KR20210027080A - Composition for preventing or treating cancer diseases comprising IL-2 expressed extracellular vesicles - Google Patents

Abstract

The present invention relates to a composition for preventing or treating cancer, which contains IL-2 surface expression-extracellular vesicles as an active ingredient. According to the present invention, immune cells, in which useful cytokines have been expressed on the cell surface using a lentiviral vector containing a cytokine-linker-PDGF receptor transmembrane domain, and extracellular vesicles, preferably small extracellular vesicles (sEV), which are derived from the immune cells and have useful cytokines expressed on the surface, are prepared. The extracellular vesicles are found to increase the proliferation and activity of cytotoxic T cells, and thereby increase anti-cancer immune efficacy. Thus, the extracellular vesicles having said efficacy can be usefully utilized as a pharmaceutical composition for preventing or treating cancer, a pharmaceutical composition for administration in combination with an anticancer agent, or a composition for delivering a drug or a physiologically active material.

Description

Composition for preventing or treating cancer diseases comprising IL-2 expressed extracellular vesicles as an active ingredient

The present invention relates to a composition for preventing or treating cancer diseases comprising the extracellular vesicles on which IL-2 is surface-expressed as an active ingredient.

Small extracellular vesicles (sEVs) are small vesicles with a membrane structure secreted by most cells. The diameter of sEV is approximately 30-100 nm, and various kinds of proteins, genetic materials (DNA, RNA, miRNA), and lipids derived from the cell are contained in the sEV. sEV does not come off directly from the plasma membrane, but originates in specific compartments within the cell called multivesicular bodies (MVBs), and is released and secreted out of the cell. In other words, when the fusion of the polycystic body and the plasma membrane occurs, the vesicles are released into the extracellular environment, which is called sEV. Although it is not known exactly what mechanism sEV is produced by, it is known to be released separately from a number of cell types in both normal and pathological conditions.

On the other hand, cancer is a product of uncontrolled and disordered cell proliferation caused by an excess of abnormal cells, and from a molecular biology point of view, it can be said to be a disease caused by mutations in genes. The types of cancer ranged to dozens of cancers as they have been discovered so far, and they are mainly classified according to the location of the affected tissue. Cancer is classified into benign tumors and malignant tumors. Benign tumors have a relatively slow growth rate and do not undergo metastasis moving from the original site of the tumor to other tissues, whereas malignant tumors leave the primary part and infiltrate into other tissues rapidly. It has a growing trait and is life-threatening. Most cancers initially have no symptoms, and even if there are symptoms, they are mild, so most people tend to overlook them, which is the cause of increasing cancer mortality.

Surgical therapy, chemotherapy, and radiation therapy have been used to treat cancer, but it is reported that, despite many studies, more than 50% of all cancer patients cannot be cured and die. The reason is that even if surgical resection was performed, the cancer could not remove the microscopically metastasized cancer cells, so the cancer recurs, the death of the cancer cells to the anticancer drug is not induced, or the tumor seems to decrease due to a response at the initial stage, but during treatment or at the end of the treatment. This is because cancer cells that have developed resistance to anticancer drugs increase rapidly. Today, about 60 kinds of various anticancer agents are used, and research on the development of new anticancer agents is actively progressing as knowledge about cancer incidence and characteristics of cancer cells is well known. However, most anticancer drugs cause serious side effects such as nausea and vomiting, hair loss, discoloration of the skin and nails, and nervous system side effects, and in the case of repeated long-term administration or recurrence of cancer, the cancer cells acquire resistance to anticancer drugs, resulting in loss of therapeutic effect. There is a drawback. In addition, radiation therapy induces death of cancer cells by irradiating high-energy radiation onto cancer tissues, but has a disadvantage of causing side effects by damaging normal tissues around cancer tissues.

Accordingly, the development of a multi-functional immune sEV in which useful cytokines are expressed from immune cells using cytokines specific for cancer treatment has the advantage of maximizing cancer prevention and treatment efficacy.

Korean Patent Registration No. 10-1820264 (Registered on Jan. 12, 2018)

An object of the present invention is to provide an extracellular vesicle in which cytokines are expressed on the surface.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer diseases comprising the extracellular vesicles as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for combined administration of an anticancer agent comprising the extracellular vesicles as an active ingredient.

Another object of the present invention is to provide a composition for delivery of drugs or physiologically active substances.

In order to achieve the above object, the present invention is a cytokine; Linker; And a transmembrane protein; it provides an extracellular vesicle fused thereto.

In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer diseases comprising the extracellular vesicles as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer diseases comprising the extracellular vesicles and anticancer agents as active ingredients.

In addition, the present invention includes at least one of a drug or a physiologically active substance, and a cytokine; Linker; And a transmembrane protein; comprising the fused extracellular vesicle, wherein the drug or physiologically active material is encapsulated in the extracellular vesicle lipid layer.

In the present invention, using a lentiviral vector containing a cytokine-linker-PDGF receptor transmembrane domain, an immune cell expressing a useful cytokine on the cell surface, and a cell derived from the immune cell and expressing a useful cytokine on the surface Extracellular vesicles, preferably small extracellular vesicles (sEV), were prepared, and it was confirmed that the extracellular vesicles increase the proliferation and activity of cytotoxic T cells to increase the immune anticancer efficacy. The extracellular endoplasmic reticulum having the same effect can be usefully used as a pharmaceutical composition for preventing or treating cancer diseases, a pharmaceutical composition for concurrent administration of an anticancer agent, a composition for delivering a drug or a physiologically active substance, and the like.

1 is a diagram showing the construction of a lentiviral vector consisting of a cytokine-linker-PDGF receptor transmembrane domain and a method for preparing multi-functional immune small extracellular vesicles (sEV).
2 is a result of confirming the expression level of IL-2 by performing real-time polymerase chain reaction and flow cytometry in Jurkat cells on which IL-2 is surface-expressed.
3 is a result of confirming the expression level of IL-2 by performing Western blot and ELISA analysis on ^{sEV (sEV IL-2} ) derived from Jurkat cells on which IL-2 is surface-expressed.
FIG. 4 shows an image obtained by using a transmission electron microscope of ^{sEV IL-2 using an immunogold labeling method.}
5 is a result of confirming the decrease in the number of sEVs and the expression of Rab 27a by ^{sEV IL-2 in melanoma cells.}
6 is a result of confirming the decrease in the expression of PD-L1 by ^{sEV IL-2 in melanoma cells.}
7 is a result of confirming the decrease in expression of exosomal PD-L1 by sEV ^{IL-2 in melanoma cells.}
8 is a result of confirming cell proliferation by ^{sEV IL-2 in cytotoxic T cells.}
9 is a result of confirming T cell activity by ^{sEV IL-2 in cytotoxic T cells.}
10 is a result of confirming the decrease in PD-1 expression by ^{sEV IL-2 in cytotoxic T cells.}
11 is a result of confirming apoptosis of melanoma in co-culture of cytotoxic T cells and ^{melanoma cells treated with sEV IL-2.}
12 is a result of confirming the anticancer effect of ^{sEV IL-2} in a melanoma transplanted mouse model.
13 is a result of confirming the inhibitory effect of exosomal PD-L1 derived from cancer cells by ^{sEV IL-2 in melanoma transplanted mice.}
14 is a result of confirming the anticancer effect using combination therapy with ^{sEV IL-2} and cisplatin or anti-PD-L1 antibody in a melanoma transplanted mouse model.
15 is a result of confirming the anticancer effect by Western blot using combination therapy with ^{sEV IL-2} and cisplatin or anti-PD-L1 antibody in a melanoma transplanted mouse model.

The MBC (membrane bound cytokine) platform consists of "the transmembrane domain of the cytokine-linker-PDGF (platelet-derived growth factor) receptor". The cytokine is linked to the transmembrane domain of the PDGF receptor through a flexible linker, and is expressed in a form attached to the cell membrane without being secreted outside the cell upon expression.

In the present invention, as shown in Fig. 1, the MBC platform is applied to the immune cells to produce immune cells expressing specific cytokines on the surface of cell membranes, and at the same time, sEV derived from immune cells expressing specific cytokines on the surface, referred to as an avatar thereof ( small extracellular vesicles)" was produced and its efficacy was evaluated.

Thus, the present invention is a cytokine; Linker; And a transmembrane protein; it provides extracellular vesicles fused thereto.

The cytokine is exposed to the surface of the extracellular vesicle by binding to a linker connected to a transmembrane protein penetrating the lipid layer of the extracellular vesicle.

The extracellular vesicles are cytokines; Linker; And a transmembrane domain; can be secreted from cells transfected with a viral vector.

It should be noted that the cytokine may be IL-2, but is not limited thereto.

The linker is of the general formula (GGGGS)n, (SGGGG)n, (SRSSG)n, (SGSSC)n, (GKSSGSGSESKS)n, (RPPPPC)n, (SSPPPPC)n, 　(GSTSGSGKSSEGKG)n, (GSTSGSGKSSEGSGSTKG)n, It consists of an amino acid sequence represented by (GSTSGSGKPGSGEGSTKG)n, or (EGKSSGSGSESKEF)n, wherein n may be an integer of 1 to 20.

The transmembrane domain is epidermal growth factor receptor, insulin receptor, platelet-derived growth factor (PDGF) receptor, vascular endothelial growth factor receptor, fibroblast growth factor receptor, cholecystokinin (CCK) receptor, neurotrophic factor (Neurotrophic factor; NGF) receptor, hepatocyte growth factor (HGF) receptor, ephrin (Eph) receptor, angiopoietin receptor, and RTK (Related to receptor tyrosine kinase) receptor. It should be noted that it may be a transmembrane domain of one or more receptors, but is not limited thereto.

It should be noted that the cell is a T cell, and more specifically, may be a helper T cell, but is not limited thereto.

The extracellular endoplasmic reticulum can increase the anticancer effect by increasing the proliferation and activity of cytotoxic T cells.

The extracellular vesicles are small extracellular vesicles (sEV) having a diameter of 30 to 100 nm, and may include exosomes, microvesicles, etc., but are not limited thereto. do.

In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer diseases comprising the extracellular vesicles as an active ingredient.

The cancer diseases include melanoma, colon cancer, lung cancer, skin cancer, non-small cell lung cancer, colon cancer, bone cancer, pancreatic cancer, head or neck cancer, uterine cancer, ovarian cancer, rectal cancer, gastric cancer, muscle cancer of the anus, breast cancer, fallopian tube carcinoma, endometrial carcinoma. , Cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hawkins' disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, It may be selected from the group consisting of bladder cancer, kidney or ureter cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system tumor, primary central nervous system lymphoma, spinal cord tumor, brainstem glioma and pituitary adenoma, but is not limited thereto. do.

It should be noted that the pharmaceutical composition may be administered in combination with an anticancer agent or an antibody, but is not limited thereto.

In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer diseases comprising the extracellular vesicles and an anticancer agent as an active ingredient, that is, a pharmaceutical composition for administration in combination with an anticancer agent for preventing or treating cancer diseases.

The anticancer agents cisplain, vinblastine, vincristine, actinomycin-D, 5-fluouracil, docetaxel, cabazitaxel (cabazitaxel), paclitaxel (paclitaxel), and pembrolizumab may be one or more selected from the group consisting of, but is not limited thereto.

The pharmaceutical composition may be administered in combination with the anticancer agent to increase the therapeutic effect on cancer diseases.

For administration, the pharmaceutical composition of the present invention may contain a pharmaceutically acceptable carrier, excipient, or diluent in addition to the above-described active ingredients. Examples of the carrier, excipient and diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oils.

The pharmaceutical compositions of the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, or sterile injectable solutions according to a conventional method. . Specifically, when formulated, it may be prepared using diluents or excipients such as fillers, weight agents, binders, wetting agents, disintegrants, and surfactants that are commonly used. Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, capsules, and the like. Such a solid preparation may be prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose, lactose, gelatin, etc. in addition to the active ingredient. In addition, in addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. It can be prepared by adding various excipients, such as wetting agents, sweetening agents, fragrances, preservatives, and the like, in addition to liquids and liquid paraffins for oral use. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, and tasks. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like may be used. As a base for suppositories, witepsol, macrosol, Tween 61, cacao butter, laurin paper, glycerogelatin, and the like can be used.

A suitable dosage of the pharmaceutical composition of the present invention varies depending on the condition and weight of the patient, the severity of the disease, the form of the drug, and the time, but may be appropriately selected by a person skilled in the art. The daily dosage of the composition is preferably It is 0.001 mg/kg to 50 mg/kg, and it can be administered once to several times a day, if necessary.

In addition, the present invention includes at least one of a drug or a physiologically active substance, and a cytokine; Linker; And a transmembrane protein; comprising the fused extracellular vesicle, wherein the drug or physiologically active material is encapsulated in the extracellular vesicle lipid layer.

It should be noted that the cytokine may be IL-2, but is not limited thereto.

The linker is of the general formula (GGGGS)n, (SGGGG)n, (SRSSG)n, (SGSSC)n, (GKSSGSGSESKS)n, (RPPPPC)n, (SSPPPPC)n, 　(GSTSGSGKSSEGKG)n, (GSTSGSGKSSEGSGSTKG)n, It consists of an amino acid sequence represented by (GSTSGSGKPGSGEGSTKG)n, or (EGKSSGSGSESKEF)n, wherein n may be an integer of 1 to 20.

The transmembrane domain is epidermal growth factor receptor, insulin receptor, platelet-derived growth factor (PDGF) receptor, vascular endothelial growth factor receptor, fibroblast growth factor receptor, cholecystokinin (CCK) receptor, neurotrophic factor (Neurotrophic factor; NGF) receptor, hepatocyte growth factor (HGF) receptor, ephrin (Eph) receptor, angiopoietin receptor, and RTK (Related to receptor tyrosine kinase) receptor. It should be noted that it may be a transmembrane domain of one or more receptors, but is not limited thereto.

The drug is selected from the group consisting of anticancer agents, anti-inflammatory analgesics, antibiotics, antibacterial agents, and vaccines, and the physiologically active material may be selected from the group consisting of peptides, proteins, hormones, and genes, but is not limited thereto. .

Hereinafter, the present invention will be described in more detail through examples. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example 1: Cell culture

HEK-293FT cells (human embryonic kidney), B16F10 (mouse melanoma), B16F10-luc-g5 (mouse melanoma) were cultured in DMEM medium (Hyclone) supplemented with 10% fetal calf serum, 1% penicillin and streptomycin. Jurkat cells (human T lymphocytes) were cultured in RPMI 1640 medium (Hyclone) supplemented with 10% fetal calf serum, 1% penicillin and streptomycin, and SK-MEL-28 (human melanoma) was 10% fetal fetal. It was cultured in EMEM medium (Hyclone) to which serum, 1% penicillin and streptomycin were added. CTLL-2 cells (mouse cytotoxic T lymphocytes) were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum, 1% penicillin and streptomycin, and 20-100 IU/mL of recombinant IL-2 (R&D systems). .

Example 2: Lentivirus production

A lentiviral vector containing the transmembrane domain of the antibody-linker-PDGF receptor was constructed with reference to the paper (Proc Natl Acad Sci US A. 2013 May 14;110(20):8099-104), which is IL-2- Linker (GSTSGSGKPGSGEGSTKG)-Reconstituted with a lentiviral vector containing the transmembrane domain of the PDGF receptor and cloned.

For transfection, HEK-293FT cells were seeded in 6 well plates at a ^{density of about 1 X 10 6} cells/well, and Lipofectamine® 2000 Reagent (ref. 11668-) in Opti-MEM (ref.31985-070; Gibco) medium. 027; Thermo fisher scientific), a lentiviral vector expressing the IL-2, pCMVD (# PS100001; Origene), and pVSVg (# 1733; Addgene) virus packaging vector in a ratio of 1:1: 1 after treatment Incubated overnight at 37°C. The next day, the supernatant was removed and replaced with a fresh medium to which 10% fetal calf serum was added. After 48 hours, the virus-containing supernatant was collected, and cell debris was removed by centrifugation and using a surfactant-free cellulose acetate (SFCA) membrane filtration device (0.22 μm; Corning). The titer of the lentivirus was measured using the Lenti-X p24 rapid titer kit (# 632200; Takara). The lentivirus was aliquoted and frozen at -80°C.

Example 3: Transduction into Jurkat cells using lentivirus

A lentivirus expressing 10 μg/mL of polybrene and 500 μg/mL of IL-2 was added to 0.3 mL RPMI medium ^{and treated with Jurkat cells (1 X 10 6} cells/ml). The lentivirus and cell mixture was centrifuged at 30° C. at 1,200 xg for 90 minutes to perform spinoculation. Thereafter, the cells were cultured overnight at 37° C. with the lentivirus. Excess virus was removed, and fresh medium containing 10% fetal calf serum was added the next day.

Example 4: Analysis of IL-2 expression in Jurkat cells using real-time polymerase chain reaction

After extracting mRNA (mRNA extraction kit, # 9767; TaKaRa) from Jurkat cells transfected with a lentiviral vector, the concentration of mRNA was measured using a nanodrop (DS-11 Series Spectrophotometer; DeNovix). After that, after synthesizing cDNA (SuperScript III First-Strand Synthesis System, Ref. 18080-051; invitrogen) with 100 ng of mRNA, real-time polymerase chain reaction was performed to obtain IL-2 (Forward: agacccagggacttaatcag, Reverse: acaatggttgctgtctcatc). Gene expression levels were analyzed.

As a result, as shown in FIG. 2(A), it was confirmed that the gene expression of IL-2 was increased by about 1,600 times in Jurkat cells transfected with lentivirus compared to the control group.

Example 5: Analysis of IL-2 expression in Jurkat cells using flow cytometry

To confirm the expression of IL-2 on the cell surface, Jurkat cells transfected with lentivirus were washed once with phosphate buffered saline (PBS) and then fixed with 4% formaldehyde. Thereafter, 1% bovine serum albumin (BSA) and 5% goat serum were added to PBS for 1 hour blocking at 4°C. Next, reacted with anti-Flag antibody (# 8146; CST) for 1 hour at 4°C, washed 3 times with PBS, reacted with FITC-conjugated secondary antibody at 4°C for 1 hour, washed 3 times with PBS, and flow cytometry The analysis was carried out.

As a result, it was confirmed that the protein expression of IL-2 was increased by about 46% on the surface of Jurkat cells transfected with lentivirus compared to the control, as shown in FIG. 2(B).

2(C), Jurkat cells transfected with lentivirus were isolated using a flow cytometer.

Example 6: sEV purification

Control Jukat cells or Jukat cells expressing IL-2 ^{were inoculated at a density of about 2 X 10 6} cells/well, and cultured in RPMI medium to which fetal calf serum was not added for 24 hours. Subsequently, in order to separate sEV or sEV ^IL-2 , each supernatant obtained from each cell was continuously centrifuged at 300 xg, 2500 xg, and 10,000 xg. Then, the supernatant was filtered through a 0.2 μm syringe filter and centrifuged at 120,000 xg. The sEV pellet was resuspended in PBS and centrifuged again at 120,000 xg. The purified sEV pellet was resuspended in PBS or 1X cell lysis buffer for the next experiment.

Example 7: Analysis of IL-2 expression of sEV using ELISA assay

^{After separating and purifying sEV IL-2} from Jurkat cells transfected with lentivirus, an enzyme-linked immunosorbent assay (ELISA) was performed to determine whether IL-2 was expressed on the sEV surface. First, an ELISA kit (#550534; BD OptEIA™ Reagent Set B) was used to confirm the expression of Flag on the surface of ^{sEV IL-2} isolated from cells. The plate was reacted with an anti-CD63 antibody (ab68418; Abcam) overnight at 4° C. to coat the plate, followed by washing 5 times using a wash buffer. ^{Thereafter, 5 μg of sEV IL-2} fixed with 4% formaldehyde (control: sEV derived from Naive Jurkat cells) was treated on the plate, attached for 1 hour at room temperature, and then blocked for 1 hour at room temperature using Assay Diluent. After reacting with anti-Flag antibody (# 8146; CST) for 1 hour at room temperature, washing was performed 5 times using a wash buffer, and reacted with HRP-conjugated secondary antibody at room temperature for 1 hour, followed by washing 5 times with wash buffer. . Finally, after 10 minutes of color development using TMB, the color development was stopped using a stop solution. Then, the absorbance was measured at 450 nm using a microplate reader.

In order to confirm the expression of IL-2 on the surface of sEV isolated from Jurkat cells transfected with lentivirus by another method, a reproduction experiment was performed using a Human IL-2 Immunoassay (D2050; R&D) kit.

As a result, as shown in FIG. 3, it was confirmed that the expression of IL-2 was increased on the surface of sEV derived from Jurkat cells infected with lentivirus compared to the control group.

Example 8: Purified sEV ^IL-2 Characterization of

In order to check the properties of the ^IL-2 sEV purified using an electron microscope, and dropped the sEV ^IL-2 purified and suspended in PBS over bar form carbon coated nickel grids (formvar-carbon coated nickel grids). After staining with 2% uranyl acetate, the grid was air-dried and the diameter structure was visualized using an HF-3300 (Hitachi) transmission electron microscope.

For immunogold labeling, a purified sEV suspended in PBS is placed on a formba carbon-coated nickel grid, blocked using PBS added with 0.5% bovine serum albumin, and then a mouse anti-human that recognizes the Flag. Incubated with monoclonal antibody. Then, the protein A-gold particles (10 nm) were incubated with the conjugated anti-mouse secondary antibody. Then, it was washed 5 times with PBS, _{10 times with ddH 2} O, and then counter-stained with 2% uranyl acetate.

As a result, as shown in FIG. 4, in the case of sEV ^IL-2 , it was confirmed that protein A-gold particles (10 nm) were labeled by an antibody that recognizes Flag.

Example 9: Analysis of sEV derived from melanoma cells using nanoparticle tracking

^{After treatment with sEV IL-2} purified to melanoma cells (B16F10: 5 X 10 ⁴ cells/ml, SK-MEL-28: 1 X 10 ⁵ cells/ml) at a concentration of 10 μg/ml and incubating for 72 hours , The size and concentration of sEV derived from the culture supernatant were measured using a Nanosight LM10 (Malvern Instruments) equipped with fast video capture and particle tracking software.

As a result, as shown in FIG. 5(A), it was confirmed by nanoparticle tracking analysis that the number of sEVs decreased in the two types of melanoma cells treated with ^{sEV IL-2 compared to the control group.}

Example 10: Melanoma cell-derived sEV analysis using Western blot

In order to re-verify the decrease in the number of sEVs derived from melanoma cells, the expression level of Rab protein involved in sEV secretion and expression was measured by Western blot. The cytoplasm or sEV protein was separated by SDS-PAGE and transferred to a nitrocellulose membrane. Thereafter, incubation with each of the primary antibodies (ab18211; abcam/Rab5, ab50533; abcam/Rab7, ab55667; abcam/Rab 27a, # 4970; Cell signaling/β-actin, ab10931; abcam/PD-L1), and HRP Incubated with the conjugated secondary antibody. Images were visualized using Enhanced chemiluminescence (ECL) detection reagent (# 34095; Thermo Scientific, # RPN2209; GE Healthcare) and quantified using ECL Hyper Film (AGFA, Morstel).

As a result, it was confirmed that the protein expression of Rab 27a was significantly reduced in the two types of melanoma cells treated with ^{sEV IL-2} compared to the control, as shown in FIG. 5(B).

In addition, in ^{order to evaluate the efficacy of sEV IL-2} in melanoma, the expression of the PD-L1 (programmed death ligand 1) protein, which is known to be the most important for immune evasion of cancer cells, was measured.

As a result, as shown in FIG. 6(A), it was confirmed that the protein expression of PD-L1 was significantly reduced in the two types of melanoma cells treated with ^{sEV IL-2 compared to the control group.} This was re-verified through immunostaining as shown in Fig. 6(B).

Next, Western blot and enzyme-linked immunosorbent assay were performed to evaluate whether ^{sEV IL-2 regulates the expression of melanoma-derived exosomal PD-L1.}

As a result, as shown in FIG. 7, it was confirmed that the expression of exosomal PD-L1 was significantly reduced in melanoma treated with ^{sEV IL-2 compared to the control group (A), and confirmed by revalidation using an enzyme-linked immunosorbent assay.} (B).

Example 11: sEV ^IL-2 Analysis of proliferation of cytotoxic T cells by

IL-2 is known to be the most important factor for proliferation and activity of cytotoxic T cells. Accordingly, in the present invention, in ^{order to analyze the effect of sEV IL-2} on cytotoxic T cells, cell proliferation analysis was performed using the MTS assay (# G3582; Promega).

CTLL-2 cells were inoculated into 96 well plates at a density of ^{5 X 10 3 cells/well and cultured for 24 hours.} Thereafter, the culture medium was replaced with a new medium containing 10% FBS and rIL-2 (100 IU/ml), control sEV or sEV ^IL-2 (10 μg/ml), and further cultured for 24 hours. Thereafter, MTS reagent was added to each well and incubated at 37° C. for 2 hours, and MTS containing the supernatant of each well was removed, and absorbance was measured at 490 nm using a microplate reader.

As a result, as shown in Figure 8, it was confirmed that the cell proliferation increased by about 7 times in CTLL-2 cells treated with ^{sEV IL-2 compared to the control, and the reaction was significantly reduced by the anti-IL-2 antibody.} I did.

That is, from the above results, it was confirmed that sEV ^IL-2 increases the number of cytotoxic T cells, which are important for cancer cell death, to increase the immune anticancer efficacy.

Example 12: sEV ^IL-2 Analysis of cytotoxic T cell activity by

Next, to confirm the expression of Perforin, Granzyme-B (GrzmB), and interferon-γ (IFN-γ) reported to be involved in the activity of cytotoxic T cells, control or sEV ^IL-2 was used. MRNA was extracted from the treated cytotoxic T cells (mRNA extraction kit, #9767; TaKaRa). After measuring the concentration of the extracted mRNA using a nanodrop (DS-11 Series Spectrophotometer; DeNovix), cDNA was synthesized with 100 ng of mRNA (SuperScript III First-Strand Synthesis System, Ref. 18080-051; invitrogen). Using the synthesized cDNA, the expression of Perforin (Forward:cgcctacctcaggcttatctc, Reverse:cctcgacagtcaggcagtc), Granzyme-B (Forward:tgggggacccagagattaaaa, Reverse:ttttcgtccataggagacaatgc), INF-γ (Forward:tgaccacagcatctcaaa, real-time polymerization of the gene expression of It was confirmed by enzymatic chain reaction.

As a result, it was confirmed that the expression of all three genes was significantly increased in the cytotoxic T cells treated with ^{sEV IL-2} , as shown in FIG. 9(A). In particular, in the case of interferon-γ, it was confirmed that the gene expression was increased by about 9 times compared to the control group.

That is, from the above results, it was confirmed that sEV ^IL-2 strongly increases the activity of cytotoxic T cells, which are important for cancer cell death.

As shown in Fig. 9(B), it was re-verified using a flow cytometer. In addition, the expression of the immune checkpoint PD-1 (programmed cell death-1, Forward: agaatcctggagacctcaac, Reverse: atacccactagggcactcat) in cytotoxic T cells treated ^{with sEV IL-2 was confirmed by the same method as above.}

As a result, as shown in FIG. 10, it was confirmed that the PD-1 gene and protein expression significantly decreased in the case of cytotoxic T cells treated with ^{sEV IL-2 compared to the control.} This suggests that the anticancer effect can be increased by reducing the immune evasion due to the binding of cancer cells to PD-L1 due to the decrease in PD-1 of cytotoxic T cells.

Example 13: Co-culture assay

with sEV ^IL-2 melanoma cells of PD-L1 decreases due to in order to show the anti-cancer effect due to the increased activity of cytotoxic T cells, as shown in FIG. ^{11 (A), sEV IL-} 2 and melanoma cells (B16F10 ) And after co-culturing the cytotoxic T cells together, the survival rate of melanoma cells was confirmed. Melanoma cells (B16F10-luc-g5) having a cell luminescence gene were used, and analyzed using an IVIS spectrum (PerkinElmer).

13-1. sEV ^IL-2 Co-culture analysis of pretreated melanoma cells

Melanoma cells were inoculated into a 96-well plate at a ^{density of about 5×10 3 cells/well and pretreated with control sEV or sEV IL-2} (5 μg/mL). After 24 hours of incubation, the cells were cultured with different ratios of CTLL-2 cells (1:1 to 1:10). At the end of the culture, MTS reagent was added to each well and incubated at 37°C for 2 hours. After removing the MTS containing the supernatant of each well, the absorbance was measured at 490 nm using a microplate reader.

13-2. sEV ^IL-2 Co-culture analysis of pretreated T cells

In a 96-well plate, CTLL-2 cells were inoculated at a density of ^{about 1×10 6 cells/well and pretreated with control sEV or sEV IL-2} (5 μg/mL). After 24 hours of incubation, the cells were cultured with different ratios of melanoma cells (1:1 to 1:10). At the end of the culture, MTS reagent was added to each well and incubated at 37°C for 2 hours. After removing the MTS containing the supernatant of each well, the absorbance was measured at 490 nm using a microplate reader.

As a result, as shown in Figs. 11(B) and (C), it was confirmed that the survival rate of melanoma cells significantly decreased in the co-culture group of ^{cytotoxic T cells and melanoma cells treated with sEV IL-2.}

Example 14: sEV in melanoma transplanted mouse model ^IL-2 Cancer growth inhibition analysis

B16F10 mouse melanoma cells 5 X 10 ⁵ were injected subcutaneously into the right flank of C57BL/6 mice. After 5 days from the start of the experiment, PBS, rhIL-2 (50,000 IU/mouse), control sEV or sEV ^IL-2 (20 μg/mouse) were injected directly into cancer tissues three times a week. Thereafter, cancer tissues (long axis * short axis * 0.52) of mice were measured and compared once every 2 days using an engineering digital caliper.

As a result, as shown in Fig. 12(A) ^{, cancer growth of the mice injected with sEV IL-2} significantly inhibited the growth of cancer compared to the PBS control group. Subsequently, the same results were shown in the weight analysis of the cancer tissues extracted from the mouse (FIG. 12(B)).

Example 15: sEV in melanoma transplanted mouse model ^IL-2 For the regulation of exosomal PD-L1 expression in blood

Blood was collected from the mice of the experiment and centrifuged at 550 x g to obtain serum. Thereafter, the supernatant was continuously centrifuged at 300 x g, 2,500 x g, and 10,000 x g. Then, the supernatant was filtered through a 0.2 μm syringe filter and centrifuged at 120,000 x g. The sEV pellet was resuspended in PBS and centrifuged again at 120,000 x g. Purified sEV pellet was incubated with anti-PD-L1 (ab10931; abcam/PD-L1) antibody overnight, and FITC-conjugated secondary antibody (a11001; invitrogen/goat anti-mouse igg (h+l) cross-adsorbed secondary antibody) alexa fluor 488) and analyzed using an sEV flow cytometer (CytoFlEX/Beckman Coulter).

As a result, as shown in Fig. 13 (A, B), it was confirmed that the amount of exosomal PD-L1 expression in the mice injected with ^{sEV IL-2 was significantly reduced compared to the control group.}

Example 16: Analysis of Cancer Growth in Melanoma Transplanted Mice Following Treatment with Anticancer Agents

B16F10 mouse melanoma cells 5 X 10 ⁵ were injected subcutaneously into the right flank of C57BL/6 mice. 7 days after the start of the experiment twice a week PBS, control sEV (20 μg / animal), sEV ^IL-2 (20 μg / animal), cisplatin (Cisplatin, p4394; Sigma-Aldrich / cis-Diammineplatinum (II) dichloride crystalline), control IgG (be0252; bioxcell/anti-rat IgG2b) and anti-PD-L1 antibody (be0101; bioxcell/anti PD-L1) were injected into mice (sEV ^IL-2 or control sEV; intratumoal injection, Cisplatin or PBS; intraperitoneal injection) , Anti-PD-L1 or control IgG; intravenous injection). Thereafter, cancer tissues (long axis * short axis * 0.52) of mice were measured and compared once every two days using an engineering digital caliper.

As a result, as shown in Fig. 14 (A, B, C), cancer growth of mice injected with an anticancer drug together with ^{sEV IL-2 significantly inhibited the growth of cancer than the control group.} Subsequently, the weight analysis of the cancer tissue extracted from the mouse also showed the same result (FIG. 14(D)).

In addition, as a result of confirming the expression of Rab27a together with PD-L1 in cancer tissues of melanoma-transplanted mice according to combination treatment with anticancer drugs, as shown in FIG. 15, PD- in cancer tissues of mice injected with ^{sEV IL-2} Both L1 and Rab27a showed dramatically reduced expression.

As the specific parts of the present invention have been described in detail above, it is clear that these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereto for those of ordinary skill in the art. Accordingly, it will be said that the substantial scope of the present invention is defined by the appended claims and their equivalents.

The scope of the present invention is indicated by the claims to be described later, and all changes or modified forms derived from the meaning and scope of the claims and their equivalent concepts should be construed as being included in the scope of the present invention.

Claims (17)

Cytokines; Linker; And transmembrane proteins; extracellular vesicles fused thereto. The method of claim 1,
The cytokine is,
Extracellular vesicles, characterized in that coupled to a linker connected to a transmembrane protein penetrating the lipid layer of the extracellular vesicles. The method of claim 1,
The extracellular vesicles,
Cytokines; Linker; And the transmembrane domain; Extracellular vesicles, characterized in that secreted from cells transfected with a viral vector comprising a. The method of claim 3,
The cytokine is an extracellular vesicle, characterized in that IL-2. The method of claim 3,
The linker,
General formula (GGGGS)n, (SGGGG)n, (SRSSG)n, (SGSSC)n, (GKSSGSGSESKS)n, (RPPPPC)n, (SSPPPPC)n, (GSTSGSGKSSEGKG)n, (GSTSGSGKSSEGSGSTKG)n, (GSTSGSGKPGSGEGSTKG) It consists of an amino acid sequence represented by n, or (EGKSSGSGSESKEF)n, wherein n is an integer of 1 to 20 extracellular endoplasmic reticulum. The method of claim 3,
The transmembrane domain,
Epidermal growth factor receptor, insulin receptor, platelet-derived growth factor (PDGF) receptor, vascular endothelial growth factor receptor, fibroblast growth factor receptor, cholecystokinin (CCK) receptor, neurotrophic factor (NGF) ) Receptor, hepatocyte growth factor (HGF) receptor, ephrin (Eph) receptor, angiopoietin receptor, and a membrane of at least one receptor selected from the group consisting of RTK (Related to receptor tyrosine kinase) receptors Extracellular endoplasmic reticulum, characterized in that it is a penetrating domain. The method of claim 3,
The cells are extracellular vesicles, characterized in that the auxiliary T cells. The method of claim 1,
The extracellular vesicles,
Extracellular endoplasmic reticulum, characterized in that to increase the anticancer effect by increasing the proliferation and activity of cytotoxic T cells. The method of claim 1,
The extracellular vesicles,
Extracellular vesicles, characterized in that small extracellular vesicles (sEV) having a diameter of 30 to 100 nm. A pharmaceutical composition for preventing or treating cancer diseases comprising the extracellular vesicles according to any one of claims 1 to 9 as an active ingredient. The method of claim 10,
The cancer disease,
Melanoma, colon cancer, lung cancer, skin cancer, non-small cell lung cancer, colon cancer, bone cancer, pancreatic cancer, head or neck cancer, uterine cancer, ovarian cancer, rectal cancer, gastric cancer, anal muscle cancer, breast cancer, fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma , Vaginal carcinoma, vulvar carcinoma, Hawkins' disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney or A pharmaceutical composition for preventing or treating cancer diseases, characterized in that selected from the group consisting of ureteral cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system tumor, primary central nervous system lymphoma, spinal cord tumor, brainstem glioma and pituitary adenoma. The method of claim 10,
The composition,
A pharmaceutical composition for preventing or treating cancer diseases, characterized in that administered in combination with an anticancer agent. A pharmaceutical composition for preventing or treating cancer diseases comprising the extracellular vesicles according to any one of claims 1 to 9 and an anticancer agent as an active ingredient. The method of claim 13,
The anticancer agent,
Cisplain, vinblastine, vincristine, actinomycin-D, 5-fluouracil, docetaxel, cabazitaxel , Paclitaxel (paclitaxel) and pembrolizumab (Pembrolizumab), characterized in that at least one selected from the group consisting of a pharmaceutical composition for co-administration of anticancer agents. At least one of drugs or physiologically active substances, and cytokines; Linker; And a transmembrane protein; comprising the fused extracellular vesicle, wherein the drug or physiologically active material is encapsulated in the extracellular vesicle lipid layer. The method of claim 15,
The cytokine is a composition for delivery of a drug or a physiologically active substance, characterized in that IL-2. The method of claim 15,
The drug is selected from the group consisting of anticancer agents, anti-inflammatory analgesics, antibiotics, antibacterial agents, and vaccines, and the physiologically active material is selected from the group consisting of peptides, proteins, hormones, and genes. .

Images