KR20220031505A - Extracellular vesicle expressing cytokines and antibodies, Method of preparing the same, and Use of the same - Google Patents

Abstract

The present invention relates to an extracellular vesicle expressing a cytokine and an antibody, a method for producing the same, and a use thereof. In the method, produced is an immune cell expressing both a cytokine and an antibody on a cell membrane surface by transforming a first vector containing a gene encoding a cytokine and a second vector containing a gene encoding an antibody into an immune cell, and produced is an extracellular vesicle expressing both a cytokine and an antibody on a surface from the immune cell. The extracellular vesicle can induce a desired cytokine response in cells that can be targeted with a specific antibody, by combining the first vector and the second vector such that a specific cytokine or a specific antibody can be expressed according to target cells, and is safe for the human body while exhibiting excellent anticancer effects as a novel anticancer agent. The present invention provides a novel cancer treatment means which can be used to deliver drugs or physiologically active substances to specific cancer cells by encapsulating drugs or physiologically active substances that exhibits a therapeutic effect on cancer inside the extracellular vesicle.

Description

Extracellular vesicle expressing cytokines and antibodies, method for preparing the same, and use thereof

The present invention relates to extracellular vesicles expressing cytokines and antibodies, methods for their preparation and uses thereof.

Extracellular vesicle (EV) refers to a nano-sized endoplasmic reticulum derived from a cell, and depending on the type and size of secretion, exosomes, microvesicles, ectosomes, microparticles ( microparticles), membrane vesicles, nanovesicles, and outer membrane vesicles. The extracellular endoplasmic reticulum is the main means of communication between cells, including nucleic acids and proteins, which are the main components of cells.

Recently, it has been reported that the secretion of extracellular vesicles is increased in cancer patients, and as a change in a specific protein that appears specifically in cancer patients is observed, the possibility that the extracellular ER can be used as a marker for diagnosing cancer is noteworthy. is becoming In addition, since the extracellular ER has high stability in the human body and does not induce an immune response, it is possible to selectively deliver the drug to target cells in the body by including an internal drug, and to separate the extracellular ER from various cells and Since it is easy to purify, research using the extracellular vesicle as a drug carrier is in progress.

On the other hand, cancer is a disease caused by abnormal cell growth, and it has been reported that the mortality rate of cancer patients is high enough to occupy the number one cause of death in Korea. There are dozens of types of cancer, and cancer is mainly classified according to the location of the affected tissue. Cancer is divided into benign and malignant tumors. Benign tumors grow relatively slowly and do not metastasize from the original site of the tumor to other tissues, whereas malignant tumors leave the primary site and invade other tissues rapidly. It has a growing characteristic and is life-threatening.

Although surgery, chemotherapy, and radiation therapy are used as cancer treatment methods, it has been reported that more than 50% of cancer patients who underwent treatment died despite long-term studies. The reason that it is difficult to treat cancer despite the application of various treatment methods is that even if the cancer is surgically removed to treat cancer patients, cancer cells metastasize to other tissues of the patient and the cancer recurs, or anticancer drugs in the initial stage of treatment This is because the size of the tumor decreases as a result, but the cancer rapidly worsens due to cancer cells that are resistant to anticancer drugs during or after treatment.

In particular, anticancer agents, which are commonly used chemotherapy drugs, mainly exhibit anticancer effects through a mechanism of inhibiting the proliferation of cancer cells, and about 60 kinds of various types have been developed. However, since most anticancer drugs act non-selectively not only on cancer cells but also on normal cells, there is a problem of showing serious side effects such as hair loss, extreme fatigue, vomiting, nausea, discoloration of skin and nails, and nervous system side effects.

In order to overcome the problems of existing anticancer drugs, targeted anticancer drugs and anticancer treatments using immune cells have been developed as treatment methods that specifically act on cancer cells. However, these treatment methods show differences in treatment efficiency depending on the characteristics of the patient, and problems such as the onset of acute inflammatory diseases due to excessive activation of the immune system have not been resolved. Therefore, the development of a new treatment method specific to cancer cells is required.

Republic of Korea Patent Registration No. 10-1820264 (Registered on Jan. 12, 2018)

It is an object of the present invention to provide an extracellular vesicle in which cytokines and antibodies are expressed on the membrane surface as a new therapeutic means for cancer.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer comprising the extracellular vesicles as an active ingredient.

Another object of the present invention is to provide a composition for delivery of a drug or a physiologically active substance comprising the extracellular vesicle in which a drug or physiologically active substance exhibiting a therapeutic effect on cancer is encapsulated as a new therapeutic means for cancer.

The present invention provides extracellular vesicles expressing cytokines and antibodies on the surface.

In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer comprising the extracellular vesicles as an active ingredient.

In addition, the present invention provides a composition for delivery of a drug or physiologically active substance, characterized in that the composition comprising the extracellular vesicle, the drug or physiologically active substance is encapsulated inside the extracellular vesicle.

In addition, the present invention provides a method for preparing the extracellular vesicle, comprising the steps of: preparing a first vector comprising a gene encoding a cytokine, a linker domain encoding a linker, and a transmembrane domain encoding a transmembrane protein; preparing a second vector comprising a gene encoding an antibody, a linker domain encoding a linker, and a transmembrane domain encoding a transmembrane protein; transforming the cells with the first vector and the second vector using a lentivirus; And it provides a method comprising the step of isolating the extracellular vesicles from the culture medium in which the cells transformed with the first vector and the second vector are cultured.

According to the present invention, by transforming immune cells with a first vector containing a gene encoding a cytokine and a second vector containing a gene encoding an antibody, immune cells expressing both cytokines and antibodies on the cell membrane surface and an extracellular vesicle expressing both cytokines and antibodies on the surface can be prepared from the immune cells, and the extracellular ER is a first vector so that a specific cytokine or a specific antibody can be expressed depending on the target cell And by combining the second vector, a desired cytokine response can be induced in cells that can be targeted with a specific antibody, and it can be provided as a new anticancer agent that is safe for the human body and exhibits excellent anticancer effect.

In addition, the extracellular vesicles of the present invention can be utilized for delivery of drugs or physiologically active substances to specific cancer cells by encapsulating drugs or physiologically active substances having a therapeutic effect on cancer therein, so a new cancer treatment means can be provided as

1 is a diagram showing the construction of a vector for preparing an extracellular ER of the present invention and a method for preparing an extracellular ER.
2 is a result of isolation of immune cells to be used for preparing the extracellular vesicles of the present invention from a blood sample and analyzing their characteristics by flow cytometry.
3 is a result of confirming whether cytokines and/or antibodies are expressed in immune cells transformed to express cytokines and/or antibodies to produce the extracellular vesicles of the present invention.
4 is a result of evaluating the cancer cell-specific cytotoxicity of the extracellular vesicles prepared according to the present invention.
5 is a result of evaluating the cytotoxicity of the cytokine IL-2.
6 is a result of evaluating cancer cell specificity according to the surface expression of the antibody in the extracellular vesicles prepared according to the present invention.
7 is a result of verifying the antibody specificity of the extracellular vesicles prepared according to the present invention.
FIG. 8 shows that when fluorescently stained extracellular vesicles were treated in non-small cell lung cancer cell (A549) transplanted mice, cancer cell-specific targeting was confirmed by 'fluorescence, luminescence and computed tomography imaging equipment system' and 'confocal fluorescence microscope'. will be.

The terms used in this specification have been selected as currently widely used general terms as possible while considering the functions in the present invention, but these may vary depending on the intention or precedent of a person skilled in the art, the emergence of new technology, and the like. In addition, in a specific case, there is a term arbitrarily selected by the applicant, and in this case, the meaning will be described in detail in the description of the corresponding invention. Therefore, the term used in the present invention should be defined based on the meaning of the term and the overall content of the present invention, rather than the name of a simple term.

Unless defined otherwise, all terms used herein, including technical and scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Terms such as those defined in a commonly used dictionary should be interpreted as having a meaning consistent with the meaning in the context of the related art, and should not be interpreted in an ideal or excessively formal meaning unless explicitly defined in the present application. does not

Numerical ranges are inclusive of the values defined in that range. Every maximum numerical limitation given throughout this specification includes all lower numerical limitations as if the lower numerical limitation were expressly written. Every minimum numerical limitation given throughout this specification includes all higher numerical limitations as if the higher numerical limitation were expressly written. Any numerical limitation given throughout this specification shall include all numerical ranges within the broader numerical range, as if the narrower numerical limitation were expressly written down.

Hereinafter, the present invention will be described in more detail.

As the development of a new therapeutic method specific to cancer cells is required, the inventors of the present invention prepared an extracellular vesicle in which cytokines that activate the immune system and antibodies that selectively target cancer cells are expressed on the surface, and their cancer cell-specific cytotoxicity By confirming, the extracellular vesicles expressing cytokines and antibodies on the surface are provided as a means for preventing or treating cancer, and as a carrier for drug or physiologically active substance delivery.

The present invention provides extracellular vesicles expressing cytokines and antibodies on the surface.

The extracellular vesicle can be prepared with a membrane bound cytokine (MBC) platform, and the MBC platform consists of "a gene encoding a cytokine or antibody-linker domain-transmembrane domain", through which the cytokine or antibody is bound to a linker linked to a transmembrane protein and is expressed in a form attached to the cell membrane without being secreted outside the cell.

1, in the present invention, by applying the MBC platform to immune cells, immune cells expressing specific cytokines and antibodies on the cell membrane surface were prepared, and through this, extracellular vesicles expressing specific cytokines and antibodies on the surface were prepared did

The phospholipid bilayer constituting the extracellular endoplasmic reticulum includes a transmembrane protein, and the transmembrane protein is coupled to the cytokine or antibody through a linker. Specifically, the cytokine may be IL-2 having the amino acid sequence shown in SEQ ID NO: 1, and the antibody may be an Erbitux scFv having the amino acid sequence shown in SEQ ID NO: 2, but is not limited thereto. The linker may have a sequence that repeats any one selected from among the amino acid sequences shown in SEQ ID NOs: 3 to 13 1 to 20 times, but is not limited thereto.

The extracellular endoplasmic reticulum comprises a gene encoding a cytokine or an antibody; a linker domain that encodes the linker; and a vector comprising a transmembrane domain encoding a transmembrane protein; derived from a transformed cell.

Specifically, the vector for preparing the extracellular endoplasmic reticulum includes a gene encoding a cytokine IL-2 (Interleukin-2) or an antibody Erbitux scFv, and the end of the gene is a linker domain and PDGF ( platelet-derived growth factor) has a form in which the transmembrane domain of the receptor is sequentially linked, and when the vector is transformed and expressed in a cell, cytokine or antibody is not secreted outside the cell and is bound to a linker connected to the transmembrane protein Therefore, cytokines or antibodies are expressed in a form attached to the surface of the transformed cell membrane.

The transmembrane domain is epidermal growth factor receptor, insulin receptor, platelet-derived growth factor (PDGF) receptor, vascular endothelial growth factor receptor, fibroblast growth factor receptor, cholecystokinin (CCK) receptor, neurotrophic factor (Neurotrophic factor; NGF) receptor, hepatocyte growth factor (HGF) receptor, Ephrin (Eph) receptor, angiopoietin receptor and RYK (Related to receptor tyrosine kinase) any selected from the group consisting of receptors It may be a transmembrane domain included in one receptor, but is not limited thereto.

The cells include helper T cells, CD8+ T cells, dendritic cells, neutrophils, eosinophils, basophils, macrophages, monocytes, natural killer cells, B cells, adult stem cells, mesenchymal stem cells, blood stem cells and It may be any one selected from the group consisting of induced pluripotent stem cells (iPSc), but is not limited thereto.

The extracellular vesicles exhibit anticancer effects by having specific cytotoxicity to cancer cells, and the extracellular vesicles may be used as carriers in which drugs or physiologically active substances are encapsulated.

In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer comprising the extracellular vesicles as an active ingredient.

The cancer is melanoma, colon cancer, lung cancer, skin cancer, non-small cell lung cancer, colon cancer, bone cancer, pancreatic cancer, head or neck cancer, uterine cancer, ovarian cancer, rectal cancer, stomach cancer, perianal cancer, breast cancer, fallopian tube carcinoma, endometrial carcinoma, Cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hawkins' disease, esophageal cancer, small intestine cancer, endocrine adenocarcinoma, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer , kidney or ureter cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system tumor, primary central nervous system lymphoma, spinal cord tumor, brainstem glioma, and any one selected from the group consisting of pituitary adenoma, but is not limited thereto.

The pharmaceutical composition may include a pharmaceutically acceptable carrier, excipient or diluent for administration. The carrier, excipient and diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, It may be selected from the group consisting of polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil, but is not limited thereto.

The pharmaceutical composition may be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, or sterile injection solutions, respectively, according to conventional methods. When formulated as a filler, it can be prepared using a diluent or excipient such as a filler, a weight agent, a binder, a wetting agent, a disintegrant, and a surfactant. Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, capsules, and the like. Such a solid preparation may be prepared by mixing at least one or more excipients, for example, starch, calcium carbonate, sucrose, lactose, gelatin, etc. in addition to the active ingredient. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. It can be prepared by adding various excipients, for example, wetting agents, sweetening agents, fragrances, preservatives, and the like, in addition to liquids for oral use and liquid paraffin. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations and tasks. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As the base of the suppository, Witepsol, Macrosol, Tween 61, cacao butter, laurin fat, glycerogelatin, etc. can be used.

A suitable dosage of the pharmaceutical composition of the present invention varies depending on the patient's condition and weight, the degree of disease, drug form, and time, but may be appropriately selected by those skilled in the art, and the daily dosage of the composition is preferably 0.001 mg/kg to 50 mg/kg, and may be administered once a day or divided into several times a day as needed.

In addition, the present invention provides a composition for delivery of a drug or physiologically active substance, characterized in that the composition comprising the extracellular vesicle, the drug or physiologically active substance is encapsulated inside the extracellular vesicle.

The drug may be any one selected from the group consisting of anticancer drugs, anti-inflammatory drugs, antibiotics, antibacterial agents and vaccines, and the physiologically active material may be any one selected from the group consisting of peptides, proteins, hormones and genes, but is limited thereto not.

In addition, the present invention provides a method for preparing the extracellular vesicle, comprising the steps of: preparing a first vector comprising a gene encoding a cytokine, a linker domain encoding a linker, and a transmembrane domain encoding a transmembrane protein; preparing a second vector comprising a gene encoding an antibody, a linker domain encoding a linker, and a transmembrane domain encoding a transmembrane protein; transforming the cells with the first vector and the second vector using a lentivirus; and separating the extracellular vesicles from the culture medium in which the cells transformed with the first vector and the second vector are cultured.

Hereinafter, examples will be described in detail to help the understanding of the present invention. However, the following examples are merely illustrative of the content of the present invention, and the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more completely explain the present invention to those of ordinary skill in the art.

Example 1. Immune cell isolation

Human CD8+ T lymphocytes were isolated from blood as immune cells to be used for preparing the extracellular vesicles of the present invention. After treating the anticoagulant-treated blood sample with Ficoll, it was centrifuged to obtain a buffy coat. The separated leukocyte soft layer was cultured in RPMI 1640 medium (Hyclone) containing 10% fetal bovine serum, 1% penicillin and streptomycin for one day, and then cells suspended in the supernatant of the medium were collected and used for the experiment. . Primary CD8+ T lymphocytes were isolated from the collected cells using the human CD8+ T cell isolation kit (MACS), a kit for CD8+ T lymphocyte isolation according to the manufacturer's instructions. The isolated primary CD8+ T lymphocytes were treated with CD3-APC, CD8-FITC, and CD56-PE antibodies (MACS), and it was confirmed that CD8+ T lymphocytes were isolated with an accuracy of 80% or more through flow cytometry ( FIG. 2 ).

Example 2. Cell Culture

HEK-293FT cells (human embryonic kidney cells) were cultured in DMEM medium (Hyclone) supplemented with 10% fetal bovine serum, 1% penicillin and streptomycin, and A549-luc cells (human non-small cell lung cancer cells) were cultured in 10% It was cultured in RPMI 1640 medium (Hyclone) supplemented with fetal bovine serum, 1% penicillin and streptomycin. Primary CD8+ T lymphocytes isolated from human blood were supplemented with 10% fetal bovine serum, 1% penicillin and streptomycin, 50 IU/mL recombinant IL-2 (R&D systems), and CD3/CD28/CD2 T cell activator (STEMCELL). It was cultured in RPMI 1640 medium (Hyclone).

Example 3. Lentivirus Preparation

In order to prepare an extracellular endoplasmic reticulum expressing cytokine and antibody on the surface according to the present invention, a first vector comprising a gene encoding a cytokine and a second vector comprising a gene encoding an antibody are prepared, and lenti Each of the two vectors was transformed into cells using a virus.

Specifically, the first vector is a cytokine and includes a gene encoding IL-2, a linker domain, and a transmembrane domain of a PDGF receptor, and the second vector has a gene encoding an Erbitux scFv, a linker domain, and PDGF contains the transmembrane domain of the receptor. Each of the first vector and the second vector was prepared with reference to the paper (Proc Natl Acad Sci US A. 2013 May 14;110(20):8099-104).

Lentiviruses to be used to transform cells with the prepared first and second vectors were prepared as follows. HEK-293FT cells were inoculated into a 100 pie plate containing DMEM (Hyclone) medium at a concentration of about 5 X 10 ⁶ cells. pCMVD (# PS100001; Origene) and pVSVg (# 1733; Addgene) viral vectors were mixed with the first or second vector in a ratio of 1:1:1, and Turbofect (Thermo fisher scientific) was used according to the manufacturer's instructions. to the cells and incubated overnight at 37°C. After culture, the supernatant was removed and replaced with fresh DMEM medium containing 10% fetal bovine serum, 1% penicillin and streptomycin. After incubation for 48 hours, a medium supernatant containing virus was obtained and centrifuged, and cell debris was removed using a surfactant-free cellulose acetate (SFCA) membrane filtration device (0.45 μm; Corning). . The titer of each lentivirus was measured using the Lenti-X p24 rapid titer kit (#632200; Takara) according to the manufacturer's instructions. The first lentivirus containing the first vector and the second lentivirus containing the second vector were each aliquoted and stored frozen at -80°C.

Example 4. Transformation of immune cells using lentivirus

In order to prepare an extracellular vesicle expressing the cytokine and the antibody according to the present invention on the surface, immune cells were transformed with the lentiviruses prepared in Example 3 above.

In order to prepare transformed immune cells, the first lentivirus or the second lentivirus prepared in Example 3 was mixed with a polybrene of 10 μg/mL at a multiplicity of infection (MOI) concentration of 100 for primary CD8+ T treated with lymphocytes. Each lentivirus-treated cell mixture was spinoculated by centrifugation at 1,200 g at 30°C for 90 minutes, and incubated at 37°C overnight. Excess virus was removed and replaced with fresh DMEM medium containing 10% fetal bovine serum supplemented with 10% fetal bovine serum.

Using untransformed lymphocyte C as a control, lymphocyte I transformed only with the first lentivirus containing the IL-2 gene, and lymphocyte E transformed only with the second lentivirus containing the scFv gene of Erbitux , and lymphocytes D transformed with both lentiviruses.

Example 5. Confirmation of expression of cytokines and antibodies in transformed immune cells

In order to prepare the extracellular vesicles expressing cytokines and antibodies according to the present invention on the surface, it was confirmed whether cytokines and antibodies were expressed in the transformed immune cells prepared in Example 4.

In Example 4, mRNA was extracted from the lymphocytes transformed with the first lentivirus and/or the second lentivirus with a kit (mRNA extraction kit, # 9767; TaKaRa) according to the manufacturer's instructions, and nanodrop (DS). -11 Series Spectrophotometer; DeNovix) was used to measure the concentration of the extracted mRNA. 100 ng of the extracted mRNA was synthesized as cDNA with a kit (SuperScript III First-Strand Synthesis System, Ref. 18080-051; invitrogen) according to the manufacturer's instructions.

The expression level of the IL-2 gene and/or the scFv gene of Erbitux in each lymphocyte was analyzed by real-time PCR using the primer set of Table 1 below.

gene base sequence SEQ ID NO: IL-2 F AGACCCAGGGACTTAATCAG 14 R ACAATGGTTGCTGTCTCATC 15 Erbitux F GGCCCAGCCGGCCAT 16 R ATTTAGGCCCCCGAGGCCTTTCAGCTCCAGCTTGGTCCCA 17

As shown in FIG. 3 , in the transformed lymphocytes compared to the control group, the expression level of the IL-2 gene increased approximately 10 ⁴ times, and the expression level of the scFv gene of Erbitux increased approximately 10 ⁵ times. . In particular, the expression levels of both IL-2 gene and/or Erbitux scFv gene were increased in D lymphocytes transformed with both lentiviruses.

In addition, each protein expression level was measured by Western blot to confirm the expression level of IL-2 and/or Erbitux in the primary CD8+ T lymphocytes. Cells were separated by SDS-PAGE and transferred to a nitrocellulose membrane. Thereafter, after reacting with Erbitux's primary antibody (R&D system, #MAB9626), FLAG's primary antibody (CST, #8146), and beta-Actin (CST, #4970), it was reacted with an HRP-conjugated secondary antibody. Images were visualized using Enhanced chemiluminescence (ECL) detection reagent (# 34095; Thermo Scientific, # RPN2209; GE Healthcare).

As shown in FIG. 3 , only IL-2 is expressed in I lymphocytes transformed with only the first lentivirus, and only Erbitux is expressed in E lymphocytes transformed with only the second lentivirus, and both lentiviruses Both IL-2 and Erbitux were expressed in the transformed D lymphocytes.

Example 6. Isolation and purification of extracellular vesicles

In order to prepare an extracellular vesicle expressing the cytokine and the antibody according to the present invention on the surface, the extracellular vesicles were isolated from the transformed immune cells prepared in Example 4.

Control C lymphocytes or transformed D lymphocytes of Example 4 were inoculated into RPMI medium without fetal bovine serum at a concentration of 1 x 10 ⁶ cells/ml, respectively, and cultured for 72 hours. The supernatant of each cell culture medium was sequentially centrifuged at 300 g, 2,500 g, and 10,000 g. The centrifuged supernatant was filtered with a 0.2 μm syringe filter and centrifuged at 120,000 g to obtain a pellet of extracellular vesicles. The obtained pellet was suspended in PBS and cryopreserved at -80°C.

The extracellular vesicles obtained from the non-transformed lymphocyte C were denoted as CE, and the extracellular vesicles obtained from the lymphocytes D transformed with the first and second lentiviruses were denoted as DE.

Example 7. Cancer cell specific cytotoxicity analysis by extracellular vesicles

In order to evaluate the cancer cell-specific cytotoxicity of the extracellular ER prepared according to the present invention, the cytotoxicity of the extracellular ER on cancer cells or normal cells was analyzed.

Human non-small cell lung cancer cells, A549-luc cells, and normal cells, HEK cells, were each cultured in a 96-well plate at a concentration of 5 x 10 ³ cells/well for one day. The extracellular vesicles prepared in Example 6 were treated with cells at a concentration of 0 ng/ml, 10 ng/ml, or 100 ng/ml, respectively, and cultured for 48 hours. The degree of cell death was analyzed by CellTiter 96 AQueous Assay (Promega, #G5421).

As shown in FIG. 4 , normal cells, HEK cells, were not killed even when treated with the extracellular ER, but cancer cells, such as A549-luc cells, showed that the cells were killed by treatment with the extracellular ER. In particular, when treated with extracellular vesicles DE obtained from lymphocytes D transformed with the first and second lentiviruses rather than treatment with extracellular vesicles CE obtained from non-transformed lymphocytes C, cancer cells were killed. degree appeared to be greater.

The above results demonstrate that since the extracellular vesicles of the present invention exhibit cancer cell-specific cytotoxicity that only kills cancer cells, they can be used as safe anticancer agents that can remove only cancer cells without affecting normal cells.

Example 8. Cytotoxicity assay by IL-2

In order to determine whether the cytotoxicity shown in Example 7 is due to IL-2, cytotoxicity was evaluated in the same manner as in Example 7, except that IL-2 was treated instead of the extracellular vesicles.

Human non-small cell lung cancer cells, A549-luc cells, and normal cells, HEK cells, were each cultured in a 96-well plate at a concentration of 5 x 10 ³ cells/well for one day. The cells were treated with the IL-2 prepared in Example 6 at a concentration of 0 IU/ml, 10 IU/ml, or 100 IU/ml, respectively, and cultured for 48 hours. The degree of cell death was analyzed by CellTiter 96 AQueous Assay (Promega, #G5421).

As shown in FIG. 5 , IL-2 did not show cytotoxicity in both cancer cells or normal cells, and the cytotoxicity shown in Example 7 was not caused by IL-2 expressed on the surface of the extracellular endoplasmic reticulum. It was confirmed that the extracellular endoplasmic reticulum itself exhibited cancer cell-specific cytotoxicity.

Example 9. Antibody-expressed extracellular vesicles on the surface of cancer cell specificity evaluation

In order to evaluate the cancer cell specificity of the antibody-expressed extracellular vesicles on the surface according to the present invention, the extracellular vesicles of Example 6 were labeled with fluorescence to analyze the specificity of the cancer cells.

Human non-small cell lung cancer cells, A549-luc cells, and normal cells, HEK cells, were cultured at a concentration of 1 x 10 ⁴ cells/well in an 8-well chamber for one day. The cultured cells were treated with extracellular vesicles stained with DID (Molecular Probes, #V-22887) at a concentration of 100 ng/ml for 3 hours. Thereafter, the cells were washed once with phosphate buffered saline (PBS), fixed with 4% formaldehyde, washed three times with saline, and then treated with DAPI to stain the nucleus. The stained cell images were analyzed using a confocal microscope.

In addition, human non-small cell lung cancer cells, A549-luc cells, and normal cells, HEK cells, were cultured in a 12 well plate at a concentration of 1 x 10 ⁴ cells/well, and stained with DID (Molecular Probes, #V-22887). The extracellular vesicles were prepared at a concentration of 100 ng/ml, washed and fixed in the same manner as above, and then analyzed by flow cytometry.

As shown in FIG. 6, when treated with extracellular vesicles (Con-EV) obtained from non-transformed lymphocyte C and extracellular vesicle (IL2-EV) obtained from lymphocyte I transformed only with the first lentivirus In this case, extracellular vesicles were not observed because they were not bound to normal cells or cancer cells, and when treated with extracellular vesicles (Double-EV) obtained from lymphocytes D transformed with the first and second lentiviruses, DID only in cancer cells It was observed that the extracellular vesicles stained with were bound to the cells.

This proves that only the extracellular endoplasmic reticulum (Double-EV), which expresses an antibody on the surface, recognizes and binds cancer cells, and has cancer cell specificity.

Example 10. Antibody-expressed extracellular endoplasmic reticulum cancer cell specificity verification

In order to verify the cancer cell specificity of the extracellular vesicles expressed on the surface of the antibody according to the present invention, a competitive antibody was treated before the extracellular vesicles were treated and whether the cancer cell specificity of the extracellular ER was maintained.

The extracellular vesicles prepared in Example 6 express Erbitux scFv as an antibody, and Erbitux scFv binds to EGFR (pidermal growth factor receptor) overexpressed in cancer cells. Therefore, in order to verify the cancer cell specificity according to the antibody in the extracellular vesicle, an antibody that competitively binds to EGFR was used.

Human non-small cell lung cancer cells, A549-luc cells, and normal cells, HEK cells, were cultured in an 8-well chamber at a concentration of 1 x 10 ⁴ cells/well. Each cell was pre-treated with a competitive antibody that specifically binds to EGFR for 1 hour, and then the extracellular vesicles stained with DID (Molecular Probes, #V-22887) were treated at a concentration of 100 ng/ml for 3 hours. Cells were washed once with phosphate buffered saline (PBS) and fixed with 4% formaldehyde. After washing 3 times with saline, the reaction was performed with a secondary antibody that recognizes human Fc (with FITC fluorescence attached) at room temperature for 1 hour, followed by washing 3 times with saline. After washing three times with saline, DAPI was treated to stain the nucleus. The stained cell images were analyzed using a confocal microscope.

As shown in Figure 7, the antibody-expressing extracellular vesicles were shown to maintain cancer cell specificity as in Example 9, but extracellular vesicles were not observed in cancer cells pretreated with a competitive antibody that specifically binds to EGFR. didn't This means that when EGFR of cancer cells is blocked by competitive antibodies, the extracellular vesicles do not recognize cancer cells. Therefore, the above results demonstrate that the extracellular vesicles of the present invention target cancer cells by the antibody expressed on the surface.

Example 11. Verification of antibody-specific targeting of extracellular vesicles in animal models

To verify that cancer cell-specific targeting is possible by the antibody attached to the surface, fluorescently stained extracellular vesicles were treated in a mouse model transplanted with a non-small cell lung cancer cell line (A549).

After purchasing BALB/c nude mice (male, 6 weeks old), after 1 week of stabilization, the non-small cell lung cancer cell line (A549) was injected subcutaneously at the number of 5 x 10 ⁶ cells/mouse, and the tumor volume was 100 I waited until it became mm ³ . The volume of the tumor was calculated as long axis x (short axis) ² x 0.5. After the tumor volume reached 100 mm ³ , 20 ug of the extracellular vesicles stained with DID (Molecular Probes, #V-22887) were injected through a mouse tail vein injection. Twenty-four hours after injection of the extracellular vesicles, the mice were sacrificed via cervical dislocation, and each organ (tumor, heart, lung, liver, spleen, and kidney) was dissectioned to obtain a 'fluorescence, luminescence and computed tomography imaging system (IVIS). )' was used to observe the fluorescence intensity. As a result, as shown in the left image of FIG. 8 , it was confirmed that more extracellular vesicles (DE) expressing an antibody on the surface were delivered to the tumor and showed strong fluorescence. (PBS; phosphate buffered saline injection control group, CE; control group treated with extracellular vesicles, DE; group treated with extracellular vesicles that simultaneously express IL-2 and Erbitux)

In addition, in order to prepare a frozen section of the tumor, the tumor was fixed with 4% formaldehyde, washed three times with PBS, and then incubated in 30% sucrose solution over night. Thereafter, the tumor was fixed at -20°C with OCT compound, frozen sectioned, placed on a slide, and nuclear stained with DAPI, followed by analysis of fluorescence intensity through a confocal fluorescence microscope. As a result, as shown in the right image of FIG. 8 , it was confirmed that more extracellular vesicles (DE) expressing antibodies on the surface were observed in the cross section of the frozen section of the tumor. (PBS; phosphate buffered saline injection control group, CE; control group treated with extracellular vesicles, DE; group treated with extracellular vesicles that simultaneously express IL-2 and Erbitux)

As described above in detail a specific part of the present invention, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. Do. That is, the substantial scope of the present invention is defined by the appended claims and their equivalents.

The scope of the present invention is indicated by the following claims, and all changes or modifications derived from the meaning and scope of the claims and their equivalents should be construed as being included in the scope of the present invention.

<110> Daegu Gyeongbuk Institute of Science and Technology Kyungpook National University <120> Extracellular vesicle expressing cytokines and antibodies, Method of preparing the same, and Use of the same <130> ADP-2021-0465 <160> 17 <170> KoPatentIn 3.0 <210> 1 <211> 153 <212> PRT <213> Artificial Sequence <220> <223> IL-2 <400> 1 Met Tyr Arg Met Gln Leu Leu Ser Cys Ile Ala Leu Ser Leu Ala Leu 1 5 10 15 Val Thr Asn Ser Ala Pro Thr Ser Ser Ser Thr Lys Lys Thr Gln Leu 20 25 30 Gln Leu Glu His Leu Leu Leu Asp Leu Gln Met Ile Leu Asn Gly Ile 35 40 45 Asn Asn Tyr Lys Asn Pro Lys Leu Thr Arg Met Leu Thr Phe Lys Phe 50 55 60 Tyr Met Pro Lys Lys Ala Thr Glu Leu Lys His Leu Gln Cys Leu Glu 65 70 75 80 Glu Glu Leu Lys Pro Leu Glu Glu Val Leu Asn Leu Ala Gln Ser Lys 85 90 95 Asn Phe His Leu Arg Pro Arg Asp Leu Ile Ser Asn Ile Asn Val Ile 100 105 110 Val Leu Glu Leu Lys Gly Ser Glu Thr Thr Phe Met Cys Glu Tyr Ala 115 120 125 Asp Glu Thr Ala Thr Ile Val Glu Phe Leu Asn Arg Trp Ile Thr Phe 130 135 140 Cys Gln Ser Ile Ile Ser Thr Leu Thr 145 150 <210> 2 <211> 243 <212> PRT <213> Artificial Sequence <220> <223> E-scFv <400> 2 Gln Val Gln Leu Lys Gln Ser Gly Pro Gly Leu Val Gln Pro Ser Gln 1 5 10 15 Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe Ser Leu Thr Asn Tyr 20 25 30 Gly Val His Trp Val Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp Leu 35 40 45 Gly Val Ile Trp Ser Gly Gly Asn Thr Asp Tyr Asn Thr Pro Phe Thr 50 55 60 Ser Arg Leu Ser Ile Asn Lys Asp Asn Ser Lys Ser Gln Val Phe Phe 65 70 75 80 Lys Met Asn Ser Leu Gln Ser Asn Asp Thr Ala Ile Tyr Tyr Cys Ala 85 90 95 Arg Ala Leu Thr Tyr Tyr Asp Tyr Glu Phe Ala Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ala Lys Leu Gly Gly Gly Gly Ser Gly Gly 115 120 125 Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Leu Leu Thr Gln Ser Pro 130 135 140 Val Ile Leu Ser Val Ser Pro Gly Glu Arg Val Ser Phe Ser Cys Arg 145 150 155 160 Ala Ser Gln Ser Ile Gly Thr Asn Ile His Trp Tyr Gln Gln Arg Thr 165 170 175 Asn Gly Ser Pro Arg Leu Leu Ile Lys Tyr Ala Ser Glu Ser Ile Ser 180 185 190 Gly Ile Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr 195 200 205 Leu Ser Ile Asn Ser Val Glu Ser Glu Asp Ile Ala Asp Tyr Tyr Cys 210 215 220 Gln Gln Asn Asn Asn Trp Pro Thr Thr Phe Gly Ala Gly Thr Lys Leu 225 230 235 240 Glu Leu Lys <210> 3 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> linker-1 <400> 3 Gly Gly Gly Gly Ser 1 5 <210> 4 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> linker-2 <400> 4 Ser Gly Gly Gly Gly 1 5 <210> 5 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> linker-3 <400> 5 Ser Arg Ser Ser Gly 1 5 <210> 6 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> linker-4 <400> 6 Ser Gly Ser Ser Cys 1 5 <210> 7 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> linker-5 <400> 7 Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Ser 1 5 10 <210> 8 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> linker-6 <400> 8 Arg Pro Pro Pro Pro Cys 1 5 <210> 9 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> linker-7 <400> 9 Ser Ser Pro Pro Pro Pro Cys 1 5 <210> 10 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> linker-8 <400> 10 Gly Ser Thr Ser Gly Ser Gly Lys Ser Ser Glu Gly Lys Gly 1 5 10 <210> 11 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> linker-9 <400> 11 Gly Ser Thr Ser Gly Ser Gly Lys Ser Ser Glu Gly Ser Gly Ser Thr 1 5 10 15 Lys Gly <210> 12 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> linker-10 <400> 12 Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr 1 5 10 15 Lys Gly <210> 13 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> linker-11 <400> 13 Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Glu Phe 1 5 10 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-2-f <400> 14 agacccaggg acttaatcag 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IL-2-r <400> 15 acaatggttg ctgtctcatc 20 <210> 16 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Erbituxc-f <400> 16 ggcccagccg gccat 15 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Erbituxc-r <400> 17 atttaggccc ccgaggcctt tcagctccag cttggtccca 40

Claims (14)

An extracellular vesicle expressing a cytokine and an antibody on the surface, wherein the cytokine is IL-2 having an amino acid sequence shown in SEQ ID NO: 1, and the extracellular ER is T-cell-derived. The extracellular vesicle according to claim 1, wherein the phospholipid bilayer constituting the extracellular ER comprises a transmembrane protein, and the transmembrane protein is coupled to the cytokine or antibody through a linker. The extracellular vesicle according to claim 2, wherein the antibody is an Erbitux scFv having the amino acid sequence shown in SEQ ID NO: 2. The extracellular vesicle according to claim 2, wherein the linker has a sequence that repeats 1 to 20 times any one selected from among the amino acid sequences shown in SEQ ID NOs: 3 to 13. The method of claim 2, wherein the extracellular vesicles are cytokines or genes encoding antibodies; a linker domain that encodes the linker; And a vector comprising a transmembrane domain encoding a transmembrane protein; Extracellular endoplasmic reticulum, characterized in that derived from the transformed T cell. According to claim 5, wherein the transmembrane domain is epidermal growth factor receptor, insulin receptor, platelet-derived growth factor (PDGF) receptor, vascular endothelial growth factor receptor, fibroblast growth factor receptor, cholecystokinin (Cholecystokinin; CCK) receptor, neurotrophic factor (NGF) receptor, hepatocyte growth factor (HGF) receptor, Ephrin (Eph) receptor, angiopoietin receptor and RYK (Related to receptor tyrosine kinase) receptor Extracellular vesicles, characterized in that the transmembrane domain contained in any one receptor selected from the group consisting of. The extracellular vesicles according to claim 5, wherein the T cells are helper T cells or CD8+ T cells. According to claim 1, wherein the extracellular vesicles are extracellular vesicles characterized in that it exhibits an anticancer effect by having a specific cytotoxicity to cancer cells. The extracellular vesicle according to claim 8, wherein the extracellular vesicle is used as a carrier in which a drug or a physiologically active substance is encapsulated therein. A pharmaceutical composition for the prevention or treatment of cancer comprising the extracellular vesicles of any one of claims 1 to 9 as an active ingredient. 11. The method of claim 10, wherein the cancer is melanoma, colon cancer, lung cancer, skin cancer, non-small cell lung cancer, colon cancer, bone cancer, pancreatic cancer, head or neck cancer, uterine cancer, ovarian cancer, rectal cancer, stomach cancer, perianal cancer, breast cancer, fallopian tube cancer Carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hawkins' disease, esophageal cancer, small intestine cancer, endocrine adenocarcinoma, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic or acute Leukemia, lymphocytic lymphoma, bladder cancer, kidney or ureter cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system tumor, primary central nervous system lymphoma, spinal cord tumor, brainstem glioma and pituitary adenoma A pharmaceutical composition for the prevention or treatment of cancer. 10. A composition comprising the extracellular vesicle of any one of claims 1 to 9, wherein the drug or physiologically active substance is encapsulated inside the extracellular vesicle, the composition for delivering a drug or physiologically active substance. The method of claim 12, wherein the drug is any one selected from the group consisting of anticancer drugs, anti-inflammatory drugs, antibiotics, antibacterial agents and vaccines, and the physiologically active material is any one selected from the group consisting of peptides, proteins, hormones and genes. A composition for delivery of a drug or physiologically active substance, characterized in that. A method for preparing the extracellular vesicle of any one of claims 1 to 9, comprising:
preparing a first vector comprising a gene encoding a cytokine, a linker domain encoding a linker, and a transmembrane domain encoding a transmembrane protein;
preparing a second vector comprising a gene encoding an antibody, a linker domain encoding a linker, and a transmembrane domain encoding a transmembrane protein;
transforming the cells with the first vector and the second vector using a lentivirus; and
Separating the extracellular vesicles from the culture medium in which the cells transformed with the first vector and the second vector are cultured;

Images