), wherein the single RNA molecule selectively binds a target RNA molecule and promotes a trans-splicing reaction with the target RNA molecule with high efficiency.
  • the disclosure provides vectors, compositions and cells comprising or encoding the single RNA molecule.
  • the disclosure provides methods of using the single RNA molecule, vectors, compositions and cells of the disclosure to treat a disease or disorder.
  • the RNA donor molecule comprises a esnRNA domain.
  • An example is depicted in FIGURE 3B.
  • an RNA donor molecule comprising at least four domains.
  • the RNA donor molecule comprises a Replacement Domain.
  • the Replacement Domain may be inserted into a Target RNA molecule via a trans-splicing reaction.
  • the RNA donor molecule comprises an Antisense Domain, which is complementary to a Target RNA.
  • the RNA donor molecule comprises an Intronic Domain, which promotes the trans-splicing reaction between the RNA donor molecule and the Target RNA.
  • the RNA donor molecule comprises a esnRNA domain, which is isolated or derived from a human small nuclear RNA gene.
  • RNA donor molecule comprising (a) at least one domain that promotes trans-splicing (“Intronic Domain”), (b) at least one binding domain (“Antisense Domain”) that contains or consists of a sequence complementary to a pre-mRNA present in a human cells (“Target RNA”), (c) a coding domain that is inserted into the Target RNA via trans-splicing (“Replacement Domain”), and (d) engineered small nuclear RNA (“esnRNA”) domain which comprises an esnRNA sequence.
  • RNA donor molecule comprising (a) at least one domain that promotes trans-splicing (“Intronic Domain”), (b) at least one binding domain (“Antisense Domain”) that contains or consists of a sequence complementary to a pre-mRNA present in a human cells (“Target RNA”), (c) a coding domain that is inserted into the Target RNA via trans-splicing (“Replacement Domain”), and (d) engineered small nuclear RNA (“esnRNA”) domain
  • the esnRNA domain recruits spliceosome components which promotes trans-splicing among the RNA donor molecule and the Target RNA, therefore inserting the RNA donor molecule sequence into the Target RNA.
  • the present disclosure provides a composition comprising a nucleic acid sequence encoding RNA donor molecule. esnRNA molecules and domains
  • the methods and compositions described herein comprise an esnRNA molecule comprising an esrRNA domain. In some embodiments, the methods and compositions described herein comprise a RNA donor molecule comprising an esRNA domain. In some embodiments, the esnRNA domain is derived or isolated from a human small nuclear RNA gene is chosen from a group consisting of: Ul, U2, U4, U5, U6, U7, U11, and U12.
  • compositions comprising esnRNA molecules and esnRNA domains disclosed herein include any sequences that are derived or isolated from human small nuclear RNA genes.
  • Small nuclear RNA genes include without limitation: Ul, U2, U4, U5, U6, U7, Ul 1, and U12.
  • the esnRNA molecule may contain sequences that are complementary to the RNA donor molecule. This complementary sequence may be located at or near the 5’ end of the esnRNA molecule.
  • the trans-splicing enhancer sequences include without limitation: 5’-CGAGCUCUCU -3’, 5’-AACGAGCUCU -3’, 5’-CGCAACGAGC-3’, 5’- UAUCGCAACG-3’, 5’-AAUAAUAUCG-3’, 5’-UAAGAGAGCU-3’, 5’-AAGAGAGCUC-3’, 5’-AGAGAGCUCGUUGC-3’, 5’-GAGAGCUCGU-3’, 5’-AGAGCUCGUUGCGA-3’, and 5’- GAGCUCGUUG-3’.
  • the esnRNA domain contains one or more stem-loop forming RNA sequences derived or isolated from a human small nuclear RNA gene.
  • such an esnRNA domain has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to its corresponding wild-type or originating sequence.
  • such an esnRNA domain has at most about 80%, at most about 85%, at most about 90%, at most about 91%, at most about 92%, at most about 93%, at most about 94%, at most about 95%, at most about 96%, at most about 97%, at most about 98%, at most about 99%, or 100% sequence identity to its corresponding wild-type or originating sequence.
  • the esnRNA molecule or esnRNA domain is not derived from any living organism and is composed of a synthetic sequence that binds spliceosomal proteins. [0031] In some embodiments, esnRNA domain is located at least about 1 nucleotide distant from the Replacement Domain.
  • the esnRNA domain is located at least about 2 nucleotides, at least about 3 nucleotides, at least about 4 nucleotides, at least about 5 nucleotides, at least about 6 nucleotides, at least about 7 nucleotides, at least about 8 nucleotides, at least about 9 nucleotides, at least about 10 nucleotides, at least about 11 nucleotides, at least about 12 nucleotides, at least about 13 nucleotides, at least about 14 nucleotides, at least about 15 nucleotides, at least about 16 nucleotides, at least about 17 nucleotides, at least about 18 nucleotides, at least about 19 nucleotides, at least about 20 nucleotides, at least about 21 nucleotides, at least about 22 nucleotides, at least about 23 nucleotides, at least about 24 nucleotides, at least about 25 nucleotides, at least about 20 nu
  • the esnRNA domain is located at most about 2 nucleotides, at most about 3 nucleotides, at most about 4 nucleotides, at most about 5 nucleotides, at most about 6 nucleotides, at most about 7 nucleotides, at most about 8 nucleotides, at most about 9 nucleotides, at most about 10 nucleotides, at most about 11 nucleotides, at most about 12 nucleotides, at most about 13 nucleotides, at most about 14 nucleotides, at most about 15 nucleotides, at most about 16 nucleotides, at most about 17 nucleotides, at most about 18 nucleotides, at most about 19 nucleotides, at most about 20 nucleotides, at most about 21 nucleotides, at most about 22 nucleotides, at most about 23 nucleotides, at most about 24 nucleotides, at most about 25 nucleotides, at most about 20 nu
  • compositions of the disclosure there may be an esnRNA sequence that promotes trans-splicing.
  • esnRNA is derived or isolated from the human U1 snRNA gene.
  • sequences esnRNA is derived or isolated from a U1 snRNA variant.
  • the U1 snRNA variant is selected from the list consisting of (name followed by genomic location in brackets according to UCSC human genome assembly 2006): tUl.
  • the sequences of the esnRNA comprise or consist of (esnRNA 1): CGAGCTCTCTgCAGGGGAAAGCGCGAACGCAGTACCACTACCACAAATTATGCAAT CGAGTTTCCCACATTTGGGGAAATCGCAGGGGTCAACACATCTGGAGTGCAATGGA TAAGCCTCGCCCTGGGAAAACCACCTTCGTGATCATGTTATCTCCCCTG
  • the sequences of the esnRNA comprise or consist of (esnRNA 2): CGAGCTCTCTgTCCAGGGGAAAGCACAAACAGTTCCCCACTGCCACAAATTATGTAG TCGAGATTCCCTCATTTGGGGAAATCACAGGGGTCAGCACATCCAGAGTAAAATTG CTAAGCCTTGCCCTGGAAAAACCACCTTCGTGATCATAACATTTCTTCTG
  • the sequences of the esnRNA comprise or consist of (esnRNA 3): CGAGCTCTCTgCAGGGAAAAACACAGACACAGTTCCCCACTGCCACAAATTATGTAA TCAAGATTCCCACATTCGGGGAAATCACAGGGGTCAGCACATCCACAGTAAAACTG CTAAGCCTTGCTCTGGAAAAACCACCTTCGTGATCATAACATTTCTTCTG
  • the sequences of the esnRNA comprise or consist of (esnRNA 4): CGAGCTCTCTgCAGGGGAAAGCGCGGACGCAGTCCCCCACTACCACAAATTATGCA GTCGAGTTTCCCACATTTGGGGAAATCGCAGGGGTCAGCACATCCGGAGTGCAATG GATAAGCCTCGCCCTGGGAAAACCACCTTCGTGATCATGGTATCTCCCCTG [0037]
  • the sequences of the esnRNA comprise or consist of (esnRNA 5):
  • sequences of the esnRNA comprise or consist of (esnRNA 6):
  • sequences of the esnRNA comprise or consist of (esnRNA 7):
  • sequences of the esnRNA comprise or consist of (esnRNA 8):
  • the sequences of the esnRNA comprise or consist of (esnRNA 9):
  • the sequences of the esnRNA comprise or consist of (esnRNA 10):
  • the sequences of the esnRNA comprise or consist of (esnRNA 11):
  • sequences of the esnRNA comprise or consist of (esnRNA 12):
  • sequences of the esnRNA comprise or consist of (esnRNA 13):
  • sequences of the esnRNA comprise or consist of (esnRNA 14):
  • sequences of the esnRNA comprise or consist of (esnRNA 15):
  • sequences of the esnRNA comprise or consist of (esnRNA 16):
  • sequences of the esnRNA comprise or consist of (esnRNA 17):
  • sequences of the esnRNA comprise or consist of (esnRNA 18):
  • sequences of the esnRNA comprise or consist of (esnRNA 19):
  • sequences of the esnRNA comprise or consist of (esnRNA 20):
  • sequences of the esnRNA comprise or consist of (esnRNA 21):
  • sequences of the esnRNA comprise or consist of (esnRNA 22):
  • sequences of the esnRNA comprise or consist of (esnRNA 23):
  • sequences of the esnRNA comprise or consist of (esnRNA 24): CGAGCTCTCTgcagggGAAAGCGCGAACGCAGTCCCCTACTATCACcagggcgaggcttatccatt gcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcc cctg
  • sequences of the esnRNA comprise or consist of (esnRNA 25):
  • sequences of the esnRNA comprise or consist of (esnRNA 26):
  • sequences of the esnRNA comprise or consist of (esnRNA 27):
  • sequences of the esnRNA comprise or consist of (esnRNA 28):
  • sequences of the esnRNA comprise or consist of (esnRNA 29):
  • sequences of the esnRNA comprise or consist of (esnRNA 30):
  • the sequences of the esnRNA comprise or consist of (esnRNA 31):
  • sequences of the esnRNA comprise or consist of (esnRNA 32):
  • sequences of the esnRNA comprise or consist of (esnRNA 33):
  • sequences of the esnRNA comprise or consist of (esnRNA 34):
  • sequences of the esnRNA comprise or consist of (esnRNA 35):
  • sequences of the esnRNA comprise or consist of (esnRNA 36):
  • sequences of the esnRNA comprise or consist of (esnRNA 37):
  • CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttccAAGTTATGCAGTCGAGTTCCTC ACATTGGGGGAAAATGGCAGGGcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgc gttcgcgctttccctg
  • sequences of the esnRNA comprise or consist of (esnRNA 38):
  • sequences of the esnRNA comprise or consist of (esnRNA 39):
  • sequences of the esnRNA comprise or consist of (esnRNA 41):
  • sequences of the esnRNA comprise or consist of (esnRNA 42):
  • sequences of the esnRNA comprise or consist of (esnRNA 44):
  • sequences of the esnRNA comprise or consist of (esnRNA 46):
  • sequences of the esnRNA comprise or consist of (esnRNA 47): CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgct gacccctgTCAGCACATCCGGAGTGCAATGGATAactgcataatttgtggtagtgggggactgcgttcgcgctttccccctg
  • sequences of the esnRNA comprise or consist of (esnRNA 48):
  • sequences of the esnRNA comprise or consist of (esnRNA 49):
  • sequences of the esnRNA comprise or consist of (esnRNA 51):
  • sequences of the esnRNA comprise or consist of (esnRNA 52):
  • sequences of the esnRNA comprise or consist of (esnRNA 53):
  • sequences of the esnRNA comprise or consist of (esnRNA 54):
  • the sequences of the esnRNA comprise or consist of (esnRNA 55):
  • sequences of the esnRNA comprise or consist of (esnRNA 56):
  • sequences of the esnRNA comprise or consist of (esnRNA 57):
  • sequences of the esnRNA comprise or consist of (esnRNA 58):
  • the sequences of the esnRNA comprise or consist of (esnRNA 59):
  • sequences of the esnRNA comprise or consist of (esnRNA 60):
  • sequences of the esnRNA comprise or consist of (esnRNA 61):
  • an Antisense Domain of the disclosure binds to a target sequence. In some embodiments of the disclosure, an Antisense Domain of the disclosure binds to a target RNA.
  • the Antisense Domain is chosen so that successful trans-splicing causes removal of micro open reading frames in the Target RNA. In this manner, the trans-splicing system removes micro open reading frames and increases the production of protein from the target RNA.
  • the sequence comprising the Antisense Domain has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or any percentage in between of complementarity to the Target RNA sequence.
  • the sequence comprising the Antisense Domain has at most about 50%, at most about 55%, at most about 60%, at most about 65%, at most about 70%, at most about 75%, at most about 80%, at most about 87%, at most about 90%, at most about 91%, at most about 92%, at most about 93%, at most about 94%, at most about 95%, at most about 96%, at most about 97%, at most about 98%, at most about 99% or any percentage in between of complementarity to the Target RNA sequence.
  • the Antisense Domain has 100% complementarity to the Target RNA sequence.
  • the Antisense Domain comprises or consists of at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 60 nucleotides, at least about 70 nucleotides, at least about 80 nucleotides, at least about 90 nucleotides, at least about 100 nucleotides, at least about 110 nucleotides, at least about 120 nucleotides, at least about 130 nucleotides, at least about 140 nucleotides, at least about 150 nucleotides, at least about 160 nucleotides, at least about 170 nucleotides, at least about 180 nucleotides, at least about 190 nucleotides, at least about 200 nucleotides, at least about 210 nucleotides, at least about 220 nucleotides, at least about 230 nucleotides, at least about 240 nucleotides, at least about 250
  • the Antisense Domain comprises or consists of at most about 20 nucleotides, at most about 30 nucleotides, at most about 40 nucleotides, at most about 50 nucleotides, at most about 60 nucleotides, at most about 70 nucleotides, at most about 80 nucleotides, at most about 90 nucleotides, at most about 100 nucleotides, at most about 110 nucleotides, at most about 120 nucleotides, at most about 130 nucleotides, at most about 140 nucleotides, at most about 150 nucleotides, at most about 160 nucleotides, at most about 170 nucleotides, at most about 180 nucleotides, at most about 190 nucleotides, at most about 200 nucleotides, at most about 210 nucleotides, at most about 220 nucleotides, at most about 230 nucleotides, at most about 240 nucleotides, at most about 250
  • the target sequence comprises or consists of at least about 5 nucleotides, at least about 10 nucleotides, at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 45 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, at least about 100 nucleotides, at least about 125 nucleotides, at least about 150 nucleotides, at least about 175 nucleo
  • the target sequence comprises or consists of at most about 5 nucleotides, at most about 10 nucleotides, at most about 15 nucleotides, at most about 20 nucleotides, at most about 25 nucleotides, at most about 30 nucleotides, at most about 35 nucleotides, at most about 40 nucleotides, at most about 45 nucleotides, at most about 50 nucleotides, at most about 55 nucleotides, at most about 60 nucleotides, at most about 65 nucleotides, at most about 70 nucleotides, at most about 75 nucleotides, at most about 80 nucleotides, at most about 85 nucleotides, at most about 90 nucleotides, at most about 95 nucleotides, at most about 100 nucleotides, at most about 125 nucleotides, at most about 150 nucleotides, at most about 175 nucleotides, at most about 200 nucleotides,
  • the target sequence comprises or consists of between about 5 and about 500 nucleotides. In some embodiments, the target sequence comprises or consists of between about 50 and about 250 nucleotides. In some embodiments, the target sequence comprises or consists of between about 5 and about 50 nucleotides.
  • a pathogenic RNA molecule is a target RNA.
  • the target RNA comprises a target sequence that is complementary to an antisense domain of the trans-splicing RNA of the disclosure.
  • a target sequence is contained within a single contiguous stretch of the target RNA.
  • the target sequence may consist of comprise of one or more nucleotides that are not spread among a single contiguous stretch of the target RNA.
  • the Antisense Domain is complementary to a gene (corresponding accession numbers in brackets, corresponding disease in parentheses) that encodes a Target RNA that sometimes carry disease-causing mutations and is selected from the group consisting of: TNFRSF13B [ENSG00000240505] (common variable immune deficiency); ADA, CECR1 [ENSG00000196839, ENSG00000093072] (Adenosine deaminase deficiency); IL2RG [ENSG00000147168] (X-linked severe combined immunodeficiency); HBB [ENSG00000244734] (Beta-thassalemia); HBA1, HBA2 [ENSG00000206172, ENSG00000188536] (alpha-thassalemia); U2AF1 [ENSG00000160201] (myelodysplastic syndrome); SOD1, TARDBP, FUS, MATR3, SOD1, C9ORF72 [ENSG
  • the methods and compositions described herein comprise an RNA donor molecule comprising a Replacement Domain.
  • the Replacement domain is derived or isolated from the Target RNA.
  • the Replacement Domain is comprised of sequence derived or isolated from a human gene.
  • the sequence comprising the Replacement Domain has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 87%, at least about 90%, at least about 95%, at least about 97%, at least about 99% or any percentage in between of identity with a human gene.
  • the sequence comprising the Replacement Domain has at most about 50%, at most about 55%, at most about 60%, at most about 65%, at most about 70%, at most about 75%, at most about 80%, at most about 87%, at most about 90%, at most about 95%, at most about 97%, at most about 99% or any percentage in between of identity with a human gene.
  • the Replacement Domain has 100% identity with a sequence derived or isolated from a human gene.
  • the Replacement Domain comprises or consists of at least about 2 nucleotides, at least about 5 nucleotides, at least about 10 nucleotides, at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 60 nucleotides, at least about 70 nucleotides, at least about 80 nucleotides, at least about 90 nucleotides, at least about 100 nucleotides, at least about 110 nucleotides, at least about 120 nucleotides, at least about 130 nucleotides, at least about 140 nucleotides, at least about 150 nucleotides, at least about 160 nucleotides, at least about 170 nucleotides, at least about 180 nucleotides, at least about 190 nucleotides, at least about 200 nucleotides, at least about 210 nucleotides, at least about 220 nucleot
  • the Replacement Domain comprises or consists of at most about 2 nucleotides, at most about 5 nucleotides, at most about 10 nucleotides, at most about 20 nucleotides, at most about 30 nucleotides, at most about 40 nucleotides, at most about 50 nucleotides, at most about 60 nucleotides, at most about 70 nucleotides, at most about 80 nucleotides, at most about 90 nucleotides, at most about 100 nucleotides, at most about 110 nucleotides, at most about 120 nucleotides, at most about 130 nucleotides, at most about 140 nucleotides, at most about 150 nucleotides, at most about 160 nucleotides, at most about 170 nucleotides, at most about 180 nucleotides, at most about 190 nucleotides, at most about 200 nucleotides, at most about 210 nucleotides, at most about 220 nucleot
  • compositions comprising replacement domains disclosed herein include any strategies where replacement or insertion of RNA sequences could be an effective therapy.
  • replacement domains include without limitation sequences derived or isolated from the following genes (with gene accession IDs in brackets and associated diseases in parentheses) such as TNFRSF13B [ENSG00000240505] (common variable immune deficiency); ADA, CECR1 [ENSG00000196839, ENSG00000093072] (Adenosine deaminase deficiency); IL2RG [ENSG00000147168] (X-linked severe combined immunodeficiency); HBB [ENSG00000244734] (Beta-thassalemia); HBA1, HBA2 [ENSG00000206172, ENSG00000188536] (alpha-thassalemia); U2AF1 [ENSG00000160201] (myelodysplastic syndrome); SOD1, TARDBP, FUS, MATR3, SOD
  • [ENSG00000170266] (GM1 gangliosidosis); GBA [ENSG00000177628] (Gaucher disease); GM2A [ENSG00000196743] (GM2 gangliosidosis); UBE3A [ENSG00000114062] (Angelman syndrome); SLC2A1 [ENSG00000117394] (glucose transporter deficiency type 1); LAMP2 [ENSG00000005893] (Danon disease); GLA [ENSG00000102393] (Fabry disease); PKD1, PKD2 [ENSG00000008710, ENSG00000118762] (Autosomal dominant polycystic kidney disease); GAA [ENSG00000171298] (Pompe disease); PCSK9, LDLR, APOB, APOE [ENSG00000169174, ENSG00000130164, ENSG00000084674, ENSG00000130203] (Familial hypercholesterolemia);
  • the replacement domain is codon optimized.
  • Replacement Domains can comprise sequences derived from other organisms in order to alter the stability, translation, processing, or localization of a target RNA.
  • the RNA donor molecule described herein comprises an Intronic Domain.
  • the Intronic Domains carry binding sites that are preferentially- targeted by RNA-binding proteins with disease-causing mutations.
  • the dissociation constant of these mutated RNA-binding proteins and the Intronic Domain is lower than the dissociation constant of the non-mutated RNA-binding protein and the Intronic Domain.
  • the esnRNA molecule described herein contains an RNA motif that is complementary to the RNA donor molecule. In some embodiments of the compositions of the disclosure, the RNA motif begins at the 5’ end of the esnRNA molecule.
  • the esnRNA molecule contains an RNA motif that is complementary to the RNA donor molecule that is at least about 1 nucleotide, at least about 2 nucleotides, at least about 3 nucleotides, at least about 4 nucleotides, at least about 5 nucleotides, at least about 6 nucleotides, at least about 7 nucleotides, at least about 8 nucleotides, at least about 9 nucleotides, at least about 10 nucleotides, at least about 11 nucleotides, at least about 12 nucleotides, at least about 13 nucleotides, at least about 14 nucleotides, at least about 15 nucleotides, at least about 16 nucleotides, at least about 17 nucleotides, at least about 18 nucleotides, at least about 19 nucleotides, at least about 20 nucleotides, at least about 21 nucleotides, at least about 22 nucleotides, at
  • the RNA motif is at most about 1 nucleotide, at most about 2 nucleotides, at most about 3 nucleotides, at most about 4 nucleotides, at most about 5 nucleotides, at most about 6 nucleotides, at most about 7 nucleotides, at most about 8 nucleotides, at most about 9 nucleotides, at most about 10 nucleotides, at most about 11 nucleotides, at most about 12 nucleotides, at most about 13 nucleotides, at most about 14 nucleotides, at most about 15 nucleotides, at most about 16 nucleotides, at most about 17 nucleotides, at most about 18 nucleotides, at most about 19 nucleotides, at most about 20 nucleotides, at most about 21 nucleotides, at most about 22 nucleotides, at most about 23 nucleotides, at most about 24 nucleotides, at most about 25 nucleotides
  • the esnRNA molecule contains an RNA motif that is complementary to the RNA donor molecule and is selected from the group consisting of: 5’- CGAGCTCTCT -3’, 5’-AACGAGCTCT -3’, 5’-CGCAACGAGC-3’, 5’-TATCGCAACG-3’, 5’-AATAATATCG-3’, 5’-TAAGAGAGCT-3’, 5’-AAGAGAGCTC-3’, 5’- AGAGAGCTCGTTGC-3’, 5’-GAGAGCTCGT-3’, 5’-AGAGCTCGTTGCGA-3’, and 5’- GAGCTCGTTG-3’.
  • the RNA motif comprises 5’-CGAGCTCTCT -3’. In some embodiments, the RNA motif comprises 5’-AACGAGCTCT -3’. In some embodiments, the RNA motif comprises 5’-CGCAACGAGC-3’. In some embodiments, the RNA motif comprises 5’-TATCGCAACG-3’. In some embodiments, the RNA motif comprises5’- AATAATATCG-3’. In some embodiments, the RNA motif comprises 5’-TAAGAGCT-3’. In some embodiments, the RNA motif comprises 5’-AAGAGAGCTC-3’. In some embodiments, the RNA motif comprises 5’-AGAGAGCTCGTTGC-3’.
  • the RNA motif comprises 5’-GAGAGCTCGT-3’. In some embodiments, the RNA motif comprises 5’- AGAGCTCGTTGCGA-3’. In some embodiments, the RNA motif comprises 5’- GAGCTCGTTG-3’.
  • the esnRNA molecule contains an RNA motif that is complementary to the RNA donor molecule that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or any percentage in between of complementarity to the RNA donor molecule.
  • the RNA motif is at most about 50%, at most about 55%, at most about 60%, at most about 65%, at most about 70%, at most about 75%, at most about 80%, at most about 87%, at most about 90%, at most about 91%, at most about 92%, at most about 93%, at most about 94%, at most about 95%, at most about 96%, at most about 97%, at most about 98%, at most about 99% or any percentage in between of complementarity to the RNA donor molecule.
  • the RNA motif is 100% complementary to the RNA donor molecule.
  • the esnRNA molecule and RNA donor molecule form a complex called the esnRNA-donor complex.
  • the esnRNA-donor complex associates with a target RNA via base pairing.
  • the RNA donor molecule further comprises a 5’ untranslated region.
  • the 5’ untranslated region increases the stability of the RNA donor molecule.
  • the 5’ untranslated region reduces the stability of the RNA donor molecule.
  • the 5’ untranslated region alters the localization of the RNA donor molecule.
  • the 5’ untranslated region alters the processing of the RNA donor molecule.
  • the RNA donor molecule further comprises a 3' untranslated region.
  • the 3' untranslated region increases the stability of the RNA donor molecule.
  • the 3' untranslated region reduces the stability of the RNA donor molecule.
  • the 3' untranslated region alters the localization of the RNA donor molecule.
  • the 3' untranslated region alters the processing of the RNA donor molecule.
  • the RNA donor molecule or esnRNA is RNA, DNA, a DNA/RNA hybrid, and/or comprises at least one of a nucleic acid analog, a chemically-modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs.
  • nucleic acid analog refers to a compound having structural similarity to a canonical purine or pyrimidine base occurring in DNA or RNA.
  • the nucleic acid analog may contain a modified sugar and/or a modified nucleobase, as compared to a purine or pyrimidine base occurring naturally in DNA or RNA.
  • the nucleic acid analog is a 2’- deoxyribonucleoside, 2’ -ribonucleoside, 2’-deoxyribonucleotide or a 2 ’-ribonucleotide, wherein the nucleobase includes a modified base (such as, for example, xanthine, uridine, oxanine (oxanosine), 7-methlguanosine, dihydrouridine, 5-methylcytidine, C3 spacer, 5-methyl dC, 5- hydroxybutynl -2’ -deoxyuridine, 5-nitroindole, 5-methyl iso-deoxy cytosine, iso deoxyguanosine, deoxyuradine, iso deoxy cytidine, other 0-1 purine analogs, N-6-hydroxylaminopurine, nebularine, 7-deaza hypoxanthine, other 7-deazapurines, and 2-methyl purines).
  • a modified base such as, for
  • the nucleic acid analog may be selected from the group consisting of inosine, 7- deaza-2’-deoxyinosine, 2’-aza-2’-deoxyinosine, PNA-inosine, morpholino-inosine, LNA- inosine, phosphoramidate-inosine, 2’-O-methoxyethyl-inosine, and 2’-OMe-inosine.
  • the nucleic acid analog is a nucleic acid mimic (such as, for example, artificial nucleic acids and xeno nucleic acids (XNA).
  • nucleic acid sequences encoding the RNA donor molecule and esnRNA molecule disclosed herein for use in gene transfer and expression techniques described herein. It should be understood, although not always explicitly stated that the sequences provided herein can be used to provide the expression product as well as substantially identical sequences that produce a protein that has the same biological properties. These “biologically equivalent” or “biologically active” or “equivalent” polypeptides are encoded by equivalent polynucleotides as described herein.
  • nucleic acid sequences may be compared using sequence identity methods run under default conditions. Specific sequences are provided as examples of particular embodiments. Additionally, an equivalent polynucleotide is one that hybridizes under stringent conditions to the reference polynucleotide or its complement.
  • the nucleic acid sequences may be codon-optimized. Codon optimization refers to the fact that different cells differ in their usage of particular codons. This codon bias corresponds to a bias in the relative abundance of particular tRNAs in the cell type. By altering the codons in the sequence to match with the relative abundance of corresponding tRNAs, it is possible to increase expression. It is also possible to decrease expression by deliberately choosing codons for which the corresponding tRNAs are rare in a particular cell type. Codon usage tables may be used for mammalian cells, as well as for a variety of other organisms.
  • nucleic acid sequences coding for various replacement domains can be generated.
  • such a sequence is optimized for expression in a host or target cell, such as a host cell used to express the RNA donor molecule containing a replacement domain in which the disclosed methods are practiced (such as in a mammalian cell, e.g., a human cell).
  • Codon preferences and codon usage tables for a particular species can be used to engineer isolated nucleic acid molecules encoding a replacement domain (such as one encoding a protein having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to its corresponding wild-type protein) that takes advantage of the codon usage preferences of that particular species.
  • the replacement domains disclosed herein can be designed to have codons that are preferentially used by a particular organism of interest.
  • a replacement domain nucleic acid sequence is optimized for expression in human cells, such as one having at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to its corresponding wild-type or originating nucleic acid sequence.
  • an isolated RNA donor molecule encoding at least one replacement domain (which can be part of a vector) includes at least one replacement domain coding sequence that is codon optimized for expression in a eukaryotic cell, or at least one replacement domain coding sequence codon optimized for expression in a human cell.
  • a codon optimized replacement domain coding sequence has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to its corresponding wild-type or originating sequence.
  • a eukaryotic cell codon optimized nucleic acid sequence encodes a replacement domain having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least 9 about 2%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to its corresponding wild-type or originating protein.
  • a variety of clones containing functionally equivalent nucleic acids may be routinely generated, such as nucleic acids which differ in sequence but which encode the same replacement domain protein sequence.
  • Silent mutations in the coding sequence result from the degeneracy (i.e., redundancy) of the genetic code, whereby more than one codon can encode the same amino acid residue.
  • leucine can be encoded by CTT, CTC, CTA, CTG, TTA, or TTG
  • serine can be encoded by TCT, TCC, TCA, TCG, AGT, or AGC
  • asparagine can be encoded by AAT or AAC
  • aspartic acid can be encoded by GAT or GAC
  • cysteine can be encoded by TGT or TGC
  • alanine can be encoded by GCT, GCC, GCA, or GCG
  • glutamine can be encoded by CAA or CAG
  • tyrosine can be encoded by TAT or TAC
  • isoleucine can be encoded by ATT, ATC, or ATA. Tables showing the standard genetic code can be found in various sources (see, for example, Stryer, 1988, Biochemistry, 3. s
  • Hybridization refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues.
  • the hydrogen bonding may occur by Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific manner.
  • the complex may comprise two strands forming a duplex structure, three or more strands forming a multi -stranded complex, a single selfhybridizing strand, or any combination of these.
  • a hybridization reaction may constitute a step in a more extensive process, such as the initiation of a PC reaction, or the enzymatic cleavage of a polynucleotide by a ribozyme.
  • Examples of stringent hybridization conditions include: incubation temperatures of about 25°C to about 37°C; hybridization buffer concentrations of about 6x SSC to about lOx SSC; formamide concentrations of about 0% to about 25%; and wash solutions from about 4x SSC to about 8x SSC.
  • Examples of moderate hybridization conditions include: incubation temperatures of about 40°C to about 50°C; buffer concentrations of about 9x SSC to about 2x SSC; formamide concentrations of about 30% to about 50%; and wash solutions of about 5x SSC to about 2x SSC.
  • Examples of high stringency conditions include: incubation temperatures of about 55°C to about 68°C; buffer concentrations of about lx SSC to about O. lx SSC;
  • Homology refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An “unrelated” or “non- homologous” sequence shares less than 40% identity, or alternatively less than 25% identity, with one of the sequences described herein.
  • the sequence encoding the RNA donor molecule further comprises a sequence encoding a promoter capable of expressing the RNA donor molecule in a eukaryotic cell.
  • the sequence encoding the engineered small nuclear RNA molecule further comprises a sequence encoding a promoter capable of expressing the engineered small nuclear RNA molecule in a eukaryotic cell.
  • a vector of the disclosure is a viral vector.
  • the viral vector comprises a sequence isolated or derived from a retrovirus.
  • the viral vector comprises a sequence isolated or derived from a lentivirus.
  • the viral vector comprises a sequence isolated or derived from an adenovirus.
  • the viral vector comprises a sequence isolated or derived from an adeno-associated virus (AAV).
  • AAV adeno-associated virus
  • the viral vector is replication incompetent.
  • the viral vector is isolated or recombinant.
  • the viral vector is self-complementary.
  • the viral vector comprises a sequence isolated or derived from an adeno-associated virus (AAV).
  • AAV adeno-associated virus
  • the viral vector comprises an inverted terminal repeat sequence or a capsid sequence that is isolated or derived from an AAV of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 or AAV12.
  • the viral vector is replication incompetent.
  • the viral vector is isolated or recombinant (rAAV).
  • the viral vector is self-complementary (scAAV).
  • a vector of the disclosure is a non-viral vector.
  • the vector comprises or consists of a nanoparticle, a micelle, a liposome or lipoplex, a polymersome, a polyplex, an exosome or a dendrimer.
  • the vector is an expression vector or recombinant expression system.
  • the term “recombinant expression system” refers to a genetic construct for the expression of certain genetic material formed by recombination.
  • an expression vector, viral vector or non-viral vector provided herein includes without limitation, an expression control element.
  • expression control element refers to any sequence that regulates the expression of a coding sequence, such as a gene.
  • expression control elements include but are not limited to promoters, enhancers, microRNAs, post-transcriptional regulatory elements, polyadenylation signal sequences, 5’ or 3’ untranslated regions, and introns.
  • Expression control elements may be constitutive, inducible, repressible, or tissuespecific, for example.
  • a “promoter” is a control sequence that is a region of a polynucleotide sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind such as RNA polymerase and other transcription factors. In some embodiments, expression control by a promoter is tissuespecific.
  • Non-limiting examples of promoters include CMV, CBA, CAG, Cbh, EF-la, PGK, UBC, GUSB, UCOE, hAAT, TBG, Desmin, MCK, C5-12, NSE, Synapsin, PDGF, MecP2, CaMKII, mGluR2, NFL, NFH, np2, PPE, ENK, EAAT2, GFAP, MBP, Hl and U6 promoters.
  • the promoter is a sequence isolated or derived from a promoter capable of driving expression of a transfer RNA (tRNA).
  • the promoter is isolated or derived from an alanine tRNA promoter, an arginine tRNA promoter, an asparagine tRNA promoter, an aspartic acid tRNA promoter, a cysteine tRNA promoter, a glutamine tRNA promoter, a glutamic acid tRNA promoter, a glycine tRNA promoter, a histidine tRNA promoter, an isoleucine tRNA promoter, a leucine tRNA promoter, a lysine tRNA promoter, a methionine tRNA promoter, a phenylalanine tRNA promoter, a proline tRNA promoter, a serine tRNA promoter, a threonine tRNA promoter, a tryptophan tRNA promoter, a tyrosine tRNA promoter, or a valine tRNA promoter. In some embodiments, the promoter is isolated or
  • the eukaryotic cell is an animal cell.
  • the animal cell is a mammalian cell.
  • the animal cell is a human cell.
  • An “enhancer” is a region of DNA that can be bound by activating proteins to increase the likelihood or frequency of transcription.
  • enhancers and post-transcriptional regulatory elements include the CMV enhancer and WPRE.
  • an expression vector, viral vector or non-viral vector includes without limitation, vector elements such as an IRES or 2A peptide sites for configuration of “multi ci str onic” or “polycistronic” or “bicistronic” or tricistronic” constructs, i.e., having double or triple or multiple coding areas or exons, and as such will have the capability to express from mRNA two or more proteins from a single construct. Multi ci str onic vectors simultaneously express two or more separate proteins from the same mRNA.
  • an IRES refers to an internal ribosome entry site or portion thereof of viral, prokaryotic, or eukaryotic origin which are used within polycistronic vector constructs.
  • an IRES is an RNA element that allows for translation initiation in a capindependent manner.
  • self-cleaving peptides or “sequences encoding self-cleaving peptides” or “2A self-cleaving site” refer to linking sequences which are used within vector constructs to incorporate sites to promote ribosomal skipping and thus to generate two polypeptides from a single promoter, such self-cleaving peptides include without limitation, T2A, and P2A peptides or sequences encoding the self-cleaving peptides.
  • the vector is a viral vector.
  • the vector is an adenoviral vector, an adeno-associated viral (AAV) vector, or a lentiviral vector.
  • the vector is a retroviral vector, an adenoviral/retroviral chimera vector, a herpes simplex viral I or II vector, a parvoviral vector, a reticuloendotheliosis viral vector, a polioviral vector, a papillomaviral vector, a vaccinia viral vector, or any hybrid or chimeric vector incorporating favorable aspects of two or more viral vectors.
  • the vector further comprises one or more expression control elements operably linked to the polynucleotide. In some embodiments, the vector further comprises one or more selectable markers. In some embodiments, the AAV vector has low toxicity. In some embodiments, the AAV vector does not incorporate into the host genome, thereby having a low probability of causing insertional mutagenesis. In some embodiments, the AAV vector can encode a range of total polynucleotides from .3 kb to 4.75 kb.
  • examples of AAV vectors that may be used in any of the herein described compositions, systems, methods, and kits can include an AAV1 vector, a modified AAV1 vector, an AAV2 vector, a modified AAV2 vector, an AAV3 vector, a modified AAV3 vector, an AAV4 vector, a modified AAV4 vector, an AAV5 vector, a modified AAV5 vector, an AAV6 vector, a modified AAV6 vector, an AAV7 vector, a modified AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV.rhlO vector, a modified AAV.rhlO vector, an AAV.rh32/33 vector, a modified AAV.rh32/33 vector, an AAV.rh43 vector, a modified AAV.rh43 vector, an AAV.rh74 vector, a modified AAV.rh64Rl vector, and a modified AAV.rh64Rl vector and any
  • the lentiviral vector is an integrase-competent lentiviral vector (ICLV).
  • the lentiviral vector can refer to the transgene plasmid vector as well as the transgene plasmid vector in conjunction with related plasmids (e.g., a packaging plasmid, a rev expressing plasmid, an envelope plasmid) as well as a lentiviral-based particle capable of introducing exogenous nucleic acid into a cell through a viral or viral-like entry mechanism.
  • examples of lentiviral vectors that may be used in any of the herein described compositions, systems, methods, and kits can include a human immunodeficiency virus (HIV) 1 vector, a modified human immunodeficiency virus (HIV) 1 vector, a human immunodeficiency virus (HIV) 2 vector, a modified human immunodeficiency virus (HIV) 2 vector, a sooty mangabey simian immunodeficiency virus (SIVSM) vector, a modified sooty mangabey simian immunodeficiency virus (SIVSM) vector, a African green monkey simian immunodeficiency virus (SIVAGM) vector, a modified African green monkey simian immunodeficiency virus (SIVAGM) vector, an equine infectious anemia virus (EIAV) vector, a modified equine infectious anemia virus (EIAV) vector, a feline immunodeficiency virus (FIV) vector, a modified feline immunodefic
  • a vector comprises or encodes an RNA donor molecule and an esnRNA molecule. In some embodiments, the vector comprises or encodes at least RNA donor molecule and an esnRNA molecule. In some embodiments, the vector comprises or encodes one or more RNA donor molecule(s) and esnRNA molecule(s) of the disclosure. In some embodiments, the vector comprises or encodes two or more RNA donor molecules and esnRNA molecules of the disclosure. In some embodiments of the compositions and methods of the disclosure, a vector comprises or encodes an RNA donor molecule. In some embodiments, the vector comprises or encodes at least RNA donor molecule. In some embodiments, the vector comprises or encodes one or more RNA donor molecule(s). In some embodiments, the vector comprises or encodes two or more RNA donor molecules.
  • a vector of the disclosure is a viral vector.
  • the viral vector comprises a sequence isolated or derived from a retrovirus.
  • the viral vector comprises a sequence isolated or derived from a lentivirus.
  • the viral vector comprises a sequence isolated or derived from an adenovirus.
  • the viral vector comprises a sequence isolated or derived from an adeno-associated virus (AAV).
  • AAV adeno-associated virus
  • the viral vector is replication incompetent.
  • the viral vector is isolated or recombinant.
  • the viral vector is self-complementary.
  • the viral vector comprises a sequence isolated or derived from an adeno-associated virus (AAV).
  • AAV adeno-associated virus
  • the viral vector comprises an inverted terminal repeat sequence or a capsid sequence that is isolated or derived from an AAV of serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 or AAV12.
  • the viral vector is replication incompetent.
  • the viral vector is isolated or recombinant (rAAV).
  • the viral vector is self-complementary (scAAV).
  • a vector of the disclosure is a non-viral vector.
  • the vector comprises or consists of a nanoparticle, a micelle, a liposome or lipoplex, a polymersome, a polyplex or a dendrimer.
  • the vector is an expression vector or recombinant expression system.
  • the term“recombinant expression system” refers to a genetic construct for the expression of certain genetic material formed by recombination.
  • the liposome, lipoplex, or nanoparticle can further comprise a non-cationic lipid, a PEG conjugated lipid, a sterol, or any combination thereof.
  • the liposome, lipoplex, or nanoparticle further comprises a non-cationic lipid, wherein the non-ionic lipid is selected from the group consisting of distearoyl-sn-glycero- phosphoethanolamine, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N- maleimidomethyl)-cyclohexane- 1 - carboxylate (DSPC), dioleoy
  • the liposome, lipoplex, or nanoparticle further comprises a conjugated lipid, wherein the conjugated lipid, wherein the conjugated-lipid is selected from the group consisting of PEG-diacylglycerol (DAG) (such as l-(monomethoxy-polyethyleneglycol)- 2,3- dimyristoylglycerol (PEG-DMG)), PEG-di alkyl oxy propyl (DAA), PEG-phospholipid, PEG- ceramide (Cer), a pegylated phosphatidylethanoloamine (PEG-PE), PEG succinate diacylglycerol (PEGS-DAG) (such as 4-0-(2',3'-di(tetradecanoyloxy)propyl-l-0-(w- methoxy(polyethoxy)ethyl) butanedioate (PEG-S-DMG)), PEG dialkoxyprop
  • DAG PEG-d
  • the liposome, lipoplex, or nanoparticle further comprises cholesterol or a cholesterol derivative.
  • the liposome, lipoplex, or nanoparticle further comprises an ionizable lipid, a non-cationic lipid, a conjugated lipid that inhibits aggregation of particles, and a sterol.
  • the amount of the ionizable lipid, the non-cationic lipid, the conjugated lipid that inhibits aggregation of particles, and the sterol can be varied independently.
  • the lipid nanoparticle comprises an ionizable lipid in an amount from about 20 mol % to about 90 mol % of the total lipid present in the particle, a non-cationic lipid in an amount from about 5 mol % to about 30 mol % of the total lipid present in the particle, a conjugated lipid that inhibits aggregation of particles in an amount from about 0.5 mol % to about 20 mol % of the total lipid present in the particle, and a sterol in an amount from about 20 mol % to about 50 mol % of the total lipid present in the particle.
  • the ratio of total lipid to DNA vector can be varied as desired.
  • the total lipid to DNA vector (mass or weight) ratio can be from about 10: 1 to about 30: 1.
  • an expression vector, viral vector or non-viral vector provided herein includes without limitation, an expression control element.
  • An “expression control element” as used herein refers to any sequence that regulates the expression of a coding sequence, such as a gene. Examples of expression control elements include but are not limited to promoters, enhancers, microRNAs, post-transcriptional regulatory elements, polyadenylation signal sequences, and introns. Expression control elements may be constitutive, inducible, repressible, or tissue-specific, for example.
  • A“promoter” is a control sequence that is a region of a polynucleotide sequence at which initiation and rate of transcription are controlled.
  • RNA polymerase and other transcription factors may contain genetic elements at which regulatory proteins and molecules may bind such as RNA polymerase and other transcription factors.
  • expression control by a promoter is tissue-specific.
  • promoters include CMV, CBA, CAG, Cbh, EF-la, PGK, UBC, GUSB, UCOE, hAAT, TBG, Desmin, MCK, C5-12, NSE, Synapsin, PDGF, MecP2, CaMKII, mGluR2, NFL, NFH, nP2, PPE, ENK, EAAT2, GFAP, MBP, and U6 promoters.
  • An“ enhancer” is a region of DNA that can be bound by activating proteins to increase the likelihood or frequency of transcription.
  • enhancers and posttranscriptional regulatory elements include the CMV enhancer and WPRE.
  • a cell of the disclosure is a eukaryotic cell.
  • the cell is a mammalian cell.
  • the cell is a bovine, murine, feline, equine, porcine, canine, simian, or human cell.
  • the cell is a non-human mammalian cell such as a non-human primate cell.
  • a cell of the disclosure is a somatic cell.
  • a cell of the disclosure is a germline cell. In some embodiments, a germline cell of the disclosure is not a human cell.
  • a cell of the disclosure is a stem cell.
  • a cell of the disclosure is an embryonic stem cell.
  • an embryonic stem cell of the disclosure is not a human cell.
  • a cell of the disclosure is a multipotent stem cell or a pluripotent stem cell.
  • a cell of the disclosure is an adult stem cell.
  • a cell of the disclosure is an induced pluripotent stem cell (iPSC).
  • a cell of the disclosure is a hematopoietic stem cell (HSC).
  • an immune cell of the disclosure is a lymphocyte.
  • an immune cell of the disclosure is a T lymphocyte (also referred to herein as a T-cell).
  • T-cells of the disclosure include, but are not limited to, naive T cells, effector T cells, helper T cells, memory T cells, regulatory T cells (Tregs) and Gamma delta T cells.
  • an immune cell of the disclosure is a B lymphocyte.
  • an immune cell of the disclosure is a natural killer cell.
  • an immune cell of the disclosure is an antigen- presenting cell.
  • a muscle cell of the disclosure is a myoblast or a myocyte.
  • a muscle cell of the disclosure is a cardiac muscle cell, skeletal muscle cell or smooth muscle cell.
  • a muscle cell of the disclosure is a striated cell.
  • a somatic cell of the disclosure is an epithelial cell.
  • an epithelial cell of the disclosure forms a squamous cell epithelium, a cuboidal cell epithelium, a columnar cell epithelium, a stratified cell epithelium, a pseudostratified columnar cell epithelium or a transitional cell epithelium.
  • an epithelial cell of the disclosure forms a gland including, but not limited to, a pineal gland, a thymus gland, a pituitary gland, a thyroid gland, an adrenal gland, an apocrine gland, a holocrine gland, a merocrine gland, a serous gland, a mucous gland and a sebaceous gland.
  • an epithelial cell of the disclosure contacts an outer surface of an organ including, but not limited to, a lung, a spleen, a stomach, a pancreas, a bladder, an intestine, a kidney, a gallbladder, a liver, a larynx or a pharynx.
  • an epithelial cell of the disclosure contacts an outer surface of a blood vessel or a vein.
  • a brain cell of the disclosure is a neuronal cell.
  • a neuron cell of the disclosure is a neuron of the central nervous system.
  • a neuron cell of the disclosure is a neuron of the brain or the spinal cord.
  • a neuron cell of the disclosure is a neuron of a cranial nerve or an optic nerve.
  • a neuron cell of the disclosure is a neuron of the peripheral nervous system.
  • a neuron cell of the disclosure is a neuroglial or a glial cell.
  • a glial of the disclosure is a glial cell of the central nervous system including, but not limited to, oligodendrocytes, astrocytes, ependymal cells, and microglia.
  • a glial of the disclosure is a glial cell of the peripheral nervous system including, but not limited to, Schwann cells and satellite cells.
  • a liver cell of the disclosure is a hepatocytes.
  • a liver cell of the disclosure is a hepatic stellate cell.
  • a liver cell of the disclosure is a Kupffer cell.
  • a liver cell of the disclosure is a sinusoidal endothelial cells.
  • a retinal cell of the disclosure is a photoreceptor.
  • a photoreceptor cell of the disclosure is a rod.
  • a retinal cell of the disclosure is a cone.
  • a retinal cell of the disclosure is a bipolar cell.
  • a retinal cell of the disclosure is a ganglion cell.
  • a retinal cell of the disclosure is a horizontal cell.
  • a retinal cell of the disclosure is an amacrine cell.
  • a heart cell of the disclosure is a cardiomyocyte. In some embodiments, a heart cell of the disclosure is a cardiac pacemaker cell.
  • a somatic cell of the disclosure is a primary cell.
  • a somatic cell of the disclosure is a cultured cell.
  • a somatic cell of the disclosure is in vivo, in vitro, ex vivo or in situ.
  • a somatic cell of the disclosure is autologous or allogeneic.
  • compositions comprising two RNA molecules (an RNA donor and an engineered small nuclear RNA or esnRNA) where the RNA donor selectively binds a target RNA molecule while the esnRNA binds the RNA donor molecule and promotes a trans-splicing reaction with the target RNA molecule.
  • RNA donor selectively binds a target RNA molecule while the esnRNA binds the RNA donor molecule and promotes a trans-splicing reaction with the target RNA molecule.
  • described herein is a non-natural esnRNA molecule that targets a non-natural RNA donor molecule that increases the recognition of the RNA donor molecule by the endogenous spliceosome.
  • the disclosure provides vectors, compositions and cells comprising or encoding the RNA donor molecule and the esnRNA molecule.
  • the disclosure provides methods of using the RNA donor molecule and the esnRNA molecule, vectors, compositions and cells of the disclosure to
  • the combination of a trans-splicing RNA donor molecule and a esnRNA that contacts the RNA donor molecule results in replacement of chosen sequences within a target RNA in a manner that is sufficiently efficient to replace diseasecausing RNA sequences in human cells to address disease.
  • the disclosure provides compositions and methods for targeting disease-causing RNA molecules in a sequencespecific manner and replacing disease-causing RNA sequences within these RNA molecules with high efficiency.
  • the RNA donor molecule and esnRNA implementations show utility in a variety of contexts including replacement of disease-causing sequences or insertion of engineered sequences into Target RNAs.
  • the engineered sequences can alter the translation or stability of Target RNAs to increase or decrease protein production or Target RNA levels.
  • this disclosure provides vectors, compositions and cells comprising or encoding RNA donor molecule and esnRNA molecule and methods of using the trans-splicing RNA compositions.
  • RNA donor molecule comprising four domains.
  • the combination of four domains in the RNA donor molecule results in replacement of chosen sequences within a target RNA in a manner that is sufficiently efficient to replace disease-causing RNA sequences in human cells to address disease.
  • the disclosure provides compositions and methods for targeting disease-causing RNA molecules in a sequence-specific manner and replacing disease-causing RNA sequences within this RNA molecules with high efficiency.
  • the RNA donor molecule implementations show utility in a variety of contexts including replacement of diseasecausing sequences or insertion of engineered sequences into Target RNAs.
  • the engineered sequences can alter the translation or stability of Target RNAs to increase or decrease protein production or Target RNA levels.
  • this disclosure provides vectors, compositions and cells comprising or encoding RNA donor molecule and methods of using the trans-splicing RNA compositions.
  • a esnRNA and RNA donor are used to correct a genetic disease as illustrated in FIGURES 1A-1C.
  • the RNA donor hybridizes to the target RNA carrying a mutation.
  • base pairing among the RNA donor and target RNA bring these molecule in close proximity.
  • b pairing among the esnRNA and the RNA donor brings spliceosome components in close proximity which promotes a trans-splicing reaction among the target RNA and the RNA donor.
  • the esnRNA contacts the RNA donor.
  • contacting the RNA donor with the esnRNA results in recruitment of spliceosome components.
  • trans-splicing occurs between the RNA donor molecule and the target RNA, resulting in a corrected target RNA with the RNA donor molecule replacing a chosen sequence in the target RNA.
  • the compositions described herein can edit internal sequences of a target RNA.
  • FIGURE 2A An example is depicted in FIGURE 2A.
  • a RNA donor and a esnRNA edit an internal sequence.
  • the compositions described herein can edit terminal portions of the target sequence.
  • FIGURE 2B An example is depicted in FIGURE 2B.
  • described herein is a method of modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule comprising contacting the composition and the RNA molecule under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or a portion thereof) to the RNA molecule.
  • the disclosure provides a method of modifying an activity of a protein encoded by an RNA molecule comprising contacting the composition and the RNA molecule under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or a portion thereof) to the RNA molecule.
  • the disclosure provides a method of modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95, or 100% efficiency comprising contacting the composition and the RNA molecule under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or a portion thereof) to the RNA molecule.
  • the methods comprise modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at most about 15%, at most about 20%, at most about 25%, at most about 30%, at most about 35%, at most about 40%, at most about 45%, at most about 50%, at most about 55%, at most about 60%, at most about 65%, at most about 70%, at most about 75%, at most about 80%, at most about 85%, at most about 90%, at most about 95, or 100% efficiency comprising contacting the composition and the RNA molecule under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or a portion thereof) to the RNA molecule.
  • the methods comprise modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 15% efficiency comprising contacting the composition and the RNA molecule under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or a portion thereof) to the RNA molecule. In some embodiments, the methods comprise modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 20% efficiency comprising contacting the composition and the RNA molecule under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or a portion thereof) to the RNA molecule.
  • the methods comprise modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 30% efficiency comprising contacting the composition and the RNA molecule under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or a portion thereof) to the RNA molecule. In some embodiments, the methods comprise modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 40% efficiency comprising contacting the composition and the RNA molecule under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or a portion thereof) to the RNA molecule.
  • the methods comprise modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 50% efficiency comprising contacting the composition and the RNA molecule under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or a portion thereof) to the RNA molecule. In some embodiments, the methods comprise modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 60% efficiency comprising contacting the composition and the RNA molecule under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or a portion thereof) to the RNA molecule.
  • the methods comprise modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 70% efficiency comprising contacting the composition and the RNA molecule under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or a portion thereof) to the RNA molecule. In some embodiments, the methods comprise modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 80% efficiency comprising contacting the composition and the RNA molecule under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or a portion thereof) to the RNA molecule.
  • the methods comprise modifying the sequence of an RNA molecule or a protein encoded by the RNA molecule with at least about 90% efficiency comprising contacting the composition and the RNA molecule under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or a portion thereof) to the RNA molecule.
  • the disclosure provides a method of modifying the sequence of an untranslated region of an RNA molecule comprising contacting the composition and the RNA molecule under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or a portion thereof) to the RNA molecule.
  • the disclosure provides a method of increasing the expression of an RNA by insertion of WPRE or sequences with similar activity comprising contacting the composition and the RNA molecule under conditions suitable for binding and trans-splicing of one or more of the RNA donor molecules (or a portion thereof) to the RNA molecule.
  • the disclosure provides a method of modifying the composition of a protein encoded by a target RNA comprising contacting the composition and a cell comprising the target RNA under conditions suitable for trans-splicing among the composition and the target RNA.
  • the disclosure provides a method of modifying the composition of a target RNA with efficiency at least about 20%, wherein 100% efficiency constitutes complete replacement of a chosen sequence within the target RNA comprising contacting the composition and a cell comprising the target RNA under conditions suitable for trans-splicing among the composition and the target RNA.
  • the efficiency is at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 89%, at least about %, at least about85%, at least about 90%, at least about 95%, or 100%.
  • the efficiency is at most about 20%, at most about 25%, at most about 30%, at most about 35%, at most about 40%, at most about 45%, at most about 50%, at most about 55%, at most about 60%, at most about 65%, at most about 70%, at most about 75%, at most about 89%, at most about %, at most about85%, at most about 90%, at most about 95%, or 100%.
  • the efficiency is at least about 20%.
  • the efficiency is at least about 40%.
  • the efficiency is at least about 60%.
  • the efficiency is at least about 70%.
  • the efficiency is at least about 80%.
  • the efficiency is at least about 90%.
  • the efficiency is about 100%.
  • the efficiency is at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 89%, at least about %, at least about85%, at least about 90%, at least about 95%, or 100%.
  • the efficiency is at most about 20%, at most about 25%, at most about 30%, at most about 35%, at most about 40%, at most about 45%, at most about 50%, at most about 55%, at most about 60%, at most about 65%, at most about 70%, at most about 75%, at most about 89%, at most about %, at most about85%, at most about 90%, at most about 95%, or 100%.
  • the efficiency is at least about 20%.
  • the efficiency is at least about 40%.
  • the efficiency is at least about 60%.
  • the efficiency is at least about 70%.
  • the efficiency is at least about 80%.
  • the efficiency is at least about 90%.
  • the efficiency is about 100%.
  • the disclosure provides a method of modifying the composition of a target RNA with high efficiency comprising contacting the composition and a cell comprising the target RNA under conditions suitable for trans-splicing among the composition and the target RNA.
  • the cell is in vivo, in vitro, ex vivo or in situ.
  • the composition comprises a vector comprising or encoding a RNA donor molecule of the disclosure.
  • the composition comprises a vector comprising or encoding an RNA donor molecule and an esnRNA of the disclosure.
  • the vector is an AAV.
  • the disclosure provides a method of modifying the composition of a protein encoded by a target RNA with high efficiency comprising contacting the composition and a cell comprising the target RNA under conditions suitable for trans-splicing among the composition and the target RNA.
  • the cell is in vivo, in vitro, ex vivo or in situ.
  • the composition comprises a vector comprising or encoding an RNA donor molecule of the disclosure.
  • the composition comprises a vector comprising or encoding an RNA donor molecule and an esnRNA molecule of the disclosure.
  • the vector is an AAV.
  • the disclosure provides a method of treating a disease or disorder comprising administering to a subject a therapeutically effective amount of a composition of the disclosure.
  • the disclosure provides a method of treating a disease or disorder comprising administering to a subject a therapeutically effective amount of a composition of the disclosure, wherein the composition comprises a vector comprising or encoding an RNA donor molecule of the disclosure, and wherein the composition modifies a level of expression of an RNA molecule of the disclosure or a protein encoded by the RNA molecule.
  • the disclosure provides a method of treating a disease or disorder comprising administering to a subject a therapeutically effective amount of a composition of the disclosure, wherein the composition comprises a vector comprising or encoding an RNA donor molecule and esnRNA molecule of the disclosure, and wherein the composition modifies a level of expression of an RNA molecule of the disclosure or a protein encoded by the RNA molecule.
  • the disclosure provides a method of treating a disease or disorder comprising administering to a subject a therapeutically effective amount of a composition of the disclosure, wherein the composition comprises a vector comprising or encoding an RNA donor molecule of the disclosure and wherein the composition modifies an activity of a protein encoded by an RNA molecule.
  • the disclosure provides a method of treating a disease or disorder comprising administering to a subject a therapeutically effective amount of a composition of the disclosure, wherein the composition comprises a vector comprising or encoding an RNA donor molecule and an esnRNA molecule of the disclosure and wherein the composition modifies an activity of a protein encoded by an RNA molecule.
  • a disease or disorder of the disclosure includes, but is not limited to, a genetic disease or disorder.
  • the genetic disease or disorder is a single-gene disease or disorder.
  • the single-gene disease or disorder is an autosomal dominant disease or disorder, an autosomal recessive disease or disorder, an X-chromosome linked (X-linked) disease or disorder, an X-linked dominant disease or disorder, an X-linked recessive disease or disorder, a Y-linked disease or disorder or a mitochondrial disease or disorder.
  • the singe-gene disease or disorder is, but not limited to, common variable immune deficiency, Adenosine deaminase deficiency, X-linked severe combined immunodeficiency, Beta- thassalemia, alpha-thassalemia, myelodysplastic syndrome, Amyotrophic lateral sclerosis, Frontotemporal dementia with parkinsonism, Usher’s syndrome, Krabbe disease, Niemann Pick disease, prion disease, Dravet syndrome, early-onset Parkinson’s disease, spinocerebellar ataxias, genetic epilepsy disorders, Ataxia-telangiectasia, GM1 gangliosidosis, Gaucher disease, GM2 gangliosidosis, Angelman syndrome, glucose transporter deficiency type 1, Danon disease, Fabry disease, Autosomal dominant polycystic kidney disease, Pompe disease, Familial hypercholesterolemia, Open Angle Glaucoma, Hurler syndrome or Mucopo
  • the genetic disease or disorder is a multiple-gene disease or disorder. In some embodiments, the genetic disease or disorder is a multiple-gene disease or disorder. In some embodiments, the single-gene disease or disorder is an autosomal dominant disease or disorder including, but not limited to, Huntington's disease, neurofibromatosis type 1, neurofibromatosis type 2, Marfan syndrome, hereditary nonpolyposis colorectal cancer, hereditary multiple exostoses, Von Willebrand disease, and acute intermittent porphyria.
  • the single-gene disease or disorder is an autosomal recessive disease or disorder including, but not limited to, Albinism, Medium-chain acyl-CoA dehydrogenase deficiency, cystic fibrosis, sickle-cell disease, Tay-Sachs disease, Niemann-Pick disease, spinal muscular atrophy, and Roberts syndrome.
  • the single-gene disease or disorder is X-linked disease or disorder including, but not limited to, muscular dystrophy, Duchenne muscular dystrophy, Hemophilia, Adrenoleukodystrophy (ALD), Rett syndrome, and Hemophilia A.
  • the single-gene disease or disorder is a mitochondrial disorder including, but not limited to, Leber's hereditary optic neuropathy.
  • a disease or disorder of the disclosure includes, but is not limited to, an immune disease or disorder.
  • the immune disease or disorder is an immunodeficiency disease or disorder including, but not limited to, B-cell deficiency, T-cell deficiency, neutropenia, asplenia, complement deficiency, acquired immunodeficiency syndrome (AIDS) and immunodeficiency due to medical intervention (immunosuppression as an intended or adverse effect of a medical therapy).
  • the immune disease or disorder is an autoimmune disease or disorder including, but not limited to, Achalasia, Addison’s disease, Adult Still's disease, Agammaglobulinemia, Alopecia areata, Amyloidosis, Anti-GBM/Anti-TBM nephritis, Antiphospholipid syndrome, Autoimmune angioedema, Autoimmune dysautonomia, Autoimmune encephalomyelitis, Autoimmune hepatitis, Autoimmune inner ear disease (AIED), Autoimmune myocarditis, Autoimmune oophoritis, Autoimmune orchitis, Autoimmune pancreatitis, Autoimmune retinopathy, Autoimmune urticaria, Axonal & neuronal neuropathy (AMAN), Balo disease, Behcet’s disease, Benign mucosal pemphigoid, Bullous pemphigoid, Castleman disease (CD), Celiac disease, Cha
  • a disease or disorder of the disclosure includes, but is not limited to, an inflammatory disease or disorder.
  • a disease or disorder of the disclosure includes, but is not limited to, a metabolic disease or disorder.
  • a disease or disorder of the disclosure includes, but is not limited to, a degenerative or a progressive disease or disorder.
  • the degenerative or a progressive disease or disorder includes, but is not limited to, amyotrophic lateral sclerosis (ALS), Huntington’s disease, Alzheimer’s disease, and aging.
  • a disease or disorder of the disclosure includes, but is not limited to, an infectious disease or disorder.
  • a disease or disorder of the disclosure includes, but is not limited to, a pediatric or a developmental disease or disorder.
  • a disease or disorder of the disclosure includes, but is not limited to, a cardiovascular disease or disorder.
  • a disease or disorder of the disclosure includes, but is not limited to, a proliferative disease or disorder.
  • the proliferative disease or disorder is a cancer.
  • the cancer includes, but is not limited to, Acute Lymphoblastic Leukemia (ALL), Acute Myeloid Leukemia (AML), Adrenocortical Carcinoma, AIDS-Related Cancers, Kaposi Sarcoma (Soft Tissue Sarcoma), AIDS-Related Lymphoma (Lymphoma), Primary CNS Lymphoma (Lymphoma), Anal Cancer, Appendix Cancer, Gastrointestinal Carcinoid Tumors, Astrocytomas, Atypical Teratoid/Rhabdoid Tumor, Central Nervous System (Brain Cancer), Basal Cell Carcinoma, Bile Duct Cancer, Bladder Cancer, Bone Cancer, Ewing Sarcoma, Osteosarcoma, Malignant
  • a disease or disorder of the disclosure includes, but is not limited to, a proliferative disease or disorder.
  • the proliferative disease or disorder is a cancer.
  • the cancer involves the present of a gene fusion that produces a chimeric RNA with sequences derived from two genes due to a deletion or translocation of DNA.
  • Gene fusions pairs include but are not limited to: MAN2A1 and FER, DNAJB1 and PRKACA, BCR-ABL1, TMPRSS2 and ERG , EWSR1 and FLU, PML and RARA, EML4 and ALK, KIAA1549 and BRAF, CCDC6 and RET, SS18 and SSX1, RUNX1 and RUNX1T1, PAX3 and FOXO1, NCOA4 and RET, ETV6 and RUNX1, FUS and DDIT3, SS18 and SSX2, NPM1 and ALK, KMT2A and AFF1, TCF3 and PBX1, STIL and TALI, COL1 Al and PDGFB, CRTC1 and MAML2, NAB2 and STAT6, EWSR1 and ATF1, ETV6 and NTRK3, EWSR1 and ERG, EWSR1 and WT1, DNAJB1 and PRKACA, PAX7 and FOXO1, FUS and CREB3L2, CBFA
  • the subject of the disclosure presents at least one sign or symptom of the disease or disorder.
  • the subject has a biomarker predictive of a risk of developing the disease or disorder.
  • the biomarker is a genetic mutation.
  • a subject of the disclosure is female. In some embodiments of the methods of the disclosure, a subject of the disclosure is male. In some embodiments, a subject of the disclosure has two XX or XY chromosomes. In some embodiments, a subject of the disclosure has two XX or XY chromosomes and a third chromosome, either an X or a Y.
  • a subject of the disclosure is a neonate, an infant, a child, an adult, a senior adult, or an elderly adult. In some embodiments of the methods of the disclosure, a subject of the disclosure is at least about 1 day, at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about 7 days, at least about 8 days, at least about 9 days, at least about 10 days, at least about 11 days, at least about 12 days, at least about 13 days, at least about 14 days, at least about 15 days, at least about 16 days, at least about 17 days, at least about 18 days, at least about 19 days, at least about 20 days, at least about 21 days, at least about 22 days, at least about 23 days, at least about 24 days, at least about 25 days, at least about 26 days, at least about 27 days, at least about 28 days, at least about 29 days, at least about 30 days, or at least about 31 days old.
  • a subject of the disclosure is at least about 1 months, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months old.
  • a subject of the disclosure is at least about 1 years, at least about 2 years, at least about 3 years, at least about 4 years, at least about 5 years, at least about 6 years, at least about 7 years, at least about 8 years, at least about 9 years, at least about 10 years, at least about 15 years, at least about 20 years, at least about 25 years, at least about 30 years, at least about 35 years, at least about 40 years, at least about 45 years, at least about 50 years, at least about 55 years, at least about 60 years, at least about 65 years, at least about 70 years, at least about 75 years, at least about 80 years, at least about 85 years, at least about 90 years, at least about 95 years, at least about 100 or any number of years or partial years in between of age.
  • a subject of the disclosure is a mammal. In some embodiments, a subject of the disclosure is a non-human mammal.
  • a subject of the disclosure is a human.
  • a therapeutically effective amount comprises a single dose of a composition of the disclosure. In some embodiments, a therapeutically effective amount comprises a therapeutically effective amount comprises at least one dose of a composition of the disclosure. In some embodiments, a therapeutically effective amount comprises a therapeutically effective amount comprises one or more dose(s) of a composition of the disclosure.
  • a therapeutically effective amount eliminates a sign or symptom of the disease or disorder. In some embodiments, a therapeutically effective amount reduces a severity of a sign or symptom of the disease or disorder.
  • a therapeutically effective amount eliminates the disease or disorder.
  • a therapeutically effective amount prevents an onset of a disease or disorder. In some embodiments, a therapeutically effective amount delays the onset of a disease or disorder. In some embodiments, a therapeutically effective amount reduces the severity of a sign or symptom of the disease or disorder. In some embodiments, a therapeutically effective amount improves a prognosis for the subject.
  • a composition of the disclosure is administered to the subject systemically.
  • the composition of the disclosure is administered to the subject by an intravenous route.
  • the composition of the disclosure is administered to the subject by an injection or an infusion.
  • a composition of the disclosure is administered to the subject locally.
  • the composition of the disclosure is administered to the subject by an intraosseous, intraocular, intracerebrospinal or intraspinal route.
  • the composition of the disclosure is administered directly to the cerebral spinal fluid of the central nervous system.
  • the composition of the disclosure is administered directly to a tissue or fluid of the eye and does not have bioavailability outside of ocular structures.
  • the composition of the disclosure is administered to the subject by an injection or an infusion.
  • the compositions comprising the RNA donor molecules disclosed herein are formulated as pharmaceutical compositions.
  • compositions for use as disclosed herein may comprise a fusion protein(s) or a polynucleotide encoding the fusion protein(s), optionally comprised in an AAV, which is optionally also immune orthogonal, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients.
  • compositions may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives.
  • buffers such as neutral buffered saline, phosphate buffered saline and the like
  • carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol
  • proteins polypeptides or amino acids
  • antioxidants e.g., antioxidants
  • chelating agents such as EDTA or glutathione
  • adjuvants e.g., aluminum hydroxide
  • preservatives e.g., aluminum hydroxide
  • a composition comprising an RNA donor molecule, comprising: (a) one or more replacement domains that encode a therapeutic sequence operably linked to; (b) one or more intronic domains that promote RNA splicing of the replacement domain; (c) one or more antisense domains that promote binding to a target RNA molecule, and (d) an engineered small nuclear RNA domain that promotes trans-splicing of the RNA donor molecule.
  • a composition comprising an engineered small nuclear RNA molecule and an RNA donor molecule, comprising: (a) one or more replacement domains that encode a therapeutic sequence operably linked to; (b) one or more intronic domains that promote RNA splicing of the replacement domain; and (c) one or more antisense domains that promote binding to a target RNA molecule.
  • composition of embodiment 2, wherein the engineered small RNA molecule contains a motif that is complementary to a sequence within the RNA donor molecule wherein the motif is one of the following sequences: 5’-CGAGCTCTCT -3’, 5’-AACGAGCTCT -3’, 5’-CGCAACGAGC-3’, 5’-TATCGCAACG-3’, 5’-AATAATATCG-3’, 5’- TAAGAGAGCT-3’, 5’-AAGAGAGCTC-3’, 5’-AGAGAGCTCGTTGC-3’, 5’- GAGAGCTCGT-3’, 5’-AGAGCTCGTTGCGA-3’, and 5’-GAGCTCGTTG-3’.
  • composition of embodiment 2 wherein the engineered small nuclear RNA molecule is composed of a sequence, starting the on the 5’ end, that is complementary to a sequence in the RNA donor molecule and is followed by a sequence derived or isolated from a human U1 gene.
  • composition of embodiment 2 wherein the engineered small nuclear RNA is composed of a sequence, starting the on the 5’ end, that is synthetic or derived or isolated from a human U1 gene, followed by a sequence that is complementary to a sequence in the RNA donor molecule, and is followed by another sequence derived or isolated from a human snRNA gene.
  • composition of embodiments 1-7 wherein the replacement domain is derived or isolated from a human gene selected from the group consisting of: GLB1 (GM1 gangliosidosis); GBA (Gaucher disease); GM2A (GM2 gangliosidosis); PCSK9, LDLR, APOB, APOE (Familial hypercholesterolemia); GAA (Pompe disease); MYOC, OPTN, TBK1, WDR36, CYPIB1 (Open Angle Glaucoma); IDS (Hunter syndrome or Mucopolysaccharidosis 2); IDUA (Hurler syndrome or Mucopolysaccharidosis 1); CLN3 (Batten disease); F9 (Hemophilia B); F8 (Hemophilia A), LAMP2 (Danon disease); GLA (Fabry disease); SLC2A1 (glucose transporter deficiency type 1); UBE3A (Angelman syndrome); MYOC, OPTN, TBK
  • WPRE Woodchuck Hepatitis Virus
  • WPRE Post-transcriptional Regulatory Element
  • MALAT1 the PRE of Hepatitis B virus
  • HPRE Hepatitis B virus
  • composition of any one of embodiments 1-2 wherein the sequence comprising RNA donor molecule and/or esnRNA comprises a sequence that is bound by an RNA-binding protein that increases the trans-splicing efficiency.
  • RNA donor molecule is RNA, DNA, a DNA/RNA hybrid, nucleic acid analog, a chemically-modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs.
  • the composition of any of one embodiments 1-13 wherein the wherein the RNA donor molecule further comprises a heterologous promoter.
  • tRNA transfer RNA
  • a composition comprising an engineered small nuclear RNA that promotes trans-splicing of a target RNA molecule and an RNA donor molecule.
  • a composition comprising an engineered small nuclear RNA that promotes trans-splicing of a target RNA molecule and an RNA donor molecule, the RNA donor molecule comprising: (a) one or more replacement domains that encode a therapeutic sequence operably linked to; (b) one or more intronic domains that promote RNA splicing of the replacement domain; and (c) one or more antisense domains that promote binding to a target RNA molecule.
  • a composition of embodiment 17-21, wherein the engineered small nuclear RNA domain comprises sequences isolated or derived from a variant of the human Ul gene.
  • composition of embodiment 17-22 wherein the engineered small nuclear RNA molecule is derived or isolated from a Ul small nuclear RNA gene or variant and contains an RNA motif that begins less than 16 nucleobases from the 5’ end that is partially or perfectly complementary to the RNA donor molecule.
  • RNA motif is chosen from a group consisting of: 5’-CGAGCTCTCT -3’, 5’-AACGAGCTCT -3’, 5’-CGCAACGAGC-3’, 5’-TATCGCAACG-3’, 5’-AATAATATCG-3’, 5’-TAAGAGAGCT-3’, 5’- AAGAGAGCTC-3’, 5’-AGAGAGCTCGTTGC-3’, 5’-GAGAGCTCGT-3’, 5’- AGAGCTCGTTGCGA-3’, and 5’-GAGCTCGTTG-3’.
  • composition of embodiment 17-25 wherein the RNA donor molecule contains an RNA motif that is at least 4 nucleotides long and is partially or perfectly complementary to a sequence in the RNA donor molecule.
  • a composition of embodiments 17-26 wherein the engineered small RNA molecule comprises sequences derived or isolated from a U1 small nuclear RNA gene or variant.
  • a composition of embodiments 17-27 wherein the engineered small RNA molecule comprises sequences derived or isolated from a U1 small nuclear RNA gene and a variant of the U1 small nuclear RNA gene.
  • composition of embodiment 17-28 wherein the RNA donor molecule is further comprising an untranslated region that enhances translation
  • the translation-enhancing element comprises a sequence derived or isolated from the group consisting of: Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE), triplex from MALAT1, the PRE of Hepatitis B virus (HPRE), and an iron response element
  • WPRE Woodchuck Hepatitis Virus
  • WPRE Posttranscriptional Regulatory Element
  • HPRE the PRE of Hepatitis B virus
  • iron response element The composition of embodiment 17-30 further comprising an RNA-binding protein that strengthens the interaction among the RNA donor molecule and the target RNA molecule and increases trans-splicing efficiency
  • the RNA donor molecule and small nuclear RNA molecule is RNA, DNA, a DNA/RNA hybrid, a nucleic acid analog, a chemically-modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid
  • a composition comprising an RNA donor molecule, comprising: (a) one or more replacement domains that encode a therapeutic sequence operably linked to; (b) one or more intronic domains that promote RNA splicing of the replacement domain; and (c) one or more antisense domains that promote binding to a target RNA molecule; and (d) an engineered small nuclear RNA domain that promotes trans-splicing of the RNA donor molecule.
  • RNA donor molecule comprising: (a) one or more replacement domains that encode a therapeutic sequence operably linked to; (b) one or more intronic domains that promote RNA splicing of the replacement domain; and (c) one or more antisense domains that promote binding to a target RNA molecule; and (d) an engineered small nuclear RNA domain that promotes trans-splicing of the RNA donor molecule.
  • a composition of embodiment 33-35, wherein the engineered small nuclear RNA domain is synthetic and binds components of the spliceosome.
  • a composition of embodiments 33-36, wherein the human small nuclear RNA gene is chosen from a group consisting of: Ul, U2, U4, U5, U6, U7, U11, and U12.
  • a composition of embodiment 37, wherein the engineered small nuclear RNA domain comprises sequences isolated or derived from a variant of the human Ul gene.
  • a composition of embodiment 37, wherein the engineered small nuclear RNA domain comprises sequences derived from the human Ul small nuclear RNA gene and a variant of the Ul small nuclear RNA gene.
  • composition of embodiment 33-41 wherein the RNA donor molecule contains an RNA motif that is at least 4 nucleotides long and is partially or perfectly complementary to a sequence in the RNA donor molecule.
  • a composition of embodiments 33-42 wherein the engineered small RNA molecule comprises sequences derived or isolated from a Ul small nuclear RNA gene or variant of the Ul small nuclear RNA gene.
  • a composition of embodiments 33-43 wherein the engineered small RNA molecule comprises sequences derived or isolated from a Ul small nuclear RNA gene and a variant of the Ul small nuclear RNA gene.
  • the composition of embodiment 44, wherein the RNA donor molecule is further comprising an untranslated region that enhances translation 46.
  • composition of embodiment 45 wherein the translation-enhancing element comprises a sequence derived or isolated from the group consisting of: Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE), triplex from MALAT1, the PRE of Hepatitis B virus (HPRE), and an iron response element
  • composition of embodiments 17-46 further comprising an RNA-binding protein that strengthens the interaction among the RNA donor molecule and the target RNA molecule and increases trans-splicing efficiency
  • composition of embodiments 17-47, wherein the RNA donor molecule and small nuclear RNA molecule is RNA, DNA, a DNA/RNA hybrid, a nucleic acid analog, a chemically-modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs.
  • composition of embodiment 17-48, wherein the nucleic acid molecule further comprises a heterologous promoter further comprises a heterologous promoter.
  • a vector comprising the composition of embodiments 17-49.
  • the vector of embodiment 50 wherein the vector is selected from the group consisting of: adeno-associated virus, retrovirus, lentivirus, adenovirus, nanoparticle, micelle, liposome, lipoplex, polymersome, polyplex, and dendrimer.
  • a cell comprising the vector of embodiment 51.
  • a method for treating a disease comprising administering to a patient in need of a therapeutically effective amount of a treatment comprising an RNA donor molecule and engineered small nuclear RNA molecule according to embodiment 17 or embodiment 18.
  • a method for correcting a genetic defect in a subject comprising administering to said subject an RNA donor molecule and engineered small nuclear RNA molecule according to embodiments 17-49.
  • a method for treating a disease comprising administering to a patient in need of a therapeutically effective amount of a treatment comprising an RNA donor molecule according to embodiments 17-49.
  • a method for correcting a genetic defect in a subject comprising administering to said subject an RNA donor molecule according to embodiments 17-49.
  • Coupled may refer to a weak or strong interaction between two or more atoms or molecules. The interaction may be directly or indirectly mediated by one or more molecules.
  • Example 1 Identification of the engineered small nuclear RNA
  • RNA donor also encoded in a plasmid, driven by a CMV promoter
  • esnRNA encoded in a plasmid and driven by the native U1 promoter
  • the esnRNAs are derived from human U1 snRNA and carry modified 5’ ends that carry 10-14 base long regions that are perfectly complementary to various sequences within the RNA donor molecule.
  • a human cell line HEK293T was maintained at 37 degrees C in 5% CO2 and plated in a 24-well plate with 300,000 cells in each well.
  • mCherry control is to provide a means to normalize the signal generated by the GFP reporter. 48 hours after transfection, cells were harvested and subjected to fluorescence measurements using fluorescence-activated cell sorting with a Sony Spectral Analyzer.
  • GFP signal was normalized to mCherry signal and the results were reported in FIGURE 6A-6B. Most esnRNAs with varied complementary sequences do not generate appreciable increases in GFP signal compared to an unmodified U1 snRNA (wildtype or “wt” esnRNA).
  • esnRNA A GCTCTCTTACgcaggggagataccatgatcacgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacc cctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctgactttctggagtttcaaa agtagactgtacgctaagggtcatatctttttttttggttttggtttggtttggtttggtttggtttggcgtctttaaatgtttaatcctgcagtggagggctgcggaatag gaagtaacatgtcgctgcacagtggagggctgctgct
  • the reporter used in FIGURE 6 contains (in the 5’ to 3’ direction) a CMV promoter, exon 81 of human COL17A1 gene, intron 81 of human COL17A1 gene, and the C-terminal portion of acGFP (127 amino acid residues).
  • FIGURE 7 It was next assessed whether an esnRNA identified in FIGURES 6A-6B could promote high-fidelity RNA trans-splicing in the context of a different reporter system (FIGURE 7).
  • FIGURE 6A the a reporter involving sequences from human COL17A1 gene was used while in FIGURE 7, sequences from human SCN1A were used in the reporter. Therefore, successful trans-splicing among these two targets indicates that potential broad applicability of this method to address many targets.
  • a similar assay was used involving a split GFP reporter that fluoresces only after successful trans-splicing of the RNA donor molecule (FIGURES 5A-5D).
  • Cells were transfected with the above plasmids with Lipofectamine 3000 (Invitrogen) according to manufacturer’s directions where 175 th of the total plasmid transfected was the reporter, l/5 th was the RNA donor plasmid, 275 th was the esnRNA plasmid, and l/5 th was a transfection control plasmid encoding CMV promoter driving expression of mCherry. 48 hours after transfection, cells were harvested and RNA extracted from the cells using RNAeasy columns (Qiagen). Next, the cells were treated with DNAse (TurboDNAse, Thermo) and subjected to reverse transcription (Superscript III, Thermo).
  • the cDNA was amplified by PCR using primers that amplify both the cis-spliced and trans-spliced reporter products using the following primers: forward: TAATACGACTCACTATAGGGAGACCC and reverse: CTCCATCTTATTGCCCAGGA.
  • Thermo TOPO-TA vector
  • Thermo Thermo
  • Thermo Thermo
  • the sequencing results were aligned to full-length GFP (FIGURE 7) and clones with perfect or near-perfect alignment were compared in FIGURE 7.
  • Full-length was only observed in the presence of the esnRNA where 4 of 25 clones yielded full length GFP (0 of 24 clones yielded full length GFP in the absence of the esnRNA).
  • the reporter used in FIGURE 7 contains (in the 5’ to 3’ direction) a CMV promoter, exon 15 of human SCN1A1 gene, intron 15 of human SCN1A gene, and the C-terminal portion of acGFP (127 amino acid residues).
  • the sequence of this reporter is as follows:
  • esnRNA B deleted or mutated various portions of the esnRNA that interact with specific spliceosomal components were deleted or mutated (FIGURE 8B). Specifically, various stem-loop structures that interact with spliceosome components were either mutated to repetitive tracts of adenosine or deleted. These data reported in FIGURE 8A indicate that recruitment of the spliceosome by the esnRNA is required for the observed enhancement of trans-splicing activity.
  • Cells were transfected with the above plasmids with Lipofectamine 3000 (Invitrogen) according to manufacturer’s directions where 175 th of the total plasmid transfected was the reporter, l/5 th was the RNA donor plasmid, 275 th was the esnRNA plasmid, and l/5 th was a transfection control plasmid encoding CMV promoter driving expression of mCherry. 48 hours after transfection, cells were harvested and subjected to fluorescence measurements using fluorescence-activated cell sorting with a Sony Spectral Analyzer. Cells that were positive for mCherry signal were identified and then the mean GFP and mCherry signal was assessed for this population.
  • GFP signal was normalized to mCherry signal and the results were reported in FIGURE 8. Deletion or mutation stem -loop 1, 2, or 4 resulted in dramatic reductions in GFP signal. This result indicates that recruitment of spliceosome components is the likely mechanism by which esnRNAs increase trans-splicing among the RNA donor and the target RNA.
  • the full sequences of the esnRNAs used in FIGURES 8A-8B are as follow: esnRNA B:
  • the reporter used in FIGURE 8A contains (in the 5’ to 3’ direction) a CMV promoter, exon 81 of human COL17A1 gene, intron 81 of human COL17A1 gene, and the C-terminal portion of acGFP (127 amino acid residues). The sequence is listed above.
  • FIGURES 6A-8B indicate that recognition of the RNA donor by the esnRNA and recruitment of spliceosomal factors are required to induce efficient trans-splicing among the RNA donor and the target RNA, it was next investigated whether reducing the reverse complementarity of esnRNA B with an RNA donor molecule would also reduce trans-splicing efficiency.
  • esnRNA B contains a 10 nucleotide sequence that is complementary to the reporter.
  • Sequential mutations of esnRNA B were made that have 9 nucleotide, 4 nucleotide and 2 nucleotide sequences that that are complementary to the reporter (FIGURE 9B). Indeed, reducing the degree of reverse complementarity concomitantly reduces the trans-splicing activity (FIGURE 9A). This result indicates that association of the esnRNA molecule to the RNA donor molecule is required to increase trans-splicing activity.
  • the reporter used in FIGURE 9 contains (in the 5’ to 3’ direction) a CMV promoter, exon 81 of human COL17A1 gene, intron 81 of human COL17A1 gene, and the C-terminal portion of acGFP (127 amino acid residues). The sequence is listed above.
  • Example 2 Use of esnRNA and RNA donor molecule to increase the translation of specific target RNAs
  • RNA trans-splicing system in contrast, could replace sequences in any target mRNA with translation-amplifying sequences to increase protein production.
  • Efficient RNA trans-splicing mediated by intronic trans-splicing enhancing sequences (trans-splicing enhancer sequences) could address this long-felt but unmet need of a means to promote targeted amplification of protein production from specific mRNAs.
  • Myotonic dystrophy is caused by RNAs that carry repetitive ‘CUG’ tracts that bind the splicing factor MBNL1. Titration of MBNL1 away from its typical targets causes widespread dysfunction of RNA alternative splicing and is responsible for most manifestations of disease in patients. Increasing MBNL1 protein production with an efficient RNA trans-splicing approach could address this disease via production of sufficient MBNL1 protein to reconstitute its typical activities in alternative splicing regulation.
  • RNA trans-splicing system carrying various cis-splicing enhancer sequences and a Woodchuck Hepatitis Virus (WHV) post-transcriptional Regulatory Element (WPRE) was created.
  • WUV Woodchuck Hepatitis Virus

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2022/042486 2021-09-03 2022-09-02 Rna editing via recruitment of spliceosome components Ceased WO2023034582A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
EP22865613.8A EP4396350A4 (en) 2021-09-03 2022-09-02 RNA EDITING BY RECRUITMENT OF SPLICING COMPLEX COMPONENTS
CN202280073582.9A CN118202051A (zh) 2021-09-03 2022-09-02 通过招募剪接体组分进行rna编辑
MX2024002647A MX2024002647A (es) 2021-09-03 2022-09-02 Edición de arn a través del reclutamiento de componentes de espliceosomas.
KR1020247010496A KR20240052034A (ko) 2021-09-03 2022-09-02 스플라이세오솜 구성요소의 동원을 통한 rna 편집
AU2022337146A AU2022337146A1 (en) 2021-09-03 2022-09-02 Rna editing via recruitment of spliceosome components
CA3230419A CA3230419A1 (en) 2021-09-03 2022-09-02 Rna editing via recruitment of spliceosome components
JP2024513942A JP2024533163A (ja) 2021-09-03 2022-09-02 スプライソソーム構成要素のリクルートを介したrna編集
IL311101A IL311101A (en) 2021-09-03 2022-09-02 RNA editing through recruitment of SPLICEOSOME components
US18/362,698 US12152239B2 (en) 2021-09-03 2023-07-31 RNA editing via recruitment of spliceosome components
US18/911,917 US20250051764A1 (en) 2021-09-03 2024-10-10 Rna editing via recruitment of spliceosome components

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202163240428P 2021-09-03 2021-09-03
US63/240,428 2021-09-03
US202263345660P 2022-05-25 2022-05-25
US63/345,660 2022-05-25

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/362,698 Continuation US12152239B2 (en) 2021-09-03 2023-07-31 RNA editing via recruitment of spliceosome components

Publications (1)

Publication Number Publication Date
WO2023034582A1 true WO2023034582A1 (en) 2023-03-09

Family

ID=85412903

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/042486 Ceased WO2023034582A1 (en) 2021-09-03 2022-09-02 Rna editing via recruitment of spliceosome components

Country Status (9)

Country Link
US (2) US12152239B2 (https=)
EP (1) EP4396350A4 (https=)
JP (1) JP2024533163A (https=)
KR (1) KR20240052034A (https=)
AU (1) AU2022337146A1 (https=)
CA (1) CA3230419A1 (https=)
IL (1) IL311101A (https=)
MX (1) MX2024002647A (https=)
WO (1) WO2023034582A1 (https=)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12152239B2 (en) 2021-09-03 2024-11-26 Tacit Therapeutics, Inc. RNA editing via recruitment of spliceosome components
WO2025147110A1 (ko) * 2024-01-02 2025-07-10 알지노믹스 주식회사 Mecp2 전사체 특이적 트랜스-스플라이싱 리보자임 및 이의 용도
US12410440B2 (en) 2022-05-13 2025-09-09 Ascidian Therapeutics, Inc. ABCA4 trans-splicing molecules

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022220968A1 (en) * 2021-04-15 2022-10-20 U1 Bio, Inc. High efficiency trans-splicing for replacement of targeted rna sequences in human cells
WO2025085691A1 (en) 2023-10-18 2025-04-24 Tacit Therapeutics, Inc. Trans-splicing nucleic acid molecules and methods of use

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5994124A (en) * 1996-01-12 1999-11-30 Universita' Degli Studi Di Roma 'la Sapienza' Ribozyme-snRNA chimeric molecules having a catalytic activity for nuclear RNAs
US20130072541A1 (en) * 2004-08-17 2013-03-21 Genethon Adeno-associated viral vector for exon skipping in a gene encoding a dispensible-domain protein
US20190111072A1 (en) * 2016-04-01 2019-04-18 National University Of Singapore TRANS-SPLICING RNA (tsRNA)

Family Cites Families (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020193580A1 (en) 1995-12-15 2002-12-19 Mitchell Lloyd G. Methods and compositions for use in spliceosome mediated RNA trans-splicing
US20090148906A1 (en) 1998-09-29 2009-06-11 Shire Human Genetic Therapies, Inc. A Delaware Corporation Optimized messenger rna
US20040214263A1 (en) * 2002-03-20 2004-10-28 Mitchell Lloyd G. Spliceosome mediated RNA trans-splicing
EP2151248A1 (en) 2008-07-30 2010-02-10 Johann Bauer Improved pre-mRNA trans-splicing molecule (RTM) molecules and their uses
US9303078B2 (en) 2009-10-08 2016-04-05 Association Institut De Myologie Nucleic acid molecules and methods for exchanging exon(s) by transsplicing
US8802642B2 (en) 2010-04-28 2014-08-12 Iowa State University Research Foundation, Inc. Spinal muscular atrophy treatment via targeting SMN2 catalytic core
IT1400425B1 (it) * 2010-06-08 2013-05-31 Amsterdam Molecular Therapeutics Bv Modified snrnas for use in therapy.
IT1405793B1 (it) * 2010-10-15 2014-01-24 Univ Ferrara Molecola di u1snrna umano modificato, gene codificante per la molecola di u1snrna umano modificato, vettore di espressione includente il gene, e loro uso in terapia genica
GB201219762D0 (en) 2012-11-02 2012-12-19 Bauer Johann A RNA trans-splicing molecule (RTM) for use in the treatment of cancer
MX388221B (es) 2013-04-20 2025-03-19 Res Institute At Nationwide Children´S Hospital ADMINISTRACIÓN DE VIRUS ADENO-ASOCIADO RECOMBINANTE DE CONSTRUCCIONES DE POLINUCLÉOTIDOS U7snRNA DIRIGIDA AL EXÓN 2.
CA3005474A1 (en) 2015-11-19 2017-05-26 The Trustees Of The University Of Pennsylvania Compositions and methods for correction of heritable ocular disease
CA3005968A1 (en) 2015-11-23 2017-06-01 The Regents Of The University Of California Tracking and manipulating cellular rna via nuclear delivery of crispr/cas9
PL3386484T3 (pl) 2015-12-10 2022-07-25 Modernatx, Inc. Kompozycje i sposoby dostarczania środków terapeutycznych
CN110612353A (zh) 2017-03-03 2019-12-24 加利福尼亚大学董事会 经由抑制性tRNAs和脱氨酶对突变进行RNA靶向
US10476825B2 (en) 2017-08-22 2019-11-12 Salk Institue for Biological Studies RNA targeting methods and compositions
KR102866133B1 (ko) 2018-04-17 2025-09-30 더 트러스티스 오브 더 유니버시티 오브 펜실바니아 트랜스-스플라이싱 분자
KR102918544B1 (ko) 2018-07-12 2026-01-27 로켓 파마슈티컬스, 리미티드 다논병을 치료하기 위한 유전자 요법 벡터
US20220010333A1 (en) 2018-09-06 2022-01-13 The Regents Of The University Of California Rna and dna base editing via engineered adar recruitment
US20210388351A1 (en) 2018-09-28 2021-12-16 The Jackson Laboratory Artificial rna-guided splicing factors
WO2020160486A1 (en) 2019-02-01 2020-08-06 Spark Therapeutics, Inc. Aav vector treatment methods for late infantile neuronal ceroid lipofuscinosis type 2
WO2020205604A1 (en) 2019-03-29 2020-10-08 Salk Institute For Biological Studies High-efficiency reconstitution of rna molecules
BR112021020539A2 (pt) 2019-04-17 2022-01-04 Univ Pennsylvania Terminador de hélice tripla para trans-splicing de rna eficiente
CN115023499A (zh) 2019-08-16 2022-09-06 麻省理工学院 使用CRISPR/Cas13的靶向反式剪接
WO2021076656A1 (en) 2019-10-15 2021-04-22 University Of Massachusetts Rna editor-enhanced rna trans-splicing
IL292904A (en) * 2019-11-11 2022-07-01 Salk Inst For Biological Studi Compositions and methods for high-efficiency recombination of rna molecules
CN115777020A (zh) 2020-04-22 2023-03-10 塑造治疗公司 使用snrna组分的组合物和方法
CA3177380A1 (en) 2020-05-26 2021-12-02 Shape Therapeutics Inc. Compositions and methods for modifying target rnas
EP4217010A4 (en) 2020-09-28 2025-01-08 Tacit Therapeutics, Inc. TRANS-SPLICING SYSTEM FOR TISSUE-SPECIFIC REPLACEMENT OF RNA SEQUENCES
AU2022337146A1 (en) 2021-09-03 2024-03-14 Tacit Therapeutics, Inc. Rna editing via recruitment of spliceosome components

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5994124A (en) * 1996-01-12 1999-11-30 Universita' Degli Studi Di Roma 'la Sapienza' Ribozyme-snRNA chimeric molecules having a catalytic activity for nuclear RNAs
US20130072541A1 (en) * 2004-08-17 2013-03-21 Genethon Adeno-associated viral vector for exon skipping in a gene encoding a dispensible-domain protein
US20190111072A1 (en) * 2016-04-01 2019-04-18 National University Of Singapore TRANS-SPLICING RNA (tsRNA)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP4396350A4 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12152239B2 (en) 2021-09-03 2024-11-26 Tacit Therapeutics, Inc. RNA editing via recruitment of spliceosome components
US12410440B2 (en) 2022-05-13 2025-09-09 Ascidian Therapeutics, Inc. ABCA4 trans-splicing molecules
WO2025147110A1 (ko) * 2024-01-02 2025-07-10 알지노믹스 주식회사 Mecp2 전사체 특이적 트랜스-스플라이싱 리보자임 및 이의 용도

Also Published As

Publication number Publication date
EP4396350A1 (en) 2024-07-10
US20240011026A1 (en) 2024-01-11
KR20240052034A (ko) 2024-04-22
US20250051764A1 (en) 2025-02-13
MX2024002647A (es) 2024-05-10
CA3230419A1 (en) 2023-03-09
JP2024533163A (ja) 2024-09-12
AU2022337146A1 (en) 2024-03-14
EP4396350A4 (en) 2026-01-14
US12152239B2 (en) 2024-11-26
IL311101A (en) 2024-04-01

Similar Documents

Publication Publication Date Title
US12152239B2 (en) RNA editing via recruitment of spliceosome components
US20240209366A1 (en) High efficiency trans-splicing for replacement of targeted rna sequences in human cells
US10822617B2 (en) RNA-targeting fusion protein compositions and methods for use
US20210009987A1 (en) Rna-targeting knockdown and replacement compositions and methods for use
US20230340469A1 (en) Trans-splicing system for tissue-specific replacement of rna sequences
WO2023039440A9 (en) Hbb-modulating compositions and methods
CA3214277A1 (en) Ltr transposon compositions and methods
US20250270553A1 (en) Stabilization of therapeutic trans-splicing rna molecules in human cells
US20210171929A1 (en) Single base editing tools with precise accuracy
US20250290067A1 (en) Localization of trans-splicing nucleic acid molecules to and within the cellular nucleus
AU2022343271A1 (en) Recruitment in trans of gene editing system components
WO2024138202A2 (en) Effector proteins, compositions, systems and methods of use thereof
CN118202051A (zh) 通过招募剪接体组分进行rna编辑
HK40111673A (zh) 通过招募剪接体组分进行rna编辑
WO2023225471A2 (en) Helitron compositions and methods

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22865613

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 808623

Country of ref document: NZ

Ref document number: 2022337146

Country of ref document: AU

Ref document number: 311101

Country of ref document: IL

Ref document number: AU2022337146

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 3230419

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2024513942

Country of ref document: JP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112024004220

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2022337146

Country of ref document: AU

Date of ref document: 20220902

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20247010496

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 11202401294T

Country of ref document: SG

WWE Wipo information: entry into national phase

Ref document number: 202417027282

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2022865613

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022865613

Country of ref document: EP

Effective date: 20240403

WWE Wipo information: entry into national phase

Ref document number: 202280073582.9

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 112024004220

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20240301