WO2023013965A1 - Composition comprising mirna derived from extracellular vesicles of activated t cells as active ingredient, and uses thereof - Google Patents

Composition comprising mirna derived from extracellular vesicles of activated t cells as active ingredient, and uses thereof Download PDF

Info

Publication number
WO2023013965A1
WO2023013965A1 PCT/KR2022/011068 KR2022011068W WO2023013965A1 WO 2023013965 A1 WO2023013965 A1 WO 2023013965A1 KR 2022011068 W KR2022011068 W KR 2022011068W WO 2023013965 A1 WO2023013965 A1 WO 2023013965A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
seq
nucleotide sequence
cancer
sequence represented
Prior art date
Application number
PCT/KR2022/011068
Other languages
French (fr)
Korean (ko)
Inventor
백문창
예경무
신상희
정인성
Original Assignee
경북대학교 산학협력단
재단법인대구경북과학기술원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경북대학교 산학협력단, 재단법인대구경북과학기술원 filed Critical 경북대학교 산학협력단
Priority claimed from KR1020220092891A external-priority patent/KR20230022800A/en
Publication of WO2023013965A1 publication Critical patent/WO2023013965A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders

Definitions

  • the present invention relates to a composition comprising miRNA derived from extracellular endoplasmic reticulum of activated T cells as an active ingredient and a use thereof.
  • Cancer is a product of uncontrolled and disorderly cell proliferation caused by an excess of abnormal cells, and can be said to be a disease caused by genetic mutations from a molecular biological point of view.
  • small extracellular vesicles are membrane-structured small vesicles secreted from most cells.
  • the diameter of sEVs is approximately 30-100 nm, and sEVs contain various types of proteins, genetic materials (DNA, RNA, miRNA), lipids, etc. derived from the cell.
  • sEVs are not directly released from the plasma membrane, but originate from specific intracellular compartments called multivesicular bodies (MVBs) and are released and secreted outside the cell. That is, when the fusion of the polycystic body and the plasma membrane occurs, the vesicles are released into the extracellular environment, which is called sEV.
  • MVBs multivesicular bodies
  • MicroRNA one of the substances derived from extracellular endoplasmic reticulum, is a non-coding RNA with 22 base sequences or less, which degrades target mRNA or inhibits the transcription of target mRNA. to regulate gene expression. Its gene expression regulation is related to cell differentiation and cell proliferation. In particular, during embryogenesis, miRNAs are expressed at elusive times, which play an important role in each stage of embryonic development. However, although the important function of regulating miRNA differentiation continues to be discovered, the precise mechanism regulating miRNA expression remains unknown. Recently, the possibility of epigenetic expression of miRNAs with anticancer functions in human cancer cells has been suggested, and various evidences for the epigenetic regulation of miRNA clusters have been reported.
  • the anticancer miRNA encoding various DNA regions is abnormally hypermethylated in human breast cancer cell lines, so the gene is not activated, and DNMT (DNA methylatransferase) 5-Asa in AGS gastric cancer cell lines.
  • DNMT DNA methylatransferase 5-Asa in AGS gastric cancer cell lines.
  • An object of the present invention is to provide a composition for enhancing immunity comprising, as an active ingredient, miRNAs that enhance the activity of immune cells among miRNAs derived from extracellular endoplasmic reticulum of activated T cells.
  • the present invention relates to any one or more selected from the group consisting of miR-10a-5p, miR-25-3p, miR-215-5p, miR-155-5p, miR-375, miR-148a-3p and miR-374b-5p.
  • a composition for enhancing immunity comprising miRNA as an active ingredient.
  • the present invention comprises the steps of treating IL-2 to T cells; Separating extracellular vesicles from the T cells; Collecting miRNA from the extracellular vesicles; and selecting miRNAs that enhance the expression of IFN- ⁇ and Granzyme B genes in T cells from among the collected miRNAs.
  • miR-10a-5p, miR-25-3p, miR-215-5p, miR-155-5p, miR-375, miR contained in IL-2-activated T cell-derived extracellular vesicles -148a-3p and miR-374b-5p confirm that they exhibit an immune-enhancing effect by increasing the expression levels of IFN- ⁇ and Granzyme B genes in T cells, so that the composition containing the miRNAs can be provided as an immune-enhancing composition.
  • 1 is a result of selecting miRNAs with high expression in T cell-derived extracellular vesicles through data analysis.
  • Figure 2 shows the results of evaluating the effects of 27 miRNAs, which are abundant in T cell-derived extracellular vesicles, on IFN- ⁇ and Granzyme B expression in primary CD8+ T cells.
  • 3 shows the results of evaluating the effects of 7 miRNAs with excellent activity among miRNAs abundant in T cell-derived extracellular vesicles on IFN- ⁇ and Granzyme B expression in primary CD8+ T cells.
  • the present invention relates to any one or more selected from the group consisting of miR-10a-5p, miR-25-3p, miR-215-5p, miR-155-5p, miR-375, miR-148a-3p and miR-374b-5p.
  • a composition for enhancing immunity comprising miRNA as an active ingredient.
  • the miR-10a-5p consists of the nucleotide sequence represented by SEQ ID NO: 5
  • the miR-25-3p consists of the nucleotide sequence represented by SEQ ID NO: 7
  • the miR-215-5p is represented by SEQ ID NO: 11
  • the miR-155-5p consists of the nucleotide sequence represented by SEQ ID NO: 12
  • the miR-375 consists of the nucleotide sequence represented by SEQ ID NO: 15
  • the miR-148a-3p consists of the nucleotide sequence represented by SEQ ID NO: 15 It consists of the nucleotide sequence represented by SEQ ID NO: 18, and the miR-374b-5p may consist of the nucleotide sequence represented by SEQ ID NO: 25.
  • composition for enhancing immunity is let-7a-5p, let-7f-5p, miR-148b-3p, miR-92a-3p, miR-320b, miR-4443, miR-24-3p, miR-191-5p, miR-200b-3p, miR-10b-5p, miR-221-3p, miR-199a-3p, miR-484, miR-197-3p, miR-340-5p, miR-374c-3p, miR-130b- It may further include any one or more miRNAs selected from the group consisting of 5p, miR-19b-3p, miR-185-5p, and let-7g-5p.
  • the let-7a-5p consists of the nucleotide sequence represented by SEQ ID NO: 1
  • the let-7f-5p consists of the nucleotide sequence represented by SEQ ID NO: 2
  • the miR-148b-3p is represented by SEQ ID NO: 3
  • the miR-92a-3p consists of the nucleotide sequence represented by SEQ ID NO: 4
  • the miR-320b consists of the nucleotide sequence represented by SEQ ID NO: 6
  • the miR-4443 consists of the nucleotide sequence represented by SEQ ID NO: 6
  • the miR-24-3p consists of the nucleotide sequence represented by SEQ ID NO: 9
  • the miR-191-5p consists of the nucleotide sequence represented by SEQ ID NO: 10
  • the miR-191-5p consists of the nucleotide sequence represented by SEQ ID NO: 10.
  • the miR-10b-5p consists of the nucleotide sequence represented by SEQ ID NO: 14
  • the miR-221-3p consists of the nucleotide sequence represented by SEQ ID NO: 16
  • the miR-199a-3p consists of the nucleotide sequence represented by SEQ ID NO: 17
  • the miR-484 consists of the nucleotide sequence represented by SEQ ID NO: 19
  • the miR-197-3p consists of the nucleotide sequence represented by SEQ ID NO: 19
  • the miR-340-5p consists of the nucleotide sequence represented by SEQ ID NO: 21
  • the miR-374c-3p consists of the nucleotide sequence represented by SEQ ID NO: 22
  • the miR-374c-3p consists of the nucleotide sequence represented by SEQ ID NO: 22.
  • let-7g-5p may consist of the nucleotide sequence represented by SEQ ID NO: 27.
  • the miRNA can increase the expression levels of IFN- ⁇ and Granzyme B genes in T cells.
  • the miRNA may be derived from extracellular vesicles of T cells activated by IL-2.
  • the extracellular vesicles are small extracellular vesicles (sEVs) having a diameter of 30 to 100 nm, and may include exosomes, microvesicles, and the like.
  • the composition for enhancing immunity is melanoma, colon cancer, lung cancer, skin cancer, non-small cell lung cancer, colon cancer, bone cancer, pancreatic cancer, head or neck cancer, uterine cancer, ovarian cancer, rectal cancer, stomach cancer, proximal anal cancer, breast cancer, fallopian tube carcinoma, uterus Endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hawkins' disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocyte Prevention or treatment of any one or more cancer diseases selected from the group consisting of lymphoma, bladder cancer, renal or ureteral cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system tumor, primary central nervous system lymphoma, spinal cord tumor, brainstem glioma, and pituitary adenoma. It can be used as
  • the pharmaceutical composition of the present invention is prepared in unit dosage form or multi-dose by formulating using a pharmaceutically acceptable carrier according to a method that can be easily performed by those skilled in the art. It can be prepared by incorporating into a container.
  • the pharmaceutically acceptable carrier is one commonly used in formulation, and includes lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methyl hydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like.
  • the pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like in addition to the above components.
  • the content of the additives included in the pharmaceutical composition is not particularly limited and may be appropriately adjusted within the range of content used in conventional formulations.
  • the pharmaceutical composition is an aqueous solution, suspension, emulsion, etc. for injection, pills, capsules, granules, tablets, creams, gels, patches, sprays, ointments, warning agents, lotions, liniment agents, pasta agents, and cataplasma agents. It may be formulated in the form of one or more external preparations selected from the group consisting of agents.
  • the pharmaceutical composition of the present invention may further contain pharmaceutically acceptable carriers and diluents for formulation.
  • pharmaceutically acceptable carriers and diluents include excipients such as starch, sugar and mannitol, fillers and extenders such as calcium phosphate, cellulose derivatives such as carboxymethylcellulose and hydroxypropylcellulose, gelatin, alginates, and polyvinyl fibres.
  • binders such as rolidone, etc., lubricants such as talc, calcium stearate, hydrogenated castor oil and polyethylene glycol, disintegrants such as povidone, crospovidone, surfactants such as polysorbates, cetyl alcohol, and glycerol; don't
  • the pharmaceutically acceptable carrier and diluent may be biologically and physiologically compatible with the subject.
  • diluents include, but are not limited to, saline, aqueous buffers, solvents and/or dispersion media.
  • the pharmaceutical composition of the present invention may be administered orally or parenterally (eg, intravenous, subcutaneous, intraperitoneal or topical application) depending on the desired method.
  • parenterally eg, intravenous, subcutaneous, intraperitoneal or topical application
  • it may be formulated into tablets, troches, lozenges, aqueous suspensions, oily suspensions, powders, granules, emulsions, hard capsules, soft capsules, syrups or elixirs.
  • parenteral administration it may be formulated as an injection solution, suppository, powder for respiratory inhalation, aerosol for spray, ointment, powder for application, oil, cream, etc.
  • the dosage of the pharmaceutical composition of the present invention depends on the condition and weight of the patient, age, sex, health condition, dietary constitution specificity, the nature of the preparation, the severity of the disease, the administration time of the composition, the administration method, the administration period or interval, and the excretion rate. , And the range may vary depending on the type of drug, and may be appropriately selected by a person skilled in the art. For example, it may be in the range of about 0.1 to 10,000 mg/kg, but is not limited thereto, and may be divided and administered once or several times a day.
  • the pharmaceutical composition may be administered orally or parenterally (eg, intravenous, subcutaneous, intraperitoneal or topical application) depending on the desired method.
  • the pharmaceutically effective amount and effective dose of the pharmaceutical composition of the present invention may vary depending on the formulation method, administration method, administration time and/or administration route of the pharmaceutical composition, and those skilled in the art can use the purpose Dosages effective for treatment can be easily determined and prescribed. Administration of the pharmaceutical composition of the present invention may be administered once a day, or may be divided into several administrations.
  • the present invention comprises the steps of treating IL-2 to T cells; Separating extracellular vesicles from the T cells; Collecting miRNA from the extracellular vesicles; and selecting miRNAs that enhance the expression of IFN- ⁇ and Granzyme B genes in T cells from among the collected miRNAs.
  • Primary CD4+ T cells (human CD4+ T cells) and primary CD8+ T cells (human CD8+ T cells) were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin and streptomycin (Hyclone).
  • FBS fetal bovine serum
  • Hyclone penicillin and streptomycin
  • PBMC Human peripheral blood In mononuclear cells
  • 50ml of blood was collected using a 50ml syringe, transferred to a vacuum containing heparin (BD Vacutainer), and then centrifuged at 550xg for 10 minutes to remove the supernatant. Then, it was mixed with PBS in a ratio of 1:1. Thereafter, 5 ml of ficoll (GE Healthcare) per 8 ml of blood mixed with PBS was added and centrifuged at 550xg for 30 minutes. Then, the supernatant was removed and the buffy coat layer was transferred to a new 50ml conical tube. After adding PBS up to 30ml, centrifugation was performed at 550xg for 10 minutes. Then, the pellet was mixed with RPMI 1640 medium supplemented with 10% FBS, 1% penicillin and streptomycin, and cultured for 16 hours in a 10 cm plate (Cat, 430167; Corning).
  • the number of cells of human peripheral blood mononuclear cells cultured in a 10 cm plate (Cat, 430167; Corning) was counted by trypan blue staining, and then centrifuged at 550xg for 10 minutes. Then, 40 ⁇ l of Macs buffer was added per 10 7 . Thereafter, 10 ⁇ l of Biotin-Ab cocktail was added per 10 7 , mixed, and incubated at 4° C. for 5 minutes. Thereafter, 20 ⁇ l of microbead cocktail was added per 10 7 , mixed, and incubated at 4° C. for 10 minutes. Then, the LS column was placed in the magnetic field of the MACS separator. After that, the column was washed 3 times with 1 ml of Macs buffer.
  • the cell supernatant cultured for 10 minutes was put into the column and flow-through was received in a 5ml tube.
  • the above process was repeated three times to receive a total of 3 ml of cell supernatant and centrifuged at 550xg for 10 minutes.
  • the pellet was mixed with RPMI 1640 medium supplemented with 10% FBS, 1% penicillin and streptomycin, and cultured on a 10 cm plate (Cat, 430167; Corning).
  • Example 3 Isolation of extracellular vesicles (sEVs) derived from primary CD4+ T cells
  • CD4+ T cells were added at a density of 2 ⁇ 10 6 per 10 cm plate (Cat. 430167; Corning), divided into plates treated with IL-2 at a concentration of 500 IU/ml and untreated plates, and cultured for 48 hours. Thereafter, in order to collect the extracellular vesicles, the medium was replaced with a medium without FBS and further cultured for 24 hours. After collecting the cell culture supernatant, cells and debris were removed by centrifugation.
  • each supernatant obtained from each cell was 300xg, 2500xg, and 10,000xg was continuously centrifuged. The supernatant was then filtered through a 0.2 ⁇ m syringe filter and centrifuged at 120,000 ⁇ g. The extracellular endoplasmic reticulum pellet was resuspended in PBS and centrifuged again at 120,000xg. The purified pellet was resuspended in PBS or 1X cell lysis buffer for the next experiment.
  • RNA libraries were generated by the Next Seq 500 system using single-end 75 sequencing (Illumina, San Diego, CA., USA).
  • Sequence reads were mapped with the bowtie2 software tool to obtain bam files (alignment files). Mature miRNA sequences were used as references for mapping. The number of reads mapped to mature miRNA sequences were extracted from alignment files using bedtools (v2.25.0) and Bioconductor (R development Core Team, 2011) using the R (version 3.2.2) statistical programming language. Read counts were used to determine the expression levels of miRNAs. Quantile normalization method was used for comparison between samples.
  • RNA-seq data as shown in Figure 1, through differentially expressed genes analysis, extracellular vesicles (CE) derived from CD4+ T cells and extracellular vesicles (IL) derived from T cells activated by IL-2 -2E), miRNAs with significantly higher expression were selected, and among those miRNAs, a miRNA candidate list with higher expression in IL-2E compared to CE was selected.
  • the 27 miRNA candidates selected in this experiment are shown in Table 1 below.
  • miRNAs base sequence sequence number hsa-let-7a-5p UGAGGUUAGUAGGUUGUAUAGUU One hsa-let-7f-5p UGAGGUAGAUAGAUUGUAUAGUU 2 hsa-miR-148b-3p UCAGUGCACUACAGAACUUUGU 3 hsa-miR-92a-3p UAUUGCACUUGUCCCGGCCUGU 4 hsa-miR-10a-5p UACCCUGUAGAUCCGAAUUUGUG 5 hsa-miR-320b AAAAGCUGGGUUGAGAGGGCAA 6 hsa-miR-25-3p CAUUGCACUUGUCUCGGUCUGA 7 hsa-miR-4443 UUGGAGGCGUGGGUUUU 8 hsa-miR-24-3p UGGCUCAGUUCAGCAGGAACAG 9 hsa-miR-191-5p CAACGGAAUCCCAAAAGCAGCUG 10 h
  • Example 5 In isolated primary CD8+ T cells microRNA mimic oligo transfection
  • each hsa-microRNA mimic oligo was added to a 100 ⁇ l Nucleocuvette Vessel (Cat; PCK-2005, Lonza), and 4D Nucleofector Core unit (Serial no 510B0263, Lonza) and 4D Nucleofector X unit (Serial no: 510 X 0441, Lonza) and transfection was performed.
  • 500 ⁇ l of RPMI 1640 medium supplemented with 10% FBS was added to the Nucleocuvette, sucked up with single use pipettes, and then 12 well plate (REF; 3513, Corning ) and cultured for 24 hours in a 37°C, 5% CO 2 incubator.
  • Example 6 hsa - miRNAs mimic oligos Evaluation of cytotoxic ability of primary CD8+ T cells after transfection
  • mRNA (Cat; R2062, ZYMO RESEARCH) was extracted from the cells, and then using nanodrop (DS-11 Series Spectrophotometer; DeNovix) The concentration of mRNA was measured.
  • synthesizing cDNA (PrimeScriptTM 1st strand cDNA Synthesis Kit, # 6110A; TaKaRa) with 100ng of mRNA, gene expression was detected using TB GreenTM Premix Ex TaqTM (Tli RNaseH Plus) kit (# RR420A; TaKaRa). Primers used in this experiment are shown in Table 2 below.
  • Real-time polymerase chain reaction was performed using the Step One Plus Real-Time PCR System (Applied Biosystems).
  • the relative mRNA level of the sample was calculated by Ct (comparative threshold cycle) analysis after normalization for the amount of beta-actin in the same sample, and was expressed as a modified 2 - ⁇ Ct value from the initial Ct value.
  • hsa-miRNA mimic oligos seven hsa-miRNA mimic oligos (hsa-miR-10a-5p, hsa-miR-25-3p, hsa-miR-215-5p, hsa-miR-155-5p, hsa-miR-155- 5p, hsa-miR-375, hsa-miR-148a-3p and hsa-miR-374b-5p) enhanced the anticancer effect of primary CD8+ T cells by flow cytometry.
  • reaction was performed at 4°C for 1 hour with 0.1% PBST (Tween (Product No; 0777-1L, VWR LIFE SCIENCE)) containing 5% Goat serum (REF; S-1000, Vector Laboratories) and 1% BSA.
  • PBST Tetrachloride
  • the sample was reacted with primary antibody for 1 hour at 4°C, washed with PBS, reacted with secondary antibody (1:2000 dilution) for 1 hour at 4°C, washed with PBS, and analyzed by flow cytometry (FACSAria III; Becton Dickinson ) was performed. Data were analyzed with FlowJo software (Flowjo, Ashland, OR, USA).
  • the primary antibodies used in this experiment were: GZMB (ab4059, 1:100; Abcam), IFNG (ab9657, 1:500; Abcam).

Abstract

The present invention relates to a composition comprising miRNA derived from extracellular vesicles of activated T cells as an active ingredient, and uses thereof. As it was confirmed that miR-10a-5p, miR-25-3p, miR-215-5p, miR-155-5p, miR-375, miR-148a-3p, and miR-374b-5p contained in extracellular vesicles derived from T cells activated with IL-2 exhibit an immune-enhancing effect by increasing the expression levels of IFN-γ and Granzyme B genes in T cells, the composition comprising the miRNAs may be provided as an immune-enhancing composition.

Description

활성화 T 세포의 세포외 소포체 유래 miRNA를 유효성분으로 포함하는 조성물 및 이의 용도Composition containing miRNA derived from extracellular vesicles of activated T cells as an active ingredient and uses thereof
본 발명은 활성화 T 세포의 세포외 소포체 유래 miRNA를 유효성분으로 포함하는 조성물 및 이의 용도에 관한 것이다.The present invention relates to a composition comprising miRNA derived from extracellular endoplasmic reticulum of activated T cells as an active ingredient and a use thereof.
암은 비정상적인 세포의 과잉으로 인하여 발생하는 비제어적이고 무질서한 세포 증식의 산물로서, 분자생물학적인 관점에서 볼 때 유전자의 변이에 의하여 발생하는 질환이라고 할 수 있다. 암의 종류는 현재까지 밝혀진 것만 해도 수십 종에 이르며 주로 발병 조직의 위치에 따라 구분된다. 암은 양성종양과 악성종양으로 구분되는데, 양성종양은 비교적 성장 속도가 느리고 종양의 원발생 부위에서 다른 조직으로 이동되는 전이가 발생하지 않는 반면, 악성종양은 원발부를 떠나 다른 조직으로 침윤되어 빠르게 성장하는 특성을 가져 생명을 위협한다. 대부분의 암은 초기에 증상이 없으며, 증상이 있다고 하더라도 경미하여 대부분의 사람들이 이를 간과하기 쉽고, 이는 암의 사망률을 높이는 원인이 되고 있다. Cancer is a product of uncontrolled and disorderly cell proliferation caused by an excess of abnormal cells, and can be said to be a disease caused by genetic mutations from a molecular biological point of view. There are dozens of types of cancer that have been identified so far, and they are mainly classified according to the location of the onset tissue. Cancer is divided into benign tumors and malignant tumors. Benign tumors grow relatively slowly and do not metastasize from the original tumor site to other tissues, whereas malignant tumors leave the primary site and invade other tissues rapidly. It has growing properties and is life threatening. Most cancers are asymptomatic in their early stages, and even if symptoms are mild, most people tend to overlook them, which causes an increase in cancer mortality.
암의 치료를 위해서 수술 요법, 화학 요법, 방사선 요법 등이 사용되고 있으나 많은 연구에도 불구하고 암 환자 전체의 50% 이상이 결국 치유되지 못하고 사망하는 것으로 보고된다. 그 이유는 외과적으로 절제를 하였다 하더라도 미세하게 전이된 암세포를 제거하지 못하여 암이 재발하거나, 항암제에 대한 암세포의 사멸이 유도되지 않거나 초기에는 반응을 보여 종양이 줄어드는 듯 보이지만 치료 도중이나 치료가 끝난 후 항암제에 대한 내성이 생긴 암세포들이 급격히 증가하기 때문이다. 오늘날에는 약 60여 종의 다양한 항암제가 사용되고 있으며, 암 발생 및 암세포의 특성에 관한 지식이 많이 알려짐에 따라 새로운 항암제 개발에 관한 연구가 활발하게 진행되고 있다. 그러나 대부분의 항암제는 오심과 구토, 탈모, 피부 및 손톱의 변색, 신경계 부작용 등의 심각한 부작용을 일으키며, 반복적으로 장기간 투여되거나 암이 재발된 경우에는 암세포가 항암제에 대한 내성을 획득함으로써 치료 효과를 상실하는 단점이 있다. 또한, 방사선 요법은 고에너지의 방사선을 암 조직에 조사하여 암세포의 사멸을 유도하나, 암 조직 주변에 있는 정상 조직에게도 손상을 주어 부작용을 발생시키는 단점이 있다.Surgery, chemotherapy, radiation therapy, etc. are used for the treatment of cancer, but despite many studies, it is reported that more than 50% of all cancer patients die without being cured. The reason for this is that even if surgical resection is performed, the cancer recurs due to the inability to remove finely metastasized cancer cells, or the death of cancer cells to anticancer drugs is not induced, or the tumor seems to shrink due to a response at the beginning, but during treatment or after treatment is finished. This is because cancer cells that have developed resistance to anticancer drugs rapidly increase. Today, about 60 different types of anticancer drugs are being used, and research on the development of new anticancer drugs is being actively conducted as a lot of knowledge about the occurrence of cancer and the characteristics of cancer cells is known. However, most anticancer drugs cause serious side effects such as nausea and vomiting, hair loss, discoloration of skin and nails, and side effects of the nervous system. There is a downside to In addition, radiation therapy induces the death of cancer cells by irradiating high-energy radiation to cancer tissue, but has a disadvantage of causing side effects by damaging normal tissues around the cancer tissue.
한편, 작은 세포외 소포체(Small extracellular vesicles; sEV)는 대부분의 세포에서 분비되는 막 구조의 작은 소낭이다. sEV의 직경은 대략 30-100nm로, sEV 안에는 그 세포에서 유래된 다양한 종류의 단백질, 유전물질(DNA, RNA, miRNA), 지질 등이 포함되어 있다. sEV는 원형질막(plasma membrane)으로부터 직접 떨어져 나가는 것이 아니라 다낭체(multivesicular bodies; MVBs)라고 불리는 세포 내 특정 구획에서 기원하여 세포 밖으로 방출 및 분비된다. 즉, 다낭체와 원형질막의 융합이 일어나면 소낭들은 세포 밖 환경으로 방출되는데 이것을 sEV라고 부른다. sEV가 어떤 기작에 의해 만들어지는지 정확하게 밝혀진 바가 없으나, 정상 상태 및 병적 상태 모두에서 다수의 세포 유형으로부터 분리되어 방출되는 것으로 알려져 있다.On the other hand, small extracellular vesicles (sEVs) are membrane-structured small vesicles secreted from most cells. The diameter of sEVs is approximately 30-100 nm, and sEVs contain various types of proteins, genetic materials (DNA, RNA, miRNA), lipids, etc. derived from the cell. sEVs are not directly released from the plasma membrane, but originate from specific intracellular compartments called multivesicular bodies (MVBs) and are released and secreted outside the cell. That is, when the fusion of the polycystic body and the plasma membrane occurs, the vesicles are released into the extracellular environment, which is called sEV. Although it has not been precisely identified by what mechanism sEVs are produced, it is known that they are separated and released from multiple cell types in both normal and diseased conditions.
세포외 소포체에서 유래되는 물질 중 하나인 마이크로 RNA(microRNA, miRNA)는 염기서열이 22개 이내의 암호화되지 않은(non-cording) RNA로서, 타켓 mRNA를 분해하거나 타켓 mRNA의 전사(translation)를 억제하여 유전자 발현을 조절한다. 이것의 유전자 발현 조절은 세포 분화와 세포 증식과 관련되어 있으며, 특히, 배아 발생 과정 중에 miRNA는 포착하기 어려운 시점에 발현하게 되는데, 이는 각 배아 발달 단계에 중요한 기능을 한다. 하지만 miRNA의 미분화를 조절하는 중요한 기능은 계속 발견되고 있음에도 불구하고, miRNA의 발현을 조절하는 정확한 메카니즘은 아직 밝혀지지 않고 있다. 최근 사람의 암세포에서 항암의 기능을 하는 miRNA의 후생성 발현 가능성이 제시되고 있으며, miRNA cluster의 후생성 조절에 대한 다양한 증거들이 보고되고 있다. 상세하게는 다양한 DNA 부위를 암호화하고 있는 항암 기능을 하는 miRNA는 사람의 유방암 세포주에서 비정상적인 과메틸레이션(hypermethylation) 되어있어 유전자가 활성화되지 않고 있으며, AGS 위암 세포주에서 DNMT(DNA methylatransferase)인 5-Asa-dC(5-Asadeoxycytidine)를 처리했을 때, DNA가 demethylation되면서 특정 miRNA cluster의 발현이 복구된다는 연구결과가 제시되고 있다.MicroRNA (miRNA), one of the substances derived from extracellular endoplasmic reticulum, is a non-coding RNA with 22 base sequences or less, which degrades target mRNA or inhibits the transcription of target mRNA. to regulate gene expression. Its gene expression regulation is related to cell differentiation and cell proliferation. In particular, during embryogenesis, miRNAs are expressed at elusive times, which play an important role in each stage of embryonic development. However, although the important function of regulating miRNA differentiation continues to be discovered, the precise mechanism regulating miRNA expression remains unknown. Recently, the possibility of epigenetic expression of miRNAs with anticancer functions in human cancer cells has been suggested, and various evidences for the epigenetic regulation of miRNA clusters have been reported. In detail, the anticancer miRNA encoding various DNA regions is abnormally hypermethylated in human breast cancer cell lines, so the gene is not activated, and DNMT (DNA methylatransferase) 5-Asa in AGS gastric cancer cell lines. Studies have shown that when treated with -dC (5-Asadeoxycytidine), DNA is demethylated and the expression of a specific miRNA cluster is restored.
본 발명의 목적은 활성화 T 세포의 세포외 소포체 유래인 miRNA들 중에서 면역세포의 활성을 증진시키는 miRNA들을 유효성분으로 포함하는 면역증진용 조성물을 제공하는 것이다.An object of the present invention is to provide a composition for enhancing immunity comprising, as an active ingredient, miRNAs that enhance the activity of immune cells among miRNAs derived from extracellular endoplasmic reticulum of activated T cells.
본 발명은 miR-10a-5p, miR-25-3p, miR-215-5p, miR-155-5p, miR-375, miR-148a-3p 및 miR-374b-5p로 이루어진 군에서 선택된 어느 하나 이상의 miRNA를 유효성분으로 포함하는 면역증진용 조성물을 제공한다.The present invention relates to any one or more selected from the group consisting of miR-10a-5p, miR-25-3p, miR-215-5p, miR-155-5p, miR-375, miR-148a-3p and miR-374b-5p. Provided is a composition for enhancing immunity comprising miRNA as an active ingredient.
또한, 본 발명은 T 세포에 IL-2를 처리하는 단계; 상기 T 세포로부터 세포외 소포체를 분리하는 단계; 상기 세포외 소포체로부터 miRNA를 수집하는 단계; 및 상기 수집된 miRNA들 중에서 T 세포의 IFN-γ 및 Granzyme B 유전자의 발현을 증진시키는 miRNA를 선정하는 단계를 포함하는 면역증진용 조성물의 제조 방법을 제공한다.In addition, the present invention comprises the steps of treating IL-2 to T cells; Separating extracellular vesicles from the T cells; Collecting miRNA from the extracellular vesicles; and selecting miRNAs that enhance the expression of IFN-γ and Granzyme B genes in T cells from among the collected miRNAs.
본 발명에 따르면, IL-2로 활성화된 T 세포 유래의 세포외 소포체에 함유된 miR-10a-5p, miR-25-3p, miR-215-5p, miR-155-5p, miR-375, miR-148a-3p 및 miR-374b-5p는 T 세포의 IFN-γ 및 Granzyme B 유전자의 발현 수준을 증가시키는 면역 증진 효과를 나타냄을 확인함으로써, 상기 miRNA들을 함유하는 조성물은 면역 증진용 조성물로 제공될 수 있다.According to the present invention, miR-10a-5p, miR-25-3p, miR-215-5p, miR-155-5p, miR-375, miR contained in IL-2-activated T cell-derived extracellular vesicles -148a-3p and miR-374b-5p confirm that they exhibit an immune-enhancing effect by increasing the expression levels of IFN-γ and Granzyme B genes in T cells, so that the composition containing the miRNAs can be provided as an immune-enhancing composition. can
도 1은 T 세포 유래 세포외 소포체에서 발현이 풍부한 miRNA를 데이터 분석으로 선별한 결과이다.1 is a result of selecting miRNAs with high expression in T cell-derived extracellular vesicles through data analysis.
도 2는 T 세포 유래 세포외 소포체에서 발현이 풍부한 27가지의 miRNA들이 Primary CD8+ T 세포에서 IFN-γ 및 Granzyme B 발현에 미치는 영향을 평가한 결과이다.Figure 2 shows the results of evaluating the effects of 27 miRNAs, which are abundant in T cell-derived extracellular vesicles, on IFN-γ and Granzyme B expression in primary CD8+ T cells.
도 3은 T 세포 유래 세포외 소포체에서 발현이 풍부한 miRNA들 중에서 활성이 우수한 7개의 miRNA가 Primary CD8+ T 세포에서 IFN-γ 및 Granzyme B 발현에 미치는 영향을 평가한 결과이다.3 shows the results of evaluating the effects of 7 miRNAs with excellent activity among miRNAs abundant in T cell-derived extracellular vesicles on IFN-γ and Granzyme B expression in primary CD8+ T cells.
본 명세서에서 사용되는 용어는 본 발명에서의 기능을 고려하면서 가능한 현재 널리 사용되는 일반적인 용어들을 선택하였으나, 이는 당 분야에 종사하는 기술자의 의도 또는 판례, 새로운 기술의 출현 등에 따라 달라질 수 있다. 또한, 특정한 경우는 출원인이 임의로 선정한 용어도 있으며, 이 경우 해당되는 발명의 설명 부분에서 상세히 그 의미를 기재할 것이다. 따라서 본 발명에서 사용되는 용어는 단순한 용어의 명칭이 아닌, 그 용어가 가지는 의미와 본 발명의 전반에 걸친 내용을 토대로 정의되어야 한다.The terms used in this specification have been selected from general terms that are currently widely used as much as possible while considering the functions in the present invention, but these may vary depending on the intention of a person skilled in the art, precedent, or the emergence of new technologies. In addition, in a specific case, there is also a term arbitrarily selected by the applicant, and in this case, the meaning will be described in detail in the description of the invention. Therefore, the term used in the present invention should be defined based on the meaning of the term and the overall content of the present invention, not simply the name of the term.
다르게 정의되지 않는 한, 기술적이거나 과학적인 용어를 포함해서 여기서 사용되는 모든 용어들은 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자에 의해 일반적으로 이해되는 것과 동일한 의미를 가지고 있다. 일반적으로 사용되는 사전에 정의되어 있는 것과 같은 용어들은 관련 기술의 문맥상 가지는 의미와 일치하는 의미를 가지는 것으로 해석되어야 하며, 본 출원에서 명백하게 정의하지 않는 한, 이상적이거나 과도하게 형식적인 의미로 해석되지 않는다.Unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs. Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with the meaning in the context of the related art, and unless explicitly defined in this application, it should not be interpreted in an ideal or excessively formal meaning. don't
수치 범위는 상기 범위에 정의된 수치를 포함한다. 본 명세서에 걸쳐 주어진 모든 최대의 수치 제한은 낮은 수치 제한이 명확히 쓰여 있는 것처럼 모든 더 낮은 수치 제한을 포함한다. 본 명세서에 걸쳐 주어진 모든 최소의 수치 제한은 더 높은 수치 제한이 명확히 쓰여 있는 것처럼 모든 더 높은 수치 제한을 포함한다. 본 명세서에 걸쳐 주어진 모든 수치 제한은 더 좁은 수치 제한이 명확히 쓰여 있는 것처럼, 더 넓은 수치 범위 내의 더 좋은 모든 수치 범위를 포함할 것이다.Numerical ranges are inclusive of the values defined therein. Every maximum numerical limitation given throughout this specification includes every lower numerical limitation, as if such lower numerical limitations were expressly written. Every minimum numerical limitation given throughout this specification includes every higher numerical limitation, as if such higher numerical limitations were expressly written. Every numerical limitation given throughout this specification will include every better numerical range within the broader numerical range, as if the narrower numerical limitations were expressly written.
이하, 본 발명을 보다 상세하게 설명한다.Hereinafter, the present invention will be described in more detail.
본 발명은 miR-10a-5p, miR-25-3p, miR-215-5p, miR-155-5p, miR-375, miR-148a-3p 및 miR-374b-5p로 이루어진 군에서 선택된 어느 하나 이상의 miRNA를 유효성분으로 포함하는 면역증진용 조성물을 제공한다.The present invention relates to any one or more selected from the group consisting of miR-10a-5p, miR-25-3p, miR-215-5p, miR-155-5p, miR-375, miR-148a-3p and miR-374b-5p. Provided is a composition for enhancing immunity comprising miRNA as an active ingredient.
상기 miR-10a-5p는 서열번호 5로 표시되는 염기서열로 이루어지고, 상기 miR-25-3p는 서열번호 7로 표시되는 염기서열로 이루어지고, 상기 miR-215-5p는 서열번호 11로 표시되는 염기서열로 이루어지고, 상기 miR-155-5p는 서열번호 12로 표시되는 염기서열로 이루어지고, 상기 miR-375는 서열번호 15로 표시되는 염기서열로 이루어지고, 상기 miR-148a-3p는 서열번호 18로 표시되는 염기서열로 이루어지고, 상기 miR-374b-5p는 서열번호 25로 표시되는 염기서열로 이루어질 수 있다.The miR-10a-5p consists of the nucleotide sequence represented by SEQ ID NO: 5, the miR-25-3p consists of the nucleotide sequence represented by SEQ ID NO: 7, and the miR-215-5p is represented by SEQ ID NO: 11 The miR-155-5p consists of the nucleotide sequence represented by SEQ ID NO: 12, the miR-375 consists of the nucleotide sequence represented by SEQ ID NO: 15, and the miR-148a-3p consists of the nucleotide sequence represented by SEQ ID NO: 15 It consists of the nucleotide sequence represented by SEQ ID NO: 18, and the miR-374b-5p may consist of the nucleotide sequence represented by SEQ ID NO: 25.
상기 면역증진용 조성물은 let-7a-5p, let-7f-5p, miR-148b-3p, miR-92a-3p, miR-320b, miR-4443, miR-24-3p, miR-191-5p, miR-200b-3p, miR-10b-5p, miR-221-3p, miR-199a-3p, miR-484, miR-197-3p, miR-340-5p, miR-374c-3p, miR-130b-5p, miR-19b-3p, miR-185-5p 및 let-7g-5p로 이루어진 군에서 선택된 어느 하나 이상의 miRNA를 추가로 더 포함할 수 있다.The composition for enhancing immunity is let-7a-5p, let-7f-5p, miR-148b-3p, miR-92a-3p, miR-320b, miR-4443, miR-24-3p, miR-191-5p, miR-200b-3p, miR-10b-5p, miR-221-3p, miR-199a-3p, miR-484, miR-197-3p, miR-340-5p, miR-374c-3p, miR-130b- It may further include any one or more miRNAs selected from the group consisting of 5p, miR-19b-3p, miR-185-5p, and let-7g-5p.
상기 let-7a-5p는 서열번호 1로 표시되는 염기서열로 이루어지고, 상기 let-7f-5p는 서열번호 2로 표시되는 염기서열로 이루어지고, 상기 miR-148b-3p는 서열번호 3으로 표시되는 염기서열로 이루어지고, 상기 miR-92a-3p는 서열번호 4로 표시되는 염기서열로 이루어지고, 상기 miR-320b는 서열번호 6으로 표시되는 염기서열로 이루어지고, 상기 miR-4443은 서열번호 8로 표시되는 염기서열로 이루어지고, 상기 miR-24-3p는 서열번호 9로 표시되는 염기서열로 이루어지고, 상기 miR-191-5p는 서열번호 10으로 표시되는 염기서열로 이루어지고, 상기 miR-200b-3p는 서열번호 13으로 표시되는 염기서열로 이루어지고, 상기 miR-10b-5p는 서열번호 14로 표시되는 염기서열로 이루어지고, 상기 miR-221-3p는 서열번호 16으로 표시되는 염기서열로 이루어지고, 상기 miR-199a-3p는 서열번호 17로 표시되는 염기서열로 이루어지고, 상기 miR-484는 서열번호 19로 표시되는 염기서열로 이루어지고, 상기 miR-197-3p는 서열번호 20으로 표시되는 염기서열로 이루어지고, 상기 miR-340-5p는 서열번호 21로 표시되는 염기서열로 이루어지고, 상기 miR-374c-3p는 서열번호 22로 표시되는 염기서열로 이루어지고, 상기 miR-130b-5p는 서열번호 23으로 표시되는 염기서열로 이루어지고, 상기 miR-19b-3p는 서열번호 24로 표시되는 염기서열로 이루어지고, 상기 miR-185-5p는 서열번호 26으로 표시되는 염기서열로 이루어지고, 상기 let-7g-5p는 서열번호 27로 표시되는 염기서열로 이루어질 수 있다.The let-7a-5p consists of the nucleotide sequence represented by SEQ ID NO: 1, the let-7f-5p consists of the nucleotide sequence represented by SEQ ID NO: 2, and the miR-148b-3p is represented by SEQ ID NO: 3 The miR-92a-3p consists of the nucleotide sequence represented by SEQ ID NO: 4, the miR-320b consists of the nucleotide sequence represented by SEQ ID NO: 6, and the miR-4443 consists of the nucleotide sequence represented by SEQ ID NO: 6 8, the miR-24-3p consists of the nucleotide sequence represented by SEQ ID NO: 9, the miR-191-5p consists of the nucleotide sequence represented by SEQ ID NO: 10, and the miR-191-5p consists of the nucleotide sequence represented by SEQ ID NO: 10. -200b-3p consists of the nucleotide sequence represented by SEQ ID NO: 13, the miR-10b-5p consists of the nucleotide sequence represented by SEQ ID NO: 14, and the miR-221-3p consists of the nucleotide sequence represented by SEQ ID NO: 16 The miR-199a-3p consists of the nucleotide sequence represented by SEQ ID NO: 17, the miR-484 consists of the nucleotide sequence represented by SEQ ID NO: 19, and the miR-197-3p consists of the nucleotide sequence represented by SEQ ID NO: 19 20, the miR-340-5p consists of the nucleotide sequence represented by SEQ ID NO: 21, the miR-374c-3p consists of the nucleotide sequence represented by SEQ ID NO: 22, and the miR-374c-3p consists of the nucleotide sequence represented by SEQ ID NO: 22. -130b-5p consists of the nucleotide sequence represented by SEQ ID NO: 23, the miR-19b-3p consists of the nucleotide sequence represented by SEQ ID NO: 24, and the miR-185-5p consists of the nucleotide sequence represented by SEQ ID NO: 26 sequence, and let-7g-5p may consist of the nucleotide sequence represented by SEQ ID NO: 27.
상기 miRNA는 T 세포의 IFN-γ 및 Granzyme B 유전자의 발현 수준을 증가시킬 수 있다.The miRNA can increase the expression levels of IFN-γ and Granzyme B genes in T cells.
상기 miRNA는 IL-2에 의해 활성화된 T 세포의 세포외 소포체 유래일 수 있다. 상기 세포외 소포체는 직경이 30 내지 100nm인 작은 세포외 소포체(Small extracellular vesicles; sEV)로, 엑소좀(exosome), 미세소포(microvesicle) 등을 포함할 수 있다.The miRNA may be derived from extracellular vesicles of T cells activated by IL-2. The extracellular vesicles are small extracellular vesicles (sEVs) having a diameter of 30 to 100 nm, and may include exosomes, microvesicles, and the like.
상기 면역증진용 조성물은 흑색종, 결장암, 폐암, 피부암, 비소세포성 폐암, 결장암, 골암, 췌장암, 두부 또는 경부 암, 자궁암, 난소암, 직장암, 위암, 항문부근암, 유방암, 나팔관암종, 자궁내막암종, 자궁경부암종, 질암종, 음문암종, 호킨스씨병, 식도암, 소장암, 내분비선암, 갑상선암, 부갑상선암, 부신암, 연조직 육종, 요도암, 음경암, 전립선암, 만성 또는 급성 백혈병, 림프구 림프종, 방광암, 신장 또는 수뇨관암, 신장세포 암종, 신장골반 암종, 중추신경계 종양, 1차 중추신경계 림프종, 척수 종양, 뇌간신경교종 및 뇌하수체 선종으로 이루어진 군에서 선택된 어느 하나 이상의 암 질환을 예방 또는 치료하기 위한 약학적 조성물로 사용될 수 있다.The composition for enhancing immunity is melanoma, colon cancer, lung cancer, skin cancer, non-small cell lung cancer, colon cancer, bone cancer, pancreatic cancer, head or neck cancer, uterine cancer, ovarian cancer, rectal cancer, stomach cancer, proximal anal cancer, breast cancer, fallopian tube carcinoma, uterus Endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hawkins' disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocyte Prevention or treatment of any one or more cancer diseases selected from the group consisting of lymphoma, bladder cancer, renal or ureteral cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system tumor, primary central nervous system lymphoma, spinal cord tumor, brainstem glioma, and pituitary adenoma. It can be used as a pharmaceutical composition for
본 발명의 약학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다.The pharmaceutical composition of the present invention is prepared in unit dosage form or multi-dose by formulating using a pharmaceutically acceptable carrier according to a method that can be easily performed by those skilled in the art. It can be prepared by incorporating into a container.
상기 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸 히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다.The pharmaceutically acceptable carrier is one commonly used in formulation, and includes lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methyl hydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like. The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like in addition to the above components.
본 발명에 있어서, 상기 약학적 조성물에 포함되는 첨가제의 함량은 특별히 한정되는 것은 아니며 통상의 제제화에 사용되는 함량 범위 내에서 적절하게 조절될 수 있다.In the present invention, the content of the additives included in the pharmaceutical composition is not particularly limited and may be appropriately adjusted within the range of content used in conventional formulations.
상기 약학적 조성물은 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립, 정제, 크림, 젤, 패취, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 및 카타플라스마제로 이루어진 군으로부터 선택되는 하나 이상의 외용제 형태로 제형화될 수 있다.The pharmaceutical composition is an aqueous solution, suspension, emulsion, etc. for injection, pills, capsules, granules, tablets, creams, gels, patches, sprays, ointments, warning agents, lotions, liniment agents, pasta agents, and cataplasma agents. It may be formulated in the form of one or more external preparations selected from the group consisting of agents.
본 발명의 약학적 조성물은 제형화를 위해 추가로 있는 약학적으로 허용가능한 담체 및 희석제를 포함할 수 있다. 상기 약학적으로 허용가능한 담체 및 희석제는 전분, 당, 및 만니톨과 같은 부형제, 칼슘 포스페이트 등과 같은 충전제 및 증량제, 카르복시메틸셀룰로오스, 히드록시프로필셀룰로오스 등과 같은 셀룰로오스 유도체, 젤라틴, 알긴산염, 및 폴리비닐 피롤리돈 등과 같은 결합제, 활석, 스테아린산 칼슘, 수소화 피마자유 및 폴리에틸렌 글리콜과 같은 윤활제, 포비돈, 크로스포비돈과 같은 붕해제, 폴리소르베이트, 세틸알코올, 및 글리세롤 등과 같은 계면활성제를 포함하나, 이에 한정되지 않는다. 상기 약학적으로 허용가능한 담체 및 희석제는 대상체에게 생물학적 및 생리학적으로 친화적인 것일 수 있다. 희석제의 예로는 염수, 수용성 완충액, 용매 및/또는 분산제(dispersion media)를 들 수 있으나, 이에 제한되는 것은 아니다.The pharmaceutical composition of the present invention may further contain pharmaceutically acceptable carriers and diluents for formulation. The pharmaceutically acceptable carriers and diluents include excipients such as starch, sugar and mannitol, fillers and extenders such as calcium phosphate, cellulose derivatives such as carboxymethylcellulose and hydroxypropylcellulose, gelatin, alginates, and polyvinyl fibres. binders such as rolidone, etc., lubricants such as talc, calcium stearate, hydrogenated castor oil and polyethylene glycol, disintegrants such as povidone, crospovidone, surfactants such as polysorbates, cetyl alcohol, and glycerol; don't The pharmaceutically acceptable carrier and diluent may be biologically and physiologically compatible with the subject. Examples of diluents include, but are not limited to, saline, aqueous buffers, solvents and/or dispersion media.
본 발명의 약학적 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구 투여(예를 들어, 정맥 내, 피하, 복강 내 또는 국소에 적용)할 수 있다. 경구 투여일 경우, 정제, 트로키제(troches), 로젠지(lozenge), 수용성 현탁액, 유성 현탁액, 조제 분말, 과립, 에멀젼, 하드 캡슐, 소프트 캡슐, 시럽 또는 엘릭시르제 등으로 제형화될 수 있다. 비경구 투여일 경우, 주사액, 좌제, 호흡기 흡입용 분말, 스프레이용 에어로졸제, 연고, 도포용 파우더, 오일, 크림 등으로 제형화 될 수 있다.The pharmaceutical composition of the present invention may be administered orally or parenterally (eg, intravenous, subcutaneous, intraperitoneal or topical application) depending on the desired method. For oral administration, it may be formulated into tablets, troches, lozenges, aqueous suspensions, oily suspensions, powders, granules, emulsions, hard capsules, soft capsules, syrups or elixirs. In the case of parenteral administration, it may be formulated as an injection solution, suppository, powder for respiratory inhalation, aerosol for spray, ointment, powder for application, oil, cream, etc.
본 발명의 약학적 조성물의 투여량은 환자의 상태 및 체중, 연령, 성별, 건강상태, 식이 체질 특이성, 제제의 성질, 질병의 정도, 조성물의 투여시간, 투여방법, 투여기간 또는 간격, 배설율, 및 약물 형태에 따라 그 범위가 다양할 수 있으며, 이 분야 통상의 기술자에 의해 적절하게 선택될 수 있다. 예컨대, 약 0.1 내지 10,000 mg/kg의 범위일 수 있으나 이제 제한되지 않으며, 하루 일회 내지 수회에 나누어 투여될 수 있다. The dosage of the pharmaceutical composition of the present invention depends on the condition and weight of the patient, age, sex, health condition, dietary constitution specificity, the nature of the preparation, the severity of the disease, the administration time of the composition, the administration method, the administration period or interval, and the excretion rate. , And the range may vary depending on the type of drug, and may be appropriately selected by a person skilled in the art. For example, it may be in the range of about 0.1 to 10,000 mg/kg, but is not limited thereto, and may be divided and administered once or several times a day.
상기 약학적 조성물은 목적하는 방법에 따라 경구 투여되거나 비경구 투여(예를 들면, 정맥 내, 피하 내, 복강 내 또는 국소에 적용)될 수 있다. 본 발명의 약학적 조성물의 약학적 유효량, 유효 투여량은 약학적 조성물의 제제화 방법, 투여 방식, 투여 시간 및/또는 투여 경로 등에 의해 다양해질 수 있으며, 당해 기술 분야에서 통상의 지식을 가진 자는 목적하는 치료에 효과적인 투여량을 용이하게 결정하고 처방할 수 있다. 본 발명의 약학적 조성물의 투여는 하루에 1회 투여될 수 있고, 수회에 나누어 투여될 수도 있다.The pharmaceutical composition may be administered orally or parenterally (eg, intravenous, subcutaneous, intraperitoneal or topical application) depending on the desired method. The pharmaceutically effective amount and effective dose of the pharmaceutical composition of the present invention may vary depending on the formulation method, administration method, administration time and/or administration route of the pharmaceutical composition, and those skilled in the art can use the purpose Dosages effective for treatment can be easily determined and prescribed. Administration of the pharmaceutical composition of the present invention may be administered once a day, or may be divided into several administrations.
또한, 본 발명은 T 세포에 IL-2를 처리하는 단계; 상기 T 세포로부터 세포외 소포체를 분리하는 단계; 상기 세포외 소포체로부터 miRNA를 수집하는 단계; 및 상기 수집된 miRNA들 중에서 T 세포의 IFN-γ 및 Granzyme B 유전자의 발현을 증진시키는 miRNA를 선정하는 단계를 포함하는 면역증진용 조성물의 제조 방법을 제공한다.In addition, the present invention comprises the steps of treating IL-2 to T cells; Separating extracellular vesicles from the T cells; Collecting miRNA from the extracellular vesicles; and selecting miRNAs that enhance the expression of IFN-γ and Granzyme B genes in T cells from among the collected miRNAs.
이하, 본 발명의 이해를 돕기 위하여 실시예를 들어 상세하게 설명하기로 한다. 다만 하기의 실시예는 본 발명의 내용을 예시하는 것일 뿐 본 발명의 범위가 하기 실시예에 한정되는 것은 아니다. 본 발명의 실시예는 당업계에서 평균적인 지식을 가진 자에게 본 발명을 보다 완전하게 설명하기 위해 제공되는 것이다.Hereinafter, examples will be described in detail to aid understanding of the present invention. However, the following examples are merely illustrative of the contents of the present invention, but the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more completely explain the present invention to those skilled in the art.
실시예 1. 세포 배양Example 1. Cell culture
Primary CD4+ T 세포(인간 CD4+ T 세포) 및 Primary CD8+ T 세포(인간 CD8+ T 세포)는 10% 우태아혈청(FBS)과 1% 페니실린 및 스트렙토마이신(Hyclone)이 첨가된 RPMI 1640 배지에서 배양하였다.Primary CD4+ T cells (human CD4+ T cells) and primary CD8+ T cells (human CD8+ T cells) were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin and streptomycin (Hyclone).
실시예Example 2. 인간 말초혈액 2. Human peripheral blood 단핵세포(PBMC)에서In mononuclear cells (PBMC) Primary CD4+ T 세포 및 Primary CD8+ T 세포 분리 Isolation of primary CD4+ T cells and primary CD8+ T cells
50ml 주사기(syringe)를 이용하여 50ml씩 혈액을 채취한 후 헤파린(heparin)이 내포된 진공기(BD Vacutainer)에 옮긴 후 550xg에서 10분 동안 원심 분리하여 상층액을 제거하였다. 이후 PBS와 1:1로 섞어주었다. 이후, PBS를 섞은 혈액을 8ml당 ficoll(GE Healthcare) 5ml을 넣어주고 550xg에서 30분 동안 원심 분리하였다. 이후, 상층액을 제거하고 Buffy coat층을 새로운 50ml conical tube에 옮겼다. 30ml까지 PBS를 넣어준 후 550xg에서 10분 동안 원심 분리하였다. 이후 pellet을 10% FBS와 1% 페니실린 및 스트렙토마이신이 첨가된 RPMI 1640 배지로 섞어주고 10cm 플레이트(Cat, 430167; Corning)에 16시간 동안 배양하였다.50ml of blood was collected using a 50ml syringe, transferred to a vacuum containing heparin (BD Vacutainer), and then centrifuged at 550xg for 10 minutes to remove the supernatant. Then, it was mixed with PBS in a ratio of 1:1. Thereafter, 5 ml of ficoll (GE Healthcare) per 8 ml of blood mixed with PBS was added and centrifuged at 550xg for 30 minutes. Then, the supernatant was removed and the buffy coat layer was transferred to a new 50ml conical tube. After adding PBS up to 30ml, centrifugation was performed at 550xg for 10 minutes. Then, the pellet was mixed with RPMI 1640 medium supplemented with 10% FBS, 1% penicillin and streptomycin, and cultured for 16 hours in a 10 cm plate (Cat, 430167; Corning).
인간 말초혈액 단핵세포를 16시간 동안 배양한 후, Human CD4+ T cell isolation kit(Cat, 130-096-533; MACS) 및 Human CD8+ T cell isolation kit(Cat, 130-096-495; MACS)를 이용하여 Primary CD4+ T 세포 및 Primary CD8+ T 세포를 분리하였다. After culturing human peripheral blood mononuclear cells for 16 hours, using Human CD4+ T cell isolation kit (Cat, 130-096-533; MACS) and Human CD8+ T cell isolation kit (Cat, 130-096-495; MACS) to separate primary CD4+ T cells and primary CD8+ T cells.
10cm 플레이트(Cat, 430167; Corning)에서 배양중인 인간 말초혈액 단핵세포의 세포 수를 trypan blue 염색을 통해 counting 후, 550xg에서 10분 동안 원심 분리하였다. 이후, 107당 40μl의 Macs buffer를 넣어주었다. 이후 Biotin-Ab cocktail을 107당 10μl 넣고 섞은 후 4℃에서 5분 동안 배양하였다. 이후 microbead cocktail을 107당 20μl 넣고 섞은 후 4℃에서 10분 동안 배양하였다. 이후 LS column을 MACS separator의 자기장에 위치시켰다. 이후 Macs buffer로 1ml씩 3번 column을 세척하였다. 이후 10분 동안 배양시켰던 세포 상층액을 column에 넣고 flow-through를 5ml tube에 받았다. 상기 과정을 3번 반복하여 총 3ml의 세포 상층액을 받고 550xg에서 10분 동안 원심 분리하였다. 이후 pellet을 10% FBS와 1% 페니실린 및 스트렙토마이신이 첨가된 RPMI 1640 배지로 섞어주고 10cm 플레이트(Cat, 430167; Corning)에 배양하였다.The number of cells of human peripheral blood mononuclear cells cultured in a 10 cm plate (Cat, 430167; Corning) was counted by trypan blue staining, and then centrifuged at 550xg for 10 minutes. Then, 40 μl of Macs buffer was added per 10 7 . Thereafter, 10 μl of Biotin-Ab cocktail was added per 10 7 , mixed, and incubated at 4° C. for 5 minutes. Thereafter, 20 μl of microbead cocktail was added per 10 7 , mixed, and incubated at 4° C. for 10 minutes. Then, the LS column was placed in the magnetic field of the MACS separator. After that, the column was washed 3 times with 1 ml of Macs buffer. Then, the cell supernatant cultured for 10 minutes was put into the column and flow-through was received in a 5ml tube. The above process was repeated three times to receive a total of 3 ml of cell supernatant and centrifuged at 550xg for 10 minutes. Then, the pellet was mixed with RPMI 1640 medium supplemented with 10% FBS, 1% penicillin and streptomycin, and cultured on a 10 cm plate (Cat, 430167; Corning).
실시예 3. Primary CD4+ T 세포 유래의 세포외 소포체(sEV) 분리Example 3. Isolation of extracellular vesicles (sEVs) derived from primary CD4+ T cells
CD4+ T 세포를 10cm 플레이트(Cat. 430167; Corning) 당 2 × 106 밀도로 첨가하고, IL-2 500IU/ml의 농도로 처리한 플레이트와 처리하지 않은 플레이트로 나눈 다음 48시간 동안 배양하였다. 이후, 세포외 소포체를 수집하기 위해, 배지를 FBS가 첨가되지 않은 배지로 교체하여 24시간 동안 추가 배양하였다. 세포 배양 상층액을 회수한 후 원심 분리하여 세포 및 잔해물을 제거하였다. 이후 CD4+ T 세포 유래의 세포외 소포체(CE) 또는 IL-2에 의해 활성화된 T 세포 유래의 세포외 소포체(IL-2E)를 분리하기 위해, 각 세포에서 얻은 각 상등액을 300xg, 2500xg 및 10,000xg으로 연속 원심 분리하였다. 이어서, 상등액을 0.2μm 주사기 필터로 여과하고, 120,000xg에서 원심 분리하였다. 세포외 소포체 펠릿을 PBS에 재현탁하고 다시 120,000xg에서 원심 분리하였다. 정제된 펠릿은 다음 실험을 위해 PBS 또는 1X 세포 용해 완충액에 재현탁하였다.CD4+ T cells were added at a density of 2 × 10 6 per 10 cm plate (Cat. 430167; Corning), divided into plates treated with IL-2 at a concentration of 500 IU/ml and untreated plates, and cultured for 48 hours. Thereafter, in order to collect the extracellular vesicles, the medium was replaced with a medium without FBS and further cultured for 24 hours. After collecting the cell culture supernatant, cells and debris were removed by centrifugation. Then, in order to isolate CD4+ T cell-derived extracellular vesicles (CE) or IL-2-derived T cell-derived extracellular vesicles (IL-2E), each supernatant obtained from each cell was 300xg, 2500xg, and 10,000xg was continuously centrifuged. The supernatant was then filtered through a 0.2 μm syringe filter and centrifuged at 120,000×g. The extracellular endoplasmic reticulum pellet was resuspended in PBS and centrifuged again at 120,000xg. The purified pellet was resuspended in PBS or 1X cell lysis buffer for the next experiment.
실시예Example 4. Primary CD4+ T 세포 유래의 4. Primary CD4+ T cell-derived 세포외extracellular 소포체( endoplasmic reticulum ( sEVsEVs )에 대한 small RNA sequencing) for small RNA sequencing
4-1. RNA 분리4-1. RNA isolation
전체 RNA는 제조업체의 지침에 따라 Trizol 시약(Invitrogen, Carlsbad, CA, USA)을 사용하여 추출되었다. RNA 품질은 RNA 6000 Pico Chip(Agilent Technologies, Amstelveen, The Netherlands)을 사용하여 Agilent 2100 bioanalyzer에 의해 평가되었으며, RNA 정량화는 NanoDrop 2000 Spectrophotometer 시스템(Thermo Fisher Scientific, Waltham, MA, USA)을 사용하여 수행되었다.Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. RNA quality was assessed by an Agilent 2100 bioanalyzer using an RNA 6000 Pico Chip (Agilent Technologies, Amstelveen, The Netherlands) and RNA quantification was performed using a NanoDrop 2000 Spectrophotometer system (Thermo Fisher Scientific, Waltham, MA, USA) .
4-2. 라이브러리 준비 및 시퀀싱4-2. Library preparation and sequencing
제어 및 테스트 RNA의 경우 제조업체의 지침에 따라 NEB Next Multiplex Small RNA Library Prep kit(New England BioLabs, Inc., USA)를 사용하여 라이브러리 구축을 수행했다. 간단히 말해, 라이브러리 구성을 위해 각 샘플의 총 RNA를 1μg로 어댑터를 결찰한 다음 어댑터 특이적 프라이머와 함께 역전사 효소를 사용하여 cDNA를 합성했다. 라이브러리 증폭을 위해 PCR을 수행하고 QIAquick PCR Purification Kit(Quaigen, Inc, German) 및 AMPure XP 비드(Beckmancoulter, Inc., USA)를 사용하여 라이브러리를 정리했다. 고감도 DNA 분석(Agilent Technologies, Inc., USA)을 위해 Agilent 2100 Bioanalyzer 기기로 소형 RNA 라이브러리의 수율 및 크기 분포를 평가했다. High-throughput 시퀀스는 Single-end 75 시퀀싱(Illumina, SanDiego, CA., USA)의 방식으로 Next Seq 500 시스템에 의해 생성되었다.For control and test RNA, library construction was performed using the NEB Next Multiplex Small RNA Library Prep kit (New England BioLabs, Inc., USA) according to the manufacturer's instructions. Briefly, for library construction, adapters were ligated with 1 μg of total RNA from each sample, followed by cDNA synthesis using reverse transcriptase with adapter-specific primers. PCR was performed for library amplification and library cleanup using the QIAquick PCR Purification Kit (Quaigen, Inc, German) and AMPure XP beads (Beckmancoulter, Inc., USA). The yield and size distribution of small RNA libraries were evaluated with an Agilent 2100 Bioanalyzer instrument for high-sensitivity DNA analysis (Agilent Technologies, Inc., USA). High-throughput sequences were generated by the Next Seq 500 system using single-end 75 sequencing (Illumina, San Diego, CA., USA).
4-3. 데이터 분석4-3. data analysis
bam 파일(정렬 파일)을 얻기 위해 bowtie2 소프트웨어 도구로 시퀀스 읽기를 매핑했다. 성숙한 miRNA 서열은 매핑을 위한 참조로 사용했다. 성숙한 miRNA 시퀀스에 매핑된 읽기 수는 bedtools(v2.25.0) 및 R(버전 3.2.2) 통계 프로그래밍 언어를 사용하는 Bioconductor(R development Core Team, 2011)를 사용하여 정렬 파일에서 추출되었다. miRNA의 발현 수준을 결정하기 위해 읽기 수를 사용했다. Quantile normalization 방법은 샘플 간의 비교를 위해 사용되었다. Sequence reads were mapped with the bowtie2 software tool to obtain bam files (alignment files). Mature miRNA sequences were used as references for mapping. The number of reads mapped to mature miRNA sequences were extracted from alignment files using bedtools (v2.25.0) and Bioconductor (R development Core Team, 2011) using the R (version 3.2.2) statistical programming language. Read counts were used to determine the expression levels of miRNAs. Quantile normalization method was used for comparison between samples.
그 결과, 도 1과 같이 RNA-seq data는 차별적으로 발현된 genes analysis를 통하여, CD4+ T 세포에서 유래된 세포외 소포체(CE)와 IL-2에 의해 활성화된 T 세포 유래의 세포외 소포체(IL-2E)에서 발현이 현저히 높은 miRNA를 선택하였고 그 miRNA 중에서 CE와 비교하여 IL-2E에 발현이 더 높은 miRNA 후보 리스트를 선별하였다. 본 실험에 선별된 miRNA 27가지의 후보는 하기 표 1과 같다.As a result, RNA-seq data, as shown in Figure 1, through differentially expressed genes analysis, extracellular vesicles (CE) derived from CD4+ T cells and extracellular vesicles (IL) derived from T cells activated by IL-2 -2E), miRNAs with significantly higher expression were selected, and among those miRNAs, a miRNA candidate list with higher expression in IL-2E compared to CE was selected. The 27 miRNA candidates selected in this experiment are shown in Table 1 below.
miRNAmiRNAs 염기서열base sequence 서열번호sequence number
hsa-let-7a-5phsa-let-7a-5p UGAGGUAGUAGGUUGUAUAGUUUGAGGUUAGUAGGUUGUAUAGUU 1One
hsa-let-7f-5phsa-let-7f-5p UGAGGUAGUAGAUUGUAUAGUUUGAGGUAGAUAGAUUGUAUAGUU 22
hsa-miR-148b-3phsa-miR-148b-3p UCAGUGCACUACAGAACUUUGUUCAGUGCACUACAGAACUUUGU 33
hsa-miR-92a-3phsa-miR-92a-3p UAUUGCACUUGUCCCGGCCUGUUAUUGCACUUGUCCCGGCCUGU 44
hsa-miR-10a-5phsa-miR-10a-5p UACCCUGUAGAUCCGAAUUUGUGUACCCUGUAGAUCCGAAUUUGUG 55
hsa-miR-320bhsa-miR-320b AAAAGCUGGGUUGAGAGGGCAAAAAAGCUGGGUUGAGAGGGCAA 66
hsa-miR-25-3phsa-miR-25-3p CAUUGCACUUGUCUCGGUCUGACAUUGCACUUGUCUCGGUCUGA 77
hsa-miR-4443hsa-miR-4443 UUGGAGGCGUGGGUUUUUUGGAGGCGUGGGUUUU 88
hsa-miR-24-3phsa-miR-24-3p UGGCUCAGUUCAGCAGGAACAGUGGCUCAGUUCAGCAGGAACAG 99
hsa-miR-191-5phsa-miR-191-5p CAACGGAAUCCCAAAAGCAGCUGCAACGGAAUCCCAAAAGCAGCUG 1010
hsa-miR-215-5phsa-miR-215-5p AUGACCUAUGAAUUGACAGACAUGACCUAUGAAUUGACAGAC 1111
hsa-miR-155-5phsa-miR-155-5p UUAAUGCUAAUCGUGAUAGGGGUUUAAUGCUAAUCGUGAAUGGGGU 1212
hsa-miR-200b-3phsa-miR-200b-3p UAAUACUGCCUGGUAAUGAUGAUAAUACUGCCUGGUAAUGAUGA 1313
hsa-miR-10b-5phsa-miR-10b-5p UACCCUGUAGAACCGAAUUUGUGUACCCUGUAGAACCGAAUUUGUG 1414
hsa-miR-375hsa-miR-375 GCGACGAGCCCCUCGCACAAACC GCGACGAGCCCCUCGCACAAACC 1515
hsa-miR-221-3phsa-miR-221-3p AGCUACAUUGUCUGCUGGGUUUCAGCUACAUUGUCUGCUGGGUUUC 1616
hsa-miR-199a-3phsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUAACAGUAGUCUGCACAUUGGUUA 1717
hsa-miR-148a-3phsa-miR-148a-3p UCAGUGCAUCACAGAACUUUGUUCAGUGCAUCACAGAACUUUGU 1818
hsa-miR-484hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAUUCAGGCUCAGUCCCCUCCCGAU 1919
hsa-miR-197-3phsa-miR-197-3p UUCACCACCUUCUCCACCCAGCUUCACCACCUUCUCCACCCAGC 2020
hsa-miR-340-5phsa-miR-340-5p UUAUAAAGCAAUGAGACUGAUUUUAUAAAGCAAUGAGACUGAUU 2121
hsa-miR-374c-3phsa-miR-374c-3p CACUUAGCAGGUUGUAUUAUAUCACUUAGCAGGUUGUAUUAUAU 2222
hsa-miR-130b-5phsa-miR-130b-5p ACUCUUUCCCUGUUGCACUACACUCUUUCCCUGUUGCACUAC 2323
hsa-miR-19b-3phsa-miR-19b-3p UGUGCAAAUCCAUGCAAAACUGAUGUGCAAAUCCAUGCAAAACUGA 2424
hsa-miR-374b-5phsa-miR-374b-5p AUAUAAUACAACCUGCUAAGUGAAUAUAAUACAACCUGCUAAGUG 2525
hsa-miR-185-5phsa-miR-185-5p UGGAGAGAAAGGCAGUUCCUGAUGGAGAGAAAGGCAGUUCCUGA 2626
hsa-let-7g-5phsa-let-7g-5p UGAGGUAGUAGUUUGUACAGUUUGAGGUAGUAGUUUGUACAGUU 2727
실시예Example 5. 분리된 Primary CD8+ T 세포에 5. In isolated primary CD8+ T cells microRNAmicroRNA mimic mimic oligo의oligo 형질주입 transfection
12 well plate(REF; 3513, Corning)에 10% FBS가 첨가된 RPMI 1640 배지 1.5ml를 분주하였다. 이후 분리된 Primary CD8+ T 세포를 0.5mL Supplement 1(Cat; V4XP-3024, Lonza)과 2.25mL P3 Primary Cell Nucleofector Solution(Cat; V4XP-3024, Lonza)을 섞은 solution으로 섞어서 100μl에 1~2 × 106 세포가 들어가는 비율로 만든 후, 각각 새로운 e-tube에 100μl씩 분주하여 나누었다. 해당 e-tube에 10μM 농도의 hsa-miRNA mimic oligos(hsa-let-7a-5p, hsa-miR-148a-3p, hsa-miR-10a-5p, hsa-miR-320b, hsa-miR-4443, hsa-miR-155-5p, hsa-miR-191-5p, hsa-miR-24-3p, hsa-miR-10b-5p, hsa-miR-215-5p, hsa-miR-375, hsa-miR-200b-3p, hsa-miR-221-3p, hsa-miR-185-5p, hsa-miR-130b-5p, hsa-miR-374c-3p, hsa-let-7g-5p, hsa-miR-484, hsa-miR-374b-5p, hsa-miR-19b-3p, hsa-miR-340-5p, hsa-miR-199a-3p, hsa-miR-25-3p, hsa-miR-148b-3p, hsa-miR-92a-3p, hsa-miR-197-3p, hsa-let-7f-5p)을 1μl씩 분주하였다. 이후 100μl Nucleocuvette Vessel(Cat; PCK-2005, Lonza)에 각 hsa-microRNA mimic oligo가 분주된 100μl를 넣고 4D Nucleofector Core unit(Serial no 510B0263, Lonza)와 4D Nucleofector X unit(Serial no : 510 X 0441, Lonza)에 넣어 transfection을 진행하였다. 진행 후, 해당 Nucleocuvette에 10% FBS 첨가된 RPMI 1640 배지를 500μl 추가하고 Single use pipettes으로 빨아들인 후 초기에 10% FBS가 첨가된 RPMI 1640 배지 1.5 ml이 분주된 12 well plate(REF; 3513, Corning)에 분주하고 37℃, 5% CO2 incubator에서 24시간 동안 배양하였다.1.5 ml of RPMI 1640 medium supplemented with 10% FBS was dispensed into a 12 well plate (REF; 3513, Corning). Thereafter, the isolated primary CD8+ T cells were mixed with a solution of 0.5mL Supplement 1 (Cat; V4XP-3024, Lonza) and 2.25mL P3 Primary Cell Nucleofector Solution (Cat; V4XP-3024, Lonza), and 1~2 × 10 in 100μl. After making it at the rate of 6 cells, it was divided by dispensing 100 μl into each new e-tube. 10μM hsa-miRNA mimic oligos (hsa-let-7a-5p, hsa-miR-148a-3p, hsa-miR-10a-5p, hsa-miR-320b, hsa-miR-4443, hsa-miR-155-5p, hsa-miR-191-5p, hsa-miR-24-3p, hsa-miR-10b-5p, hsa-miR-215-5p, hsa-miR-375, hsa-miR- 200b-3p, hsa-miR-221-3p, hsa-miR-185-5p, hsa-miR-130b-5p, hsa-miR-374c-3p, hsa-let-7g-5p, hsa-miR-484, hsa-miR-374b-5p, hsa-miR-19b-3p, hsa-miR-340-5p, hsa-miR-199a-3p, hsa-miR-25-3p, hsa-miR-148b-3p, hsa- miR-92a-3p, hsa-miR-197-3p, hsa-let-7f-5p) were dispensed by 1 μl. Then, 100 μl of each hsa-microRNA mimic oligo was added to a 100 μl Nucleocuvette Vessel (Cat; PCK-2005, Lonza), and 4D Nucleofector Core unit (Serial no 510B0263, Lonza) and 4D Nucleofector X unit (Serial no: 510 X 0441, Lonza) and transfection was performed. After proceeding, 500 μl of RPMI 1640 medium supplemented with 10% FBS was added to the Nucleocuvette, sucked up with single use pipettes, and then 12 well plate (REF; 3513, Corning ) and cultured for 24 hours in a 37°C, 5% CO 2 incubator.
실시예Example 6. 6. hsahsa -- miRNAmiRNAs mimic mimic oligos의oligos 형질주입 후 Primary CD8+ T 세포의 세포독성능력 평가 Evaluation of cytotoxic ability of primary CD8+ T cells after transfection
6-1. 실시간 중합효소 연쇄반응6-1. real-time polymerase chain reaction
상기 실시예 5에서 hsa-miRNA mimic oligos를 Primary CD8+ T 세포에 형질주입시킨 후, 해당 세포로부터 mRNA(Cat; R2062, ZYMO RESEARCH)를 추출한 뒤, nanodrop(DS-11 Series Spectrophotometer; DeNovix)을 이용하여 mRNA의 농도를 측정하였다. 이후 100ng의 mRNA로 cDNA(PrimeScriptTM 1st strand cDNA Synthesis Kit, # 6110A; TaKaRa)를 합성한 후, TB GreenTM Premix Ex TaqTM(Tli RNaseH Plus) kit(# RR420A; TaKaRa)를 사용하여 유전자 발현을 검출하였다. 본 실험에 사용된 프라이머는 하기 표 2와 같다.After transfecting hsa-miRNA mimic oligos into primary CD8+ T cells in Example 5, mRNA (Cat; R2062, ZYMO RESEARCH) was extracted from the cells, and then using nanodrop (DS-11 Series Spectrophotometer; DeNovix) The concentration of mRNA was measured. After synthesizing cDNA (PrimeScriptTM 1st strand cDNA Synthesis Kit, # 6110A; TaKaRa) with 100ng of mRNA, gene expression was detected using TB GreenTM Premix Ex TaqTM (Tli RNaseH Plus) kit (# RR420A; TaKaRa). Primers used in this experiment are shown in Table 2 below.
유전자gene 염기서열base sequence 서열번호sequence number
IFN-γIFN-γ FF 5'-CTG TTA CTG CCA GGA CCC AT-3'5'-CTG TTA CTG CCA GGA CCC AT-3' 2828
RR 5'-TCT GTC ACT CTC CTC TTT CCA A -3'5'-TCT GTC ACT CTC CTC TTT CCA A -3' 2929
Granzyme BGranzyme B FF 5'-AGT CTC TGA AGA GGT GCG GT-3'5'-AGT CTC TGA AGA GGT GCG GT-3' 3030
RR 5'-TTA TGG AGC TTC CCC AAC AGT G-3'5'-TTA TGG AGC TTC CCC AAC AGT G-3' 3131
실시간 중합효소 연쇄반응은 Step One Plus Real-Time PCR System(Applied Biosystems)을 사용하여 수행하였다. 시료의 상대적인 mRNA 수준은 동일한 시료의 beta-actin의 양에 대한 정규화 후 Ct(comparative threshold cycle) 분석으로 계산하였고, 초기 Ct 값으로 부터 변형된 2-△△Ct 값으로 표시하였다.Real-time polymerase chain reaction was performed using the Step One Plus Real-Time PCR System (Applied Biosystems). The relative mRNA level of the sample was calculated by Ct (comparative threshold cycle) analysis after normalization for the amount of beta-actin in the same sample, and was expressed as a modified 2 -ΔΔCt value from the initial Ct value.
그 결과, 도 2에서와 같이, 상기 표 1에 기재된 27가지의 hsa-miRNA mimic oligo에 의한 영향으로 T 세포의 활성(activation) 표지자인 IFN-γ 및 Granzyme B의 mRNA 발현 수준이 증가하는 것을 확인하였다. 이는 Primary CD8+ T 세포가 상기 표 1에 기재된 27가지 hsa-miRNA mimic oligos에 의해 암세포를 공격할 수 있는 능력이 촉진되어 항암 효과를 증진시킬 수 있음을 의미한다.As a result, as shown in FIG. 2, it was confirmed that the mRNA expression levels of IFN-γ and Granzyme B, which are T cell activation markers, increased due to the influence of the 27 hsa-miRNA mimic oligos listed in Table 1 above. did This means that the ability of primary CD8+ T cells to attack cancer cells is promoted by the 27 hsa-miRNA mimic oligos listed in Table 1, thereby enhancing anticancer effects.
6-2. 유세포 분석6-2. flow cytometry
상기 hsa-miRNA mimic oligos 중 가장 활성이 우수한 7가지의 hsa-miRNA mimic oligos(hsa-miR-10a-5p, hsa-miR-25-3p, hsa-miR-215-5p, hsa-miR-155-5p, hsa-miR-375, hsa-miR-148a-3p 및 hsa-miR-374b-5p)가 Primary CD8+ T 세포의 항암 효과를 증진시키는지 유세포 분석으로 확인하였다. hsa-miRNA mimic oligos가 형질 주입된 Primary CD8+ T 세포를 37℃, 5% CO2 incubator에서 24시간 동안 배양 후, 세포를 수확하여 PBS(Cat. SH30028.02; Hyclone)로 세척한 뒤 4% 파라포름알데하이드로 4℃에서 10분 동안 고정시켰다. 이어서, 0.1% Triton-X(CAS #. 9002-93-1; Biosesang)을 포함하는 PBS(Cat. SH30028.02; Hyclone)를 첨가하고, 4℃에서 10분 동안 반응시켜 세포를 투과시켰다. 투과 후, 5% Goat serum(REF; S-1000, Vector Laboratories) 및 1% BSA가 있는 0.1% PBST(Tween (Product No; 0777-1L, VWR LIFE SCIENCE))로 4℃에서 1시간 반응시킨 후, 시료를 1차 항체와 4℃에서 1시간 반응시킨 후 PBS로 세척하고, 2차 항체(1:2000 희석)와 4℃에서 1시간 반응시킨 후 PBS로 세척하여 유세포 분석(FACSAria III; Becton Dickinson)을 수행하였다. 데이터를 FlowJo 소프트웨어(Flowjo, Ashland, OR, USA)로 분석하였다. 본 실험에 사용된 1차 항체는 다음과 같다: GZMB(ab4059, 1:100; Abcam), IFNG(ab9657, 1:500; Abcam).Among the hsa-miRNA mimic oligos, seven hsa-miRNA mimic oligos (hsa-miR-10a-5p, hsa-miR-25-3p, hsa-miR-215-5p, hsa-miR-155-5p, hsa-miR-155- 5p, hsa-miR-375, hsa-miR-148a-3p and hsa-miR-374b-5p) enhanced the anticancer effect of primary CD8+ T cells by flow cytometry. Primary CD8+ T cells transfected with hsa-miRNA mimic oligos were cultured in a 37°C, 5% CO 2 incubator for 24 hours, and then the cells were harvested, washed with PBS (Cat. SH30028.02; Hyclone), and 4% Paralysis. It was fixed with formaldehyde at 4°C for 10 minutes. Subsequently, PBS (Cat. SH30028.02; Hyclone) containing 0.1% Triton-X (CAS #. 9002-93-1; Biosesang) was added and reacted at 4° C. for 10 minutes to permeabilize the cells. After permeation, reaction was performed at 4°C for 1 hour with 0.1% PBST (Tween (Product No; 0777-1L, VWR LIFE SCIENCE)) containing 5% Goat serum (REF; S-1000, Vector Laboratories) and 1% BSA. , The sample was reacted with primary antibody for 1 hour at 4°C, washed with PBS, reacted with secondary antibody (1:2000 dilution) for 1 hour at 4°C, washed with PBS, and analyzed by flow cytometry (FACSAria III; Becton Dickinson ) was performed. Data were analyzed with FlowJo software (Flowjo, Ashland, OR, USA). The primary antibodies used in this experiment were: GZMB (ab4059, 1:100; Abcam), IFNG (ab9657, 1:500; Abcam).
그 결과, 도 3에서와 같이, 상기 7가지의 hsa-miRNA mimic oligo에 의한 영향으로 T 세포의 활성(activation) 표지자인 IFN-γ 및 Granzyme B의 단백질 발현 수준이 증가하는 것을 확인하였다. 이는 Primary CD8+ T 세포가 상기 7가지 hsa-miRNA mimic oligos에 의해 암세포를 공격할 수 있는 능력이 촉진되어 항암 효과를 증진시킬 수 있음을 의미한다.As a result, as shown in FIG. 3, it was confirmed that the protein expression levels of IFN-γ and Granzyme B, which are T cell activation markers, increased due to the influence of the 7 hsa-miRNA mimic oligos. This means that the ability of primary CD8+ T cells to attack cancer cells is promoted by the 7 hsa-miRNA mimic oligos, thereby enhancing anticancer effects.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 즉, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다.As above, specific parts of the present invention have been described in detail, and for those skilled in the art, it is clear that these specific descriptions are only preferred embodiments, and the scope of the present invention is not limited thereby. do. That is, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims (8)

  1. miR-10a-5p, miR-25-3p, miR-215-5p, miR-155-5p, miR-375, miR-148a-3p 및 miR-374b-5p로 이루어진 군에서 선택된 어느 하나 이상의 miRNA를 유효성분으로 포함하는 면역증진용 조성물.Any one or more miRNAs selected from the group consisting of miR-10a-5p, miR-25-3p, miR-215-5p, miR-155-5p, miR-375, miR-148a-3p and miR-374b-5p are effective. Immunity enhancement composition comprising as a component.
  2. 제1항에 있어서, 상기 miR-10a-5p는 서열번호 5로 표시되는 염기서열로 이루어지고, 상기 miR-25-3p는 서열번호 7로 표시되는 염기서열로 이루어지고, 상기 miR-215-5p는 서열번호 11로 표시되는 염기서열로 이루어지고, 상기 miR-155-5p는 서열번호 12로 표시되는 염기서열로 이루어지고, 상기 miR-375는 서열번호 15로 표시되는 염기서열로 이루어지고, 상기 miR-148a-3p는 서열번호 18으로 표시되는 염기서열로 이루어지고, 상기 miR-374b-5p는 서열번호 25로 표시되는 염기서열로 이루어진 것을 특징으로 하는 면역증진용 조성물.According to claim 1, wherein the miR-10a-5p consists of the nucleotide sequence represented by SEQ ID NO: 5, the miR-25-3p consists of the nucleotide sequence represented by SEQ ID NO: 7, and the miR-215-5p consists of the nucleotide sequence represented by SEQ ID NO: 11, the miR-155-5p consists of the nucleotide sequence represented by SEQ ID NO: 12, the miR-375 consists of the nucleotide sequence represented by SEQ ID NO: 15, A composition for enhancing immunity, characterized in that miR-148a-3p consists of the nucleotide sequence represented by SEQ ID NO: 18, and miR-374b-5p consists of the nucleotide sequence represented by SEQ ID NO: 25.
  3. 제1항에 있어서, 상기 면역증진용 조성물은 let-7a-5p, let-7f-5p, miR-148b-3p, miR-92a-3p, miR-320b, miR-4443, miR-24-3p, miR-191-5p, miR-200b-3p, miR-10b-5p, miR-221-3p, miR-199a-3p, miR-484, miR-197-3p, miR-340-5p, miR-374c-3p, miR-130b-5p, miR-19b-3p, miR-185-5p 및 let-7g-5p로 이루어진 군에서 선택된 어느 하나 이상의 miRNA를 추가로 더 포함하는 것을 특징으로 하는 면역증진용 조성물.The method of claim 1, wherein the composition for enhancing immunity is let-7a-5p, let-7f-5p, miR-148b-3p, miR-92a-3p, miR-320b, miR-4443, miR-24-3p, miR-191-5p, miR-200b-3p, miR-10b-5p, miR-221-3p, miR-199a-3p, miR-484, miR-197-3p, miR-340-5p, miR-374c- 3p, miR-130b-5p, miR-19b-3p, miR-185-5p, and let-7g-5p, and any one or more miRNAs selected from the group consisting of further comprising a composition for enhancing immunity.
  4. 제3항에 있어서, 상기 let-7a-5p는 서열번호 1로 표시되는 염기서열로 이루어지고, 상기 let-7f-5p는 서열번호 2로 표시되는 염기서열로 이루어지고, 상기 miR-148b-3p는 서열번호 3으로 표시되는 염기서열로 이루어지고, 상기 miR-92a-3p는 서열번호 4로 표시되는 염기서열로 이루어지고, 상기 miR-320b는 서열번호 6으로 표시되는 염기서열로 이루어지고, 상기 miR-4443은 서열번호 8로 표시되는 염기서열로 이루어지고, 상기 miR-24-3p는 서열번호 9로 표시되는 염기서열로 이루어지고, 상기 miR-191-5p는 서열번호 10으로 표시되는 염기서열로 이루어지고, 상기 miR-200b-3p는 서열번호 13으로 표시되는 염기서열로 이루어지고, 상기 miR-10b-5p는 서열번호 14로 표시되는 염기서열로 이루어지고, 상기 miR-221-3p는 서열번호 16으로 표시되는 염기서열로 이루어지고, 상기 miR-199a-3p는 서열번호 17로 표시되는 염기서열로 이루어지고, 상기 miR-484는 서열번호 19로 표시되는 염기서열로 이루어지고, 상기 miR-197-3p는 서열번호 20으로 표시되는 염기서열로 이루어지고, 상기 miR-340-5p는 서열번호 21로 표시되는 염기서열로 이루어지고, 상기 miR-374c-3p는 서열번호 22로 표시되는 염기서열로 이루어지고, 상기 miR-130b-5p는 서열번호 23으로 표시되는 염기서열로 이루어지고, 상기 miR-19b-3p는 서열번호 24로 표시되는 염기서열로 이루어지고, 상기 miR-185-5p는 서열번호 26으로 표시되는 염기서열로 이루어지고, 상기 let-7g-5p는 서열번호 27로 표시되는 염기서열로 이루어진 것을 특징으로 하는 면역증진용 조성물.The method of claim 3, wherein the let-7a-5p consists of the nucleotide sequence represented by SEQ ID NO: 1, the let-7f-5p consists of the nucleotide sequence represented by SEQ ID NO: 2, and the miR-148b-3p consists of the nucleotide sequence represented by SEQ ID NO: 3, the miR-92a-3p consists of the nucleotide sequence represented by SEQ ID NO: 4, the miR-320b consists of the nucleotide sequence represented by SEQ ID NO: 6, and the miR-4443 consists of the nucleotide sequence represented by SEQ ID NO: 8, the miR-24-3p consists of the nucleotide sequence represented by SEQ ID NO: 9, and the miR-191-5p consists of the nucleotide sequence represented by SEQ ID NO: 10 The miR-200b-3p consists of the nucleotide sequence represented by SEQ ID NO: 13, the miR-10b-5p consists of the nucleotide sequence represented by SEQ ID NO: 14, and the miR-221-3p consists of the sequence It consists of the nucleotide sequence represented by SEQ ID NO: 16, the miR-199a-3p consists of the nucleotide sequence represented by SEQ ID NO: 17, the miR-484 consists of the nucleotide sequence represented by SEQ ID NO: 19, and the miR-484 consists of the nucleotide sequence represented by SEQ ID NO: 19. 197-3p consists of the nucleotide sequence represented by SEQ ID NO: 20, the miR-340-5p consists of the nucleotide sequence represented by SEQ ID NO: 21, and the miR-374c-3p consists of the nucleotide sequence represented by SEQ ID NO: 22 The miR-130b-5p consists of the nucleotide sequence represented by SEQ ID NO: 23, the miR-19b-3p consists of the nucleotide sequence represented by SEQ ID NO: 24, and the miR-185-5p consists of the sequence Composition for enhancing immunity, characterized in that it consists of the nucleotide sequence represented by SEQ ID NO: 26, and let-7g-5p consists of the nucleotide sequence represented by SEQ ID NO: 27.
  5. 제1항에 있어서, 상기 miRNA는 T 세포의 IFN-γ 및 Granzyme B 유전자의 발현 수준을 증가시키는 것을 특징으로 하는 면역증진용 조성물.The composition for enhancing immunity according to claim 1, wherein the miRNA increases the expression levels of IFN-γ and Granzyme B genes in T cells.
  6. 제1항에 있어서, 상기 miRNA는 IL-2에 의해 활성화된 T 세포의 세포외 소포체 유래인 것을 특징으로 하는 면역증진용 조성물.The composition for enhancing immunity according to claim 1, wherein the miRNA is derived from the extracellular endoplasmic reticulum of T cells activated by IL-2.
  7. 제1항에 있어서, 상기 면역증진용 조성물은 흑색종, 결장암, 폐암, 피부암, 비소세포성 폐암, 결장암, 골암, 췌장암, 두부 또는 경부 암, 자궁암, 난소암, 직장암, 위암, 항문부근암, 유방암, 나팔관암종, 자궁내막암종, 자궁경부암종, 질암종, 음문암종, 호킨스씨병, 식도암, 소장암, 내분비선암, 갑상선암, 부갑상선암, 부신암, 연조직 육종, 요도암, 음경암, 전립선암, 만성 또는 급성 백혈병, 림프구 림프종, 방광암, 신장 또는 수뇨관암, 신장세포 암종, 신장골반 암종, 중추신경계 종양, 1차 중추신경계 림프종, 척수 종양, 뇌간신경교종 및 뇌하수체 선종으로 이루어진 군에서 선택된 어느 하나 이상의 암 질환을 예방 또는 치료하기 위한 것을 특징으로 하는 면역증진용 조성물.The method of claim 1, wherein the composition for enhancing immunity is melanoma, colon cancer, lung cancer, skin cancer, non-small cell lung cancer, colon cancer, bone cancer, pancreatic cancer, head or neck cancer, uterine cancer, ovarian cancer, rectal cancer, stomach cancer, proximal anal cancer, Breast cancer, fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hawkins' disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, Any one or more selected from the group consisting of chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, renal or ureteric cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system tumor, primary central nervous system lymphoma, spinal cord tumor, brainstem glioma, and pituitary adenoma. A composition for enhancing immunity, characterized in that for preventing or treating cancer disease.
  8. T 세포에 IL-2를 처리하는 단계;treating T cells with IL-2;
    상기 T 세포로부터 세포외 소포체를 분리하는 단계; Separating extracellular vesicles from the T cells;
    상기 세포외 소포체로부터 miRNA를 수집하는 단계; 및Collecting miRNA from the extracellular vesicles; and
    상기 수집된 miRNA들 중에서 T 세포의 IFN-γ 및 Granzyme B 유전자의 발현을 증진시키는 miRNA를 선정하는 단계를 포함하는 면역증진용 조성물의 제조 방법.A method for preparing a composition for enhancing immunity comprising selecting miRNAs that enhance the expression of IFN-γ and Granzyme B genes in T cells from among the collected miRNAs.
PCT/KR2022/011068 2021-08-05 2022-07-27 Composition comprising mirna derived from extracellular vesicles of activated t cells as active ingredient, and uses thereof WO2023013965A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2021-0102881 2021-08-05
KR20210102881 2021-08-05
KR10-2022-0092891 2022-07-27
KR1020220092891A KR20230022800A (en) 2021-08-05 2022-07-27 Composition comprising miRNA derived from extracellular vesicles of activated T cells as an active ingredient and use thereof

Publications (1)

Publication Number Publication Date
WO2023013965A1 true WO2023013965A1 (en) 2023-02-09

Family

ID=85154533

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/011068 WO2023013965A1 (en) 2021-08-05 2022-07-27 Composition comprising mirna derived from extracellular vesicles of activated t cells as active ingredient, and uses thereof

Country Status (1)

Country Link
WO (1) WO2023013965A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014059248A1 (en) * 2012-10-12 2014-04-17 Philadelphia Health & Education Corporation D/B/A/ Drexel Mir-155 enhancement of cd8+ t cell immunity
US20190307786A1 (en) * 2016-10-27 2019-10-10 The Regents Of The University Of California Microrna in t cell activation
WO2020157288A1 (en) * 2019-02-01 2020-08-06 Universität Basel Calcineurin inhibitor resistant immune cells for use in adoptive cell transfer therapy
KR20210027080A (en) * 2019-09-02 2021-03-10 경북대학교 산학협력단 Composition for preventing or treating cancer diseases comprising IL-2 expressed extracellular vesicles

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014059248A1 (en) * 2012-10-12 2014-04-17 Philadelphia Health & Education Corporation D/B/A/ Drexel Mir-155 enhancement of cd8+ t cell immunity
US20190307786A1 (en) * 2016-10-27 2019-10-10 The Regents Of The University Of California Microrna in t cell activation
WO2020157288A1 (en) * 2019-02-01 2020-08-06 Universität Basel Calcineurin inhibitor resistant immune cells for use in adoptive cell transfer therapy
KR20210027080A (en) * 2019-09-02 2021-03-10 경북대학교 산학협력단 Composition for preventing or treating cancer diseases comprising IL-2 expressed extracellular vesicles

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DIAZ-SALAZAR CARLOS, SUN JOSEPH C.: "Coordinated Viral Control by Cytotoxic Lymphocytes Ensures Optimal Adaptive NK Cell Responses", CELL REPORTS, ELSEVIER INC, US, vol. 32, no. 12, 1 September 2020 (2020-09-01), US , pages 108186, XP093032581, ISSN: 2211-1247, DOI: 10.1016/j.celrep.2020.108186 *
RODRÍGUEZ-GALÁN ANA, FERNÁNDEZ-MESSINA LOLA, SÁNCHEZ-MADRID FRANCISCO: "Control of Immunoregulatory Molecules by miRNAs in T Cell Activation", FRONTIERS IN IMMUNOLOGY, vol. 9, 25 September 2018 (2018-09-25), XP093032579, DOI: 10.3389/fimmu.2018.02148 *

Similar Documents

Publication Publication Date Title
US11091538B2 (en) Use of regulatory T cell-specific surface protein LRIG-1
WO2017131352A1 (en) Composition for inducing beige adipocyte differentiation containing exosome extracted from stem cells
WO2022102887A1 (en) Mass proliferation culture method of nk cells
WO2021241981A1 (en) Composition for preventing or treating cancer
WO2017082562A1 (en) Stem cell with suppressed socs and improved immunosuppressive ability and use thereof
WO2023013965A1 (en) Composition comprising mirna derived from extracellular vesicles of activated t cells as active ingredient, and uses thereof
WO2021150078A1 (en) Off-the-shelf stem cells and immune cells, and pharmaceutical composition comprising same
WO2022045813A1 (en) Pharmaceutical composition for treating, preventing, or inhibiting metastasis of lung cancer, comprising exosome as active ingredient
WO2017188790A1 (en) Method for proliferating and culturing immune cells by using hypoxic conditions
Goupille et al. BET bromodomain inhibition rescues erythropoietin differentiation of human erythroleukemia cell line UT7
KR20230022800A (en) Composition comprising miRNA derived from extracellular vesicles of activated T cells as an active ingredient and use thereof
WO2017086744A1 (en) Pharmaceutical composition for preventing and treating cancer or cancer metastasis, containing pstl1 protein as active ingredient
WO2023013970A1 (en) Composition containing mirna derived from extracellular vesicles of t cells as active ingredient and use thereof
WO2014098314A1 (en) Cell model for neovascular diseases using ebv-infected human retinal pigment epithelial cells
WO2012036437A9 (en) Immunogenic peptide and composition having the peptide for preventing or treating hpv-related disease
WO2021071126A1 (en) Composition, for prevention or treatment of cancer disease, comprising cytotoxic t cells activated by t helper cell-derived extracellular vesicles as active ingredient
WO2021141237A1 (en) Composition for reinforcing function of stem cell
WO2020153800A2 (en) Composition for preventing or treating triple negative breast cancer, containing tumor infiltrating lymphocytes as active ingredient
WO2024072052A1 (en) Composition for treating cancer disease, comprising extracellular vesicle derived from natural killer cells with surface expression of cytokine and antibody
WO2021049880A1 (en) Use of endothelin receptor inhibitor for inhibiting exosome secretion or inhibiting pd-l1 expression
Yokozaki et al. Effect of 3, 4-dihydro-6-[4-(3, 4-dimethoxybenzoyl)-1-piperazinyl]-2 (1H)-quinolinone (vesnarinone) on the growth of gastric cancer cell lines
WO2023013955A1 (en) Pharmaceutical composition for combined administration comprising t-cell extracellular vesicles and anticancer drug as active ingredients
WO2020139027A1 (en) Immunopotentiating or anticancer activity-augmenting composition comprising mal-expressed stem cell like memory t cell as active ingredient
WO2021071127A1 (en) Composition comprising inhibitor against expression of exosomal pd-l1 as active ingredient for enhancing anticancer effect
WO2023075346A1 (en) Enhancing anticancer function of natural killer cell through regulation of antioxidant mechanism

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22853343

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE