WO2023010073A1 - Compositions and methods for improving t cell persistence and function - Google Patents

Compositions and methods for improving t cell persistence and function Download PDF

Info

Publication number
WO2023010073A1
WO2023010073A1 PCT/US2022/074251 US2022074251W WO2023010073A1 WO 2023010073 A1 WO2023010073 A1 WO 2023010073A1 US 2022074251 W US2022074251 W US 2022074251W WO 2023010073 A1 WO2023010073 A1 WO 2023010073A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
cell
engineered
gene
exhaustion
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2022/074251
Other languages
English (en)
French (fr)
Inventor
Ansuman Satpathy
Julia BELK
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Leland Stanford Junior University
Original Assignee
Leland Stanford Junior University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Leland Stanford Junior University filed Critical Leland Stanford Junior University
Priority to EP22850516.0A priority Critical patent/EP4376858A4/en
Priority to US18/580,472 priority patent/US20240327826A1/en
Priority to JP2024505066A priority patent/JP2024527997A/ja
Priority to CN202280052739.XA priority patent/CN117813102A/zh
Publication of WO2023010073A1 publication Critical patent/WO2023010073A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/32T-cell receptors [TCR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4267Cancer testis antigens, e.g. SSX, BAGE, GAGE or SAGE
    • A61K40/4269NY-ESO
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1082Preparation or screening gene libraries by chromosomal integration of polynucleotide sequences, HR-, site-specific-recombination, transposons, viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/31Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the route of administration
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/38Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/46Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
    • A61K2239/50Colon
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/46Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
    • A61K2239/57Skin; melanoma
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2503/00Use of cells in diagnostics
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/15011Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041Use of virus, viral particle or viral elements as a vector

Definitions

  • the present disclosure relates to modified T cells and composition and methods of use thereof.
  • T cell exhaustion is a major barrier to durable and effective CAR ⁇ T cell therapies, particularly for solid tumors.
  • chronic T cell activation by tumor cells leads to T cell exhaustion, which results in impaired proliferation, cytotoxicity, and effector functions, thereby limiting T cell killing of cancer cells.
  • Exhaustion is often targeted with checkpoint inhibitors.
  • checkpoint inhibitors a majority of patients fail to respond to these agents and no efficacy has been shown in combination with CAR T cells in clinical trials.
  • engineered T cells lacking at least one gene winch facilitates or supports T cell persistence and functionality.
  • the engineered T cell maintains functionality under conditions in which non-engineered T cells display exhaustion.
  • the engineered T cells lack at least one gene selected from the group consisting of: INO80C, GAT A3, ARID 1 A, WDR82, TRP53, GPR137C, ZFP219,
  • the engineered T cells lack two or more genes selected from the group consisting of: JNO80C, GATA3, ARID 1 A, WDR82,
  • the engineered T cell lacks at least one chromatin remodeling protein or a gene encoding thereof. In some embodiments, the engineered T cell lacks two or more chromatin remodeling proteins or a genes encoding thereof. In some embodiments, the at least one chromatin remodeling protein is a INO80 nucleosome positioning complex protein or SWI/SNF family member, or a combination thereof. In some embodiments, the ING80 nucleosome positioning complex protein is ActrS, Ino80, InoSOc, Ino80b, Actr8, or a combination thereof. In some embodiments, the SWI/SNF family member is a member of cBAF (canonical BRG 1/BRM-associated factor) complex.
  • cBAF canonical BRG 1/BRM-associated factor
  • the SWI/SNF family member is Arid! a, Arid2, Aridlb, Smarchl, Smarcd2, Smarcad, Smarcc l, or a combination thereof.
  • the engineered T cell further lacks at least one gene selected from the group consisting of: GATA3, WDR82, TRP53, GPR137C, ZFP219, HDAC1, and ELMS AN 1.
  • the engineered T cells may further comprise an exogenous receptor or a nucleic acid encoding thereof
  • the exogenous receptor is a T cell receptor (TCR) or chimeric antigen receptor (CAR).
  • the exogenous receptor is specific for a tumor antigen.
  • the T cells are derived from a biological sample from a subject. In some embodiments, the T cells are isolated from a tumor sample. In some embodiments, the T cells are expanded ex vivo.
  • compositions comprising a population of the engineered T cells described herein.
  • the compositions may further comprise at least one therapeutic agent.
  • the at least one therapeutic agent is selected from the group consisting of: an agent for treating T cell exhaustion; an antiviral agent; an antibiotic agent; an antimicrobial agent; a chemotherapeutic agent; or a combination thereof.
  • the methods comprise comprising obtaining a sample comprising T cells; altering the DN A of the T cells to knockout or disrupt at least one gene selected from the group consisting of: INO80C, GATA3, ARID 1 A, WDR82, TRP53, GPR137C, ZFP219, HDAC1, ELMSANi, and ACTR8; and engineering the T cells to express an exogenous receptor.
  • the methods comprise obtaining a sample comprising T cells; altering the DNA of the T cells to knockout or disrupt at least one gene encoding a chromatin remodeling protein; and engineering the T cells to express an exogenous receptor.
  • the chromatin remodeling protein is a INO80 nueleosome positioning complex protein or SWI/SNF family member, or a combination thereof.
  • the INQ80 nueleosome positioning complex protein is ActrS, Ino80, InoSOc, Ino80b, ActrB, or a combination thereof.
  • the SWI/SNF family member is a member of cBAF complex.
  • the SWI/SNF family member is Arid la, Arid2, Aridlb, Smarcbl, Smarcd2, Smarca4, Smarccl, or a combination thereof.
  • the method further comprises altering the DNA of the T cells to knockout or disrupt at least one gene selected from the group consisting of: GAT A3, WDR82, TRP53, GPR137G, ZFP219, HDAC1, and ELMS AN I .
  • the T cells are derived from a biological sample from a subject.
  • the T eells are isolated from a tumor sample.
  • the T cells are expanded ex vivo.
  • the exogenous receptor is a T cell receptor (TCR) or chimeric antigen receptor (CAR). In some embodiments, the exogenous receptor is specific for a tumor antigen.
  • TCR T cell receptor
  • CAR chimeric antigen receptor
  • the disease or disorder comprises an infection or cancer.
  • the cancer comprises a tumor.
  • the administering reduces the number of cancerous cells in the subject, reduces and/or eliminates the tumor burden in the subject, and/or shows enhanced cancer treatment compared to administration of unmodified T cells.
  • the method further comprises administering at least one additional therapeutic agent.
  • the at least one therapeutic agent may be selected from the group consisting of: an agent for treating T cell exhaustion; an antiviral agent; an antibiotic agent; an antimicrobial agent; a chemotherapeutic agent; or a combination thereof.
  • the T cells are autologous to the subject.
  • the T cells maintain functionality under conditions in which non-engineered T cells display exhaustion and/or have improved persistence and function compared to non-engineered T cells.
  • the methods comprise genetically modifying the T cell to lack at least one gene selected from the group consisting of: INO80C, GATA3, ARID 1 A, WDR82, TRP53, GPR137C, ZFP219, HDAC1, ELMSAN1, and ACTR8.
  • the methods comprise genetically modifying the T cell to lack at least one gene encoding a chromatin remodeling protein.
  • the chromatin remodeling protein is a INO80 nucleosome positioning complex protein or SWI/'SNF family member, or a combination thereof.
  • the INO80 nucleosome positioning complex protein is ActrS, Ino80, InoBOc, InoBOb, ActrS, or a combination thereof.
  • the SWI/SNF family member is a member of cBAF complex.
  • the SWI/SNF family member is Aridla, Arid2, Arid lb, Smarcbl, Smarcd2, Smarca4, Smarccl, or a combination thereof.
  • the method further comprises genetically modifying the T cell to lack at least one gene selected from the group consisting of: GAT A3, WDR82, TRP53, GPR137C, ZFP219, HDACl, and ELMS AN 1.
  • the T cells have increased survival in the presence of a chronic antigen.
  • the engineered T cells may further comprise an exogenous receptor or a nucleic acid encoding thereof.
  • the exogenous receptor Is a T cell receptor (TCR) or chimeric antigen receptor (CAR).
  • the exogenous receptor is specific for a tumor antigen.
  • the methods may further comprise administering the T cells to a subject in need thereof.
  • the subject has cancer or an infectious disease.
  • kits for screening for genes which facilitate T cell exhaustion comprising: culturing T cells under conditions of chronic or acute stimulation for at least six days, wherein each of T cells comprises at least one gene knockout or knockdown; isolating T cells not showing an exhausted T cell surface phenotype; and identifying the at least one gene knockout or knockdown.
  • the T cells are a T cell library, wherein the I’ cell library comprises at least one T cell with a knockout or knockdown for each gene in the genome of the T cell.
  • the T cells are CD8+ T cells.
  • the T cells are isolated from a subject.
  • the T cells are generated using a CRISPR-Cas system wherein each cell comprises at least one guide RNA directed to a gene of interest.
  • conditions of chronic stimulation comprise culturing the T cells using anti-CD3 coated plates. In some embodiments, the conditions of chronic stimulation further comprise culturing the T cells with IL-2. In some embodiments, conditions of acute stimulation comprise culturing the T cells with IL-2. In some embodiments, the culturing lasts six to ten days.
  • the system for genetic engineering T ceils may comprise a clustered interspersed short palindromic repeat (CRISPRi/CRISPR- associated protein (Cas) system, or a nucleic acid(s) encoding thereof, as described herein.
  • the system for genetic engineering T ceils comprises Cas9 (e.g., dCas9), or a nucleic acid encoding Cas9, and a gRNA directed to at least one gene which facilitates T cell exhaustion, or a nucleic acid encoding the gRNA.
  • the at least one gene which facilitates T cell exhaustion may be selected from the group consisting of: INO80C, GAT A3, ARID! A, WDR82, TRP53, GPR137C, ZFP219, I ID AC 1 , ELMS AN 1 , and ACTR8.
  • the at least one gene which facilitates T cell exhaustion is a gene encoding a chromatin remodeling protein.
  • the chromatin remodeling protein is a INO80 nucleosome positioning complex protein or SWl/SNF family member, or a combination thereof.
  • the IN 080 nucleosome positioning complex protein is Actr5, Ino80, InoBOc, InoBOb, Actr8, or a combination thereof.
  • the SWl/SNF family member is a member of cBAF complex.
  • the SWI/SNF family member is Arid la, And 2.
  • the systems or kits further comprise an exogenous receptor or a nucleic acid encoding thereof,
  • the systems or kits further comprise at least one additional therapeutic agent.
  • the at least one therapeutic agent may be selected from the group consisting of: an agent for treating T cell exhaustion; an antiviral agent; an antibiotic agent; an antimicrobial agent; a chemotherapeutic agent; or a combination thereof.
  • FIGS. 1A-1F show an exemplary in vitro assay recapitulating epigenetic hallmarks of T cell exhaustion.
  • FIG. 1A is a diagram of in vitro exhaustion assay.
  • FIG. IB shows the surface phenotype of CD8+ T cells at day 0 and day 10 of the T cell exhaustion assay, gated on live cells.
  • FIG. 1C is principal component analysis of ATAC-seq profiles of CD8+ T cells throughout the course of chronic stimulation.
  • FIG. 1A is a diagram of in vitro exhaustion assay.
  • FIG. IB shows the surface phenotype of CD8+ T cells at day 0 and day 10 of the T cell exhaustion assay, gated on live cells.
  • FIG. 1C is principal component analysis of ATAC-seq profiles of CD8+ T cells throughout the course of chronic stimulation.
  • FIG. 1A is a diagram of in vitro exhaustion assay.
  • FIG. IB shows the surface phenotype of CD8+
  • FIG. IE is a heatmap showing ATAC-seq coverage of each peak in the “Terminal Exhaustion peak set” for each time point in the in vitro exhaustion assay. Reference data from TILs is also included. Selected nearest genes are indicated on the right.
  • FIG. IF is the chromVAR motif accessibility heatmap for each ATAC-seq sample. Selected motifs are indicated on the right. Top 100 most variable motifs are shown.
  • FIGS. 2A-2F show' genome-wide functional interrogation of T cell exhaustion.
  • FIG. 2A is a diagram of genome-wide T cell exhaustion screen.
  • FIG. 2B shows the correlation of replicate screens with selected functional categories of genes colored as indicated. Gene sets were based on GO Terms and were supplemented with manual annotations.
  • FIG. 2C is a volcano plot with top hits labeled.
  • FIG. 2D is individual sgRNA residuals for top hits in different functional categories: integrin or TCR signaling.
  • FIG. 2E is a GO Term analysis of the top 100 hits.
  • FIG. 2F is individual sgRNA residuals for top hits in different functional categories: chromatin (left), selected receptors and transcription factors (center), or other (right). Histogram for all guide residuals is shown above, and 1000 randomly selected guides are shown in the background of each row in gray, for visual reference.
  • FIG. 3 is cytoscape network representation of top hits. Top positive and negative hits from the genome- wdde screen are shown. Each protein is represented by a node in the cytoscape network, colored by its z-score in the genome-wide screen. Nodes are connected if there is a high confidence protein-protein interaction.
  • FIGS. 4A-4G show 7 the targeted follow up of top hits in vivo.
  • FIG. 4A is a diagram of exemplary in vivo pooled screening.
  • FIG. 4B is a volcano plot of genes enriched or depleted in MC-38 tumors.
  • FIG. 4C show's the correlation of tumor LFC z-scores to spleen LFC z- scores colored by functional category.
  • FIG. 4D shows the correlation of in vivo z-score and in vitro (genome- wide) z-scores for genes in the minipool.
  • FIG. 4E is a cytoscape protein-protein interaction network colored by z-score in MC-38 tumors.
  • FIG. 4A is a diagram of exemplary in vivo pooled screening.
  • FIG. 4B is a volcano plot of genes enriched or depleted in MC-38 tumors.
  • FIG. 4C show's the correlation of tumor LFC z-scores to s
  • FIG. 4F is a boxplot of tumor vs input log fold change for each sgRNA targeting the indicated gene, with the mean control log fold change subtracted.
  • FIG. 4G is z-scores for every tumor for the top 15 in vivo hits as well as control guides and Cd3d.
  • FIGS. 5A-5G show' in vivo Perturh-seq of tumor infiltrating lymphocytes.
  • FIG. 5A is a diagram of direct capture Perturb-seq of sorted TILs.
  • FIG. 5B is scRN A-seq profiles of TILs colored by cluster assignment.
  • FIG. 5C left is scRN A-seq profiles of cells colored by the perturbation detected in each cell. Cells where no guide, or multiple guides, were detected per cell are shown in grey.
  • 5C right is z-score of each gene knockout in vitro and in vivo (MC-38 tumor z-score).
  • FIG. 5D is the correlation of genome wide gene expression differences of cells with each perturbation compared to control cells.
  • FIG. 5E is an upset plot of induced genes for different perturbations.
  • FIG. 5F is an upset plot of repressed genes for different perturbations.
  • FIG. 5G shows selected genes, grouped by category, and the change in expression relative to control in different perturbations.
  • FIGS. 6A-6F show additional characterization of in vitro assay.
  • FIG. 6A shows the surface phenotype of chronically stimulated T cells throughout the in vitro exhaustion assay.
  • FIG. 6B is a graph of the proliferation of chronically stimulated and acutely stimulated T cells in vitro.
  • FIG. 6C show's effector cytokine production of acutely (left) and chronically (right) stimulated T cells. Cells were restimulated with PMA and ionomycin 8 days after initial stimulation.
  • FIG. 6D is a graph of the survi val of B16 cells after co-culture with acutely or chronically stimulated OT-1 T cells. Tumor cells were pulsed with cognate peptide (SIINFEKL- SEQ ID NO: I).
  • FIG. 6E is a graph of B 16-ovalbumin tumor growth in vivo after adoptive transplant of acutely or chronically stimulated T cells.
  • FIG. 6F is a heatmap showing ATAC-seq coverage of each peak in the “Terminal Exhaustion peak set” for each time point in the in vitro exhaustion assay. Reference data from T cells in LCMV is also included.
  • FIGS. 7A-7D show quality control data for in vitro genome wide screen.
  • FIG. 7A shows expression of BFP on day 2 of screen.
  • FIG. 7B shows the surface phenotype of cells before gDNA extraction.
  • FIG. 7C shows sgRNA representation of each sample.
  • FIG. 7D are graphs of the guide count correlations (Acute vs Chronic) for each replicate. CDS subunits are shown in red, all other guides in black.
  • FIGS. 8A-8D show' LCMV Clone 13 expression analysis of top hits.
  • FIG. 8A is a graph of cell types identified in scRNA- seq data.
  • FIG. 8B shows expression of Pdedl, Haver2, Tcf7, and CxScrl in single cells.
  • FIG. 8C is violin plots of the expression of the gene module containing the top 100 in vitro hits across clusters.
  • FIG. 8D is a eytoscape network of top hits colored by average expression across all single cells.
  • FIGS. 9A-9D show additional data for targeted in vivo screening.
  • FIG. 9 A are graphs of tumor sizes and T cell injection timeline for each group in the minipool screen.
  • FIG. 9B top is a boxplot of spleen vs input log fold change for each sgRNA targeting the indicated gene, with the mean control log fold change subtracted.
  • FIG. 9B bottom is a heatmap of z-scores for every spleen for the top 15 in vivo hits as well as control guides and Cd3d.
  • FIG. 9C is GO Term analysis of the top 20 positive hits in tumors.
  • FIG. 9D is LCMV expression analysis for 9 top epi genetics hits.
  • FIGS. 10A-10E show additional data for in vivo direct capture Perturb-seq.
  • FIG. 10A Is violin plots showing expression of Pdedl, Havcr2, and Mki67 by cluster.
  • FIG. 10B is a volcano plot comparing Cluster 1 (Cl) to Cluster 2 (C2). Selected differential genes are Indicated.
  • FIG. IOC shows expression of selected transcription factors Tbx21 , Tox, Homes, and Tcf7.
  • FIG. IQD is visualization of cells containing each gene knockout.
  • FIG. 10E, top is a graph of counts of repressed or induced genes for each perturbation.
  • FIG. 10E, bottom is a graph of counts of repressed or induced genes that are shared with Nr4a3-KG for each perturbation.
  • FIG. 11A is a casTLE volcano plot of the Chronic vs Acute stimulation screen comparison, with top hits labeled.
  • FIG. 11 B show's the correlation of Acute vs Chronic z-scores in the mini-pool versus the genome-wide screen.
  • FIG. 11C show's the correlation of the mini- pool Chronic vs Acute z-scores against Acute vs Input (left) or Chronic vs Input (right).
  • Genes in (G) and (H) are colored by functional category: TCR signaling, integrin signaling (orange), chromatin (blue), or other (grey). Colored boxes in (H, left) denote enhanced, similar , or reduced expansion (top to bottom) after acute stimulation.
  • FIG. 12A shows the correlation of tumor LFC z-scores to spleen LFC z-scores, colored by functional category.
  • FIG. 12B shows the correlation of in vivo z-score and in vitro z- scores for genes in the CRISPR mini - pool .
  • FIG. 12C shows the correlation of in vivo MC-38 and B16 tumor z-scores for genes in the CRISPR mini-pool.
  • FIG. 12D is a cytoscape protein-protein interaction network colored by z-score in MC-38 tumors.
  • FIG. 12E top is a boxplot of tumor versus input log fold change for each sgRNA targeting the indicated gene, with the mean control log fold change subtracted.
  • FIG. 12E top is a boxplot of tumor versus input log fold change for each sgRNA targeting the indicated gene, with the mean control log fold change subtracted.
  • FIG. 12E bottom is heatmaps showing the sgRNA average of the indicated in vivo or in vitro screen for the same hits.
  • FIG. 12 F is individual sgRNA residuals for six top hits showing the Tumor vs Input comparison (left), Spleen vs Input (center), and in vitro Chronic vs Acute (right).
  • FIGS. I3A-13F show SWI/SNF mini-pool CRISPR screens and functional studies demonstrating that tuning cBAF activity can enhance anti-tumor immunity.
  • FIG. 13A show's an in vitro competition assay of Aridl a-sgRNA versus CTRL1 T cells. Left: cells were mixed on Day 4 at the indicated ratios and passaged in the chronic stimulation assay for 6 days. On Day 10, proliferation relative to CTRL! T cells and surface phenotype were assessed by flow' cytometry.
  • FIG. 13B shows an in vivo competition assay of Arid] a-sgRNA versus CTRL1 T cells. Cells were mixed on Day 6 (Input) and then transplanted into tumor bearing mice.
  • FIG. 13C are graphs of tumor sizes for each cohort. Statistical significance was assessed at Day 15.
  • FIG. 13D are survival graphs showing that Aridl a-sgRNA T cells significantly Improve survival of tumor- bearing mice.
  • FIG. 13E shows the correlation of SWI/SNF CRISPR mini-pool tumor enrichments in MC-38 versus B16 tumor models.
  • FIG. 13F are cartoons of the three BAF complexes colored by z-score from SWI/SNF CRISPR mini-pool experiments in MC-38 tumors. BAF complex cartoons adapted from (Mashtalir et al., 2018). * p ⁇ 0.05, *** p ⁇ 0.001.
  • FIGS. 14A-14D show conserved function of ARID l A in human T cells in vitro and in vivo .
  • FIG. I4A are graphs of the proliferation and viability of primary human T cells after electroporation of the indicated RNP. Left: Acutely stimulated T cells. Right: Chronically stimulated T cells using anti-CD3-coated plates. Data shown is representative of 3 independent experiments and 3 donors.
  • FIG. 14B is a schematic of CRISPR mini-pool screen in primary human €D8 f T cells transduced with the NY-ESO-1 -specific TCR, 1G4.
  • FIG. 14C shows the results of the human CRISPR mini-pool screen aggregated by gene.
  • FIGS. 15A-15G show in vivo Perturb-seq revealing distinct transcriptional roles of the cBAF and INO80 complexes in TILs.
  • FIG. 15.4 is a schematic of direct-capture Perturb-seq of sorted TILs.
  • FIG. 15B is scRNA-seq profiles of TILs colored by cluster assignment.
  • FIG. 15C is scRNA-seq profiles of cells colored by the perturbation detected in each cell. Cells where no guide, or multiple guides, were detected are shown in grey.
  • FIG. 15D show's the expression of selected marker genes In each single cell.
  • FIG. I5E Is the analysis of LCMV signature gene sets for each cluster.
  • FIG. 15F is histograms of Pearson correlation of gene expression differences of pairs of sgRNAs. Top: Pairs targeting the same gene are shown in blue, other pairs are shown in gray. Bottom: Pairs targeting the same protein complex are shown in red, other pairs are shown in gray. Complexes considered in the analysis are cBAF ( Aridla , Aridlb , Srnarcdl, and Smarccl ) and INO80 ( InoSOc mdActrS). Pairs of sgRNAs that target the same gene are excluded.
  • FIG. 15G Left: Heatmap of the correlation of gene expression differences of each pair of sgRNAs.
  • FIG. 15G Center (from left to right): Representation of each sgRNA in the pre-transplant sample, cell count of each sgRNA in the Perturb-seq dataset, and estimated fold change of each sgRN A relative to controls.
  • FIGS. 16A-16H show' cBAF-depleted T cells exhibit enhanced effector gene signatures and reduced terminal exhaustion.
  • FIG. 16A is volcano plots comparing aggregated cells with the indicated perturbation versus CTRL1 cells.
  • FIG. I6B is pairwise correlations of gene expression differences induced by each perturbation.
  • FIG. 16C is heatmaps of all upregulated (up) or downregulated (down) genes in at least one perturbation, grouped by which perturbation has the strongest effect on expression. Selected genes in each block are labeled.
  • FIG. 16D shows a comparison of upregulated or downregulated gene sets by perturbation of cBAF subunits, Arid! a, Smarcdl, or Srnarccl
  • FIG. 16E shows a comparison of gene sets up- or downregulated by perturbation of INO80 subunits ActrS, or InoSOc
  • FIG. 16F shows a comparison of gene sets upregulated by perturbation of cBAF subunits, INO80 subunits, or Pdcdl, GataS, or Arid2 '
  • FIG. 16G is enrichments of upregulated and downregulated gene sets in LCMV expression data (Daniel et al., 2021). Module scores of each gene set were computed for each single cell in the LCMV dataset, averaged by cluster, and then z-scored to obtain the indicated enrichment z-scores.
  • FIG. 16H shows selected GO Terms of indicated gene sets.
  • FIGS. 17A-17F show Aridla facilitates the acquisition of the exhausted T cell chromatin state.
  • FIG. 17A shows principal component analysis of ATAC-seq profiles of Aridla- sgRNA and CTRL! cells in the in vitro exhaustion competition assay. Unperturbed naive and activated samples (Day 0 and 2) are included for reference.
  • FIG. 17B shows a comparison of ‘opened’ and ‘closed’ ATAC-seq peak sets from Day 6 to Day 10 for each genotype.
  • FIG. 16C is visualization of ‘opened’ and ‘closed’ ATAC-seq peak sets, with selected nearest genes labeled.
  • FIG. 16D shows ATAC-seq signal tracks of selected gene loci. Representative replicates are shown for each condition.
  • FIG. 17A shows principal component analysis of ATAC-seq profiles of Aridla- sgRNA and CTRL! cells in the in vitro exhaustion competition assay. Unperturbed naive and activated samples (Day 0
  • FIG. 16F is heatmaps showing ATAC-seq coverage of each peak in the “Terminal Exhaustion peak set” for A ridla-sgRNA and CTRL! cells at Day 6 and Day 10 in the in vitro exhaustion assay. Reference data from TILs Is also included, as well as reference naive and activated cell profiles.
  • FIG. 16F Is chromVAR motif accessibility heatmap for Aridla- sgRNA and CTRL1 ATAC-seq samples. Selected motifs are indicated on the right. Top 100 most variable motifs are shown.
  • FIG. 18A shows effector cytokine production of acutely (left) and chronically (right) stimulated T cells after 6 days of chronic stimulation (day 8 after isolation). Cells were restimulated with PMA and ionomycin 8 days after initial stimulation.
  • FIG. I8B are graphs of empirical cumulative distribution of peak accessibility for peaks in the Term. TEX peak set (top) and Prog. TEX peak set (bottom) for the indicated time points in vitro, Reference profiles from TILs are included as indicated.
  • FIG. ISC is box plots for the indicated peak sets in the in vitro exhaustion assay and reference TIL samples. Each dot represents one peak.
  • FIG. 19A and 19B are comparisons of cytokine production after acute stimulation, chronic stimulation (6 days of anti-CD3 stimulation) (FIG. 19A), or the modified chronic stimulation protocol (6 days of anti-CD3 stimulation after a 48-hour rest) (FIG. 19B).
  • FIG. 19C are Gini index and empirical cumulative distribution function shown for each sample in the genome-wide screen.
  • FIGS. 20A-20E show the comparison of CRISPR analysis strategies.
  • FIG. 20A is volcano plots of genome wide CRISPR screen results using casTLE (top left), MAGeCK (top right), and the disclosed pipeline (bottom).
  • FIG. 20B show's comparison of hit lists for each of the three pipelines.
  • FIG. 20C shows comparison of LFC difference computed by the disclosed pipeline to the casTLE Effect (left) and MAGeCK LFC (right).
  • FIG. 2QD is a counts table for RpllSa.
  • FIG. 20E shows genome wide screen results when z- scores are computed relative to all sgRNAs or a set of olfactory receptors (Vmnr* genes).
  • FIGS. 21A-21E show data for targeted in vitro screening.
  • FIG. 2IA is sgRNA representation of each sample in the in vitro mini-pool screen.
  • FIG. 2 IB shows the correlation of the sgRNA counts of each sample in the mini-pool screen.
  • FIG. 2 IC shows the correlation of the Chronic vs Acute replicate z-scores.
  • FIG. 21 D is a cytoscape interaction network with genes colored by their z-score in the Chronic vs Acute mini-pool screen.
  • FIG. 21E is a cytoscape interaction network with genes colored by their fitness categorization in acute stimulation.
  • FIGS. 22A-22F show data for targeted in vivo screening and validation of Arid la- targeting sgRNAs.
  • FIG. 22A shows sgRNA pool coverage for each sample in the in vivo mini- pool screen.
  • FIG. 22B is sgRNA residuals in tumors, spleens, and in vitro mini-pool Chronic vs Acute for selected genes in the “TCR signaling” and “Integrin signaling” categories.
  • FIG. 22C is boxplot of spleen vs input and acute vs chronic log fold change for each sgRNA targeting the indicated gene, with the mean control log fold change subtracted.
  • FIG. 22D is Sanger sequencing (TIDE) analysis of editing efficiency of A rid la sgRNAs.
  • FIG. TIDE Sanger sequencing
  • FIG. 22E Is Western blot analysis of protein knockdown for Arid la sgRNAs, as well as Arid lb and Smarca4 expression.
  • FIG. 22F shows quantification of protein knockdown for each identified isoform of Arid] a (panel C three bands). * p ⁇ 0.05, ** p ⁇ 0.01, *** p ⁇ 0.001, **** p ⁇ 0.0001.
  • FIGS. 23A-23G show data on the in vivo Perturb-seq.
  • FIG. 23A is scRNA-seq profiles of TILs colored by each independent experiment.
  • FIG. 23B is scRNA-seq profiles of TILs colored by each sample.
  • FIG. 23C is scRNA-seq profiles of TILs colored by predicted phase of the cell cycle.
  • FIG. 23 D shows additional marker genes shown for each cluster.
  • FIG. 23E shows expanded reference LCMV dataset with single cell profiles colored by LCMV cluster.
  • FIG. 23F shows expanded LCMV dataset with single cell profiles colored by LCMV infection (Acute corresponds to Armstrong infection while Chronic corresponds to Clone 13) and time point (Day 8 or Day 21 post infection).
  • FIG. 23 G is a heatmap of the correlation of gene expression differences subsetted on each cluster. The indicated gene knockdown was compared to CTRL1 cells within each cluster. Comparisons with ⁇ 150 cells in the comparison groups are excluded due to lack of
  • FIGS. 24A-24G show data on up- and down-regulated gene sets and ATAC-seq data.
  • FIG. 24A shows a comparison of gene sets downregulated by perturbation of cBAF subunits, INO80 subunits, or Pdcdl- sgRNA, GatoiFsgRNA, or Arid2-sgRNA.
  • FIG. 24B is module scores of the indicated gene sets computed for each cell in the expanded LCMV reference dataset.
  • FIG. 24C is box plots for the indicated peak sets in the in vitro exhaustion assay and reference TIL samples. Each dot represents one peak.
  • FIG. 24D are graphs of empirical cumulative distribution of peak accessibility for peaks in the Term. TEX peak set (top) and Prog.
  • FIG. 24E is principal component analysis of ATAC-seq data of primary human T ceils chronically stimulated for six days.
  • FIG. 24F shows differential peaks between ARIDlA-sgRNA and AAVS primary human T cells.
  • FIG. 24G is HOMER analysis of TF motifs enriched in AAVS ‘up’ peaks. Selected highly ranked motifs are shown. Results in (FIGS. 24E-24G) are merged from three different human donors in two Independent experiments with two different ARID 1 A targeting sgRNAs per donor.
  • an in vitro T cell exhaustion model enabled genome-wide screening for genes that influence T cell function.
  • several gene targets were identified, deletion of which: prevented CAR-T cell exhaustion, improved T cell survival In the presence of chronic antigen in vitro , and improved T cell persistence and function in tumor models in vivo.
  • Cell therapies with deletions of each of these genes find use for improved CAR-T or other adoptive T cell based therapies.
  • each intervening number there between with the same degree of precision is explicitly contemplated.
  • the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.
  • nucleic acid or the cell is at least substantially free from at least one other component with which they are naturally associated in nature and as found in nature.
  • nucleic acid or a “nucleic acid sequence” refers to a polymer or oligomer of pyrimidine and/or purine bases, preferably cytosine, thymine, and uracil, and adenine and guanine, respectively (See Albert L. Lehninger, Principles of Biochemistry, at 793- BOO (Worth Pub. 1982)).
  • the present technology contemplates any deoxyribonucleotide, ribonucleotide, or peptide nucleic acid component, and any chemical variants thereof, such as methylated, hydroxymethyl ated, or glycosylated forms of these bases, and the like.
  • the polymers or oligomers may be heterogenous or homogenous in composition and may be isolated from naturally occurring sources or may be artificially or synthetically produced.
  • the nucleic acids may be DNA or RNA, or a mixture thereof, and may exist permanently or transitionally in single-stranded or double-stranded form, including homoduplex, heteroduplex, and hybrid states.
  • nucleic acid or “nucleic acid sequence” may also encompass a chain comprising non-natural nucleotides, modified nucleotides, and/or non- nucleotide building blocks that can exhibit the same function as natural nucleotides (e.g,, “nucleotide analogs”); further, the term “nucleic add sequence” as used herein refers to an oligonucleotide, nucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin, which may be single or double-stranded, and represent the sense or antisense strand.
  • nucleic acid refers to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof.
  • compositions of the disclosure are used interchangeably herein and refer to the placement of the compositions of the disclosure into a subject by a method or route which results in at least partial localization of the composition to a desired site.
  • the compositions can be administered by any appropriate route which results in delivery to a desired location in the subject.
  • a “subject” or “patient” may be human or non-human and may include, for example, animal strains or species used as “model systems” for research purposes, such a mouse model as described herein. Likewise, subject may include either adults or juveniles (e.g., children). Moreover, subject may mean any living organism, preferably a mammal (e.g., humans and non- humans) that may benefit from the administration of compositions contemplated herein.
  • mammals include, but are not limited to, any member of the Mammalian class: humans, non-human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like.
  • non -mammals include, but are not limited to, birds, fish, and the like.
  • the mammal is a human.
  • “treat,” “treating,” and the like means a slowing, stopping, or reversing of progression of a disease or disorder when provided an engineered T cell or composition described herein to an appropriate control subject.
  • the term also means a reversing of the progression of such a disease or disorder to a point of eliminating or greatly reducing the symptoms.
  • “treating” means an application or administration of the engineered T cells or compositions described herein to a subject, where the subject has a disease or a symptom of a disease, where the purpose is to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disease or symptoms of the disease.
  • engineered T cells lacking at least one gene which facilitates or supports T cell persistence and functionality.
  • the genes may play a role in chromatin organization, chromatin remodeling (e.g., ATP-dependent chromatic remodeling), T cell receptor signaling pathways, immune response -activating signal transduction, immune response- activating cell surface receptor signaling pathways, nucleosome disassembly, and/or Fc receptor signaling pathways.
  • the genes comprise chromatin remodeling and transcription factors.
  • the at least one gene is selected from those included in FIGS. 3, 5C, and 9B.
  • the at least one gene is: INO80C (INO80 Complex Subunit C), GATA3 (GATA Binding Protein 3), ARID 1 A (AT-Rich Interaction Domain 1A), WDR82 (WD Repeat Domain 82), TRP53 (Tumor Protein P53), GPR137C (G Protein-Coupled Receptor 137C), ZFP219 (Zinc Finger Protein 219), HDACl (Histone Deacetyl ase 1), ELMSAN1 (EL.M2 and Myb/SANT-like domain containing 1), or ACTR8 (Aetin Related Protein 8).
  • the engineered T cell lacks two or more of: INO80C, GAT A3, ARID! A, WDR82, TRP53, GPR137C, ZFP219, HDACl, ELMSAN1, and ACTR8. In some embodiments, the engineered T cell further lacks NR4A3 (Nuclear Receptor Subfamily 4 Group A Member 3). [0073] In some embodiments, the engineered T cell lacks at least one chromatin remodeling protein or a gene encoding thereof. In some embodiments, the engineered T cell lacks two or more chromatin remodeling proteins or a genes encoding thereof.
  • the at least one chromatin remodeling protein Is a INO80 nucleosome positioning complex protein or SWL/SNF (SWItch/Sucrose Non-Fermen table) family member, or a combination thereof.
  • the INO80 nucleosome positioning complex protein Is Actr5 (Aetin Related Protein 5), InoBQ (INO80 Complex ATPase Subunit), InoSOc (INO80 Complex Subunit C), InoBOb (INO80 Complex Subunit B), Actr8 (Aetin Related Protein 8), or a combination thereof.
  • the 8WI/SNF family member is a member of cBAF complex.
  • the SWI/SNF family member is Aridla (AT-Rich Interaction Domain 1A), Arid2 (AT-Rich interaction Domain 2), Arid lb (AT-Rich Interaction Domain IB), Smarcbl (SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily h, member 1), Smarcd2 (SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2), Smarca4 (S WI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4), Smarccl (S WI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1), or a combination thereof.
  • the engineered T cell further lacks at least one gene selected from the group consisting of: GAT A3, WDR82, TRP53, GPR137C, ZFP219, HDAC1, and ELMS AN 1.
  • “Lacking a gene” can refer to either a full or partial deletion, mutation, or other disruption that results in no functional gene product being expressed or being targeted for degradation immediately upon expression. Thus, lacking a gene may result from any disruption to the genetic code such that a portion of the gene is altered, thereby affecting transcription and/or translation, e.g., rendering the gene unreadable through knockout techniques or by insertion of an additional gene for a desired protein or insertion of a regulatory sequence that modulates transcription of an existing sequence. In certain embodiments, the gene or a portion thereof is deleted, commonly referred to as gene knockout.
  • Any method known in the art for genetic engineering may be used to generate the engineered T cells described herein, including, but not limited to, use of a clustered interspersed short palindromic repeat (CRISPR)/CRISPR- associated protein (Cas) system, a meganuclease, transcription activator-like effector nuclease (TALEN) or a Zinc-finger nuclease (ZFN).
  • CRISPR clustered interspersed short palindromic repeat
  • Cas CRISPR-associated protein
  • TALEN transcription activator-like effector nuclease
  • ZFN Zinc-finger nuclease
  • the T cells maintain functionality under conditions in which unmodified T cells, T cells not lacking at least one gene which facilitates or supports T cell persistence and functionality, display exhaustion (e.g., maintaining functionality of T cells exposed to excessive antigen).
  • T cell exhaustion refers to loss of T cell function, which may occur as a result of an infection (e.g., a chronic infection) or a disease. T cell exhaustion is associated with increased expression of exhaustion markers and inhibitory receptors (e.g., PD-1, TIM-3, and LAG-3), apoptosis, and reduced cytokine secretion.
  • the invention is not limited by the type of T cell which is engineered to lack at least one gene which facilitates or supports T cell persistence and functionality.
  • the T cells may be selected from CD3+ T cells (e.g., a combination of CD4+ and CD8+ T cells), CD8+ T cells, CD4+ T cells, natural killer (NK) T cells, alpha beta T cells, gamma delta T cells, or any combination thereof, in some embodiments, the T cells are memory T cells (e.g., central memory I’ cells or effector memory T cells).
  • the T cells are tumor infiltrating lymphocytes, in some embodiments, the T cells are cytokine-induced killer cells.
  • the T cells are CD8+ T cells.
  • the T cells are naturally occurring T cells.
  • the T cells may be isolated from a subject sample.
  • the T cell is an anti-tumor T cell (e.g., a T cell with activity against a tumor (e.g., an autologous tumor) that becomes activated and expands in response to antigen).
  • a tumor e.g., an autologous tumor
  • Anti-tumor T cells include, but are not limited to, T cells obtained from resected tumors or tumor biopsies (e.g., tumor infiltrating lymphocytes (TILs)) and a polyclonal or monoclonal tumor-reactive T cell (e.g., obtained by apheresis, expanded ex vivo against tumor antigens presented by autologous or artificial antigen-presenting cells).
  • TILs tumor infiltrating lymphocytes
  • a polyclonal or monoclonal tumor-reactive T cell e.g., obtained by apheresis, expanded ex vivo against tumor antigens presented by autologous or artificial antigen-presenting cells.
  • the T cells are expanded ex vivo.
  • the T cells further comprise an exogenous receptor or a nucleic acid encoding an exogenous receptor.
  • the exogenous receptor is a T cell receptor (TCR) or a chimeric antigen receptor (CAR).
  • the exogenous receptor is not limited by its specificity to recognize and respond to any specific antigen or protein.
  • Such receptors are generally composed of extracellular domains comprising a specific antigen binding motif (e.g., single-chain antibody (scFv)) linked to Intracellular T cell signaling motifs.
  • a specific antigen binding motif e.g., single-chain antibody (scFv)
  • the T cells are genetically modified with exogenous receptors that recognize and respond to antigens for infectious disease and/or autoimmunity (e.g., Aspergillus carbohydrate b-glucan, Hepatitis C virus E2 glycoprotein, HIV envelope glycoprotein gpi20).
  • exogenous receptors e.g., Aspergillus carbohydrate b-glucan, Hepatitis C virus E2 glycoprotein, HIV envelope glycoprotein gpi20.
  • the T cells are genetically modified with exogenous receptors that recognize and respond to tumor antigens.
  • the invention is not limited by the type of tumor antigen so recognized.
  • tumor antigen refers to any molecule (e.g., protein, peptide, lipid, carbohydrate, etc.) solely or predominantly expressed or over-expressed by a tumor cell or cancer cell, such that the antigen is associated with the tumor or cancer.
  • the tumor antigen can additionally be expressed by normal, non-tumor, or non-cancerous cells. However, in such cases, the expression of the tumor antigen by normal, non-tumor, or noncancerous cells is not as robust as the expression by tumor or cancer cells.
  • the tumor or cancer cells can over-express the antigen or express the antigen at a significantly higher level, as compared to the expression of the antigen by normal, non-tumor, or noncancerous cells.
  • the cancer antigen can additionally be expressed by cells of a different state of development or maturation.
  • the tumor antigen can be additionally expressed by cells of the embryonic or fetal stage, which cells are not normally found in an adult.
  • the tumor antigen can be additionally expressed by stem cells or precursor cells, which cells are not normally found in an adult.
  • the tumor antigen can be an antigen expressed by any cell of any cancer or tumor.
  • Hie tumor antigen may be a tumor antigen of only one type of cancer or tumor, such that the tumor antigen is associated with or characteristic of only one type of cancer or tumor.
  • the tumor antigen may be a tumor antigen (e.g., may be characteristic) of more than one type of cancer or tumor.
  • the tumor antigen may be expressed by both breast and prostate cancer cells and not expressed at all by normal, non-tumor, or non-cancer cells.
  • Exemplary tumor antigens include, but are not limited to, glycoprotein 100 (gplOO), melanoma antigen recognized by T cells 1 (MART-1), melanoma antigen gene (MAGE) Family Members (e.g., MAGE- A 1 , MAGE- .42, MAGE- A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8, MAGE- .49, MAGE- A10, MAGE-A 11 , MAGE-A 12), New' York esophageal squamous cell carcinoma 1 (NY-ESO-1), vascular endothelial growth factor receptor-2 (VEGFR-2), glioma-associated antigen, carcmoembryonic antigen (CEA), beta- human chorionic gonadotropin, alphafetoprotein (AFP), lectin-reactive AFP, thyroglobulin, human telomerase reverse transcriptase, prostate-specific antigen (gpl
  • T cell containing a receptor that recognizes a tumor antigen finds use in the T cells, compositions, and methods of the invention.
  • a receptor e.g., a native or naturally occurring receptor, or a receptor engineered to express a synthetic receptor such as an engineered TCR or a CAR
  • a receptor e.g., a native or naturally occurring
  • the T cell is engineered to express a chimeric antigen receptor (CAR).
  • CAR chimeric antigen receptor
  • Any CAR that binds with specificity to a desired antigen e.g., tumor antigen
  • the CAR comprises an antigen- binding domain.
  • the antigen-binding domain is a single-chain variable fragment (scFv) containing heavy and light chain variable regions that bind with specificity to the desired antigen.
  • the CAR further comprises a transmembrane domain (e.g., a T cell transmembrane domain (e.g., a CD28 transmembrane domain)) and a signaling domain comprising one or more irmmmoreceptor tyrosine-based activation motifs (IT AMs) (e.g., a T cell receptor signaling domain (e.g., TCR zeta chain)).
  • the CAR comprises one or more co-stimulatory domains (e.g., domains that provide a second signal to stimulate T cell activation). The invention is not limited by the type of co-stimulatory domain.
  • any co-stimulatory domain known in the art may be used including, but not limited to, CD28, OX40/CD134, 4-1BB/CD137/TNFRSF9, the high affinity immunoglobulin E receptor- gamma subunit, FcERIy, ICOS/CD278, interleukin 2 subunit beta (ILRp) or CD 122, cytokine receptor common subunit gamma (IL-2Rv) or CD 132, and CD4Q.
  • the co- stimulatory domain is 4-1BB.
  • the co-stimulatory domain is CD28,
  • the CAR may comprise a target-specific binding element otherwise referred to as an antigen binding moiety.
  • the choice of moiety depends upon the type and number of ligands that define the surface of a target cell.
  • the antigen binding domain may be chosen to recognize a ligand that acts as a cell surface marker on target cells associated with a particular disease state.
  • Examples of cell surface markers that may act as ligands for the antigen moiety domain in the CAR of the invention include those associated with viral, bacterial, and parasitic infections, autoimmune diseases and, as described above, cancer cells.
  • a CAR can be engineered to include the appropriate antigen binding moiety specific to the desired antigen target. For example, if CD 19 is the desired antigen that is to be targeted, an antibody for CD 19 can be used as the antigen binding moiety for incorporation into the CAR of the invention.
  • the nucleic acid encoding the exogenous receptor may comprise DNA or RNA (e.g., mRNA).
  • the nucleic acid comprises vectors.
  • the nucleic acid may comprise a promoter that is constitutive, regulatable or inducible, cell type specific, tissue-specific, or species specific.
  • the promoter may also include sequences of other regulatory elements that are involved in modulating transcription (e.g., enhancers, Kozak sequences and introns).
  • promoter/regulatory sequences useful for driving constitutive expression include, but are not limited to, for example, CMV (cytomegalovirus promoter), EFla (human elongation factor 1 alpha promoter), SV40 (simian vacuolating virus 40 promoter), PGK (mammalian phosphogiycerate kinase promoter), Ubc (human uhiquitin C promoter), human heta-actin promoter, rodent beta-actin promoter, CBh (chicken beta-actin promoter), CAG (hybrid promoter contains CMV enhancer, chicken beta actin promoter, and rabbit beta-globin splice acceptor), TRE (Tetracycline response element promoter), HI (human polymerase III RNA promoter), U6 (human U6 small nuclear promoter), and the like.
  • CMV cytomegalovirus promoter
  • EFla human elongation factor 1 alpha promoter
  • SV40 simian
  • Additional promoters that can be used for expression, include, without limitation, cytomegalovirus (CMV) intermediate early promoter, a viral LTR such as the Rous sarcoma virus LTR, HIV-LTR, HTLV-1 LTR, Maloney murine leukemia virus (MMLV) LTR, myeoloproliferative sarcoma virus (MPSV) LTR, spleen focus-forming virus (SFFV) LTR, the simian virus 40 (SV40) early promoter, herpes simplex tk virus promoter, elongation factor 1 -alpha (EFl-a) promoter with or without the EFl-a intron.
  • CMV cytomegalovirus
  • a viral LTR such as the Rous sarcoma virus LTR, HIV-LTR, HTLV-1 LTR, Maloney murine leukemia virus (MMLV) LTR, myeoloproliferative sarcoma virus (MPSV) LTR, s
  • inducible expression can be accomplished by placing the nucleic acid encoding such a molecule under the control of an inducible promoter/regulatory sequence.
  • Promoters that are well known in the art can be induced in response to inducing agents such as metals, glucocorticoids, tetracycline, hormones, and the like, are also contemplated for use with the invention.
  • inducing agents such as metals, glucocorticoids, tetracycline, hormones, and the like.
  • present disclosure includes the use of any promoter/regulatory sequence known in the art that is capable of driving expression of the desired protein operably linked thereto.
  • the present disclosure also provides for vectors containing the nucleic acid and cells containing the nucleic acid or vectors thereof.
  • vectors of the present disclosure can drive the expression of one or more sequences in mammalian cells using a mammalian expression vector.
  • mammalian expression vectors include pCDMB (Seed, Nature (1987) 329:840, incorporated herein by reference) and pMT2PC (Kaufman, et al., EMBQ J. (1987) 6:187, incorporated herein by reference).
  • the expression vector's control functions are typically provided by one or more regulatory elements.
  • commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, simian virus 40, and others disclosed herein and known in the art.
  • the vector may contain, for example, some or all of the following: a selectable marker gene for selection of stable or transient transfectants in host eells; transcription termination and RNA processing signals; 5’ -and 3’ -untranslated regions; internal ribosome binding sites (IRESes), versatile multiple cloning sites; and reporter gene for assessing expression of the chimeric receptor.
  • a selectable marker gene for selection of stable or transient transfectants in host eells
  • transcription termination and RNA processing signals 5’ -and 3’ -untranslated regions
  • IVSes internal ribosome binding sites
  • reporter gene for assessing expression of the chimeric receptor.
  • Suitable vectors and methods for producing vectors containing transgenes are well known and available In the art.
  • Selectable markers include chloramphenicol resistance, tetracycline resistance, spectinomycin resistance, neomycin, streptomycin resistance, erythromycin resistance, rifampicin resistance, bleomycin resistance, thermally adapted kanamycin resistance, gentamycin resistance, hygromycin resistance, trimethoprim resistance, dihydrofolate reductase (DHFR), GPT; the URA3, HIS4, LEU2, and TRP1 genes of S. cerevisiae.
  • the vectors When introduced into a cell, the vectors may be maintained as an autonomously replicating sequence or extrachromosomal element or may be integrated into host DNA.
  • the nucleic acids may be delivered to the cells by any suitable means.
  • Viral and non-viral based gene transfer methods can be used to introduce the nucleic acids into cells. Such methods can be used to administer the nucleic acids to cells in culture, or in a host organism.
  • Non-viral vector delivery systems include DNA plasmids, cosmids, RNA (e.g., a transcript of a vector described herein), a nucleic acid, and a nucleic acid complexed with a delivery vehicle.
  • Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell.
  • a variety of viral constructs may be used to deliver the present nucleic acids to the cells.
  • Viral vectors include, for example, retroviral, lenti viral, adenoviral, adeno-associated and herpes simplex viral vectors.
  • Nonlimiting examples of such recombinant viruses include recombinant adeno-associated virus (AAV), recombinant adenoviruses, recombinant lentivimses, recombinant retroviruses, recombinant herpes simplex viruses, recombinant poxviruses, phages, etc.
  • the present disclosure provides vectors capable of integration in the host genome, such as retrovirus or lentivirus. See, e.g., Ausuhel et aL, Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989; Kay, M. A., et a!., 2001 Nat. Medic. 7(l):33-40; and Walther W. and Stein U., 2000 Drags,
  • Transfection refers to the taking up of a vector by a cell whether or not any coding sequences are in fact expressed. Numerous methods of transfection are known to the ordinarily skilled artisan, for example, lipofectamine, calcium phosphate co-precipitation, electroporation, DEAE-dexlran treatment, rnicroinjection, viral infection, and other methods known in the art. Transduction refers to entry of a virus into the cell and expression (e.g., transcription and/or translation) of sequences delivered by the viral vector genome. In the case of a recombinant vector, “transduction” generally refers to entry of the recombinant viral vector into the cell and expression of a nucleic acid of Interest delivered by the vector genome.
  • Methods of delivering vectors to cells are well known In the art and may include DNA or RNA electroporation, transfection reagents such as liposomes or nanoparticles to delivery DNA or RNA; delivery of DNA, RNA, or protein by mechanical deformation (see, e.g., Sharei et al. Proc. Natl. Acad. Sci, USA (2013) 110(6): 2082-2087, incorporated herein by reference); or viral transduction.
  • the vectors are delivered to cells by viral transduction.
  • Nucleic acids can he delivered as part of a larger construct, such as a plasmid or viral vector, or directly, e.g., by electroporation, lipid vesicles, viral transporters, rnicroinjection, and biolistics (high-speed particle bombardment).
  • delivery vehicles such as nanoparticle- and lipid-based delivery systems can be used.
  • Further examples of delivery vehicles include lentiviral vectors, ribonucleoprotein (RNP) complexes, lipid-based delivery system, gene gun, hydrodynamic, electroporation or micleofection microinjection, and biolistics.
  • RNP ribonucleoprotein
  • compositions comprising a population of engineered T cells as described herein.
  • the composition may optionally include at least one additional therapeutic agent, such as other drugs for treating T cell exhaustion (e.g,, anti-PD-1 checkpoint inhibitor, such as nivolumab), or other medications used to treat a subject for an infection or disease associated with T cell exhaustion (e.g., antiviral, antibiotic, antimicrobial, or anti-cancer drugs).
  • additional therapeutic agent such as other drugs for treating T cell exhaustion (e.g, anti-PD-1 checkpoint inhibitor, such as nivolumab), or other medications used to treat a subject for an infection or disease associated with T cell exhaustion (e.g., antiviral, antibiotic, antimicrobial, or anti-cancer drugs).
  • the at least one additional therapeutic agent comprises at least one chemotherapeutic agent.
  • chemotherapeutic includes any small molecule or other drug used in cancer treatment or prevention.
  • Chemotherapeutics include, but are not limited to, cyclophosphamide, methotrexate, 5-fluorouracil, doxorubicin, doeetaxel, daunorubicin, bleomycin, vinblastine, dacarbazine, cispiatin, paclitaxe!, raloxifene hydrochloride, tamoxifen citrate, ahemacicilib,
  • Armolimus alpelisib, anastrozole, pamidronate, anastrozole, exemestane, capecitabine, epirubicin hydrochloride, eribulin mesylate, toremifene, fulvestrant, letrozole, gemcitabine, goserelin, ixabepilone, emtansine, lapatinib, olaparib, megestrol, neratinib, palbociclib, ribociclib, talazop
  • compositions can include, for example, cytokines, chemokines and other biologic signaling molecules, tumor specific vaccines, cellular cancer vaccines (e.g., GM-CSF transduced cancer cells), tumor specific monoclonal antibodies, autologous and allogeneic stem cell rescue (e.g., to augment graft versus tumor effects), other therapeutic antibodies, molecular targeted therapies, anti-angiogenic therapy, infectious agents with therapeutic intent (such as tumor localizing bacteria) and gene therapy.
  • cytokines e.g., chemokines and other biologic signaling molecules
  • tumor specific vaccines e.g., GM-CSF transduced cancer cells
  • tumor specific monoclonal antibodies e.g., GM-CSF transduced cancer cells
  • autologous and allogeneic stem cell rescue e.g., to augment graft versus tumor effects
  • other therapeutic antibodies e.g., to augment graft versus tumor effects
  • molecular targeted therapies e.g., anti-angi
  • compositions may include pharmaceutically acceptable carriers.
  • pharmaceutically acceptable carrier means a non-toxic, inert solid, semi-solid or liquid filler, diluent, encapsulating material, surfactant, cyclodextrins or formulation auxiliary of any type.
  • a carrier may include a single ingredient or a combination of two or more ingredients.
  • materials which can serve as pharmaceutically acceptable carriers are sugars such as, but not limited to, lactose, glucose and sucrose; starches such as, but not limited to, corn starch and potato starch; cellulose and its derivatives such as, but not limited to, sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; pow'dered tragacanth; malt; gelatin; talc; excipients such as, but not limited to, cocoa butter and suppository waxes; oils such as, but not limited to, peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; surfactants such as, but not limited to, cremophor EL, cremophor RH 60,
  • cyclodextrins such as, but not limited to, alpha-CD, beta
  • compositions will dictate the type of carrier to be used.
  • the composition may be in a variety of forms, suitable, for example, for systemic administration (e.g., oral, rectal, nasal, sublingual, buccal, implants, or parenteral Injections) or topical administration (e.g., dermal, pulmonary, nasal, aural, ocular, liposome delivery systems, or iontophoresis).
  • systemic administration e.g., oral, rectal, nasal, sublingual, buccal, implants, or parenteral Injections
  • topical administration e.g., dermal, pulmonary, nasal, aural, ocular, liposome delivery systems, or iontophoresis.
  • the present disclosure provides methods for making a therapeutic T cell.
  • the methods comprise obtaining a sample of T cells; altering the DNA of the T cells to knockout or disrupt at least one gene selected from the group consisting of: INO80C, GATA3, ARID 1 A, WDR82, TRP53, GPR137C, ZFP219, HD AO, ELMSAN1, and ACTR8; and engineering the T cells to express an exogenous receptor.
  • the methods comprise obtaining a sample comprising T cells; altering the DNA of the T cells to knockout or disrupt at least one gene encoding a chromatin remodeling protein; and engineering the T cells to express an exogenous receptor.
  • the chromatin remodeling protein is a INQ80 micleosome positioning complex protein or SW1/SNF family member, or a combination thereof.
  • the INO80 micleosome positioning complex protein is Actr5, InoBG, InoBOc, Ino80b, ActrS, or a combination thereof.
  • the SWI/SNF family member is a member of cBAF complex.
  • the SWI/SNF family member is Arid la, Arid2, Aridlb, Smarcbl, Smarcd2, Smarca4, Smarccl, or a combination thereof.
  • the method further comprises altering the DNA of the T cells to knockout or disrupt at least one gene selected from the group consisting of: GAT A3, WDR82, TRP53, GPRI37C, ZFP219, HD AC I, and ELMS AN I.
  • Altering the DNA prevents or reduces exhaustion of the T cells as compared with cells not including the modification. Thus, altering the DNA increases T cell persistence and function, thereby, improving the T cell for therapeutic uses.
  • the T cells may be selected from CD3+ T cells (e.g., a combination of CD4+ and CD8+ T cells), CD8+ T cells, CD4+ T cells, natural killer (NK) T cells, alpha beta T cells, gamma delta T cells, or any combination thereof.
  • the T cells are memory T cells (e.g., central memory T cells or effector memory T cells).
  • the T cells are tumor infiltrating lymphocytes.
  • the T cells are cytokine-induced killer cells.
  • the T cells are CD8+ T cells.
  • the T cells are naturally occurring T cells.
  • the T cells may be isolated from a subject sample.
  • the T cell is an anti-tumor T cell (e.g., a T cell with activity against a tumor (e.g., an autologous tumor) that becomes activated and expands in response to antigen).
  • a tumor e.g., an autologous tumor
  • Anti-tumor T cells include, but are not limited to, T cells obtained from resected tumors or tumor biopsies (e.g., tumor infiltrating lymphocytes (TILs)) and a polyclonal or monoclonal tumor-reactive T cell (e.g., obtained by apheresis, expanded ex vivo against tumor antigens presented by autologous or artificial antigen-presenting cells).
  • TILs tumor infiltrating lymphocytes
  • a polyclonal or monoclonal tumor-reactive T cell e.g., obtained by apheresis, expanded ex vivo against tumor antigens presented by autologous or artificial antigen-presenting cells.
  • the T cells are expanded ex vivo.
  • Engineering the T cells to express an exogenous receptor may comprise transfecting, transforming, or otherwise introducing a nucleic acid into the cell which expresses an exogenous receptor.
  • Nucleic acids and methods for transfecting, transforming, or otherwise introducing such nucleic acids into a cell described elsewhere herein are suitable for the disclosed method,
  • the exogenous receptor is a T cell receptor (TCR) or a chimeric antigen receptor (CAR).
  • TCR T cell receptor
  • CAR chimeric antigen receptor
  • the exogenous receptor is not limited by its specificity to recognize and respond to any specific antigen or protein.
  • the T cells are genetically modified with exogenous receptors that recognize and respond to antigens for infectious disease and/or autoimmunity.
  • the T cells are genetically modified with exogenous receptors that recognize and respond to tumor antigens
  • the present disclosure also provides methods for treating a disease or disorder.
  • the methods comprise administering to the subject an effective amount of T cells modified to lack at least one gene which facilitates or supports T cell persistence and functionality.
  • the at least one gene is selected from the group consisting of: INQ80C, GAT A3, ARID 1 A, WDR82, TRP53, GPR137C, ZFP219, HD ACT, ELMS AN 1 , and
  • the at least one gene encodes a chromatin remodeling protein.
  • the chromatin remodeling protein is a INO80 nucleosome positioning complex protein or SWI/SNF family member, or a combination thereof.
  • the INO80 nucleosome positioning complex protein is ActrS, Ino80, InoSOc, Ino80h, Actr8, or a combination thereof.
  • the SWI/SNF family member is a member of cBAF complex.
  • the SWI/SNF family member is Arid la, Arid2, Aridlb, Smarebl, Smarcd2, Smarca4, Smarccl, or a combination thereof.
  • the invention is not limited by the type of disease or condition treated. Any disease or condition that is treatable via administration of T cells can be treated in art improved and more effective manner using T cells and compositions thereof as described herein.
  • the administration inhibits or reduces T cell exhaustion (e.g., compared to a subject receiving the same amount of T cells (e.g., CAR T cells or T cells comprising an exogenous TCR) not engineered to lack the at least one gene.
  • the at least one gene is selected from the group consisting of: INOSOC, GAT A3, ARID 1 A, WDR82, TRP53, GPR137C, ZFP219, HD ACT, ELMS AN 1 , and ACTRS.
  • the chromatin remodeling protein is a INQ80 micleosome positioning complex protein or SW1/SNF family member, or a combination thereof.
  • the INO80 micleosome positioning complex protein is Actr5, InoBG, InoBOc, Ino80b, ActrS, or a combination thereof.
  • the SWI/SNF family member is a member of cBAF complex.
  • the SWI/SNF family member is Arid la, Arid2, Aridlb, Smarcbl, Smarcd2, Smarca4, Smarccl, or a combination thereof.
  • the administration results in improved T cell survival in the presence of chronic antigen and/or improved T cell persistence and function compared to lion- engineered T cells.
  • the T cells may be isolated from a subject.
  • the T cells are allogeneic to the subject.
  • the T cells are autologous to the subject.
  • the T cells may be isolated from a sample from the subject, modified and expanded ex vivo, and returned to the subject.
  • the disease or condition is cancer.
  • the disease or condition is an infectious disease.
  • the invention is not limited by the type of cancer or by the type of infectious disease. Indeed, any cancer known in the art for which T cell therapy is used for treatment may be treated with the compositions and methods of the invention. Similarly, any infectious disease known in the art for which T cell therapy is used for treatment may be treated with the compositions and methods of the invention.
  • the invention provides methods for treating or delaying the progression of cancer, or for treating or delaying the progress of infectious disease, in an individual comprising administering to the individual an effective amount of engineered T cells or compositions thereof, as described herein.
  • the treatment results in a sustained response in the individual after cessation of the treatment.
  • the methods can be used with any cancer cell or in a subject having any type of cancer, for example those described by the National Cancer Institute.
  • the cancer may be a carcinoma, sarcoma, lymphoma, leukemia, melanoma, mesothelioma, multiple myeloma, or seminoma.
  • the cancer may be a cancer of the bladder, blood, bone, brain, breast, cervix, colon/rectum, endometrium, head and neck, kidney, liver, lung, muscle tissue, ovary, pancreas, prostate, skin, spleen, stomach, testicle, thyroid, or uterus.
  • the cancer comprises a solid tumor.
  • the cancer is metastatic cancer.
  • the methods described herein may find use in treating conditions where enhanced immunogen icity is desired such as increasing tumor immunogenicity for the treatment of cancer.
  • the recombinant receptor e.g., CAR and/or TCR
  • the recombinant receptor is specific for the cancer being treated.
  • the recombinant receptor e.g., CAR and/or TCR
  • the present invention demonstrates that treatment of a subject having cancer with a therapeutically effective amount of the disclosed compositions is superior to treatment of a subject having cancer with unmodified T cells.
  • treatment with therapeutically effective amounts of the disclosed T cells or compositions thereof inhibits the development or growth of cancer cells or and/or renders the cancer cells as a population more susceptible to other treatments (e.g., the cell death-inducing activity of cancer therapeutic drugs or radiation therapies).
  • T cells, compositions, and methods of the invention may be used as a monotherapy (e.g., to kill cancer cells, and/or reduce or inhibit cancer cell growth, induce apoptosis and/or cell cycle arrest in cancer cells), or when administered in combination with one or more additional agent(s), such as other anti-cancer agents (e.g., cell death-inducing or cell cycle-disrupting cancer therapeutic drugs or radiation therapies) to render a greater proportion of the cancer cells susceptible to killing, inhibited cancer cell growth, induced apoptosis and/or cell cycle arrest compared to the corresponding proportion of cells in an animal treated only with the cancer therapeutic drug or radiation therapy alone.
  • a monotherapy e.g., to kill cancer cells, and/or reduce or inhibit cancer cell growth, induce apoptosis and/or cell cycle arrest in cancer cells
  • additional agent(s) such as other anti-cancer agents (e.g., cell death-inducing or cell cycle-disrupting cancer therapeutic drugs or radiation therapies) to render a
  • the individual has cancer that Is resistant (e.g., has been demonstrated to be resistant) to one or more other forms of anti-cancer treatment (e.g., chemotherapy, immunotherapy, etc.).
  • resistance includes recurrence of cancer or refractory cancer. Recurrence may refer to the reappearance of cancer, in the original site or a new' site, after treatment.
  • resistance includes progression of the cancer during treatment with chemotherapy.
  • resistance includes cancer that does not respond to traditional or conventional treatment with a chemotherapeutic agent. The cancer may he resistant at the beginning of treatment or it may become resistant during treatment. In some embodiments, the cancer is at early stage or at late stage.
  • the modified T cells and compositions thereof are used to treat, ameliorate, or prevent a cancer that is characterized by resistance to one or more conventional cancer therapies (e.g., those cancer cells which are chemoresistant, radiation resistant, hormone resistant, and the like).
  • the treatment may inhibit the growth of resistant cancer cells outright and/or render such cells as a population more susceptible to cancer therapeutic drugs or radiation therapies (e.g., to the cell death-inducing activity thereof).
  • the therapeutically effective amount of the modified T cell composition reduces the number of cancer cells in the subject following such treatment. In certain embodiments, the therapeutically effective amount of the modified T cell composition reduces and/or eliminates the tumor burden in the subject following such treatment.
  • a wide range of second therapies may be used in conjunction with the methods of the present disclosure.
  • the second therapy may be administration of an additional therapeutic agent or may be a second therapy not connected to administration of another agent.
  • Such second therapies include, but are not limited to, surgery, immunotherapy, radiotherapy, or an additional chemotherapeutic or anti-cancer agent.
  • the second therapy may be administered at the same time as the initial therapy, either as a single composition or in a separate composition administered at substantially the same time as the initial therapy.
  • the second therapy may precede or follow the treatment of the first therapy by time intervals ranging from hours to months.
  • the method further comprises administering radiation therapy to the subject.
  • the radiation therapy is administered before, at the same time as, and/or after the subject receives the therapeutically effective amount of the modified T cell composition.
  • the method further comprises administering to the subject one or more anticancer agents and/or one or more chemotherapeutic agents.
  • the one or more anticancer agents and/or one or more chemotherapeutic agents are administered before, at the same time as, and/or after the subject receives the therapeutically effective amount of the engineered T cells or a composition thereof.
  • combination treatment of a subject with a therapeutically effective amount of engineered T cells and a course of an anticancer agent produces a greater tumor response and clinical benefit in such subject compared to those treated with the engineered T cells or anticancer drags/radiation alone.
  • the present invention contemplates the various combinations of them with the engineered T cells.
  • the second therapy comprises administration of antibodies.
  • the antibodies may target antigens either specifically expressed by tumor cells or antigens shared with normal cells.
  • the antibody may target, for example, CD20, CD33, CD52, CD30, HER (also referred to as erhB or EGFR), VEGF, CTLA-4 (also referred to as CD 152), epithelial cell adhesion molecule (EpCAM, also referred to as CD326), and PD- 1 /PO- LL
  • Suitable antibodies include, but are not limited to, rituximab, blinatumomab, trastuzumab, gemtuzumab, alemtuzumab, ibritumomab, tositumomab, bevacizumab, cetuximab, panitumumab, ofatumumab, ipilimumab, brentuximab, pertuzumab and the like).
  • the additional therapeutic agent may comprise anti-PD-l/PD-Ll antibodies, including, but not limited to, pembrolizumab, nivolumab, cemiplimab, atezolizumab, avelumab, durvalumab, and ipilimumab.
  • the antibodies may also be linked to a chemotherapeutic agent.
  • the antibody is an antibody-drug conjugate.
  • administration of second therapy may be admini stered to a subject by a variety of methods.
  • administration may be by various routes known to those skilled in the art, including without limitation oral, inhalation, intravenous, intramuscular, topical, subcutaneous, systemic, and/or intraperitoneal administration to a subject in need thereof.
  • the present disclosure also provides methods preventing exhaustion (e.g., maintaining functionality of T cells exposed to excessive antigen) of engineered T cells.
  • the methods comprise genetically modifying the T cell to lack at least one gene selected from the group consisting of: INO80C, GATA3, ARID 1 A, WDR82, TRP53,
  • the methods comprise genetically modifying the T cell to lack at least one gene encoding a chromatin remodeling protein.
  • the chromatin remodeling protein is a IN 080 nucleosome positioning complex protein or SWI/SNF family member, or a combination thereof.
  • the INO80 nucleosome positioning complex protein is Actr5, InoBO, InoBOc, InoSOb, ActrB, or a combination thereof.
  • the SWI/SNF family member is a member of cBAF complex.
  • the SWI/SNF family member is Arid la, Ark!2, Arid lb, Smarcbl, Smarcdl, Smarca4, Smarccl, or a combination thereof.
  • the methods further comprise administering the engineered T cells to a subject in need thereof.
  • Preventing T cell exhaustion refers to a condition of maintained or restored functionality of T cells characterized by one or more of the following compared to cells in an exhausted state: decreased expression and/or level of one or more of PD-1, TIM-3, and LAG-3; increased memory cell formation and/or maintenance of memory markers (e.g., CD62L); prevention of apoptosis; increased antigen-induced cytokine (e.g., IL-2) production and/or secretion; enhanced killing capacity; increased recognition of tumor targets with low surface antigen; enhanced proliferation in response to antigen; and knver expression of inhibitory receptors (e.g., programed cell death 1 (PDCDl, also called PD1) and cytotoxic T lymphocyte- associated Antigen 4 (CTLA-4)).
  • PDCDl programed cell death 1
  • CTL-4 cytotoxic T lymphocyte- associated Antigen 4
  • the engineered T cells may display increased functionality and/or activity (e.g., increased antigen induced cytokine production, enhanced killing capacity (e.g., increased recognition of tumor targets with low surface antigen), increased memory cell formation, and/or enhanced proliferation in response to antigen) and/or reduced features of exhaustion (e.g., lower levels of markers or inhibitory receptors indicative of exhaustion (e.g., PD-1, TIM-3, LAG-3) and/or lower levels of programmed cell death) compared to non-modified T cells.
  • the modified T cells may enhance the clinical efficacy of the therapeutics (e.g., CAR T cells).
  • the isolated T cells further comprise a nucleic acid encoding an exogenous receptor.
  • the exogenous receptor is a T cell receptor (TCR) or a chimeric antigen receptor (CAR). Descriptions of methods for modifying the T cell, the exogenous receptor and the nucleic acids and target antigens thereof, the subject, and the disease and disorders set forth above in connection with the disclosed T cells, and compositions and methods thereof are also applicable to the method of preventing exhaustion of engineered T cells.
  • An effective amount of the modified T cells or compositions disclosed herein may be determined based on the type of disease to be treated, the type of modified T cell, the severity and course of the disease, the clinical condition of the individual, the individual's clinical history and response to the treatment, and the discretion of the attending physician.
  • the efficacy of any of the methods described herein may be tested in various models known in the art, such as clinical or pre-clinical models. Effectiveness of the treatment may refer to any one or more of: extending survival (including overall survival and progression free survival); resulting in an objective response (including a complete response or a partial response); or improving signs or symptoms of the disease or disorder (e.g., cancer or an infection disease).
  • a sample is obtained prior to treatment with T cells (e.g., alone or in combination with another therapy described herein) as a baseline for measuring response to treatment.
  • the sample is a tissue sample (e.g., formalin-fixed and paraffin- embedded (FFPE), archival, fresh, or frozen).
  • FFPE formalin-fixed and paraffin- embedded
  • the sample is whole blood.
  • the whole blood comprises immune cells, circulating tumor cells and any combinations thereof.
  • mice may be placed into treatment groups receiving treatment or control treatment.
  • Tumor size e.g., tumor volume
  • overall survival rate is also monitored.
  • efficacy may refer to improvement of one or more factors according to the published set of RECIST guidelines for determining the status of a tumor in a cancer patient, e.g., responding, stabilizing, or progressing.
  • a responsive subject may refer to a subject whose cancer(s) show improvement, e.g., according to one or more factors based on RECIST criteria.
  • a non-responsive subject may refer to a subject whose cancer(s) do not show' improvement, e.g., according to one or more factors based on RECIST criteria.
  • Effectiveness may also refer to improvement of one of more immune-related response criteria (irRC).
  • new lesions are added into the defined tumor burden and followed, e.g., for radiological progression at a subsequent assessment.
  • the presence of non-target lesions is included in assessment of complete response and not included in assessment of radiological progression.
  • radiological progression may be determined only on the basis of measurable disease and/or may he confirmed by a consecutive assessment following a period of time (e.g., four weeks) from the date first documentation. 6.
  • the present disclosure also provides for screening for genes which facilitate T cell exhaustion.
  • the methods comprise: culturing T cells under conditions of chronic or acute stimulation for at least six days, wherein the T cell comprises at least one gene knockout or knockdown; isolating T cells not showing an exhausted T cell surface phenotype; and identifying the at least one gene knockout or knockdown.
  • the T cells are a T cell library, wdierein the T cell library comprises at least one I’ cell for each gene in the genome of the T cell,
  • the T cells may be selected from CD3+ T cells (e.g,, a combination of CD4+ and CD8+ T cells), CD 8+ T cells, CD4+ T cells, natural killer (NK) T cells, alpha beta T cells, gamma delta T cells, or any combination thereof.
  • the T cells are memory T cells (e.g., central memory T cells or effector memory T cells).
  • the T cells are tumor infiltrating lymphocytes.
  • the T cells are cytokine-induced killer cells.
  • the T cells are CD8+ T cells.
  • the T cells are naturally occurring T cells.
  • the T cells may be isolated from a subject sample.
  • the T cells or T cell library may be generated using methods known in the art for genetic screening, e.g., RNAi, complementary DNA (cDNA) libraries, or CRISPR/Cas9-based genome editing.
  • the method may be designed to measure single gene knockdowns or knockouts separately. Alternatively, the method may be designed to measure combinatorial gene knockdowns or knockouts.
  • the T cells are generated by performing single or combinatorial CRISPR-Cas-based gene knockdowns with a genome-wide library of guide RNAs.
  • the T cells are generated using a CRISPR-Cas system wherein each cell comprises at least one guide RNA. See for example, U.S. Patent Application 20190085324, incorporated herein by reference in its entirety.
  • CRISPR-Cas systems e.g., CRI8PR-Cas9 systems, as used herein, refer to non- naturally occurring systems derived from bacterial Clustered Regularly Interspaced Short Palindromic Repeats loci. These systems generally comprise an enzyme (Cas protein, such as Cas9 protein) and one or more guide RNAs.
  • the CRISPR-Cas system may be engineered, for example for optimal use in mammalian cells, for optimal delivery therein, for optimal activity in gene edi ting,
  • the guide RNA may he a crRNA, crRNA/tracrRNA (or single guide RNA, sgRNA).
  • the terms “gRN A,” “guide RNA” and “CR1SPR guide sequence” may be used interchangeably throughout and refer to a nucleic acid comprising a sequence that determines the binding specificity of the CRISPR-Cas system, A gRNA hybridizes to (complementary to, partially or completely) a target nucleic acid sequence (e.g., a gene in the genome of a cell).
  • a target nucleic acid sequence e.g., a gene in the genome of a cell.
  • gRNAs there are many publicly available software tools that can be used to facilitate the design of sgRNA(s); including but not limited to, Genscript Interactive CRISPR gRNA Design Tool, WU-CRISPR, and Broad Institute GPP sgRNA Designer, There are also publicly available pre-designed gRNA sequences to target many genes and locations within the genomes of many species (human, mouse, rat, zebrafish, C. elegans), including but not limited to, IDT DNA Predesigned Alt-R CRISPR-Cas9 guide RNAs, Addgene Validated gRNA Target Sequences, and GenSeript Genome-wide gRNA databases. [0157] For genome-wide approaches, it is possible to design and construct suitable gRNA libraries. Such gRNAs may be delivered to cells using vector delivery such as viral vector delivery. Combination of CRISPR-Cas-mediated perturbations may be obtained by delivering multiple gRNAs within a single cell.
  • T cells cultured under conditions of chronic or acute stimulation may become exhausted.
  • an exhausted T cell surface phenotype comprises increased concentrations of PD-i, TIM-3, and LAG-3.
  • conditions of chronic stimulation comprise culturing the T cells using anti-CD3 coated plates.
  • the chronic stimulation conditions further comprise culturing in the presence of IL-2.
  • conditions of acute stimulation comprise culturing the T cells in the presence of IL-2, [0159]
  • the culturing may last for any period of time necessary for onset of T cell exhaustion.
  • the culturing is at least 6 days.
  • the duration of the culturing is for 6-10 days (e.g., 6 days, 7 days, 8 days, 9 days, or 10 days), in some embodiments, the culturing lasts for more than 10 days.
  • the T cells may exist in culture prior to the culturing under conditions of chronic or acute stimulation.
  • the T cells may be cultured under normal culture conditions for growth, reproduction, or genetic engineering prior to placing the T cells under conditions of chronic or acute stimulation.
  • Isolating T cells not showing an exhausted T cell surface phenotype includes any method(s) which allow identification of exhausted T cells and/or separation of identified cells. For example, FACS analysis of markers of T cell exhaustion, as described elsewhere herein, enables identification and removal of non-exhausted T cells prior to identification of the at least one gene knockout or knockdown.
  • T cells which do not exhibit an exhausted phenotype are isolated and the genomic DNA is extracted for analysis.
  • the analysis may comprise sequencing of the genome to determine the knocked out gene.
  • the gRNA-encoding regions are subjected to PCJR amplification, sequenced, and mapped to the gRNA library. By comparing the gRNA profiles, the link between the knockout and T cell exhaustion can be determined.
  • the disclosure further provides systems or kits containing one or more reagents or other components useful, necessary, or sufficient for practicing any of the methods described herein.
  • the systems or kits may include exogenous receptor reagents ⁇ nucleic acids, vectors, compositions, etc.), transfection or administration reagents, negative and positive control samples (e.g., T cells or empty vector DNA), T celis, system for genetic engineering T cells (e.g., Cas proteins, gRNAs, vectors thereof, etc.), additional therapeutic agents, containers (e.g., microcentrifuge tubes), detection and analysis instruments, software, instructions, and the like. Descriptions of nucleic acids, vectors, compositions, T cells, additional therapeutic agents provided elsewhere herein are suitable for use with the disclosed systems or kits.
  • the systems or kits comprise engineered T cells as described herein or a system for genetic engineering T cells.
  • the system for genetic engineering T cells may comprise a clustered interspersed short palindromic repeat (CRISPR)/CRISPR- associated protein (Cas) system, as described herein.
  • the system for genetic engineering T cells comprises a Cas protein (e.g., Cas9, dCas9), or a nucleic acid encoding a Cas protein, and a gRNA directed to at least one gene which facilitates T cell exhaustion, or a nucleic acid encoding the gRNA.
  • the nucleic acid encoding the Cas protein (e.g., Cas 9) and the gRNA are the same or different nucleic acid.
  • the gRNA and the Cas protein may be expressed from the same vector.
  • the at least one gene which facilitates T cell exhaustion may be selected from the group consisting of; INO80C, GAT A3, ARID I A, WDR82, TRP53, GPR137C, ZFP2I9, HDAC1, ELMSAN1, and ACTR8,
  • the at least one gene which facilitates T cell exhaustion may encode a chromatin remodeling protein.
  • the chromatin remodeling protein is a INO80 nucleosome positioning complex protein or SWFSNF family member, or a combination thereof.
  • the INO80 nucleosome positioning complex protein is ActrS, Ino80, InoBOc, InoSOb, ActrS, or a combination thereof.
  • the SWFSNF family member is a member of cBAF complex.
  • the SWFSNF family member is Arid la, Arid2, Aridlh, Smarcbl, Smarcd2, Srnarca4, Smarccl, or a combination thereof.
  • the systems or kits further comprise an exogenous receptor or a nucleic acid encoding thereof.
  • the systems or kits further comprise at least one additional therapeutic agent.
  • the at least one therapeutic agent may be selected from the group consisting of: art agent for treating T cell exhaustion; an antiviral agent; art antibiotic agent; an antimicrobial agent; a chemotherapeutic agent; or a combination thereof.
  • the systems or kits further comprise instructions for using the components of the system or kit.
  • the instructions are relevant materials or methodologies pertaining to the systems or kits.
  • the materials may include any combination of the following; background information, list of components and their availability information (purchase information, etc.), brief or detailed protocols for using the systems or kits, trouble-shooting, references, technical support, and any other related documents.
  • Instructions can be supplied with the systems or kits or as a separate member component, either as a paper form or an electronic form which may be supplied on computer readable memory device or downloaded from an internet website, or as recorded presentation. 7. Examples
  • mice All mice were procured from JAX. Wild type mice were C57BL/6J mice (JAX: 000664), Cas9 knock-in mice were bred in house (JAX: 026179). OT-1 mice (JAX: 003831) were crossed with Cas9 mice. Ragl _/" mice were bred in house (JAX: 002216).
  • CDS T cells were enriched using the mouse CDS T cells isolation kit from Miltenyi and then resuspended in RPM1 with 10% FBS, 1 % Sodium pyruvate, 1% Non-essential amino-acids, 100U Pen/Strep, 50 nM of B-mercaptoethanol (eRPMI) and supplemented with 10 ng/ml of mouse IL-2.
  • Cells were seeded at a concentration of 1 million cells/ml on plates coated with 5 ug/ml of anti-CD3 and 2 ug/ml of anti-CD28. Cells were kept on these activation plates for 48 hours at the beginning of all experiments.
  • CD8 + T cell purity was verified via flow cytometry. Cells were passaged every two days and maintained at 1 million cells per ml,.
  • T cells were re-stimulated with phorbol myristate acetate (Sigma, 50 ng ml ”1 ) and ionomycin (Sigma, 500 ng ml ”1 ) or plate bound anti-CD3 at 3 pg/mh After 90 min, cells were treated with brefeldin A to block cytokine secretion. Then, 3 h later, cells were stained for surface markers and simultaneously labeled with Live/Dead Blue Viability Dye (Thermo Fisher) for 20 min at 4 °C. Cells were washed twice and fixed overnight using a FoxP3 Fixation/Permeabilization Kit (Thermo Fisher). The following day, cells were washed and stained for intracellular cytokines at room temperature for 1 h. They were then washed three times and analyzed using an LSR Fortessa machine (Beckman Dickinson).
  • T cells were activated, as described. They were subsequently plated in 24-well plates at 5 x 10 5 cells in 1 ml of RPMI-1640 medium containing 10% FBS, 2 mM 1- glutamine, 5 mM b-ME and 10 ng ml ”1 IL-2, and with (chronic) or without (acute) plate-bound anti-CD3 (3 pg ml " 1 ). Every 2 d for the duration of the experiment, cells were collected, and cell number was counted using a Beckmann Coulter Counter with a cell volume gate of 75- 4,000 femtoliters. Then, 50% of the cells were re-plated in 1 ml of fresh T cell medium. All experiments were performed at least two independent times.
  • Luciferase activity was normalized to cells cultured in the absence of T cells
  • BI ⁇ -ovalhumin in vivo tumor models C57BL/6 scid (Jackson 001913) mice were injected subcutaneously with 2 x 10 5 B 16-OVA cells in a 1:1 mix of PBS and Matrigel (Corning). At 5 d later, 2 x 10 6 OT-1 T cells that had been acutely or chronically stimulated as described previously were adoptively transferred to mice via retro-orbital injection. Mice were monitored daily and were killed for signs of morbidity.
  • ATAC-seq sample processing and analysis ATAC-seq was performed using the Omni- ATAC protocol (Corees et ah, 2017, Nat. Methods 14, 959-962). Briefly, 50,000 live cells were purified by flow cytometry immediately prior to ATAC-seq. Lysis, nuclei isolation, and transposition were performed according to the Omni- AT AC protocol. Libraries were prepared for sequencing and sequenced in 2x75 dual-indexed format on an Jllumina NovaSeq.
  • Terminal and Progenitor TEX ATAC-seq peaks were computed using DESeq2 with cutoffs of Log ? .
  • a union peak set was created encompassing all samples and re-analyzed.
  • the HOMER findMotifsGenome command line utility was used to identify motifs present in peaks in the indicated peak set relative to a background peak set.
  • Genome-wide sgRNA library Retroviral Mouse Genome-wide CRTS PR Knockout Library was a gift from Sarah Teichmann (Addgene #104861). The library was amplified via electroporation and confirmed by sequencing.
  • sgRNA mini-pool was designed using a previously developed protocol for cloning into a lentiviral backbone and then subcloned into retroviral construct pMSCV (Flynn et al., 2021, Cell 184, 2394-2411).
  • lentiCRlSPR-v2 was a gift from Feng Zhang (Addgene plasmid #52961).
  • pMSC V-U 6sgRN A(BbsI)-PGKpuro2ABFP was a gift from Sarah Teichmann (Addgene plasmid #102796).
  • sgRN A .. design .. 10090 .. GRCm38 jSpyoCas9 .. CRISPRko__NCBI . 20200317(dot)txt(dot)gz, available online ai poitals(dol)broadinstilute(dot)org/gpp/public/dir?dirpath sgraa .. design.
  • GPP Broad Genetic Perturbation Platform
  • One step digestion/ligation of amplified oligos into lentiCRISPR-v2 was performed at 37 °C for 1 hour in a 20 uL reaction with 1 uL T4 ligase, I uL Esp3I, 2 uL T4 ligase buffer, 200 ng digested backbone, and 50 ng amplified insert. Reaction was heat inactivated for 15 minutes at 65 °C and then 1 uL was electroporated using 25 uL Lucigen Endura electrocompetent cells and a BioRad MicroPulser with 0.1cm gap cuvettes. After 1 hour recovery in SOC, a lOOOx dilution was plated onto an agar plate to confirm library coverage.
  • the remainder was cultured overnight in a 150 rnL liquid culture and then purified by maxiprep. Finally, the pool was subcloned into pMSCV by Gibson Assembly of the sgRNA variable region amplified via PCR and pMSCV backbone pre-digested with Bbsl. Electroporation was repeated as described above. Guide representation was confirmed by sequencing.
  • the sgRNA SWI/SNF mini-pool and micro-pool for perturb-seq were designed with 4 guides per gene, as described above for the mini-pool using the Broad GPP mouse genome-wide designs.
  • the SWI/SNF mini-pool contained 50 single-targeting controls and Perturb-seq micro- pool contained 12 single-targeting controls.
  • Two primers were ordered per designed guide, for cloning via annealing.
  • the pMSCV vector was digested with Bbsl. All primer pairs were annealed separately. Annealed products were pooled equally, diluted, and then ligated into pMSCV. Amplification was performed using Stbl3 Chemically Competent cells (ThermoFisher C737303) and library coverage was confirmed via colony counting and then sequencing.
  • Retrovirus production and transduction The pMSCV plasmid was transfected into GP2-293 cells (Takara, RetroPackTM PT67 Cell Line) or 293T HEK cells at roughly 80% confhiency in 15 cm tissue culture plates coated with poly-d-lysine. Viral supernatant was collected at 48h and 72h post-transfection, filtered via a 0.45 mhi filtration unit (Millipore). Filtered virus was concentrated using the LentiX concentrator (Takara) at 1500 x g for 45 minutes. The concentrated supernatant was subsequently aliquoted, flash frozen, and stored in -80 °C until use,
  • CDS T cells were transduced with concentrated retrovirus 24 hours after isolation. 4 ug/ml of Polybrene was added to each well. Plates w'ere sealed and then spun at 1 lOOx g at 32 °C for 90 minutes. 24 hours after spinfection (e.g., starting on day 2) cells were checked for fluorescence via flow' cytometry and 2 ug/mL puromycin was added to the media.
  • sgRNA library preparation and sequencing For samples from in vitro chronic culture, live cells w'ere first isolated via FACS. gDNA was extracted using a commercially available Zymo kit. sgRNA libraries were prepared for sequencing as previously described (Flynn et al., 2021, Cell 184, 2394-2411). Briefly, a standard three-step amplification protocol was used. First, sgRNAs were amplified off of gDNA using primers specific to the pMSCV vector for 22 cycles of PCR. 100 ul. reactions with up to 4 ug of gDNA per reaction were used, and the number of reactions was sealed up until all gDNA was used. For sequencing of plasmid pools, this first PCR was skipped.
  • a 0-7bp offset was added to the front of the library using 8 pooled stagger primers to increase the diversity of the library.
  • PCR2 primer target sites were nested inside those of PCR 1 to improve the specificity of the product.
  • index sequences were added. Libraries were sequenced in dual-indexed 1x75 bp or 1x150 bp format on either an Illumina NextSeq or NovaSeq.
  • Inhibitory receptor -- GOBP__NEGATIVEJREGULATION__QFJLYMPH()CYTE_ ACTIVATION Gene lists were manually supplemented with the following genes; Chromatin -- ZFP219, TBX2I, KDM6A, ELMSAN1, DNTTIP1, SETD1B, TADA2B, ZFP217, EOMES. Integrins - ITGB3, APBB1IP, ITGAV. Inhibitory receptors -- PDCD1.
  • the indicated gene list was uploaded to the online gProfiler tool (available at bii t(dot)cs(dot)ut ⁇ dot)ee/gprofi ler/gost) .
  • Cytoscape interaction network The top one hundred positive hits and top twenty negative hits were imported into Cytoscape. Edges were created by using the stringApp Cytoscape plugin to import known protein-protein interactions curated from string-db (Szklarczyk et a!., 2019, Nucleic Acids Res. 47, D6Q7-D613). A cutoff of stringdb score > 0.75 was used to filter these protein-protein interactions, which represents a conservative cutoff for identifying only high confidence interactions. Nodes were grouped based on GO Term analysis, subcellular localization, and/or manual curation. A small number of poorly characterized and/or disconnected nodes were removed from the visualization.
  • Tumor inoculation and T cell adoptive transfer for in vivo CRISPR experiments MC ⁇ 38 of B16 cells ectopically expressing an rnCheny-ovalbumin fusion construct were prepared for injection by resuspending in a 1:1 mixture of matrigel and PBS. lx10 6 cells per tumor were injected subcutaneously into the flanks of Ragi "/_ mice (two tumors per mouse). Tumors were measured every three days.
  • Cas9-QT-1 CD8 + T cells were transduced with sgRNA pools or individual sgRNAs and selected with puromycin for 4 days, as described above. T cells were then intravenously injected into tumor-hearing mice.
  • Tumors were weighed and then minced into small pieces. The tumors were transferred to a gentle MACS C tube and digested in the protocol recommended enzyme mix with a gentleMACS octo dissociator using the listed soft/medium tumor program. Tumor suspensions were then filtered with a 70 uM filter and then subject to RBC lysis. Spleens were mashed and filtered through a 70 uM strainer, then treated with RBC lysis buffer.
  • tumor infiltrating lymphocytes or T cells were isolated from the tumors or spleens by FACS. Samples were washed twice with MACS buffer and stained for 30 mins on ice. CD8+ BFP+ cells v/ere isolated via flow cytometry.
  • the pMSCV retroviral vector was modified to replace the BFP-puromycin fusion with a VEX-puromycin fusion.
  • Individual guides were cloned by annealing pairs of primers, as described above.
  • the Arid! a- 1 sgRNA sequence used was GCAGCTGCGAAG AT ATCGGG (SEQ ID NO: 2) and the Arid! a-2 sequence used was CAGCAGAACTCGCACGACCA (SEQ ID NO: 3).
  • the CTRL, sgRNA sequence used was CTTACTCGACGAATGAGCCC (SEQ ID NO: 4). Tumor processing was performed as described above for the in vivo validation.
  • the PCR amplicons were purified with a commercially available Zymo DNA clean up kit and sanger sequenced. Quantification of edits was performed using the online tool tide(dot)nki (dot)nl.
  • Membranes were washed three times with PBST and then incubated with near-infrared fluorophore- conjugated species-specific secondary antibodies: Goat Anti-Mouse IgG Polyclonal Antibody (IRDye 680RD, 1:10,000, LI-CQR Biosciences, 926-68070) or Goat Anti-Rabbit IgG Polyclonal Antibody (IRDye 800CW, 1:10,000, LI-CQR Biosciences, 926-32211) for 1 hour at RT, Following secondary antibody application, membranes were washed three times with PBST, and then imaged using a LI-CQR Odyssey CLx imaging system (LI-CQR).
  • LI-CQR LI-CQR Odyssey CLx imaging system
  • T cell expansion and viability assays T cells were activated for 4 days at a 1:3 ratio of T cells to anti-CD3/28 Dynabeads (Invitrogen). T cell expansion assays were performed with EL-2 in the culture medium at 10 ng/rnL. Cell counts and viability measurements were obtained using the Cellaca Mx Automated Cell Counter (Nexcelom).
  • RNP Ribonucleoprotein
  • Synthego 2'-Q-methy! phosphorothioate modification
  • TE buffer 100 mM
  • 5 m ⁇ sgRNA was incubated with 2.5 m ⁇ Duplex Buffer (IDT) and 2.5 pg Alt-R S.p.
  • Cas9 Nuclease V3 (IDT) for 30 minutes at room temperature. 100 m ⁇ reactions were assembled with 10 million T cells, 90 m ⁇ P3 buffer (Lonza), and 10 m ⁇ RNP.
  • mice per donor were injected subcutaneously with 1 x 10 6 A375 cells, as previously described (Roth et al., 2020, Cell 181, 728-744.e21).
  • 1 x 10 6 TCR-positive T cells were transferred to mice 7 days later via retro-orbital injection. Tumors and spleens were collected 7 days after T cell transfer and processed to single cell suspension, as described previously (Roth et al., 2020, Cell 181, 728-744.e21).
  • T cells were sorted by CD45 staining and gDNA was extracted using commercial kits. library preparation, next generation sequencing and analysis was performed as previously described (Shifrut et ah, 2018, Cell 175, 1958-1971.el5).
  • the guide abundance in the spleen and tumor of each mouse was used to calculate log fold change of each guide, and MAGeCK scores were calculated with default parameters.
  • Step 1 GEM Generation and Barcoding, 5 pmol of primer KP_bead_sgRNA_RT was spiked into the reaction, enabling capture of sgRNAs in droplets and then reverse transcription of sgRNAs.
  • Step 3.2B Supernatant Cleanup for Cell Surface Protein Library was performed to isolate sgRNA library.
  • Step 3.2B 2 uL of the product of Step 3.2B was amplified and indexed using 3 rounds of PCR.
  • the 250bp library was purified via agarose gel and sequenced together with the gene expression (GEX) library in 26x91 format, according to 10X protocol guidelines.
  • GEX gene expression
  • Seurat cell cycle scoring was used to predict the cell cycle phase of each single cell. For volcano plot analysis, significantly differential genes were identified as FDR ⁇ 0.05. For comparisons of different gene sets across perturbations, an addition fold change cutoff was applied of average log2 FC > 0.1 or average log? FC ⁇ -0.1. For categorization of shared ‘up’ and ‘down’ gene sets within the cBAF and INO80 complexes (analysis shown in FIGS. 16D-16E), the union set of significantly differential genes within each complex was aggregated, and then ‘up ’ and ‘down’ genes for each subunit were defined simply as LFC > 0 or LFC ⁇ 0.
  • Seurat gene module scoring was used to convert the LCMV gene sets (consisting of the top 100 marker genes per LCMV cluster) into a gene module score for each cell in the perturb-seq dataset. Gene module scoring was also used to convert the upregulated and downregulated gene sets into module scores for each cell in the expanded LCMV data set, as shown in EIG. 24.
  • This model isolates the core determinant of T cell exhaustion . chronic stimulation through the
  • this assay is scalable; enabling the culture upwards of 108 cells, enabling l,000x coverage of genome-wide CRISPR sgRNA libraries.
  • a progressive upregulation of the inhibitory receptors, PD-1 and TIM3 was confirmed, and a growth defect in the chronically- stimulated T cells, compared to cells passaged without further stimulation after initial activation (acute stimulation; p ⁇ 0.0001, impaired t-test; FIGS.
  • Chronically stimulated T cells also exhibited defects in the secretion of IFNy and TNFa after restimulation with phorbol myri state acetate and ionomycin, compared to acutely stimulated cells (acute: 80% IRNg+TNRa+, chronic: 1% IFNy+TNFa+, FIGS. 6C and 18 A).
  • Co-culture of OT-1 T cells and B16 tumor cells expressing luciferase and pulsed with the cognate peptide antigen, SUNFEKL (SEQ IF) NO: 1) also demonstrated that chronically stimulated cells were impaired in tumor killing in vitro (FIG. 6D).
  • An assay for transposase-accessible chromatin with sequencing was performed every two days over the course of chronic stimulation and analyzed global chromatin accessibility profiles.
  • Principal component analysis (PCA) of ATAC-seq profiles showed that PCI separated naive cells (Day 0) from all other samples, while PC2 captured a progressive epigenetic polarization of the T cells during chronic stimulation (FIG. 1C).
  • the global epigenetic similarity of in vitro stimulated cells to reference T cell exhaustion data from tumors and chronic infection was evaluated.
  • a “terminal exhaustion peak set” was defined as ATAC-seq peaks that are specifically active in terminally exhausted T cells, compared to progenitor exhausted T cells. 3,537 terminal exhaustion ATAC-seq peaks were identified in the B16 melanoma tumor model and 2,346 peaks in the lymphocytic choriomeningitis vims (LCMV) chronic infection model (Log2 FC > 1; FDR ⁇ 0.05; FIGS. IE and 6F).
  • LCMV lymphocytic choriomeningitis vims
  • TF motifs previously associated with terminal exhaustion including Batf, Fos, Jun, and Nr4a factors were highly accessible in vitro at day 10.
  • progressive loss of accessibility at naive and progenitor exhaustion-associated Lefi and Tcf7 motifs and early dynamic accessibility of NF-KB and Nfat motifs was observed, mirroring the progression of TF activity observed in T cell exhaustion in vivo (FIG. IF).
  • the in vitro exhaustion assay was adapted to be compatible with CRISPR screening by using Rosa26-Cas9 knock-in mice, which constitutive]) ' ’ express Cas9-P2A-EGFP (FIG. 2A). Twenty-four hours after T cell isolation, Cas9+CD8+ T cells were transduced with a genome- wide retroviral sgRNA library containing 90,230 sgRNAs. A 48h delay was introduced between activation and the onset of chronic stimulation to allow ' time for efficient gene editing and puromycin selection of transduced cells.
  • This modified chronic stimulation protocol caused similar defects in cytokine production after re-stimulation with anti-CD3 or PMA/IO (FIGS. 19A-19B).
  • the cells were split into acute (IL-2 only) and chronic (anti -CD 3 and IL-2) stimulation conditions on Day 4 and both pools were sequenced on Day 10 (FIG. 2A).
  • Replicate screens were prepared and confirmed: (1) transduction of the T cells at low multiplicity of infection (MOI) to optimize single sgRNA targeting of cells (replicate 1: 16.9% sgRNA+ cells, MOI - 0.18; replicate 2: 29.3% sgRNA+ cells, MOI - 0.35; FIG.
  • MOI multiplicity of infection
  • the retroviral library pool did not contain a control sgRNA set, the normalization strategy (relative to all sgRNAs in the pool) was compared to a strategy that utilizes a set of sgRN As targeting olfactory receptors that are not expressed or predicted to function in T cells (Gilbert et ah, 2014, Cell 159, 647-661). Normalizing sgRNA enrichments to the olfactory receptor sgRNA set modestly boosted the statistical power of the screen results but otherwise had a minimal impact on the results (FIG. 20E).
  • top hits in the screen included other known components of the TCR signaling pathway such as Zap70, Lcp2, Lat, and Lck, as well as cell adhesion and integrin-related genes Fermt3, Tlnl, Itgav, and ltgb3 (FIGS. 2B-2D).
  • the co-stimulatory and inhibitory receptors Icos, Pdcdl, Ctla4, Cd28, Havcr2, Lag3, and Tigit were not significantly enriched by the screen (FIG. 2F, center).
  • the TFs M4, Junb, Homes, and Batf3 were depleted, while Tbx21, and Nr4a3 were modestly enriched, supporting previous demonstrations of their roles in exhaustion (FIG. 2F, center).
  • Tox and Tox2 were not significant hits in this screen, demonstrating that deletion of these factors may not improve T cell persistence in vivo , perhaps due to activation - induced cell death (FIG. 2F, center).
  • Cytoscape was used to visualize the protein-protein interaction network of top positive and negative hits (FIG. 3). This analysis confirmed the highly interconnected and enriched network of hits that directly associate with the TCR complex and downstream signaling components, as well as several other protein complexes and functional categories.
  • InoBO nucleosome remodeling complex hits included InoBO, Ino80b, Actr5, and ActrB
  • SetlC/COMPASS complex that regulates histone methylation hits included Wdr82, Dpy30, and Setdlh
  • SWI/SNF chromatin remodeling complex hits included Arid la, Smarcbl, Smarcd2, Smarca4, and Smarccl
  • MiDAC mitotic deacetylase
  • Smarccl, Smarcdl, and Smarcbl are part of the BAF core, which assembles together with Aridla
  • FIGS. 8A-8B This dataset encompasses the key subtypes of progenitor, transitory, and terminally exhausted T cells, and analysis of the top 100 positive hits demonstrated that all factors are detectably expressed in T cells in chronic viral infection (FIGS. 8C-8D). Moreover, all but two of these genes, Tmem253 and Itgb3, were expressed early during exhaustion (98 of the top 100 hits detectably expressed in progenitor exhausted T cells) and remained relatively stable across exhausted subtypes, suggesting that disruption of epigenetic factors and other hits altered the molecular course of T cell exhaustion, rather than reversing exhaustion only after terminal differentiation (FIG. 8C).
  • Example 3 hi vivo CRISPR screens identify epigenetic factors that limit T cell persistence in tumors
  • a custom pool of 2,000 sgRNAs was created, which included sgRNAs that targeted the top 300 hits (6 sgRNAs per gene), as well as 100 non-targeting and 100 single-targeting controls.
  • the sgRNA pool was introduced into Cas9/OT-i T cells, to remove functional variability due to differing TCR sequences.
  • bilateral MC-38 colon adenocarcinoma tumors that ectopically expressed ovalbumin were injected into Ragl-/- mice and CD8+ T cells were isolated from Cas9/QT-1 mice.
  • the T cells were transduced with the custom minipool (FIG. 4A).
  • mice Three different T cell dosing protocols were used to monitor protocol- specific knockout effects: group 1 received ix lO 6 T cells per mouse 6 days after tumor inoculation, group 2 received 5x10 s T cells per mouse 6 days after tumor inoculation, and group 3 received 5x10 5 T cells per mouse 9 days after tumor inoculation (FIG. 9 A).
  • a T cell dose-dependent reduction in tumor size was observed.
  • the tumors and spleens of mice were harvested on day 15 (groups 1 and 2) or day 18 (group 3) and the sgRNAs present in each tissue were sequenced (FIGS. 9A and 22A).
  • sgRNAs targeting the TCR complex and signaling genes were analyzed, since cells containing these guides should have an impaired ability to recognize antigen and thus be depleted in tumors. Indeed, sgRNAs targeting nearly all of the previously identified TCR and integrin signaling-related hits were depleted in tumors relative to the spleen (FIG. 4C). Similarly, genes in a number of other functional categories were also depleted in both tumors and spleens, likely indicating a general proliferation impairment of these knockouts in vivo (FIGS. 12A and 12D).
  • Gata.3 is a transcription factor which was previously demonstrated to regulate the development of T cell exhaustion, and importantly, deletion of this factor improves T cell function, persistence, and tumor control in vivo.
  • the remaining hits have not been studied in T cell exhaustion or immunotherapy contexts.
  • Visualizing the tumor enrichments of each gene in the context of the Cytoscape network revealed that many of the positive hits in vivo were epigenetic factors, including subunits of two chromatin remodeling complexes, the INO80 complex, (subunits InoSOc and ActrS), and the BAF complex (subunits Aridla , Smarcdl, and Smarccl ; FIG.
  • deletion of each epigenetic factor improved T cell accumulation in tumors by approximately ⁇ 3-5 fold, compared to control sgRNAs, which is comparable to the scale of T cell depletion that was observed for T cells lacking a component of the CD3 co-receptor, Cd3d, demonstrating the significant improvement in T cell function that is mediated by deletion of these genes (FIG. 4F).
  • Example 4 in vivo Perturh-seq of T cell exhaustion factors in TILs [0211] Perturb-seq, which captures CRISPR perturbation and transcriptome in single cells was used to understand the molecular mechanisms driving improved T cell function in each knockout identified by the in vivo CRISPR screens. Specifically, direct-capture Perturb-seq was used because it does not require a vector with a barcode sequence separate from the sgRNA, or other modifications to standard sgRNA vectors, and thus was immediately compatible with the retroviral reagents.
  • a third custom sgRNA pool (micropool) of sgRNAs was designed by prioritizing genes that: (1) preferentially persisted in the in vitro assay, (2) preferentially proliferated and infiltrated tumors in vivo , and (3) were chromatin-related proteins or TFs. Based on these criteria, nine genes were selected for Perturb- seq analysis: Wdr82, Setdlb, Arid la, ActrB, InoBO, Hdacl, Elmsanl, Nr4a3, and Zfp219.
  • the sgRNA pool contained two guides per gene, as well as two non-targeting and two single-targeting control guides, for a total of 22 sgRNAs. To ensure similar representation of all guides, pairs of primers containing the 20bp variable sgRNA sequences were individually annealed, which were then pooled and cloned together into retroviral vector pMSCY.
  • CD8+ T cells were isolated from Cas9/OT-l mice, transduced with the sgRNA micropool, and then transplanted into Ragl-/- mice bearing MC-38 ovalbumin tumors.
  • tumors were harvested, TILs were isolated, and direct-capture Perturb-seq was used to read out sgRNA identity and gene expression profiles simultaneously using the lOx Genomics 5’ gene expression platform (FIG. 5 A), After quality control filtering, high-quality scRNA-seq profiles were obtained from 2,305 cells, and scRNA-seq clustering and dimensionality reduction identified 4 clusters (FIG, 5B).
  • All cell clusters contained cells expressing moderate levels of Pdcdl and Havcr2, indicating that they represented exhausted T cells in the tumor microenvironment (FIG. I0A). Comparing marker genes between Cluster 1 and Cluster 2 revealed that Cluster I had higher expression of costimulatory molecules, including Tnfrsf9 (encoding 4- IBB) and Tnfrsf4 (encoding 0X40), the cytotoxic molecules, Gzmb and Prfl, and inhibitory receptors, including Lag3, Havcr2, and Cdl60 (FIG. 10B).
  • costimulatory molecules including Tnfrsf9 (encoding 4- IBB) and Tnfrsf4 (encoding 0X40)
  • the cytotoxic molecules including Gzmb and Prfl
  • inhibitory receptors including Lag3, Havcr2, and Cdl60 (FIG. 10B).
  • Cluster 2 had higher expression of the progenitor exhaustion genes, Tcf7, Ifngrl, and Ccl5, as well as several interferon response genes, including Ifitl, Ifit3, Ml, and Irf7 (FIGS. lOB-lOC).
  • Cluster 1 and Cluster 2 contained the vast majority of the cells, while Cluster 3 contained a small population of cells with a higher percentage of mitochondrial reads, and Cluster 4 contained a small number of proliferating cells, marked by Mki67 expression (FIG. 10.4).
  • a high-confidence sgRNA identity was determined for each cell by considering the sgRNA by cell counts matrix and computing row (cell) z-scores (FIGS. 5C and 10D). Any cell with a maximum sgRNA z-score > 3 was determined to contain the guide with maximum z- seore, while cells with no sgRNA counts were assigned as “no guide, ' ’ and cells with a lower maximum z-score were assigned “multi guide”. The average gene expression profile for cells with a given perturbation was computed, the gene expression profile of control cells was subtracted, and differential gene expression profiles were correlated across the different perturbations (FIG. 5D).
  • cytotoxic molecules, cytokines, and cytokine receptors including upregulation of Tnf, Ifng, and II7r, and downregulation of Gzmb, Gzmc, and Gzmf
  • exhaustion -relevant TFs including upregulation of Batf, M ' 4, and Klf2, and downregulation of Tbx21
  • amino acid transporters and other metabolic genes including upregulation of SlclaS (ASCT2, imports glutamine), Slc38al (SNAT1, neutral amino acids), and Slc38a2 (SNAT2, neutral amino acids).
  • TILs Mini-pool CRI8PR screens validate genetic regulators of T cell exhaustion in vitro [0214] To further validate and characterize the top ranked genome-wide screen factors, a custom mini-pool of 2,000 sgRNAs, which included sgRNAs that targeted 300 top ranked genes (6 sgRNAs per gene), as well as 100 non-targeting and 100 single-targeting controls was created. The in vitro stimulation screen was repeated and acute and chronic samples, as well as input samples were collected on day 4 (FIG. 21A). High concordance between biological replicates was observed and therefore the replicates were merged to perform three comparisons: (1) chronic vs acute, (2) acute vs input, and (3) chronic vs input (FIGS. 21B-21E).
  • the chronic vs acute comparison served as validation of the original genome-wide screen, and of the 88 genes in the pool that were significant positive hits in the genome wide screen, 52 (59.1%) were validated in the mini-pool (FDR ⁇ 0.05; FIGS. 11B and 21C).
  • the chronic vs acute gene enrichments were compared to acute vs input enrichments, which measured the fitness advantage or disadvantage of each gene knockdown in acutely stimulated proliferating T ceils in culture (FIGS. 11C, left and 21E).
  • Two hits, Trp53 and Brdl, were enriched in both comparisons, demonstrating that depletion of these factors imparts an overall proliferation advantage to T ceils in both acute and chronic stimulation conditions.
  • Aridla- targeting sgRNAs were confirmed at the DNA and protein level by Sanger sequencing and Western blot (FIGS. 22D- 22F), Cells were separately transduced with either vector, selected with puromycin to enrich for transduced cells, and mixed together. The mixed cells were then put into the in vitro chronic stimulation assay (FIG. ISA) or the in vivo MC-38 tumor model (FIG. 13B). In vitro and in vivo, Aridla- sgRNA cells demonstrated significantly enhanced persistence, compared to control cells, confirming the results of the pooled screens (FIGS. 13A-13B; Aridla- 1 to CTRL!
  • mice were inoculated with MC-38 tumors as previously described, and on day 6, transplanted 5x 10 s Cas9/OT-l CD8 ⁇ T cells transduced with either CTRLl retrovirus or A ridla-sgRNA retrovirus and monitored tumor growth (FIG. 13C).
  • Perturbation of AMD! A improves T cell persistence in primary human T celis [0217]
  • CRISPR-Cas9/sgRNA RNPs targeting ARID! A two independent sgRNAs
  • a control RNP were introduced into primary human T cells.
  • the cells were split into acute and chronic cultures, and the chronic condition was stimulated for 6 days with anti-CD3 coated plates (analogous to the mouse assay). In acutely stimulated cultures, no difference between the genotypes for proliferation or viability were observed.
  • a CRISPR mini-pool was designed for in vivo human T cell experiments, which encompassed 48 sgRNAs targeting 20 genes and included 8 negative control guides.
  • sgRNAs target i n g A RID 1 A , as well as the inhibitory receptors, PDCD1, LAG 3, and HAVCR2, and other top-ranked genes from prior screens, such as TMEM222, CBLB, TCEB2, and SOCSl were included.
  • the screen was performed in the A375 human melanoma xenograft model, which expresses the NY-ESO-1 antigen that can be targeted with the 1G4 TCR.
  • the cognate 1G4 TCR was introduced into primary human T cells from two independent donors on day 1 along with the sgRNAs, and on day 14 transplanted T cells into NOD-SCID-IL2Ry-null (NSG) tumor-bearing mice (FIG. 14B), 7 days later, T cells were sorted from the tumors and spleens, sequenced sgRNAs present in each organ, and compared their abundance to input samples prior to transplant.
  • NSG NOD-SCID-IL2Ry-null
  • SWI/SNF genes For SWI/SNF genes, Aridla, Smarccl, and Srnarcdl (top hits identified in vitro and in vivo), as well as Arid 2 and Aridlb, which were enriched in the SWI/SNF-specific mini- pool screen, were targeted. Of these, Smarccl and Smarcdl are in the BAF core, Aridla and Aridlb are in the cBAF complex, and Arid! is present only in the PBAF complex. From the INO80 complex, ActrS and InoSOc, which were enriched in both the in vitro and in vivo screens, were selected.
  • yeast homologues of ActrS and InoSOc, Arp5 and Ies6, have been shown to physically associate with each other, forming a subcomplex independent of the rest of the INO80 complex.
  • the subcomplex can modulate the activity of the rest of the INO80 complex; it interacts with chromatin in an !NQBQ-dependent manner and repositions nucleosomes (particularly the +1 nucleosome) to activate gene transcription, especially at metabolism-related genes.
  • positive controls, Pdcdl and Gata3. as well as 12 single targeting negative controls were included, for a total of 48 sgRNAs targeting 9 genes.
  • T cells were isolated from Cas9/OT-l mice, transduced with the sgRNA micro-pool, and then transplanted into RagT" mice bearing MC-38 ovalbumin tumors.
  • an input sample collected on the day of transplantation
  • tumors were harvested tumors, TILs were isolated, and direct-capture Perturb-seq was used to read out sgRNA identity and gene expression profiles simultaneously using the lOx Genomics 5’ gene expression platform (FIG, 15 A). Cells from seven biological replicate Perturb-seq samples across two independent experiments were sequenced (FIGS. 23-23B).
  • scRNA-seq profiles were obtained from 70,646 cells, and scRNA-seq clustering and dimensionality reduction identified 6 clusters (FIG, 15B).
  • a high-confidence sgRNA identity was identified for each cell by using z-scores to quantify the enrichment of each sgRNA, relative to other sgRNAs detected in the same cell.
  • Cells were assigned to a particular sgRNA if that sgRNA had a z-seore of at least 5, and a z- score at least 2 units higher than the next-most prevalent sgRNA.
  • Cluster 1 cells expressed high levels of Kit 2 and Slprl (T effector memory; TEM), Cluster 2 expressed high levels of interferon stimulated genes (ISGs) including Mxl (TJSG), Cluster 3 expressed high levels of Tnfrsfi) (encoding 41BB) and Cdl60 (T-41 BB), Cluster 4 expressed high levels of progenitor exhaustion genes including Pdcdl, Tcfl and Stamp (T E xProg), Cluster 5 expressed the highest levels of inhibitory receptors Pdcdl, Lag3, and Haver 2 (Ti-xTerm), and Cluster 6 consisted primary of cycling cells, marked by Mki67 and confirmed by cell cycle analysis (T-Cycling; FIGS. 23C-23D).
  • Projection of genes upregulated by cBAF depletion onto canonical T cell states identified in chronic LCMY infection showed an enrichment in effector T cell genes, while projection of downregulated genes showed an enrichment in terminal exhaustion-related genes (FIGS. 16G and 24B).
  • GO Term analysis of upregulated gene sets was performed. Genes upregulated in cBAF-deficient T cells enriched effector terms, including T cell activation, cell adhesion, cytokine production, and I’ cell proliferation, while genes upregulated in INQ80-deficient T cells enriched metabolic terms, including oxidative phosphorylation and aerobic respiration (FIG. 16H). in contrast, perturbation of Pdcdl induced cell signaling related terms (FIG. 16H).
  • Regulatory elements were defined as ‘opened’ peaks if increased accessibility at Day 10, compared to Day 6, was observed, and as ‘closed ’ peaks if decreased accessibility at Day 10, compared to Day 6, was observed (p ad: ⁇ 0.05, Log:’ FC > 1 ). Analysis of these peak sets demonstrated substantially different chromatin remodeling changes in Aridla- sgRNA T cells, compared to CTRL! T cells (FIGS. 17B-17C). First, Aridla- sgRNA cells exhibited a marked global decrease in the number of opened peaks, likely representing a relative inability of cBAF- depleted cells to establish accessible chromatin (Aridla- sgRNA: 1,419 peaks, CTRL1: 5,692 peaks; FIG.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Hematology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Virology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Mycology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2022/074251 2021-07-28 2022-07-28 Compositions and methods for improving t cell persistence and function Ceased WO2023010073A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP22850516.0A EP4376858A4 (en) 2021-07-28 2022-07-28 COMPOSITIONS AND METHODS FOR ENHANCING T-CELL PERSISTENCE AND FUNCTION
US18/580,472 US20240327826A1 (en) 2021-07-28 2022-07-28 Compositions and methods for improving t cell persistence and function
JP2024505066A JP2024527997A (ja) 2021-07-28 2022-07-28 T細胞持続性及び機能を改善するための組成物及び方法
CN202280052739.XA CN117813102A (zh) 2021-07-28 2022-07-28 用于改善t细胞持久性和功能的组合物和方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163226559P 2021-07-28 2021-07-28
US63/226,559 2021-07-28

Publications (1)

Publication Number Publication Date
WO2023010073A1 true WO2023010073A1 (en) 2023-02-02

Family

ID=85087331

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/074251 Ceased WO2023010073A1 (en) 2021-07-28 2022-07-28 Compositions and methods for improving t cell persistence and function

Country Status (5)

Country Link
US (1) US20240327826A1 (https=)
EP (1) EP4376858A4 (https=)
JP (1) JP2024527997A (https=)
CN (1) CN117813102A (https=)
WO (1) WO2023010073A1 (https=)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118345080A (zh) * 2024-06-17 2024-07-16 江苏柯菲平医药股份有限公司 一种抗耗竭t细胞及其制备方法、应用
WO2024173916A1 (en) * 2023-02-17 2024-08-22 Dana-Farber Cancer Institute, Inc. Compositions and methods of preventing t cell exhaustion
WO2025185585A1 (zh) * 2024-03-05 2025-09-12 上海沙砾生物科技有限公司 一种鉴定靶标的方法及其应用

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN119120385B (zh) * 2024-11-14 2025-03-14 四川大学华西医院 一种具有长效抑瘤效果的嵌合抗原受体t细胞及其制备方法和用途
CN121294362A (zh) * 2025-12-11 2026-01-09 良渚实验室 Tada2b基因在促进红系终末分化中的应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190183932A1 (en) * 2017-12-15 2019-06-20 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods for inhibiting t cell exhaustion
WO2020198340A1 (en) * 2019-03-26 2020-10-01 The Trustees Of The University Of Pennsylvania Dnmt3a knockout car t cells for adoptive immunotherapy
WO2020219682A2 (en) * 2019-04-24 2020-10-29 St. Jude Children's Research Hospital, Inc. Gene knock-outs to improve t cell function
US20210071139A1 (en) * 2017-10-27 2021-03-11 The Trustees Of The University Of Pennsylvania Identifying Epigenetic And Transcriptional Targets To Prevent And Reverse T Cell Exhaustion

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11447769B2 (en) * 2018-03-27 2022-09-20 The Trustees Of The University Of Pennsylvania Modified immune cells having enhanced function and methods for screening for same
CN110904045A (zh) * 2018-09-17 2020-03-24 中国科学院动物研究所 经修饰的t细胞、其制备方法及用途

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20210071139A1 (en) * 2017-10-27 2021-03-11 The Trustees Of The University Of Pennsylvania Identifying Epigenetic And Transcriptional Targets To Prevent And Reverse T Cell Exhaustion
US20190183932A1 (en) * 2017-12-15 2019-06-20 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods for inhibiting t cell exhaustion
WO2020198340A1 (en) * 2019-03-26 2020-10-01 The Trustees Of The University Of Pennsylvania Dnmt3a knockout car t cells for adoptive immunotherapy
WO2020219682A2 (en) * 2019-04-24 2020-10-29 St. Jude Children's Research Hospital, Inc. Gene knock-outs to improve t cell function

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BELK JULIA A.; YAO WINNIE; LY NGHI; FREITAS KATHERINE A.; CHEN YAN-TING; SHI QUANMING; VALENCIA ALFREDO M.; SHIFRUT ERIC; KALE NUP: "Genome-wide CRISPR screens of T cell exhaustion identify chromatin remodeling factors that limit T cell persistence", CANCER CELL, CELL PRESS, US, vol. 40, no. 7, 23 June 2022 (2022-06-23), US , pages 768, XP087115761, ISSN: 1535-6108, DOI: 10.1016/j.ccell.2022.06.001 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024173916A1 (en) * 2023-02-17 2024-08-22 Dana-Farber Cancer Institute, Inc. Compositions and methods of preventing t cell exhaustion
WO2025185585A1 (zh) * 2024-03-05 2025-09-12 上海沙砾生物科技有限公司 一种鉴定靶标的方法及其应用
CN118345080A (zh) * 2024-06-17 2024-07-16 江苏柯菲平医药股份有限公司 一种抗耗竭t细胞及其制备方法、应用

Also Published As

Publication number Publication date
JP2024527997A (ja) 2024-07-26
US20240327826A1 (en) 2024-10-03
EP4376858A1 (en) 2024-06-05
EP4376858A4 (en) 2025-10-01
CN117813102A (zh) 2024-04-02

Similar Documents

Publication Publication Date Title
US20240327826A1 (en) Compositions and methods for improving t cell persistence and function
US12171783B2 (en) Methods and compositions for targeting developmental and oncogenic programs in H3K27M gliomas
CN113661180B (zh) Tn-MUC1嵌合抗原受体(CAR)T细胞疗法
EP3610266A1 (en) Tumor signature for metastasis, compositions of matter methods of use thereof
WO2018112033A1 (en) Methods and compositions for targeting tumor-infiltrating tregs
WO2022256620A1 (en) Novel targets for enhancing anti-tumor immunity
JP2021522188A (ja) 内因性遺伝子活性化を用いる多重腫瘍ワクチン接種のための組成物および方法
US20250277786A1 (en) Gene activation targets for enhanced human t cell function
CA3188988A1 (en) Compositions and methods for engineering and selection of car t cells with desired phenotypes
US12497611B2 (en) Compositions and methods for high-throughput activation screening to boost T cell effector function
Jiang et al. Reciprocal inhibition between TP63 and STAT1 regulates anti-tumor immune response through interferon-γ signaling in squamous cancer
US20250201339A1 (en) Use of combined cd274 copy number changes and tmb to predict response to immunotherapies
US20240148791A1 (en) Compositions and methods for assessing and treating t cell dysfunction
Zhang et al. High-throughput screening for optimizing adoptive T cell therapies
EP4630014A1 (en) Method for optimizing t cells for immuno-therapy
WO2024158777A1 (en) Methods and compositions for inhibiting suppression of anti-tumor immunity by targeting ligand-receptor interactions present in the placenta
JP2024546848A (ja) 固形腫瘍の治療のためのキメラ抗原受容体(car)を含むcd5改変された細胞
CN117120062A (zh) 用于发现cd8 t细胞中治疗靶标的体内crispr筛选系统
WO2024059821A2 (en) Car t cell compositions for treatment of cancer
HK40104859A (zh) 用於改善t细胞持久性和功能的组合物和方法
Yan et al. Activation of T Cell–Intrinsic p53 by Acetylation Elicits Antitumor Immunity to Boost Cancer Immunotherapy
US20250230412A1 (en) Methods and compositions for treating cancer
Gandolfi Landscape of molecular events regulating multiple myeloma cell responses to natural killer cells
US20250333695A1 (en) Methods for optimizing t cell immunotherapeutic effector and memory function
Geng et al. Krüppel-like factor 2 programs early exhausted T cell states and restrains antiviral immunity

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22850516

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2024505066

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 202280052739.X

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 2022850516

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022850516

Country of ref document: EP

Effective date: 20240228