WO2022265409A1 - 진행성 난소암의 예후를 예측하기 위한 종양 표현형 및 바이오마커 - Google Patents

진행성 난소암의 예후를 예측하기 위한 종양 표현형 및 바이오마커 Download PDF

Info

Publication number
WO2022265409A1
WO2022265409A1 PCT/KR2022/008504 KR2022008504W WO2022265409A1 WO 2022265409 A1 WO2022265409 A1 WO 2022265409A1 KR 2022008504 W KR2022008504 W KR 2022008504W WO 2022265409 A1 WO2022265409 A1 WO 2022265409A1
Authority
WO
WIPO (PCT)
Prior art keywords
tumor
ovarian cancer
prognosis
advanced ovarian
predicting
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2022/008504
Other languages
English (en)
French (fr)
Inventor
김희승
박수진
이은지
김준환
임현지
백혜린
문재희
송권화
임화선
박선우
홍태연
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea University Research and Business Foundation
Kookmin University
Seoul National University Hospital
Original Assignee
Korea University Research and Business Foundation
Kookmin University
Seoul National University Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea University Research and Business Foundation, Kookmin University, Seoul National University Hospital filed Critical Korea University Research and Business Foundation
Publication of WO2022265409A1 publication Critical patent/WO2022265409A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57545—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the ovaries
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • the present invention relates to tumor phenotypes and biomarkers for predicting the prognosis of advanced ovarian cancer.
  • Advanced ovarian cancer means that cancer that started in the ovary has spread outside the ovary. Maximal cytoreduction is important for the treatment of advanced ovarian cancer, but removing the tumor located in the rectosigmoid colon together during debulking surgery for advanced ovarian cancer is a gynecological oncologist's task. burden on Some gynecological oncologists are able to remove tumors located in the rectosigmoid in practice, but in general 80-90% of cases rely on colorectal surgeons.
  • LAR Low Anterior Resection
  • Removal of the tumor on the surface of the rectosigmoid by stripping instead of removing the entire rectosigmoid with LAR may be an alternative to LAR because it preserves the rectosigmoid colon and is easier to perform by gynecological oncologists.
  • some patients with advanced ovarian cancer can expect similar prognosis to LAR even after stripping the tumor of the rectosigmoid colon.
  • Non-Patent Document 0001 Surgical technique of visceral segmental serosectomy for advanced ovarian cancer, HS Kim et al., Gland Surg 2021;10(3):1276-1278 (2021.03.10)
  • Non-Patent Document 0002 Clinical Phenotypes of Tumors Invading the Rectosigmoid Colon Affecting the Extent of Debulking Surgery and Survival in Advanced Ovarian Cancer, Park SJ, Mun J, Lee EJ, et al., Front Oncol. 2021;11:673631. (2021.04.22)
  • the present inventors have found that the prognosis of advanced ovarian cancer can be good even if conservative surgery is performed instead of LAR, depending on the clinical phenotype of rectal sigmoid colon tumor metastasized by advanced ovarian cancer.
  • identifying the clinical phenotype of a tumor that has metastasized to the rectosigmoid colon in an advanced ovarian cancer patient or by identifying the gene expression pattern that varies depending on each clinical phenotype, selection of a tumor removal method and prognosis of advanced ovarian cancer can be predicted.
  • Figure 1 shows the step-by-step procedure of visceral segmental serousectomy (VSS).
  • A is evaluating the length of the rectosigmoid colon where the tumor is located;
  • B is stripping the tumor by electrocauterization;
  • C tagging the left and right anterolateral edges and folding the surface of the separated intestine;
  • D shows the step of suturing the edge of the peeled area with 3-0 vicryl sutures.
  • Figure 2 distinguishes clinical phenotypes according to the degree of tumor segregation and spread of tumors metastasized to the rectosigmoid colon, A is FI type, B is FI type, and C is D type.
  • 3 and 4 show the progression-free survival and overall survival results of the FS, FI, and D groups log-rank using the Kaplan-Meier method and Breslow test it was compared.
  • 5 and 6 show the progression-free survival and overall survival results of the FS, FI, and D groups by Cox proportional hazards regression analysis.
  • FIG. 7 shows the mRNA expression patterns of genes RPL36, IGFBP6, ANKRD1, ATOH8, RPS28, and ADAMTS4 classified as cluster 1 based on RPKM values in ovarian masses of FS, FI, and D groups by qPCR.
  • the unit of the vertical axis is 2 - ⁇ CT .
  • 16 to 19 show the protein expression patterns of genes DPEP3, AMY1A, RELN, and REG1A classified as cluster 2 based on RPKM values in ovarian masses of FS, FI, and D groups by immunohistochemical staining and expression levels is scored and graphed.
  • One aspect is a method for providing information for selecting a method for removing a rectal sigmoid tumor in an advanced ovarian cancer patient having a tumor in the rectosigmoid colon, comprising: measuring a length of the rectal sigmoid colon with the tumor; Confirming whether the tumor has penetrated the mucosal layer and the submucosa; and selecting conservative surgery if the length of the rectal sigmoid colon where the tumor has occurred is 18 cm or less and the tumor does not penetrate the mucosal layer or submucosa, and otherwise selecting resection surgery.
  • a method for providing information for selection of a tumor removal method is provided.
  • the present inventors performed visceral segmental serosectomy (VSS) or LAR according to the phenotype of tumor metastasized to the rectosigmoid of patients with advanced ovarian cancer, and compared the surgical results and prognosis.
  • VSS visceral segmental serosectomy
  • the possibility of preserving the rectosigmoid by exfoliating the tumor may depend on the clinical phenotype based on tumor separability. Tumor segregation can be determined according to tumor invasiveness and extent.
  • the patient with advanced ovarian cancer may be a patient classified as stage 3 or stage 4 according to the cancer staging system of the International Federation of Obstetricians and Gynecologists (FIGO).
  • FIGO International Federation of Obstetricians and Gynecologists
  • the advanced ovarian cancer patient may be Asian or Korean.
  • the conservative surgery may be Visceral Segmental Serosectomy (VSS).
  • VSS Visceral Segmental Serosectomy
  • the resection surgery may be a low anterior resection (LAR).
  • LAR low anterior resection
  • the case where the tumor does not penetrate the mucosal layer and the submucosa may be the case where the tumor exists only in the serosal layer or the case where the tumor exists only in the serosal layer and the muscular layer. Conservative surgery can be selected if the tumor has not penetrated the mucosal layer or submucosal layer. Tumors that have metastasized from ovarian cancer to the rectosigmoid colon invade the serous, muscular, submucosal, and mucosal layers of the rectosigmoid in this order.
  • Whether or not the tumor has penetrated into the mucosal layer and the submucosa can be confirmed by whether or not the tumor is exfoliated without opening or damaging the mucosal layer and the submucosa when the tumor located in the serous membrane of the rectosigmoid colon is detached. This does not require special skills, and can be easily performed by a general medical practitioner even if you are not a colorectal surgeon.
  • Another aspect is a method for providing information for predicting the prognosis of an advanced ovarian cancer patient having a tumor in the rectosigmoid colon, comprising: measuring the length of the rectal sigmoid colon in which the tumor has occurred; Confirming whether the tumor has penetrated the mucosal layer and the submucosa; and local separation type if the length of the rectal sigmoid colon with tumor is less than 18 cm and the tumor does not penetrate the mucosal layer or submucosa.
  • a method for providing information for predicting the prognosis of patients with advanced ovarian cancer including a step of determining the phenotype of a tumor in which the tumor is classified as a diffuse type if the length of the rectal sigmoid colon in which the tumor has occurred is 18 cm or more.
  • the prognosis is meant to encompass prospects for symptoms or progress after the time of diagnosis or analysis of the disease.
  • the prognosis can usually mean metastasis or survival period within a certain period after cancer onset or surgery.
  • the prognosis may be one or more selected from the group consisting of recurrence rate, overall survival (OS), progression-free survival (PFS), and operative outcome.
  • the surgical outcome may be, for example, operation time, amount of blood loss, blood transfusion, length of hospital stay, surgical complexity score (SCS), surgical complication, and degree of leakage and bleeding at the tumor resection site.
  • the prognosis is positive (positive prognosis or positive prognosis).
  • the prognosis may be determined as negative (negative prognosis or negative prognosis).
  • Another aspect is for predicting the prognosis of advanced ovarian cancer, including an agent capable of detecting the expression level of one or more mRNAs or proteins selected from the group consisting of RPL36, ANKRD1, IGFBP6, and ATOH8 genes, respectively, from a patient's biological sample.
  • composition is provided.
  • FS locally separated
  • FI non-localized
  • D diffuse
  • the present inventors found that the RPL36, ANKRD1, IGFBP6, and ATOH8 genes were found in locally separated (FS) tumors. It was confirmed that the expression was relatively high, and the expression was relatively low in local non-separable (FI) and diffuse (D) tumors.
  • the agent for detecting the mRNA or protein expression level refers to a material that can be used to determine the expression level of the biomarker gene of the present invention or the protein encoded by these genes, for example, specifically for the biomarker. It may be a primer pair that binds, a probe or an antisense nucleotide, or an antibody specific to a protein encoded by the biomarker gene.
  • the composition for predicting the prognosis of advanced ovarian cancer further comprises an agent capable of detecting the expression level of at least one mRNA or protein selected from the group consisting of the REG1A, AMY1A, RELN, and DPEP3 genes. it may be
  • the composition for predicting the prognosis of advanced ovarian cancer may further include an agent capable of detecting the expression level of at least one mRNA or protein selected from the group consisting of the BRCA2 and SIDT1 genes.
  • BRCA2 and SIDT1 genes showed relatively high expression in local non-separable (FI) tumors and diffuse (D) tumors, and relatively low expression in locally dissociable (FS) tumors.
  • the composition for predicting the prognosis of advanced ovarian cancer may further include an agent capable of detecting the mRNA or protein expression levels of at least one gene selected from the group consisting of the RPS28 and ADAMTS4 genes. there is.
  • the RPS28 and ADAMTS4 genes have relatively high expression in locally separated (FS) tumors and relatively low expression in localized non-separable (FI) tumors and diffuse (D) tumors according to the RPKM value by DEG analysis
  • FI non-separable
  • D diffuse
  • expression was high not only in locally separated (FS) tumors but also in diffuse (D) tumors.
  • the biological sample may be cells, tumors or blood.
  • the tumor may be an ovarian cancer tumor, or a tumor that has metastasized from ovarian cancer to other organs such as the stomach, pancreas, small intestine, large intestine, or colon.
  • composition for predicting the prognosis of the advanced ovarian cancer Another aspect, the composition for predicting the prognosis of the advanced ovarian cancer; and a reference value of an advanced ovarian cancer patient for comparison with the measured expression level.
  • the reference value is the gene expression level, expression pattern, or expression pattern, and the clinical phenotype of rectal sigmoid colon tumor is investigated for advanced ovarian cancer patients with a known prognosis, and patients are classified into local separable type, locally non-separable type, and diffuse type, and these It can be obtained by examining the gene expression levels of tumors or blood.
  • kit includes a composition for measuring mRNA expression levels, in addition to each pair of primers specific for the gene, a test tube or other suitable container, reaction buffer, deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase , DNase, RNase inhibitors, DEPC-water, sterile water, and the like.
  • dNTPs deoxynucleotides
  • the kit when it includes a composition for measuring protein expression level, it may include a substrate, an appropriate buffer solution, a secondary antibody labeled with a chromogenic enzyme or a fluorescent substance, and a chromogenic substrate for immunological detection of the antibody.
  • a nitrocellulose membrane, a 96-well plate synthesized with polyvinyl resin, a 96-well plate synthesized with polystyrene resin, and glass slide glass may be used as the substrate, and the coloring enzyme may be peroxidase, alkaline phosphatase Alkaline phosphatase may be used, FITC, RITC, etc.
  • ABTS 2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid )
  • OPD o-phenylenediamine
  • TMB tetramethyl benzidine
  • Another aspect includes preparing a biological sample from a patient; Confirming mRNA or protein expression level or expression pattern data of RPL36, ANKRD1, IGFBP6, and ATOH8 genes from the sample; and comparing the expression level or expression pattern with reference data of an advanced ovarian cancer patient whose prognosis is known.
  • the step of confirming the expression level or expression pattern data of the mRNA is RT-PCR, competitive RT-PCR (Real-time RTPCR), RNase protection method (RNase protection method), Northern Methods such as blotting (northern blotting) or DNA chip (DNA chip technology) may be used, but are not particularly limited.
  • Confirmation of the mRNA expression level or expression pattern data may be based on the number of reads mapped by RNA sequencing. For example, the RNA expression level or expression pattern may be confirmed by RNA sequencing, differential expression gene expression value calculation (RPKM, FPKM, or TPM, etc.), and clustering, but is not limited thereto.
  • the step of confirming the expression level or expression pattern data of the protein is western blotting, ELISA (enzyme linked immunosorbentassay), radioimmunoassay (RIA: radioimmunoassay), radial immunodiffusion, and oxteroney immunoassay.
  • ELISA enzyme linked immunosorbentassay
  • RIA radioimmunoassay
  • radial immunodiffusion and oxteroney immunoassay.
  • Advanced ovarian cancer patients with known prognosis refer to patients diagnosed with advanced ovarian cancer and for whom the progression of the disease has been revealed. It may be a confirmed patient, or a patient confirmed to have a good prognosis by surviving or cured without recurrence after 36 months.
  • the prognosis of a patient whose prognosis is to be determined can be predicted by obtaining gene expression levels or expression patterns from samples collected from these patients and comparing them as reference values.
  • the gene expression level or expression pattern of a patient with a known prognosis is databased together with the patient's prognosis, and the prognosis can be predicted by entering the expression level or expression pattern of a patient whose prognosis is to be determined later into the database.
  • Known algorithms and statistical analysis programs for comparing expression levels or expression patterns can be used.
  • the method for providing information for predicting the prognosis of advanced ovarian cancer includes the expression level or expression pattern of one or more mRNAs or proteins selected from the group consisting of REG1A, AMY1A, RELN, and DPEP3 genes from the sample.
  • a step of verifying the data may be further included.
  • the method for providing information for predicting the prognosis of advanced ovarian cancer comprises the step of identifying expression level or expression pattern data of one or more mRNAs or proteins selected from the group consisting of BRCA2 and SIDT1 genes from the sample may further include.
  • the method for providing information for predicting the prognosis of advanced ovarian cancer includes the steps of identifying expression level or expression pattern data of one or more mRNAs or proteins selected from the group consisting of RPS28 and ADAMTS4 genes from the sample. may further include.
  • Example 1 Phenotypic discrimination and prognostic analysis of tumor metastasized to the rectosigmoid colon
  • VSS visceral segmental serosectomy
  • the corresponding phenotype was defined as a focal and separable type (FS type).
  • FS type focal and separable type
  • FI type focal and inseparable type
  • LAR diffuse
  • the surgical complexity score was calculated to evaluate the complexity and degree of surgery, and surgical complications were evaluated using the Memorial Sloan Kettering Cancer Center (MSKCC) surgical secondary event grading. Tumor response was assessed by RECIST (Response Evaluation Criteria In Solid Tumors) criteria (version 1.1).
  • PFS Progression-free survival
  • OS overall survival
  • Surgical extent and tumor invasion Tables 2 and 3 show the surgical extent and tumor invasion of the resected area.
  • the FS group showed more frequent tumor infiltration in the right and left constricted peritoneum than the FI group, and less tumor infiltration in the small and large intestine than the D group.
  • Table 4 compares surgical outcomes among the FS, FI, and D groups.
  • the FI and D groups tended to have a longer operation time, more blood loss and transfusion, and a longer hospitalization period than the FS group.
  • the D group had the highest surgical complexity score (SCS) and the FS group had the lowest. .
  • SCS surgical complexity score
  • the size of the residual tumor and the time interval from surgery to adjuvant chemotherapy were not different between the three groups.
  • grade 3-4 infections were more common in the FI group than in the FS and D groups, but gastrointestinal complications and thromboembolic complications were not different between the three groups.
  • the average values of OS were 56.6, 81.1, and 49.6 months in the FS, FI, and D groups, respectively.
  • the D group had a higher risk of disease progression than the FS and FI groups, and the FI and D groups had a higher risk of cancer-related death than the FS group.
  • Table 9 shows factors affecting PFS and OS. Primary tumourectomy, no grossly residual tumor, and type D affected PFS. (Adjusted HRs, 0.44, 0.52 and 2.06; 95% CIs, 0.23-0.85, 0.25-1.08 and 1.01-4.20). Stage 3(III) disease, no grossly residual tumor, FI and D types also affected OS. (Adjusted HRs, 0.25. 0.24, 4.59 and 3.34; 95% CIs, 0.08-0.81, 0.08-0.70, 1.31-16.08 and 1.06-10.54)
  • Recurrence Pattern Of the 48 recurrent patients (57.8%), 26 (59.1%), 6 (33.3%), and 16 (76.2%) were included in the FS, FI, and D groups. According to Table 10, there was no difference in recurrence pattern among the three groups, and no disease recurrence was observed at the tumor resection site of the rectosigmoid colon.
  • Example 2 Screening of biomarkers associated with clinical phenotypes
  • RNA-sequencing was performed using samples of their ovarian cancer masses, and DEG (differentially expressed genes) analysis was performed for mRNA.
  • Comparative groups in the DEG analysis were 1) FS/FI and D; 2) FS and FI/D; 3) FI / FS and D were set.
  • the FS may be referred to as a VSS group as a group that performed VSS
  • FI as a group that performed LAR
  • D may be referred to as a group that performed LAR and may be referred to as LAR2.
  • genes having a significance of p ⁇ 0.001 in each item were primarily selected.
  • the differentially expressed genes of the selected genes were analyzed by time series (simultaneous comparison of differences between three or more comparison groups) by RPKM and classified into three clusters according to the expression pattern. Specifically, genes with high expression in ovarian cancer tissues of patients in the FS group and low expression levels in the FI and D groups were grouped into cluster 1, and genes with high expression levels in the ovarian cancer tissues of patients in the D group and low levels of expression in FS and FI were grouped into cluster 2, Genes with high expression in ovarian cancer tissues of patients in FI and D groups and low expression in FI were classified as cluster 3.
  • Table 12 shows selected biomarker candidates.
  • the expression of the target gene was calculated as a CT value and normalized based on GAPDH expression. PCR conditions were carried out at 95 ° C for 3 minutes, and then amplified 40 times at 95 ° C for 30 seconds, 60 ° C for 30 seconds, and 72 ° C for 30 seconds. Primers used in the experiments are disclosed in Table 13 below.
  • the mRNA expression levels of DPEP3, AMY1A, RELN, and REG1A belonging to cluster 2 were significantly higher in the D group than in the FS and FI groups, which was consistent with the expression pattern by the DEG analysis.
  • RELN, RPL36, RPS28, and 12 genes of SIDT1 were immunohistochemical staining tests.
  • paraffin blocks were prepared using the tumor tissues of each patient, excised to a thickness of 5 ⁇ m, deparaffinized, and rehydrated using xylene and alcohol. Endogenous peroxidase activity was blocked by incubation in methanol and 1% hydrogen peroxide at room temperature for 15 minutes, and non-specific binding sites were blocked by incubation in PBS (phosphate buffered saline) and horse serum at room temperature. Thereafter, the cells were incubated with anti-human monoclonal antibody diluted 1:50 for 16 hours at 4°C in a humidified chamber, washed with PBS for 5 minutes, and then incubated with biotinylated secondary antibody for 1 hour at 37°C.
  • PBS phosphate buffered saline
  • Index 1 percent tumor staining x intensity
  • the tumor staining group is 1 point for 0-24%, 2 points for 25-49%, 3 points for 50-74%, 4 points for 75-100%, and 1 point for weak (staining) intensity. , 2 points for moderate and 3 points for strong.
  • RPL36, IGFBP6, ATOH8, and RPS28 which were previously classified as cluster 1, were more strongly expressed in the FS group than in the FI and D groups, which was consistent with the expression pattern by the DEG analysis.
  • ANKRD1 and ADAMTS4 had higher expression levels in the D group than in the FS group, and accordingly, in these cases, immunohistochemical staining does not seem to be available for discrimination of the FS group.
  • the expression level of BRCA2 belonging to cluster 3 was higher in the FI and D groups than in the FS group, which was consistent with the results of the DEG analysis.
  • SIDT1 was found strongly in the FS and D groups, not in the FI, unlike the DEG analysis results. Accordingly, in this case, immunohistochemical staining does not seem to be available for discrimination of the FI group.
  • the experimental results will help determine the phenotype or surgical method of metastasized tumors or determine the prognosis of advanced ovarian cancer by confirming the expression patterns of the above genes and comparing them with reference values for the gene expression patterns of patients with advanced ovarian cancer.
  • a biological sample is obtained from an advanced ovarian cancer patient whose phenotype has not been confirmed, and expression patterns of genes belonging to clusters 1 to 3 of Table 12 are measured from the sample.
  • ADAMTS4 and ANKRD1 genes in cluster 1 REG1A in cluster 2, and SIDT1 in cluster 3 are excluded and expression intensities are compared.
  • FS, FI, or D type is determined through the gene expression pattern of advanced ovarian cancer, based on this, a method for removing the tumor metastasized to the rectosigmoid colon is selected, or the prognosis of advanced ovarian cancer, such as recurrence and death It can help predict risk.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 진행성 난소암 환자에서 직장구불결장에 전이된 종양의 임상 표현형을 확인하거나, 또는 각 임상 표현형에 따라 달라지는 유전자 발현양상을 확인함으로써 종양 제거 방법의 선택 및 진행성 난소암의 예후를 예측할 수 있는 조성물 및 방법을 제공한다.

Description

진행성 난소암의 예후를 예측하기 위한 종양 표현형 및 바이오마커
본 발명은 진행성 난소암의 예후를 예측하기 위한 종양 표현형 및 바이오마커에 관한 것이다.
진행성 난소암(advanced ovarian cancer)은 난소에서 발생한 암이 난소 외부로 전이된 것을 의미한다. 진행성 난소암의 치료를 위해서는 최대 종양감축(Maximal cytoreduction)이 중요하지만, 진행성 난소암의 종양감축술(debulking surgery)을 하는 동안 직장구불결장(rectosigmoid colon)에 위치한 종양을 함께 제거하는 것은 부인과 종양전문의에게 부담이 된다. 부인과 종양전문의 중 일부는 임상에서 직장구불결장에 위치한 종양을 제거할 수 있으나, 일반적으로 80-90%의 사례에서는 대장 외과 의사에게 의존한다.
그러나 직장구불결장 부위의 종양은 난소암에서 종양감축술을 받는 환자의 약 24 내지 64%에서 빈번하게 나타난다. 따라서 종양의 완전한 제거를 통한 생존율 향상을 위해서는 난소암 종양감축술과 직장구불결장의 종양 절제를 통합하는 것이 중요하다.
저위전방절제술(Low Anterior Resection, LAR)은 직장구불결장과 관련된 종양을 제거하기 위한 일반적인 방법으로, 미세 잔류 종양(microscopic residual tumor)을 남길 위험이 없는 장점이 있다. 그러나 LAR을 받은 환자의 2.3 내지 6.8%는 문합 부위 누출(anastomosis site leakage)이 발생하고, 17 내지 18%는 장루형성(bowel diversion) 이 필요하다. 또한 LAR을 시행한 환자의 40%가 저전방 절제 증후군(low anterior resection syndrome)으로 발전하여 삶의 질(Quality of life)이 저하되는 것으로 보고되었다.
LAR로 직장구불결장 전부를 제거하는 대신 직장구불결장 표면의 종양을 박리(stripping)하여 제거하는 것은 직장구불결장을 보존할 수 있고 부인과 종양전문의도 수행하기 용이하기 때문에 LAR의 대안이 될 수 있다. 그러나 종래 연구에서는 직장구불결장을 절제하지 않고 표면의 종양만을 제거하면 미세종양이 잔존하여 생존율 감소의 위험이 있다고 여겨졌다. 그러나, 최근 연구에 따르면 진행성 난소암 환자 중 일부는 직장구불결장의 종양을 박리(stripping)하여도 LAR와 비슷한 예후를 기대할 수 있다.
[선행기술문헌]
(비특허문헌 0001) Surgical technique of visceral segmental serosectomy for advanced ovarian cancer, HS Kim et al., Gland Surg 2021;10(3):1276-1278 (2021.03.10)
(비특허문헌 0002) Clinical Phenotypes of Tumors Invading the Rectosigmoid Colon Affecting the Extent of Debulking Surgery and Survival in Advanced Ovarian Cancer, Park SJ, Mun J, Lee EJ, et al., Front Oncol. 2021;11:673631. (2021.04.22)
직장구불결장으로 전이가 진행된 진행성 난소암 환자의 효율적인 수술방법 선택 및 삶의 질 향상을 위하여, 임상 표현형 및 분자적 방법에 기초하여 LAR 대신 종양 박리를 수행할 수 있는 환자를 구별할 수 있는 기술이 요구된다.
본 발명자는 진행성 난소암에 의해 전이된 직장구불결장 종양의 임상 표현형에 따라 LAR 대신 보존적 수술을 실시하여도 진행성 난소암의 예후가 양호할 수 있음을 발견하였다. 그리고 직장구불결장 종양의 임상 표현형 별로 특징적인 바이오마커가 존재하며, 이를 통해 진행성 난소암의 예후 예측 및 종양 제거방법 선택에 이용할 수 있음을 확인하였다.
일 실시예에 따르면 진행성 난소암 환자에서 직장구불결장에 전이된 종양의 임상 표현형을 확인하거나, 또는 각 임상 표현형에 따라 달라지는 유전자 발현양상을 확인함으로써 종양 제거 방법의 선택 및 진행성 난소암의 예후를 예측할 수 있다.
도 1은 장측구획장막절제술(VSS)의 단계별 절차를 나타낸 것이다. A는 종양이 위치한 직장구불결장의 길이를 평가하는 단계; B는 전기소작(electrocauterization)으로 종양을 박리(stripping)하는 단계; C는 좌우의 앞가쪽 가장자리(anterolateral edge)를 태그하고(tagged), 박리된 장의 표면을 접는 단계; D는 박리된 영역의 가장자리를 3-0 바이크릴 봉합사(3-0 vicryl sutures)로 봉합하는 단계를 나타낸 것이다.
도 2는 직장구불결장에 전이된 종양의 종양 분리성 및 확산 정도에 따른 임상 표현형을 구별한 것으로, A는 FI형, B는 FI형, C는 D형을 나타낸 것이다.
도 3 및 도 4는 FS, FI, 및 D 그룹의 무진행 생존(progression-free survival) 및 전체 생존(overall survival) 결과를 Kaplan-Meier 방법을 사용한 로그 순위(log-rank) 및 Breslow 테스트를 사용하여 비교한 것이다.
도 5 및 도 6은 FS, FI, 및 D 그룹의 무진행 생존(progression-free survival) 및 전체 생존(overall survival) 결과를 Cox 비례 위험 회귀 분석(Cox proportional hazards regression analysis)으로 나타낸 것이다.
도 7은 FS, FI, 및 D 그룹의 난소 종괴에서 RPKM 값을 기준으로 클러스터 1로 분류한 유전자 RPL36, IGFBP6, ANKRD1, ATOH8, RPS28 및 ADAMTS4의 mRNA 발현양상을 qPCR로 확인한 결과이다.
도 8은 FS, FI, 및 D 그룹의 난소 종괴에서 RPKM 값을 기준으로 클러스터 2로 분류한 유전자 DPEP3, AMY1A, RELN, 및 REG1A의 mRNA 발현양상을 qPCR로 확인한 결과이다.
도 9는 FS, FI, 및 D 그룹의 난소 종괴에서 RPKM 값을 기준으로 클러스터 3으로 분류한 유전자 BRCA2 및 SIDT1의 mRNA 발현양상을 qPCR로 확인한 결과이다.
상기 도 7 내지 9의 그래프에서 세로축 단위는 2-ΔΔCT이다.
도 10 내지 도 13 는 FS, FI, 및 D 그룹의 난소 종괴에서 RPKM 값을 기준으로 클러스터 1로 분류한 유전자 RPL36, IGFBP6, ANKRD1, 및 ATOH8 의 단백질 발현양상을 면역조직화학염색법(immunohistochemistry)으로 관찰하고 발현 정도를 점수화하여 그래프로 나타낸 것이다.
도 14 내지 도 15 는 FS, FI, 및 D 그룹의 난소 종괴에서 RPKM 값을 기준으로 클러스터 1로 분류한 유전자 RPS28 및 ADAMTS4의 단백질 발현양상을 면역조직화학염색법으로 관찰하고 발현 정도를 점수화하여 그래프로 나타낸 것이다.
도 16 내지 도 19 는 FS, FI, 및 D 그룹의 난소 종괴에서 RPKM 값을 기준으로 클러스터 2로 분류한 유전자 DPEP3, AMY1A, RELN, 및 REG1A의 단백질 발현양상을 면역조직화학염색법으로 관찰하고 발현 정도를 점수화하여 그래프로 나타낸 것이다.
도 20 내지 도 21 는 FS, FI, 및 D 그룹의 난소 종괴에서 RPKM 값을 기준으로 클러스터 3으로 분류한 유전자 BRCA2 및 SIDT1의 단백질 발현양상을 면역조직화학염색법으로 관찰하고 발현 정도를 점수화하여 그래프로 나타낸 것이다.
일 양상은 직장구불결장에 종양이 있는 진행성 난소암 환자의 직장구불결장 종양 제거 방법 선택을 위한 정보를 제공하는 방법에 있어서, 종양이 있는 직장구불결장의 길이를 측정하는 단계; 점막층 및 점막하층에 종양 침투 여부를 확인하는 단계; 및 종양이 발생한 직장구불결장의 길이가 18cm 이하이고, 점막층 및 점막하층에 종양이 침투하지 않으면 보존수술을 선택하고, 그 외에는 절제수술을 선택하는 단계를 포함하는, 진행성 난소암 환자의 직장구불결장 종양 제거 방법 선택을 위한 정보를 제공하는 방법을 제공한다.
본 발명자는 진행성 난소암 환자의 직장구불결장에 전이된 종양의 표현형에 따라 장측구획장막절제술(VSS, visceral segmental serosectomy) 또는 LAR를 실시하고 수술결과 및 예후 등을 비교하였다. 그 결과 종양이 발생한 직장구불결장의 길이가 18cm 이하이고, 종양 박리시 점막층 및 점막하층에 종양이 침투하지 않은 경우에는 LAR을 실시하지 않고 종양을 박리하고 VSS를 실시하여도 예후가 양호함을 확인하였다. 일 실시예에 따르면, 종양을 박리(exfoliating)함으로써 직장구불결장을 보존할 수 있는 가능성은 종양 분리성(tumor separability)을 기초로 한 임상 표현형에 의존할 수 있다. 종양 분리성은 종양 침습성 및 범위에 따라 결정될 수 있다.
상기 진행성 난소암 환자는 세계산부인과연맹(FIGO)의 암병기결정 시스템에 따라 3기 내지 4기로 분류된 환자일 수 있다.
상기 진행성 난소암 환자는 아시아계, 또는 한국인일 수 있다.
상기 보존수술은 장측구획장막절제술(Visceral Segmental Serosectomy, VSS)일 수 있다.
상기 절제수술은 저위전방절제술(Low Anterior Resection, LAR)일 수 있다.
점막층 및 점막하층에 종양이 침투하지 않은 경우는 종양이 장막(serosal layer)에만 존재하는 경우, 또는 종양이 장막 및 근육층(muscular layer)에만 존재하는 경우일 수 있다. 종양이 점막층(mucosal layer) 및 점막하층(submucosal layer)에 침투하지 않은 경우 보존수술을 선택할 수 있다. 난소암으로부터 직장구불결장으로 전이된 종양은 직장구불결장의 장막, 근육층, 점막하층, 및 점막층의 순서로 침입한다. 종양이 점막층 및 점막하층까지 침투하지 않았는지 여부는 직장구불결장의 장막에 위치한 종양을 박리할 때, 점막층 및 점막하층이 열리지 않거나 또는 이들이 손상되지 않고 종양이 박리되는지 여부로 확인할 수 있다. 이는 특별한 숙련이 필요 없으며, 대장 외과전문의가 아니어도 일반적인 의료업 종사자라면 쉽게 실시할 수 있다.
상기 종양이 발생한 직장구불결장의 길이의 기준을 18cm 로 한 것은 임상적 경험상 18cm가 VSS를 시행할 수 있는 최대치이기 때문이다.
다른 양상은 직장구불결장에 종양이 있는 진행성 난소암 환자의 예후를 예측하기 위한 정보를 제공하는 방법에 있어서, 종양이 발생한 직장구불결장의 길이를 측정하는 단계; 점막층 및 점막하층에 종양 침투 여부를 확인하는 단계; 및 종양이 발생한 직장구불결장의 길이가 18cm 이하이고 점막층 및 점막하층에 종양이 침투하지 않으면 국소 분리형, 종양이 발생한 직장구불결장의 길이가 18cm 이하이고 점막층 및 점막하층에 종양이 침투하면 국소 분리불가형, 종양이 발생한 직장구불결장의 길이가 18cm 이상이면 확산형으로 분류하는 종양의 표현형 결정 단계를 포함하는, 진행성 난소암 환자의 예후를 예측하기 위한 정보를 제공하는 방법을 제공한다.
상기 예후(prognosis)는 질병을 진단 또는 분석한 시점 이후의 증세 또는 경과에 대한 전망을 포괄하는 의미이다. 진행성 난소암 환자에 있어서 예후는 통상적으로 암 발병 또는 수술 이후 일정기간 내의 전이 여부 또는 생존기간을 의미할 수 있다. 상기 예후는 재발률, 전체 생존기간(OS), 무진행 생존기간(PFS), 및 수술결과(operative outcome)로 구성된 군으로부터 선택되는 하나 이상일 수 있다. 수술 결과는 예를 들면 수술 시간, 출혈량, 수혈, 입원기간, 수술 복잡성 점수(SCS), 수술적 합병증, 종양 절제 부위의 누출 및 출혈 정도일 수 있다.
일 구체예에 따르면, 상기 종양의 표현형이 국소 분리형으로 분류되면 예후가 긍정적인 것(긍정적 예후 또는 양성적 예후)으로 결정할 수 있다.
일 구체예에 따르면, 상기 종양의 표현형이 국소 분리불가형 또는 확산형으로 분류되면 예후가 부정적인 것(부정적 예후 또는 음성적 예후)으로 결정할 수 있다.
또 다른 양상은, 환자의 생물학적 시료로부터 RPL36, ANKRD1, IGFBP6, 및 ATOH8 유전자로 이루어진 군에서 선택된 하나 이상의 mRNA 또는 단백질의 발현수준을 각각 검출할 수 있는 제제를 포함하는, 진행성 난소암의 예후 예측용 조성물을 제공한다.
본 발명자는 국소 분리형(FS), 국소 분리불가형(FI) 및 확산형(D)종양의 유전자 발현양상을 비교한 결과, 상기 RPL36, ANKRD1, IGFBP6, 및 ATOH8 유전자들은 국소 분리형(FS) 종양에서 상대적으로 발현이 높고, 국소 분리불가형(FI) 및 확산형(D)종양에서 상대적으로 발현이 낮음을 확인하였다.
상기 mRNA 또는 단백질 발현수준을 검출하는 제제란 본 발명의 바이오마커 유전자 또는 이들 유전자에 의해 코딩된 단백질의 발현수준을 확인하기 위하여 사용될 수 있는 물질을 의미하며, 예를 들면 상기 바이오마커에 특이적으로 결합하는 프라이머쌍, 프로브 또는 안티센스 뉴클레오티드이거나, 또는 상기 바이오마커 유전자에 의해 코딩되는 단백질에 특이적인 항체일 수 있다.
일 구체예에 따르면, 상기 진행성 난소암의 예후 예측용 조성물은 상기 REG1A, AMY1A, RELN, 및 DPEP3 유전자로 이루어진 군에서 선택된 어느 하나 이상의 mRNA 또는 단백질의 발현수준을 각각 검출할 수 있는 제제를 더 포함하는 것일 수 있다.
본 발명자는 국소 분리형(FS), 국소 분리불가형(FI) 및 확산형(D)종양의 유전자 발현양상을 비교한 결과, 상기 REG1A, AMY1A, RELN, 및 DPEP3 유전자들은 확산형(D) 종양에서 상대적으로 발현이 높고, 국소 분리형(FS) 및 국소 분리불가형(FI) 종양에서 상대적으로 발현이 낮음을 확인하였다.
일 구체예에 따르면, 상기 진행성 난소암의 예후 예측용 조성물은 상기 BRCA2 및 SIDT1 유전자로 이루어진 군에서 선택된 어느 하나 이상의 mRNA 또는 단백질의 발현수준을 각각 검출할 수 있는 제제를 더 포함하는 것일 수 있다.
상기 BRCA2 및 SIDT1 유전자들은 국소 분리불가형(FI) 종양 및 확산형(D) 종양에서 상대적으로 발현이 높고, 국소 분리형(FS) 종양에서 상대적으로 발현이 낮음을 확인하였다.
일 구체예에 따르면, 상기 진행성 난소암의 예후 예측용 조성물은 상기 RPS28 및 ADAMTS4 유전자로 이루어진 군에서 선택된 어느 하나 이상의 유전자의 mRNA 또는 단백질의 발현수준을 각각 검출할 수 있는 제제를 더 포함하는 것일 수 있다.
상기 RPS28 및 ADAMTS4 유전자들은 DEG 분석에 의한 RPKM 값에 의할 때 국소 분리형(FS) 종양에서 상대적으로 발현이 높고, 국소 분리불가형(FI) 종양 및 확산형(D) 종양에서 상대적으로 발현이 낮았으나, qPCR에 의할 때는 국소 분리형(FS) 종양 뿐만 아니라 확산형(D) 종양에서도 발현이 높았다.
일 구체예에 따르면, 상기 생물학적 시료는 세포, 종양 또는 혈액일 수 있다. 상기 종양은 난소암 종양이거나, 또는 난소암으로부터 위장, 췌장, 소장, 대장, 또는 결장 등 다른 기관으로 전이된 종양일 수도 있다.
또 다른 양상은, 상기 진행성 난소암의 예후 예측용 조성물; 및 상기 측정된 발현수준과 비교하기 위한 진행성 난소암 환자의 참조값;을 포함하는 진행성 난소암의 예후 예측용 키트를 제공한다.
상기 참조값은 유전자 발현량, 발현 양상 또는 발현 패턴으로써, 예후가 알려진 진행성 난소암 환자에 대해 직장구불결장 종양의 임상 표현형을 조사하여 국소 분리형, 국소 분리불가형, 확산형으로 환자를 분류하고, 이들의 종양 또는 혈액의 유전자 발현량을 조사하여 얻을 수 있다.
상기 키트가 mRNA 발현 수준을 측정하기 위한 조성물을 포함하는 경우, 유전자에 대한 특이적인 각각의 프라이머 쌍 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액, 데옥시뉴클레오티드(dNTPs), Taq-중합효소 및 역전사효소, DNase, RNase 억제제, DEPC-물(DEPC-water), 멸균수 등을 포함할 수 있다.
상기 키트가 단백질 발현 수준을 측정하기 위한 조성물을 포함하는 경우, 항체의 면역학적 검출을 위하여 기질, 적당한 완충용액, 발색 효소 또는 형광물질로 표지된 2차 항체 및 발색 기질 등을 포함할 수 있다. 상기에서 기질은 니트로셀룰로오스 막, 폴리비닐 수지로 합성된 96 웰 플레이트, 폴리스틸렌 수지로 합성된 96 웰 플레이트 및 유리로 된 슬라이드 글라스 등이 이용될 수 있고, 발색효소는 퍼옥시다아제(peroxidase), 알칼라인 포스파타아제(alkaline phosphatase)가 사용될 수 있고, 형광물질은 FITC, RITC 등이 사용될 수 있으며, 발색기질액은 ABTS(2,2'-아지노-비스-(3-에틸벤조티아졸린-6-설폰산)) 또는 OPD(o-페닐렌디아민), TMB(테트라메틸 벤지딘) 등이 사용될 수 있다.
또 다른 양상은 환자의 생물학적 시료를 준비하는 단계; 상기 시료로부터 RPL36, ANKRD1, IGFBP6, 및 ATOH8 유전자의 mRNA 또는 단백질의 발현수준 또는 발현패턴 데이터를 확인하는 단계; 및 상기 발현수준 또는 발현패턴을 예후가 알려진 진행성 난소암 환자의 참조 데이터와 비교하는 단계를 포함하는, 진행성 난소암의 예후를 예측하기 위한 정보를 제공하는 방법을 제공한다.
상기 mRNA의 발현수준 또는 발현패턴 데이터를 확인하는 단계는 RT-PCR, 경쟁적 RT-PCR(competitive RT-PCR), 실시간 RT-PCR(Real-time RTPCR), RNase 보호 분석법(RNase protection method), 노던 블랏팅(northern blotting) 또는 DNA 칩(DNA chip technology) 등의 방법이 이용될 수 있으나 특별히 한정되는 것은 아니다. 상기 mRNA의 발현수준 또는 발현패턴 데이터 확인은 RNA 시퀀싱으로 매핑된 리드의 수를 기준으로 할 수도 있다. 예를 들면 RNA 시퀀싱, 차등발현 유전자 발현값 계산(RPKM, FPKM, 또는 TPM 등), 및 클러스터링으로 RNA의 발현수준 또는 발현패턴을 확인할 수 있으나 이에 한정되는 것은 아니다.
상기 단백질의 발현수준 또는 발현패턴 데이터를 확인하는 단계는 웨스턴 블랏 (western blotting), ELISA (enzyme linked immunosorbentassay), 방사선면역분석 (RIA: radioimmunoassay), 방사 면역 확산법 (radial immunodiffusion), 오우크테로니면역 확산법 (Ouchterlony immunodiffusion), 로케트 면역전기영동 (rocket immunoelectrophoresis), 면역조직화학염색법 (immunohistochemical staining), 면역침전분석법 (immunoprecipitation assay), 보체 고정 분석법 (complement Fixation Assay), 면역형광법 (immunofluorescence), 면역크로마토그래피법 (immunochromatography), FACS 분석법 (fluorescenceactivated cell sorter analysis) 또는 단백질 칩 방법 (protein chip technology) 등이 있으나, 이에 제한되는 것은 아니다.
상기 예후가 알려진 진행성 난소암 환자는 진행성 난소암으로 진단받은 환자 중에서 병의 진행 경과가 밝혀진 환자를 의미하며, 예를 들면 진행성 난소암으로 인한 수술을 받은 후 36개월 안으로 재발하여 불량한 예후를 가진 것으로 확정된 환자, 또는 36개월 이후 재발하지 않고 생존하거나 완치되어 양호한 예후를 가진 것으로 확정된 환자일 수 있다. 이들 환자로부터 채취한 시료로부터 유전자의 발현수준 또는 발현패턴을 수득하고, 이를 참조값으로서 비교함으로써 예후를 알고자 하는 환자의 예후를 예측할 수 있다. 예후가 알려진 환자의 유전자 발현수준 또는 발현패턴은 환자의 예후와 함께 데이터베이스화하고, 추후 예후를 알고자 하는 환자의 발현수준 또는 발현패턴을 상기 데이터베이스에 입력하여 예후를 예측할 수 있다. 발현수준 또는 발현패턴을 비교하기 위한 알고리즘, 통계분석 프로그램은 공지의 것을 사용할 수 있다.
상기 방법에 의해 긍정적인 예후가 예측되는 환자에 대해서는 직장구불결장 종양의 제거방법으로 덜 침습적인 수술, 또는 VSS를 실시할 것을 결정할 수 있고, 부정적인 예후가 예측되는 환자에 대해서는 LAR 또는 더 공격적이고 실험적인 치료를 실시할 것을 결정할 수 있다.
일 구체예에 따르면, 상기 진행성 난소암의 예후를 예측하기 위한 정보를 제공하는 방법은 상기 시료로부터 REG1A, AMY1A, RELN, 및 DPEP3 유전자로 이루어진 군에서 선택된 하나 이상의 mRNA 또는 단백질의 발현수준 또는 발현패턴 데이터를 확인하는 단계를 더 포함할 수 있다.
일 구체예에 따르면, 상기 진행성 난소암의 예후를 예측하기 위한 정보를 제공하는 방법은 상기 시료로부터 BRCA2 및 SIDT1 유전자로 이루어진 군에서 선택된 하나 이상의 mRNA 또는 단백질의 발현수준 또는 발현패턴 데이터를 확인하는 단계를 더 포함할 수 있다.
일 구체예에 따르면, 상기 진행성 난소암의 예후를 예측하기 위한 정보를 제공하는 방법은 상기 시료로부터 RPS28 및 ADAMTS4 유전자로 이루어진 군에서 선택된 하나 이상의 mRNA 또는 단백질의 발현수준 또는 발현패턴 데이터를 확인하는 단계를 더 포함할 수 있다.
이하 하나 이상의 구체예를 실시예를 통해 보다 상세하게 설명한다. 그러나, 이들 실시예는 하나 이상의 구체예를 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예 1: 직장구불결장에 전이된 종양의 표현형 구별 및 예후 분석
(1) 실험방법
1-1. 환자의 선별(Patient Selection)
본 연구는 2014년 8월부터 2020년 6월까지 서울대학교 병원에서 상피 난소암(epithelial ovarian cancer) 진단을 받은 환자를 중에서 (1) 국제 산부인과 연맹 (FIGO) 기준으로 3B기 내지 4B기이고, (2) 데이터의 품질을 제어하기 위해서 숙련된 부인과 종양전문의(HSK)에 의해 1차 질환(primary disease)인 난소암에 대한 최대 종양감축술(maximal debulking surgery)을 받았고, (3) 종양감축술 중 직장구불결장(rectosigmoid colon)에서 종양 분리성(tumor separability)을 평가한 환자를 대상으로 하였다.
서울대학교 병원기관심의위원회(IRB, Seoul National University Hospital Institutional Review Board)는 본 연구(H-1707-079-869)를 승인했으며 후향적 실험디자인(retrospective design)이므로 환자 동의는 면제되었다.
1-2. 수술 절차(Surgical Procedure)
모든 환자는 이전 연구(Kim HS, Bristow RE, Chang S-J. Total Parietal PeritonectomyWith En Bloc Pelvic Resection for Advanced Ovarian CancerWith Peritoneal Carcinomatosis. Gynecol Oncol (2016) 143(3):688-9)에서 설명한 절차에 따라 난소암의 최적의 종양감축을 위해 종양감축술을 받았다.
종양감축술 중에 종양이 위치한 직장구불결장의 길이를 평가했다. 종양이 형성된 조직의 길이가 18cm 미만일 때는 직장구불결장을 손상시키지 않기 위해 이전에 보고된 수술 절차(Park SJ, Kim HS. Surgical Technique of Visceral Segmental Serosectomy for Advanced Ovarian Cancer. Gland Surg (2021) 10(3):1276-8)에 따라 장측구획장막절제술(visceral segmental serosectomy, 이하 VSS로 지칭)을 시도하였다. (도 1 참고)
VSS을 시도하여 점막결손(mucosal defect) 없이 종양을 쉽게 분리할 수 있는 경우에는 해당 표현형을 국소 분리가능 유형(focal and separable type, FS type)으로 정의하였다. 반면, VSS 시술 중에 점막 결손이 발생하면 해당 표현형을 국소 분리불가 유형(focal and inseparable type, FI type)으로 정의하고 VSS 대신 LAR을 실시하였다. 마지막으로, 종양이 포함된 조직의 길이가 18cm를 초과했을 때는 과도한 장력(excessive tension)에 의한 장막 수선 부위의 누출 위험을 방지하기 위해 LAR를 수행하였으며, 해당 표현형은 확산(D) 유형으로 정의했다. (도 2 참고)
종양 침습성(invasiveness) 및 확장성(extensiveness)에 따른 종양 분리성(tumor separability)은 두 명의 부인과 종양학자(SJP 및 EJL)에 의해 검증되었으며, 세 번째 부인과 종양학자(JM)는 두 검증자의 검증결과를 조율했다. 최종적으로 3 명의 부인과 종양전문의는 수술 기록, 병리 보고서, 전자 의료 기록에 업로드된 수술 분야의 비디오와 사진을 사용하여 검증을 수행했다.
1-3. 데이터 선별
직장구불결장에 위치한 종양의 절제 유형에 따라 환자를 FS, FI 및 D 그룹으로 나누었다.
세 그룹에 대해서 다음 데이터를 수집했다: 연령, FIGO 병기(FIGO stage), 조직학적 유형(histologic type), 치료 유형(treatment type), 베바시주맙(bevacizumab) 사용, 추적 기간(duration of follow-up), 수술 범위(surgical extent), 종양 침윤(tumor infiltration), 수술 결과(operative outcome), 무진행 생존(PFS, progression-free survival) 및 전체 생존(OS, overall survival). 또한 수술 복잡성 점수(SCS, surgical complexity score)를 계산하여 수술의 복잡성과 정도를 평가하고, 메모리얼 슬론 케터링 암센터(MSKCC) 외과 2차 사건 등급 분류를 사용하여 수술 합병증을 평가했다. 종양 반응(Tumor response)은 RECIST (Response Evaluation Criteria In Solid Tumors) 기준 (버전 1.1)에 의해 평가되었다. 무진행 생존(PFS)은 치료 시작일부터 질병 재발 또는 마지막 추적일까지의 시간 간격으로 정의되었으며, 전체 생존(OS)은 치료 시작일부터 암 관련 사망 또는 마지막 추적일까지의 시간 간격으로 정의되었다. 재발 패턴은 직장구불결장(rectosigmoid colon)의 절제부위, 골반강(pelvic cavity), 복강(abdominal cavity), 원거리 전이(distant metastasis)로 분류되었다.
1-4. 통계분석
카이 제곱 검정(Chi-squared test)은 범주형 변수(categorical variables)에 대해 수행하였고, Kruskal-Wallis 검정은 연속 변수(continuous variables)에 대해 수행하였다. 생존 결과는 로그 순위 및 Breslow 검정을 사용하여 Kaplan-Meier 방법으로 추정되었으며, 생존과 관련된 요인은 위험 비율(HR)과 95% 신뢰 구간(CI)을 사용하는 Cox 비례 위험 회귀 방법으로 식별되었다. 모든 통계 분석은 SPSS 소프트웨어 버전 22.0 (SPSS Inc., Chicago, IL, USA)을 사용하였다.
(2) 임상 표현형에 따른 특성 분석
2-1. 기준특성 (Baseline characteristics)
총 83명의 환자가 진행성 난소암에 대해 직장구불결장의 종양의 절제를 포함한 최대 종양감축술을 받았다. 이 중 44명(53%)은 FS군, 18명(21.7%)은 FI군, 24명(25.3%)은 D군으로 분류되었다.
세 그룹은 연령, FIGO 병기, 조직학, 치료 유형, 베바시주맙 사용, 및 추적 기간에서 유의한 차이가 없었다. (표 1 참고)
FS group
(n=44, %)		 FI group
(n=18, %)		 D group
(n=21, %)		 P
value
Age (median, range, years) 57 (32, 76) 61 (31, 89) 60 (42, 79) 0.821
FIGO stage 0.126
Ⅲ 17 (38.6) 12 (66.7) 9 (42.9)
Ⅳ 27 (61.4) 6 (33.3) 12 (57.1)
Histology(조직학) 0.289
Serous(장액) 39 (88.6) 14 (77.8) 21 (100)
Endometrioid(자궁내막) 0 1 (5.6) 0
Clear cell(투명세포) 3 (6.8) 3 (16.7) 0
mixed 2 (4.6) 0 0
Treatment 0.239
Neoadjuvant 25 (56.8) 13 (72.2) 16 (76.2)
chemotherapy
Primary debulking surgery 19 (43.2) 5 (27.8) 5 (23.8)
Use of bevacizumab 0.674
Yes 5 (11.4) 1 (5.6) 3 (14.3)
No 39 (88.6) 17 (94.4) 18 (85.7)
Duration of follow-up(median, range,
mons)		 45.1 (8.3-70.3) 64.0 (6.7-128.7) 38.7 (9.4-80.4) 0.139
D, diffuse; FI, focal and inseparable; FIGO, International Federation of Gynecology and Obstetrics; FS, focal and separable.
2-2. 수술 범위 및 종양 침윤 표 2 및 표 3은 절제된 부위의 수술 범위 및 종양 침윤을 나타낸 것이다.
Surgical extent
(수술 범위)		 FS group
(n=44, %)		 FI group
(n=18, %)		 D group
(n=21, %)		 P value
Hysterectomy(자궁적출) 44 (100) 18 (100) 21 (100) -
BSO(양측난소적출) 44 (100) 18 (100) 21 (100) -
Lymphadenectomy(림프절절제) 44 (100) 18 (100) 21 (100) -
Omentectomy(대망절제) 44 (100) 18 (100) 21 (100) -
Hepatobiliary resection(간쓸개절제)
Splenectomy(비장절제) 27 (61.4)a,b 7 (38.9)a 17 (81.0)b 0.027
Distal pancreatectomy(원위부췌절제) 12 (27.3) 1 (5.6) 6 (28.6) 0.14
Hepatectomy(간절제) 1 (2.3) 1 (5.6) 0 0.527
Wedge resection of liver(간 쐐기절제) 11 (25.0) 2 (11.1) 7 (33.3) 0.265
Cholecystectomy(담낭절제) 14 (31.8)c,d 2 (11.1)c 10 (47.6)d 0.049
Portal triad stripping(간세동이박리) 11 (25)e,f 1 (5.6)e 9 (42.9)f 0.028
Adrenalectomy(부신절제) 5 (11.4) 1 (5.6) 4 (19.0) 0.426
Cardiophrenic LND(심장가로막 림프절 절제) 15 (34.1) 3 (16.7) 6 (28.6) 0.389
Peritonectomy(복막절제)
Rt diaphragm Peritonectomy(우측 가로막 복강라이닝절제) 30 (68.2) 10 (55.6) 16 (76.2) 0.386
Lt diaphragmPeritonectomy
(좌측 가로막 복강라이닝절제)		 20 (45.5)g,h 4 (22.2)g 13 (61.9)h 0.045
Rt paracolicPeritonectomy
(우측 잘록창자 복강라이닝절제)		 30 (68.2)i 5 (27.8) 14 (66.7)i 0.01
Lt paracolicPeritonectomy
(좌측 잘록창자 복강라이닝절제)		 26 (59.1)j 4 (22.2) 13 (61.9)j 0.017
Rt pelvicPeritonectomy
(우측 골반 복강라이닝절제)		 30 (68.2) 9 (50) 13 (61.9) 0.404
Lt pelvicPeritonectomy
(좌측 골반 복강라이닝절제)		 28 (63.6) 8 (44.4) 12 (57.1) 0.38
BladderPeritonectomy
(방광 복강라이닝절제)		 30 (68.2) 14(77.8) 17 (81.0) 0.495
Bowel surgery (장수술)
Small bowel R&A(소장 절제 및 문합) 4 (9.1)k 4 (22.2)k,l 7 (33.3)l 0.052
Large bowel R&A(대장 절제 및 문합) 10 (22.7) 4 (22.2) 8 (38.1) 0.379
Appendectomy(충수절제) 27 (61.4) 9 (50) 16 (76.2) 0.234
Prophylactic ileostomy(예방적 회장루조설술) 1 (2.3)m 2 (11.1)m,n 4 (19.0)n 0.067
BSO, bilateral salpingo-oophorectomy; D, diffuse; FI, focal and inseparable; FS, focal and separable; LND, lymph node dissection; LN, lymph node; R&A, resection and anastomosis. There is no significant difference between the two groups with the same symbols
Tumor infiltration
(종양 침윤)		 FS group
(n=44, %)		 FI group
(n=18, %)		 D group
(n=21, %)		 P value
Uterus(자궁) 29 (65.9) 13 (72.2) 18 (85.7) 0.249
Adnexa (자궁부속기관) 43 (97.7) 18 (100) 20 (95.2) 0.624
Lymph node(림프절) 28 (63.6) 10 (55.6) 13 (61.9) 0.838
Omentum(대망) 26 (59.1) 10 (55.6) 17 (81) 0.163
Hepatobiliary resection(간쓸개절제)
Spleen(지라) 18 (40.9) 5 (27.8) 12 (57.1) 0.175
Distal pancreas(원위부 췌장) 5 (11.4) 0 2 (9.5) 0.336
Liver (hepatectomy) 1 (2.3) 1 (5.6) 0 0.527
Liver (wedge resection)(간 쐐기절제) 9 (20.5)o,p 1 (5.6)o 7 (33.3)p 0.101
Gall bladder(담낭) 8 (18.2) 0 4 (19) 0.143
Portal triad (간세동이) 9 (20.5)q 0r 4 (19)q,r 0.117
Adrenal gland(부신) 2 (4.5) 1 (5.6) 1 (4.8) 0.986
Cardiophrenic LN(심장가로막 림프절) 12 (27.3) 2 (11.1) 2 (9.5) 0.145
Peritonectomy(복강라이닝절제)
Rt diaphragm peritoneum(우측 가로막 복막) 27 (61.4) 10 (55.6) 16 (76.2) 0.361
Lt diaphragm peritoneum(좌측 가로막 복막) 19 (43.2)s,t 4 (22.2)s 13 (61.9)t 0.045
Rt paracolic peritoneum(우측 잘록창자 복막) 26 (59.1)u 4 (22.2)v 10 (47.6)u,v 0.031
Lt paracolic peritoneum(좌측 잘록창자 복막) 23 (52.3)w 4 (22.2) 12 (57.1)w 0.055
Rt pelvic peritoneum(우측 골반 복막) 26 (59.1) 7 (38.9) 11 (52.4) 0.35
Lt pelvic peritoneum(좌측 골반 복막) 23 (52.3) 7 (38.9) 11 (52.4) 0.602
Bladder peritoneum(방광 복막) 28 (63.6) 12 (66.7) 16 (76.2) 0.598
Bowel surgery
Small bowel segment(소장 분절) 4 (9.1)x 2 (11.1)x,y 6 (28.6)y 0.102
Large bowel segment(대장 분절) 6 (13.6)z 3 (16.7)z,aa 8 (38.1)aa 0.066
Appendix(충수) 17 (38.6)bb,cc 4 (22.2)bb 13 (61.9)cc 0.038
BSO, bilateral salpingo-oophorectomy; D, diffuse; FI, focal and inseparable; FS, focal and separable; LND, lymph node dissection; LN, lymph node; R&A, resection and anastomosis. There is no significant difference between the two groups with the same symbols
비장절제술(Splenectomy), 담낭절제술(cholecystectomy), 간세동이 박피(portal triad stripping), 좌측 횡경막 복막절제술(left diaphragm peritonectomy), 좌우 잘록창자 복막제거술(right and left paracolic peritonectomy) 은 FI 그룹보다 D 그룹에서 더 많이 수행되었다. 그러나 FI 그룹과 D 그룹 간에 소장 및 대장 절제술(small and large bowel resection)의 수행정도는 차이가 없었다.반면, FS 그룹은 FI 그룹보다 좌우 잘록창자 복막절제술(right and left paracolic peritonectomy)을 더 많이 수행하였고, D 그룹보다 소장 절제술(small bowel resection) 및 예방 회장조루술(prophylactic ileostomy)을 더 많이 수행하였다.
병리학적 검사에서, D 그룹은 FI 그룹보다 좌측 횡격막(left diaphragm), 좌측 잘록창자 복막(left paracolic peritoneum), 충수(appendix)에서 종양 침윤이 더 흔하게 나타났다. 그러나 두 군 간에 소장과 대장의 종양 침윤에는 차이가 없었다.
반면, FS 그룹은 FI 그룹보다 좌우 잘록창자 복막에서 종양 침윤이 더 빈번하게 나타났으며, D 그룹보다 소장 및 대장에서의 종양 침윤은 더 적게 나타났다.
2-3. 수술 결과(operative outcome)
표 4는 FS, FI, 및 D 그룹 간의 수술 결과를 비교한 것이다.
Outcomes FS group
(n=44, %)		 FI group
(n=18, %)		 D group
(n=21, %)		 p-value
Operation time (median, range, minutes) 300 (170, 761)a 343 (215, 630)a,b 440 (200, 785)b 0.008
Estimated blood loss (median, range, ml) 1450 (300, 5000)c 1615 (350, 6900)c 2800 (350, 9000) 0.008
Transfusion (median, range) 3 (0, 11)d 4 (0, 15)d,e 6 (1, 16)e 0.007
Hospitalization (median, range, days) 13 (8, 36)f 13.5 (9, 46)f,g 17 (11, 38)g 0.019
Surgical Complexity Score (median, range) 10 (4, 14) 10.5 (7, 17) 14 (7, 18) <0.001
Size of residual tumor
No gross residual tumor 35 (79.5) 15 (83.3) 14 (66.7) 0.398
<0.5cm 42 (95.5) 16 (88.9) 17 (81.0) 0.175
<1cm 44 (100) 17 (94.4) 19 (90.5) 0.139
Time interval from surgery to adjuvant chemotherapy (median, range, days) 27 (10, 56) 25 (11, 70) 27 (12, 51) 0.429
Surgical complication
Gastrointestinal 0.298
Grade 1-2 2 (4.5) 1 (5.6) 0 (0)
Grade 3-4 0 (0) 1 (5.6) 2 (9.5)
Infection 0.023
Grade 1-2 4 (9.1) 1 (5.6) 2 (9.6)
Grade 3-4 0 (0) 3 (16.7) 0 (0)
Thromboembolic(혈전 색전성) 0.599
Grade 1-2 2 (4.5) 0 (0) 0 (0)
Grade 3-4 1 (2.3) 0 (0) 0 (0)
Complication at the tumor resection site of the rectosigmoid colon (n, %)
Leakage 0 (0) 1 (5.6) 2 (9.5) 0.139
Bleeding 0 (0)h 2 (11.1)i 1 (4.8)h,i 0.099
D, diffuse; FI, focal and inseparable; FS, focal and separable.
There is no significant difference between the two groups with the same symbols.
첫째, FI 그룹 및 D 그룹은 FS 그룹보다 수술 시간이 길고 출혈량 및 수혈이 많았고 입원기간이 더 긴 경향을 보였다.수술 복잡성 점수(surgical complexity score, SCS)는 D 그룹이 가장 높았고 FS 그룹이 가장 낮았다. 그러나 잔여 종양의 크기와 수술부터 보조 화학 요법까지의 시간 간격은 세 그룹 간에 차이가 없었다.
수술적 합병증은 3-4 등급 감염이 FS 그룹 및 D 그룹보다 FI 그룹에서 더 흔하였으나, 위장관 합병증 (gastrointestinal complication) 및 혈전색전성 합병증(thromboembolic complication)은 세 그룹 간에 차이가 없었다.
또한 직장구불결장의 종양 절제 부위의 누출 및 출혈의 정도는 세 그룹 간에 차이가 없었다.
2-4. 생존(survival)
도 3 및 표 5 내지 표 6에 따르면, PFS의 중앙값(Mean)은 23.9, 52.6, 17.8 개월이었다. 표 5에 따르면, PFS에 대한 카플란-메이어(Kaplan-Meier) 곡선은 FS와 D 그룹 사이(p = 0.048), FI와 D 그룹 (p = 0.013) 사이에 유의한 차이를 나타냈다.
FS FI D
Events, n(%) 26(59.1%) 6(33.3%) 16(76.2%)
Mean (95% CI) 23.9(16.9-30.9) 52.6(14.3-90.8) 17.8(12.2-23.5)
FS와 D 사이 Log-rank: p=0.048
Breslow: p=0.201
FS와 FI 사이 Log-rank: p=0.403 Breslow: p=0.459
FI와 D 사이 Log-rank: p=0.013 Breslow: p=0.081
Time
(months)		 0 12 24 36 48 60 72 84 96
FS 44 33(3) 18(5) 12(2) 8(2) 5(1) 0(5) - -
FI 18 10(6) 5(3) 5(0) 4(0) 2(1) 1(1) 1(0) 0(1)
D 21 15(2) 6(0) 0(3) - - - - -
도 4 및 표 7 내지 표 8에 따르면 OS의 평균값은 FS, FI, D 그룹에서 각각 56.6, 81.1, 49.6 개월이었다. 표 7에 따르면, 세 그룹의 OS에 대한 Kaplan-Meier 곡선은 큰 차이를 보이지 않았지만, FS 군과 D 군 간에는 유의한 차이를 보였고 (p = 0.046), FS 군과 FI 군 간에는 유의한 한계 차이(marginal difference)를 보였다 (p = 0.074).
FS FI D
Events, n(%) 7(15.9%) 6(33.3%) 8(38.1%)
Mean (95% CI) 56.6 (50.3-62.8) 81.1 (51.2-110.9) 49.6(36.3-62.9)
FS와 D 사이 Log-rank: p=0.046
Breslow: p=0.205
FS와 FI 사이 Log-rank: p=0.118 Breslow: p=0.074
FI와 D 사이 Log-rank: p=0.773 Breslow: p=0.574
Number at risk (number censored)
Time
(months)		 0 12 24 36 48 60 72 84 96 108 120 132 144
FS 44 39
(3)		 25
(12)		 19
(5)		 13
(4)		 8
(5)		 0
(8)		 - - - - - -
FI 18 11
(3)		 8
(3)		 7
(0)		 5
(1)		 4
(1)		 2
(2)		 2
(0)		 1
(1)		 1
(0)		 1
(0)		 0
(1)		 -
D 21 18
(2)		 14
(2)		 8
(5)		 4
(1)		 2
(1)		 1
(1)		 0
(1)		 - - - - -
질병 진행 위험과 암 관련 사망을 평가한 결과, D 그룹은 FS 및 FI 그룹보다 질병 진행 위험이 더 높았으며 FI 및 D 그룹은 FS 그룹보다 암 관련 사망 위험이 더 높은 것으로 나타났다. 표 9는 PFS 및 OS에 영향을 미치는 요인을 나타낸다. 1 차 종양감축술, 육안상 잔존 종양 없음, 및 D 유형은 PFS에 영향을 미쳤다. (조정된 HRs, 0.44, 0.52 및 2.06; 95% CIs, 0.23-0.85, 0.25-1.08 및 1.01-4.20). 또한 3(III)기 질환, 육안상 잔류 종양 없음, FI 및 D 유형은 OS에 영향을 미쳤다. (조정된 HRs, 0.25. 0.24, 4.59 및 3.34; 95 % CIs, 0.08-0.81, 0.08-0.70, 1.31-16.08 및 1.06-10.54)
Univariate Multivariate
HR (95% CI) p-value Adjusted HR (95% CI) p-value
Progression-free survival
Stage III disease 0.53 (0.30-0.95) 0.03 0.75 (0.39-1.43) 0.38
Primary debulking surgery 0.43 (0.23-0.78) 0.01 0.44 (0.23-0.85) 0.01
Serous type 0.64 (0.23-1.811) 0.40 1.00 (0.34-2.93) 0.99
Age ≤57 years 0.83 (0.47-1.48) 0.54 0.89 (0.49-1.64) 0.71
No gross residual tumor 0.34 (0.18-0.65) <0.001 0.52 (0.25-1.08) 0.08
Surgery on the rectosigmoid colon
FI type 0.67 (0.28-1.63) 0.38 0.89 (0.34-2.36) 0.82
D type 1.96 (1.02-3.76) 0.04 2.06 (1.01-4.20) 0.04
Overall survival
Stage III disease 0.31 (0.12-0.80) 0.02 0.25 (0.08-0.81) 0.02
Primary debulking surgery 0.52 (0.21-1.28) 0.16 0.65 (0.22-1.89) 0.43
Serous type 0.53 (0.18-1.59) 0.26 0.29 (0.08-1.04) 0.06
Age ≤57 years 0.59 (0.25-1.41) 0.23 0.47 (0.18-1.23) 0.12
No gross residual tumor 0.18 (0.08-0.44) <0.001 0.24 (0.08-0.70) 0.01
Surgery on the rectosigmoid colon
FI type 2.32 (0.78-6.92) 0.13 4.59 (1.31-16.08) 0.02
D type 2.65 (0.96-7.33) 0.06 3.34 (1.06-10.54) 0.04
HR, hazard ratio; CI, confidence interval.
2-5. 재발 패턴(Recurrence Pattern)재발 환자 48명 (57.8 %) 중 26 명 (59.1 %), 6 명 (33.3 %), 16 명 (76.2 %)이 FS, FI, D 군에 포함되었다. 표 10에 따르면, 세 군 간 재발 패턴의 차이가 없었고 직장구불결장의 종양 절제 부위에서의 질병 재발은 관찰되지 않았다.
Recurrent sites FS group
(n=26, %)		 FI group
(n=6, %)		 D group
(n=16, %)		 P value
Tumor resection site of the rectosigmoid colon (n, %) 0 (0) 0 (0) 0 (0) 0.088
Pelvis other than the rectosigmoid colon (n, %) 2 (7.7) 1 (16.7) 1 (6.3)
Intra-abdominal above the pelvis (n, %) 7 (26.9) 4 (66.7) 10 (62.5)
Distant metastasis (n, %) 17 (65.4) 1 (16.7) 5 (31.3)
(3) 소결직장구불결장에 위치한 종양의 절제 유형에 기초한 3가지 임상 표현형의 주요 결과를 표 11에 요약하였다. 연구 결과를 종합하면, 3가지 임상 표현형은 수술 범위, 종양 침윤, 수술 결과, 및 진행성 난소암의 예후와 관련이 있다.
Characteristics FS group FI group D group
Clinical phenotypes Less invasive but more extensive More invasive but less extensive More invasive and more extensive
Surgical extent
Bowels + ++ ++
Others ++ + ++
Tumor Infiltration
Bowels + ++ ++
Others ++ + ++
Operative Outcomes
Operation time + + or ++ ++
Estimated blood loss + + ++
Transfusion + + or ++ ++
Hospitalization + + or ++ ++
Surgical complexity + ++ +++
Risk of disease progression Lower Lower Higher
Risk of cancer related death Lower Higher Higher
실시예 2: 임상 표현형과 관련된 바이오마커 선별
(1) DEG 분석에 의한 바이오마커 선별 및 클러스터 분류
상기 실시예 1의 FS, FI, 및 D 그룹에서 이들의 난소암 종괴를 시료로 Total RNA-sequencing을 진행하고 mRNA에 대한 DEG(differentially expressed genes, 차별발현 유전자) 분석을 시행하였다.
DEG 분석의 비교군은 1) FS / FI 및 D; 2) FS 및 FI / D; 3) FI / FS 및 D 으로 설정하였다. (이하에서, 상기 FS는 VSS를 실시한 그룹으로 VSS 그룹으로 지칭할 수 있고, FI는 LAR를 실시한 그룹으로 LAR1으로 지칭할 수 있고, D는 LAR를 실시한 그룹으로 LAR2로 지칭할 수 있다.)
이 중에서 각 항목에서 p<0.001의 유의성을 가지는 유전자를 1차적으로 선별하였다. 그리고 선별된 유전자를 RPKM에 의한 차등발현 유전자 발현량을 time series(세 개 이상 비교군의 차이를 동시에 비교)로 분석하여 발현양상에 따라 3개의 클러스터로 분류하였다. 구체적으로, FS 그룹 환자의 난소암 조직에서 발현이 높고 FI 및 D 그룹에서는 발현량이 낮은 유전자들을 클러스터 1, D 그룹 환자의 난소암 조직에서 발현이 높고 FS 및 FI에서는 발현량이 낮은 유전자를 클러스터 2, FI 그룹 및 D 그룹 환자의 난소암 조직에서 발현이 높고 FI에서는 발현량이 낮은 유전자를 클러스터 3으로 분류하였다.
표 12는 선정된 바이오마커 후보를 나타낸 것이다.
cluster gene Seq ID Gene bank
1 RPL36 1 NM_015414.4
ANKRD1 2 NM_014391.3
ADAMTS4 3 NM_005099.6
IGFBP6 4 NM_002178.3
ATOH8 5 NM_032827.7
RPS28 6 NM_001031.5
2 REG1A 7 NM_002909.5
AMY1A 8 NM_001008221.1
RELN 9 NM_005045.4
DPEP3 10 NM_001129758.2
3 BRCA2 11 NM_000059.4
SIDT1 12 NM_001308350.2
(2) qRT-PCR (quantative reverse transcription real-time PCR)에 의한 발현량 검증동결된 난소암 조직을 각각 0.05g씩 잘라 Trizol 500㎕에 넣어 분쇄하였다. 이후 Trizol 500㎕ 및 chloroform 200㎕를 추가하고 원심분리하여 상층액을 분리하였다. 상층액에 isopropanol 500㎕를 혼합하고 원심분리하여 RNA가 포함된 pellet을 분리한 후 RNase free water로 재현탁하였다. AccuPower premix를 이용하여 total RNA 1㎍을 cDNA로 합성하였다. 유전자 발현은 SYBR Green (Sigma-Aldrich) 및 StepOnePlus real-time PCR system (Applied Biosystems, CA)으로 측정하였다. 타겟 유전자의 발현은 CT값으로 계산하였으며, GAPDH 발현을 기준으로 표준화하였다. PCR 조건은 95℃로 3분 진행한 후, 95℃ 30초, 60℃ 30초, 72℃ 30초 조건으로 40회 증폭하였다. 실험에 사용된 프라이머는 하기 표 13에 개시되어 있다.
qRT primer_F qRT primer_R qRT_size Gene bank
RPL36 CGCCATGGAGTTACTGAAGG TCTTGGCAGCAGCTTTCC 143 NM_015414.4
ANKRD1 AACGCCAAAGACAGAGAAGG GTGTAGCACCAGATCCATCG 147 NM_014391.3
ADAMTS4 CTGGGTATGGCTGATGTGG TCATGAGCAGCAGTGAAGG 98 NM_005099.6
IGFBP6 GGAATCCAGGCACCTCTACC CCAGATGTCTACGGCATGG 87 NM_002178.3
ATOH8 GAGATCAAAGCCCTGCAGC CATATGAGTAGCACGGCACC 121 NM_032827.7
RPS28 TCTCTTCGGCCAGTGTTAGC AACCCCCAGGTTCAGTAAGC 138 NM_001031.5
REG1A ATGCCTATCGCTCCTACTGC AATCAGTGAGGCCACAAAGG 143 NM_002909.5
AMY1A TCGTCTGTCTGGTCTTCTCG ATTCTGAACCCTGCAACACC 108 NM_001008221.1
RELN ATTCGCTGGAGACAAACAGG AAATCCAGGGTCACACTTGC 138 NM_005045.4
DPEP3 CACTGTGGCAGATCACTTTG CCAGTCCCGTCATAATTTCC 84 NM_001129758.2
BRCA2 TCTTCATGGAGCAGAACTGG GGCCGAGTACTGTTAGCAGA 99 NM_000059.4
SIDT1 CAAGGACATCTTTGCTGTGG GGTGTCGAATTGGAAGTTGG 142 NM_001308350.2
도 7에 따르면, 앞서 클러스터 1로 분류된 RPL36, IGFBP6, ANKRD1, ATOH8의 mRNA 발현량은 FI 및 D 그룹보다 FS 그룹에서 유의하게 높게 나타났으며, 이들은 DEG 분석에 의한 발현양상과 일치하였다. 다만, RPS28 및 ADAMTS4의 mRNA 발현량은 FS 그룹 뿐만 아니라 D그룹에서도 높았다. 도 8에 따르면, 클러스터 2에 속하는 DPEP3, AMY1A, RELN, REG1A의 mRNA 발현량은 FS 및 FI그룹보다 D그룹에서 유의하게 높았으며, 이는 DEG 분석에 의한 발현양상과 일치하였다.
도 9에 따르면, 클러스터 3에 속하는 BRCA2 및 SIDT1의 mRNA 발현량은 FS 그룹보다 FI 및 D 그룹에서 유의하게 높았으며, 이는 DEG 분석 결과와 일치하였다.
(3) 면역조직화학염색(immunohistochemistry)에 의한 발현량 검증
RNA sequencing으로 분석된 15명의 환자들 (FS 타입 5명, FI 타입 5명, D 타입 5명)을 대상으로 각 환자의 종양 조직 시료로부터 ADAMTS4, ANKRD1, AMY1A, ATOH8, BRCA2, DPEP3, IGFBP6, REG1A, RELN, RPL36, RPS28, SIDT1의 12개 유전자에 대해 면역조직화학염색 검사를 실시하였다.
우선 각 환자들의 종양조직을 이용하여 파라핀 블록을 제작하였고, 5 um의 두께로 절제 후 탈파라핀화(deparaffinized)하고, xylene 및 alcohol을 이용하여 재수화(rehydrate)하였다. Endogenous peroxidase 활성도는 상온에서 15분간 methanol과 1% 과산화수소에 배양하여 차단하였고, 비특이적 결합부위는 상온에서 PBS (phosphate buffered saline)과 말의 혈청에 배양하여 차단하였다. 이후 가습 챔버 내 4℃에서 16시간 동안 1:50으로 희석한 anti-human monoclonal antibody와 배양을 하였고, 이후 5분동안 PBS로 세척 후 37℃에서 1시간동안 biotinylated secondary antibody와 배양하였다. 이후 상온에서 30분동안 Avidin-Biotin 혼합물과 배양 후 5분 동안 PBS로 세척하였다. 이후 항원 발현을 가시화하기 위해 3,3′-Diaminobenzidine 용액에 배양 후 각 조직 슬라이드는 xylene과 alcohol을 이용하여 탈수화하였고, 이후 영구적으로 장착하여 발현 정도를 평가하였다.
발현 정도를 객관적으로 평가하기 위해 다음과 같이 점수화된 지수 1 (Index 1) 및 지수 2 (Index 2)를 계산하였으며 그 결과를 도 10 내지 21 에서 그래프로 비교하였다:
* Index 1 = 종양 염색 퍼센트 x 강도
* Index 2 = 종양 염색 그룹 x 강도
여기서, 종양 염색 그룹은 0-24%일때 1점, 25-49%일때 2점, 50-74%일때 3점, 75-100%일때 4점이고, (염색) 강도는 약한 경우(weak) 1점, 중간의 경우(moderate) 2점, 강한 경우(strong) 3점이다.
도 10 내지 13 및 14 및 15 에 따르면, 앞서 클러스터 1로 분류된 RPL36, IGFBP6, ATOH8, 및 RPS28 은 FI 및 D 그룹보다 FS 그룹에서 발현 정도가 강했으며 이는 DEG 분석에 의한 발현양상과 일치하였다. 다만, ANKRD1 및 ADAMTS4 는 DEG 분석 결과와 달리, FS 그룹보다 D 그룹에서 오히려 발현량이 더 높았으며 이에 따라 이들의 경우 면역조직화학염색에서는 FS 그룹의 판별에 이용가능하지 않을 것으로 보인다.
도 16 내지 도 19 에 따르면, 앞서 클러스터 2에 속하는 DPEP3, AMY1A, RELN 은 FS 및 FI 그룹보다 D 그룹에서 발현 정도가 강했으며 이는 DEG 분석에 의한 발현양상과 일치하였다. 다만, REG1A은 DEG 분석 결과와 달리, FS 그룹에서 오히려 발현량이 더 높았으며 이에 따라 이의 경우 면역조직화학염색에서는 D 그룹의 판별에 이용가능하지 않을 것으로 보인다.
도 20 내지 도 21 에 따르면, 앞서 클러스터 3 에 속하는 BRCA2 은 FS 그룹보다 FI 및 D 그룹에서 발현 정도가 강했으며 이는 DEG 분석 결과와 일치하였다. 다만, SIDT1 은 DEG 분석 결과와 달리 FI 가 아니라 FS 및 D 그룹에서 발견 정도가 강했으며 이에 따라 이의 경우 면역조직화학염색에서는 FI 그룹의 판별에 이용가능하지 않을 것으로 보인다.
실험결과를 종합하면 상기 유전자의 발현양상을 확인하고 진행성 난소암 환자의 유전자 발현양상에 대한 참조값과 비교함으로써 전이된 종양의 표현형 또는 수술방법을 결정하거나, 진행성 난소암의 예후를 판단하는데 도움을 줄 수 있다.
예를 들면 표현형이 확인되지 않은 진행성 난소암 환자로부터 생물학적 시료를 얻고, 시료부터 상기 표 12의 클러스터 1 내지 3에 속하는 유전자들의 발현 양상을 측정한다. 측정 결과를 표현형이 확인된 진행성 난소암 환자들로부터 얻은 참조값과 비교하여 (1) 클러스터 1에 속하는 유전자들의 발현량이 높고 다른 클러스터에 속하는 유전자들의 발현량이 낮다면 FS 형으로 결정할 수 있고, (2) 클러스터 2에 속하는 유전자들의 발현량이 높고 다른 유전자의 발현량이 낮다면 D형으로 결정할 수 있고, (3) 클러스터 3에 속하는 유전자들의 발현량이 높고 다른 유전자의 발현량이 낮다면 FI형으로 결정할 수 있다. 다만, 면역조직화학염색에 의한 검사를 실시할 경우에는 클러스터 1 에서 ADAMTS4 및 ANKRD1 유전자를, 클러스터 2 에서 REG1A 를, 클러스터 3 에서 SIDT1 을 제외하여 발현 강도를 비교한다.
진행성 난소암의 유전자 발현양상을 통해 FS, FI, 또는 D형인지를 결정하면, 이를 기초로 직장구불결장에 전이된 종양의 제거방법을 선택하거나, 진행성 난소암의 예후, 예를 들면 재발 및 사망 위험을 예측하는데 도움을 줄 수 있다.

Claims (13)

  1. 직장구불결장에 종양이 있는 진행성 난소암 환자의 직장구불결장 종양 제거 방법 선택을 위한 정보를 제공하는 방법에 있어서,
    종양이 있는 직장구불결장의 길이를 측정하는 단계;
    점막층 및 점막하층에 종양 침투 여부를 확인하는 단계; 및
    종양이 발생한 직장구불결장의 길이가 18cm 이하이고, 점막층 및 점막하층에 종양이 침투하지 않으면 보존수술을 선택하고, 그 외에는 절제수술을 선택하는 단계를 포함하는,
    진행성 난소암 환자의 직장구불결장 종양 제거 방법 선택을 위한 정보를 제공하는 방법.
  2. 직장구불결장에 종양이 있는 진행성 난소암 환자의 예후를 예측하기 위한 정보를 제공하는 방법에 있어서,
    종양이 발생한 직장구불결장의 길이를 측정하는 단계;
    점막층 및 점막하층에 종양 침투 여부를 확인하는 단계; 및
    종양이 발생한 직장구불결장의 길이가 18cm 이하이고 점막층 및 점막하층에 종양이 침투하지 않으면 국소 분리형, 종양이 발생한 직장구불결장의 길이가 18cm 이하이고 점막층 및 점막하층에 종양이 침투하면 국소 분리불가형, 종양이 발생한 직장구불결장의 길이가 18cm 이상이면 확산형으로 분류하는 종양의 표현형 결정 단계를 포함하는,
    진행성 난소암 환자의 예후를 예측하기 위한 정보를 제공하는 방법.
  3. 제2항에 있어서,
    상기 종양의 표현형이 국소 분리형으로 분류되면 예후가 긍정적인 것으로 결정하는,
    진행성 난소암 환자의 예후를 예측하기 위한 정보를 제공하는 방법.
  4. 환자의 생물학적 시료로부터 RPL36, ANKRD1, IGFBP6, 및 ATOH8 유전자로 이루어진 군에서 선택된 어느 하나 이상의 mRNA 또는 단백질의 발현수준을 각각 검출할 수 있는 제제를 포함하는,
    진행성 난소암의 예후 예측용 조성물.
  5. 제4항에 있어서,
    REG1A, AMY1A, RELN, 및 DPEP3 유전자로 이루어진 군에서 선택된 어느 하나 이상의 mRNA 또는 단백질의 발현수준을 각각 검출할 수 있는 제제를 더 포함하는,
    진행성 난소암의 예후 예측용 조성물.
  6. 제4항에 있어서,
    BRCA2 및 SIDT1 유전자로 이루어진 군에서 선택된 어느 하나 이상의 mRNA 또는 단백질의 발현수준을 각각 검출할 수 있는 제제를 더 포함하는,
    진행성 난소암의 예후 예측용 조성물.
  7. 제4항에 있어서,
    RPS28 및 ADAMTS4 유전자로 이루어진 군에서 선택된 어느 하나 이상의 유전자의 mRNA 또는 단백질의 발현수준을 각각 검출할 수 있는 제제를 더 포함하는,
    진행성 난소암의 예후 예측용 조성물.
  8. 제4항에 있어서,
    상기 생물학적 시료는 종양 또는 혈액인,
    진행성 난소암의 예후 예측용 조성물.
  9. 제4항의 조성물; 및
    상기 측정된 발현수준과 비교하기 위한 진행성 난소암 환자의 참조값을 포함하는
    진행성 난소암의 예후 예측용 키트.
  10. 환자의 생물학적 시료를 준비하는 단계;
    상기 시료로부터 RPL36, ANKRD1, IGFBP6, 및 ATOH8 유전자로 이루어진 군에서 선택된 하나 이상의 mRNA 또는 단백질의 발현수준 또는 발현패턴 데이터를 확인하는 단계; 및
    상기 발현수준 또는 발현패턴을 예후가 알려진 진행성 난소암 환자의 참조값과 비교하는 단계를 포함하는,
    진행성 난소암의 예후를 예측하기 위한 정보를 제공하는 방법.
  11. 제10항에 있어서,
    상기 시료로부터 REG1A, AMY1A, RELN, 및 DPEP3 유전자로 이루어진 군에서 선택된 하나 이상의 mRNA 또는 단백질의 발현수준 또는 발현패턴 데이터를 확인하는 단계를 더 포함하는,
    진행성 난소암의 예후를 예측하기 위한 정보를 제공하는 방법.
  12. 제10항에 있어서,
    상기 시료로부터 BRCA2 및 SIDT1 유전자로 이루어진 군에서 선택된 하나 이상의 mRNA 또는 단백질의 발현수준 또는 발현패턴 데이터를 확인하는 단계를 더 포함하는,
    진행성 난소암의 예후를 예측하기 위한 정보를 제공하는 방법.
  13. 제10항에 있어서,
    상기 시료로부터 RPS28 및 ADAMTS4 유전자로 이루어진 군에서 선택된 하나 이상의 mRNA 또는 단백질의 발현수준 또는 발현패턴 데이터를 확인하는 단계를 더 포함하는,
    진행성 난소암의 예후를 예측하기 위한 정보를 제공하는 방법.
PCT/KR2022/008504 2021-06-15 2022-06-15 진행성 난소암의 예후를 예측하기 위한 종양 표현형 및 바이오마커 Ceased WO2022265409A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20210077448 2021-06-15
KR10-2021-0077448 2021-06-15

Publications (1)

Publication Number Publication Date
WO2022265409A1 true WO2022265409A1 (ko) 2022-12-22

Family

ID=84526666

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/008504 Ceased WO2022265409A1 (ko) 2021-06-15 2022-06-15 진행성 난소암의 예후를 예측하기 위한 종양 표현형 및 바이오마커

Country Status (2)

Country Link
KR (1) KR102886019B1 (ko)
WO (1) WO2022265409A1 (ko)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016049276A1 (en) * 2014-09-25 2016-03-31 Moffitt Genetics Corporation Prognostic tumor biomarkers

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016049276A1 (en) * 2014-09-25 2016-03-31 Moffitt Genetics Corporation Prognostic tumor biomarkers

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
CHEN JIANJUN, LUO YANG, ZHOU YONG, QIN SHAOLAN, QIU YIER, CUI RAN, YU MINHAO, QIN JUN, ZHONG MING: "Promotion of Tumor Growth by ADAMTS4 in Colorectal Cancer: Focused on Macrophages", CELLULAR PHYSIOLOGY AND BIOCHEMISTRY, KARGER BASEL, CH, vol. 46, no. 4, 1 January 2018 (2018-01-01), CH , pages 1693 - 1703, XP093015071, ISSN: 1015-8987, DOI: 10.1159/000489245 *
PARK SOO JIN, HEE SEUNG KIM, MD1 , JAE-WEON KIM, M: "628. Visceral segmental serosectomy during debulking surgery for advanced ovarian and fallopian tubal cancer.", GYNECOLOGIC ONCOLOGY., ACADEMIC PRESS, LONDON., GB, vol. 162, no. 1, 1 January 2021 (2021-01-01), GB , pages S331, XP093015112, ISSN: 0090-8258 *
PARK SOO JIN, KIM HEE SEUNG: "Surgical technique of visceral segmental serosectomy for advanced ovarian cancer", GLAND SURGERY, vol. 10, no. 3, 1 March 2021 (2021-03-01), pages 1276 - 1278, XP093015056, ISSN: 2227-684X, DOI: 10.21037/gs-2019-ursoc-03 *
PARK SOO JIN, MUN JAEHEE, LEE EUN JI, PARK SUNWOO, KIM SANG YOUN, LIM WHASUN, SONG GWONHWA, KIM JAE-WEON, LEE SEUNGMEE, KIM HEE SE: "Clinical Phenotypes of Tumors Invading the Rectosigmoid Colon Affecting the Extent of Debulking Surgery and Survival in Advanced Ovarian Cancer", FRONTIERS IN ONCOLOGY, FRONTIERS RESEARCH FOUNDATION, CH, vol. 11, 22 April 2021 (2021-04-22), CH , pages 1 - 9, XP093015125, ISSN: 2234-943X, DOI: 10.3389/fonc.2021.673631 *
PARK, S. J. et al. 480: Surgery for rectosigmoid peritonectomy in advanced ovarian cancer: surgical technique of visceral segmental serosectomy and 8-year experience. International Journal of Gynecological Cancer. 2020, vol. 30, Sppl. 3, p. A198. *
SIAVOSHI A, TAGHIZADEH M, DOOKHE E, PIRAN M: "Gene expression profiles and pathway enrichment analysis to identification of differentially expressed gene and signaling pathways in epithelial ovarian cancer based on high-throughput RNA-seq data", BIORXIV, 31 March 2019 (2019-03-31), pages 1 - 12, XP093015061, Retrieved from the Internet <URL:https://www.biorxiv.org/content/10.1101/566331v2.full.pdf> [retrieved on 20230118], DOI: 10.1101/566331 *
WANG XUE, LIN FEI-KAI, LI JIA-RUI, WANG HU-SHENG: " as Immune Infiltration Relevant Genes", ONCOTARGETS AND THERAPY, vol. Volume 13, pages 5617 - 5628, XP093015064, DOI: 10.2147/OTT.S254494 *
YANG FAN, GUO XIAOQING, YANG GONG, ROSEN DANIEL, LIU JINSONG: "AURKA and BRCA2 expression highly correlate with prognosis of endometrioid ovarian carcinoma", MODERN PATHOLOGY, NATURE PUBLISHING GROUP, GB, vol. 24, no. 6, 1 June 2011 (2011-06-01), GB , pages 836 - 845, XP009541925, ISSN: 0893-3952, DOI: 10.1038/modpathol.2011.44 *

Also Published As

Publication number Publication date
KR20220168179A (ko) 2022-12-22
KR102886019B1 (ko) 2025-11-21

Similar Documents

Publication Publication Date Title
Garraway et al. Trefoil factor 3 is overexpressed in human prostate cancer
WO2013104102A1 (zh) 乳腺癌诊断和预示的标志物
Yachida et al. Biological significance of KRAS mutant allele expression in ovarian endometriosis
Iwaya et al. Colitis-associated colorectal adenocarcinomas are frequently associated with non-intestinal mucin profiles and loss of SATB2 expression
KR20250007468A (ko) 기계학습 예측모델을 이용한 난소암 진단 방법 및 이를 적용하는 시스템
WO2017222221A1 (ko) 포타슘 채널 단백질을 이용한 암 진단용 조성물
CN104711341B (zh) Dlk1基因在制备胃肠道间质瘤诊断试剂中的应用
CN110187110A (zh) 一种贲门癌预后预测标志物及其应用
KR102328497B1 (ko) 자궁내막증 진단용 조성물 및 이를 이용한 자궁내막증 진단방법
US20120135877A1 (en) DNA Methylation Markers For Prostate Cancer Field Defect
WO2009131365A2 (ko) 위암 진단 마커로서의 ｃst1, ｄcc1, ifitm1 또는 ｍelk
US20210404018A1 (en) Unbiased dna methylation markers define an extensive field defect in histologically normal prostate tissues associated with prostate cancer: new biomarkers for men with prostate cancer
Shariat et al. Urinary levels of soluble e-cadherin in the detection of transitional cell carcinoma of the urinary bladder
WO2011081421A9 (en) Complement c9 as markers for the diagnosis of cancer
WO2022265409A1 (ko) 진행성 난소암의 예후를 예측하기 위한 종양 표현형 및 바이오마커
Sugimoto et al. DNA methylation genome-wide analysis in remnant and primary gastric cancers
WO2022270926A1 (ko) 다양한 암의 진단, 전이 또는 예후 예측용 신규한 바이오마커 및 이의 용도
US20230203593A1 (en) Method for carrying out in vitro molecular diagnosis of ovarian tumor and kit
WO2024085495A1 (ko) 엑소좀 유래의 대장암 진단용 바이오 마커 및 이의 용도
ES2820732T3 (es) Marcadores de metilación de ADN no sesgados que definen un defecto de campo amplio en tejidos de próstata histológicamente normales asociados al cáncer de próstata: nuevos biomarcadores para hombres con cáncer de próstata
Soliman et al. Endometrial cancer associated with defective DNA mismatch repair
WO2009131366A2 (ko) 위암 또는 대장암 진단 마커 및 치료제로서의 ｃdca5
WO2021045456A1 (ko) 난소암에 대한 정보 제공 방법 및 이를 이용한 키트
WO2024225769A1 (ko) 간암 진단용 신규 혈액 바이오마커 gulp1 및 이의 용도
US20240344133A1 (en) A method of predicting risk of an aggressive or recurrent cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22825332

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22825332

Country of ref document: EP

Kind code of ref document: A1