WO2022261296A1 - Compounds that bind non-canonical g-quadruplex structures and methods of making and using the same - Google Patents
Compounds that bind non-canonical g-quadruplex structures and methods of making and using the same Download PDFInfo
- Publication number
- WO2022261296A1 WO2022261296A1 PCT/US2022/032798 US2022032798W WO2022261296A1 WO 2022261296 A1 WO2022261296 A1 WO 2022261296A1 US 2022032798 W US2022032798 W US 2022032798W WO 2022261296 A1 WO2022261296 A1 WO 2022261296A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- compound
- pyridazin
- methoxyphenyl
- oxadiazol
- aliphatic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
- C07D413/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
- C07D413/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings directly linked by a ring-member-to-ring-member bond
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/50—Pyridazines; Hydrogenated pyridazines
- A61K31/501—Pyridazines; Hydrogenated pyridazines not condensed and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
- A61K31/5375—1,4-Oxazines, e.g. morpholine
- A61K31/5377—1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/55—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D413/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
- C07D413/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing three or more hetero rings
Definitions
- FIELD This disclosure relates to compounds that selectively bind to non-canonical G-quadruplex DNA structures found in certain genes, as well as methods of using the compounds to reduce or inhibit expression of such genes in cells, such as cancer cells.
- BACKGROUND The MYC family of genes encode transcription factors that broadly govern and amplify gene expression. Three Myc proteins, c-Myc, N-Myc, and l-Myc, contain basic helix-loop-helix (bHLH) regions that bind to DNA and directly regulate transcription. Among these genes, MYCN has been shown to be involved in fetal development and is highly expressed in neural tissue.
- MYCN is often overexpressed or mutated in cancers and is considered an oncogene in cancers, such as neuroblastoma and small cell lung cancers.
- Embedded within the MYCN locus is a second transcript that is produced through antisense transcription and originally called ncym, which was shown to be imbedded within a longer noncoding RNA (lncRNA) called MYCN opposite-strand (MYCNOS).
- lncRNA noncoding RNA
- MYCNOS MYCN opposite-strand
- Expression of MYCNOS has been shown to decrease promoter occupancy of MYCN and to control MYCN transcript stability through sequence complementarity. More recent studies have shown that NCYM, the variant 2 of the MYCNOS transcript, can also be translated to produce a small protein.
- NCYM This polypeptide, known as NCYM, has been characterized to have diverse regulatory activities, including controlling the stability of N-Myc protein, inhibiting GSK3 ⁇ , and influencing Wnt/ ⁇ catenin signaling. Molecules that control or inhibit the N-Myc protein and other proteins involved in cancers are of interest as anticancer agents; however, as a transcription factor, the N-Myc protein is classically considered “undruggable” and attempts to develop ligands that target N-Myc itself, and other undruggable proteins (particularly those, that like N-Myc, comprise G-quadruplexes or “G4s”), have not been successful.
- SUMMARY A new class of small molecule compounds that target non-canonical G4 structures, such as hairpin- containing G4s found in the MYCN gene, are described herein.
- the compounds are useful, for example, in methods of reducing or inhibiting N-Myc expression in cells (such as cancer cells), as well as in methods of treating or preventing a cancer in a subject, where the cancer is characterized at least in part by N-Myc overexpression.
- X 1 , X 2 , and X 3 independently is N or O;
- R 1 is -(linker)t-R b wherein R b is aromatic, heteroaliphatic, or aliphatic; the linker is an aliphatic or heteroaliphatic group; and t is 0 or 1;
- R 2 is H or aliphatic; each R 3 independently is heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo;
- x is an integer selected from 0 to 5; and provided that the compound is not 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1- yl)propyl)pyridazin-3-amine, N-(3-([1,4'-bipiperidin]
- ring A is a 5-membered heteroaryl ring other than thiophenyl, thiazolyl, furanyl, triazolyl, thiadiazolyl, and 1,3,4-oxadiazolyl
- ring B is a 6-membered heteroaryl ring containing at least two nitrogen atoms
- R 1 is -(linker)t-R b wherein R b is aromatic, heteroaliphatic, or aliphatic; the linker is an aliphatic or heteroaliphatic group; and t is 0 or 1
- R 2 is H or aliphatic; each R 3 independently is heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; each R 4 independently is H, aliphatic, or halo;
- x is an integer selected from 0 to 5; and n is an integer selected
- the compound, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof has a structure according to Formula I: Formula I wherein ring A is a 5-membered heteroaryl ring; ring B is a 6-membered heteroaryl ring containing at least two nitrogen atoms; R 1 is –(CR a 2 ) m -R b where each R a independently is H, alkyl, or halo, m is 1, 2, 3, 4, or 5, and R b is a nitrogen-containing group; R 2 is H or alkyl; each R 3 independently is alkoxy, hydroxy, aliphatic, or halo; each R 4 independently is H, alkyl, or halo; n is 0, 1, 2, or 3; and x is 0, 1, 2, 3, 4, or 5, with the proviso that the compound does not comprise the structure set forth as any one of MY-1, MY-2, MY-10, MY-11, or MY-12.
- the compound, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof has a structure according to Formula I: Formula I wherein ring A is a 5-membered heteroaryl ring; ring B is a 6-membered heteroaryl ring containing at least two nitrogen atoms; R 1 is -(CR a 2)m-R b or -[(CR a 2)mO]r-(CH2)s-R b , wherein each R a independently is H, aliphatic, or halo; t is 1, 2, 3, 4, or 5; r is 1, 2, 3, 4, or 5; s is 0 or 1; and R b is an acridinyl group; R 2 is H or aliphatic; each R 3 independently is heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; each R 4 independently is H, aliphatic, or halo; x is an integer selected from 0 to 5;
- a pharmaceutical composition comprising a compound according to the present disclosure and at least one pharmaceutically acceptable additive. Also disclosed is a method of decreasing cancer-relevant protein expression in a cell, comprising contacting the cell with an effective amount of a compound, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, according to the present disclosure. And, use of a compound or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, according to the present disclosure for decreasing N-Myc expression in a cell, comprising contacting the cell with an effective amount of the compound is disclosed. In some implementations, the use is for treating or preventing cancer in a subject.
- FIG.1 is a table describing five G-quadruplex sequences used for binding selectivity profiling as discussed herein, wherein all the DNA/RNA oligos were labeled with Cy5 fluorescent dye at 5′ ends and guanines that were involved in G4-formation are underlined.
- FIG.2 is a table describing MYCN wild-type/mutated/truncated G4 sequences.
- FIG.3 shows the location of the G4 forming sequence in the MYCN gene.
- FIG.4 is a map showing MYCN G4 forming probability obtained by genome-wide G4-sequence analysis.
- FIGS.5A and 5B show results of Quadruplex Forming G-Rich Sequence (or QGRS) analysis of the G-quadruplex forming sequences in MYCN/MYCNOS, wherein FIG.5A show the G4-forming sequence (a target of interest) in MYCNOS discovered by G4-seq technology and FIG.5B shows G-scores of potential G4s in this region.
- QGRS Quadruplex Forming G-Rich Sequence
- FIG.6 shows four hit compounds identified using small molecule microarray (SMM) screening.
- FIG.7 shows fluorescence intensity assay results for 14 hit compounds from the SMM (100 ⁇ M in 5% DMSO) and a negative control (compound 15), along with structures for four particular compounds, including compounds 1, 2, and 5, and compound MY-1.
- FIG.8 shows surface plasmon resonance results for the compounds of FIG.7.
- FIG.9 shows binding affinity measurements by the fluorescence intensity assay for compounds 1, 2, MY-1, and 5.
- FIG.10 shows binding affinity measurements by surface plasmon resonance for compounds 1, 2, MY-1, and 5.
- FIGS.11A-11D show MYCN G4 structure stabilization by small molecule and binding selectivity evaluations, wherein FIG.11A is circular dichroism (CD) spectra of MYCN G4 DNA in different buffers (10 mM Tris containing 100 mM KCl or 100 mM LiCl) and in water; FIG.11B is a CD curve recording of 5 ⁇ M MYCN G4 during melting in low KCl buffer (10 mM Tris, pH 7.0, 5 mM KCl); FIG.11C shows MYCN G4 melting with/without compounds 1 or MY-1; FIG.11D shows CD melting tests of dsDNA incubated with compounds 1 or MY-1.
- CD circular dichroism
- FIG.12 shows CD spectra of MYCN G4 after annealing in buffers containing 10 mM Tris, pH 7.0, and 100, 20, or 5 mM KCl.
- FIGS.13A and 13B show the binding selectivity profiles of compounds 1 (FIG.13A) and MY-1 (FIG.13B) using tRNA, wherein a 2-aminopurine fluorescence assay was carried out by titrating the compounds into MYCN G4 DNA with the absence/presence of 10 ⁇ tRNA.
- FIGS.14A-14E are graphs showing binding affinity of compound 1 with six different G4 targets, wherein all of the DNA/RNA G4 oligomers were labeled with fluorophore at 5′ and titration curves were obtained by a fluorescence intensity assay.
- FIGS.15A-15E are graphs showing binding affinity of compound MY-1 with six different G4 targets, wherein all of the DNA/RNA G4 oligomers were labeled with fluorophore at 5′ and titration curves were obtained by a fluorescence intensity assay.
- FIGS.16A-16E are quality control graphs of G4s used in selectivity evaluations described herein, wherein all G4s were tested by a fluorescence intensity assay using a classical G4 binder, TMPyP4 (100 ⁇ M), as a positive control.
- FIG.17 is an SPR curve of a competitive binding study between compounds 1 and MY-1.
- FIGS.18A and 18B illustrate results of a competitive assay of compounds 1 and MY-1, wherein FIG.18A is an SPR curve of continuous injection of compounds 1 and MY-1, and FIG.18B shows the binding level of compound MY-1 after injecting different concentrations of compound 1.
- FIGS.19A and 19B show results of an SPR binding assay of TMPyP4 with and without compound MY-1 at concentrations of 50 ⁇ M (FIG.19A) and 250 ⁇ M (FIG.19B).
- FIGS.20A and 20B include a CD melting curve of G4 stabilized by an individual compound (MY- 1) or compound mixture (1 and MY-1) (FIG.20A) and the melting temperature of MYCN G4 stabilized by the compound combination (FIG.20B).
- FIG.21 is a graph showing the stoichiometry of compound MY-1 binding with MYCN G4 determined by Job Plot analysis.
- FIG.22 is a graph showing fluorescence titration of compound MY-1 using 3′-Cy5-labeled MYCN G4 DNA.
- FIGS.23A and 23B summarize results of an microscale thermophoresis (MST) study on compound MY-1 binding with 3′Cy5-MYCN G4.
- FIGS.24A-24F show results from a binding site evaluation using fluorescence quenching-based methods and dimethylsulfate (DMS) footprinting, wherein FIG.24A is a schematic prediction of the MYCIN G4 folded structure; FIG.24B is a quenching study by adding 100 ⁇ M MY-1 into solutions of 5′/3′-Cy5 labeled MYCN G4s; FIG.24C is a quenching study by adding 100 ⁇ M MY-1 into solutions of 2-AP MYCN G4s labeled at A11, A18 and A24 positions, respectively; FIG.24D shows fluorescence titration using wild type/mutated/truncated MYCN G4 DNA samples with 5′-Cy5 labeling – fluorescence intensities during titration were recorded and KD values were calculated by fitting the curves; FIG.24E is a fluorescence replacement assay using minor groove binders (Hoechst 33258 and netropsin); and FIG.24F shows the
- FIGS.25A-25C show quenching fraction determination by 2-AP modification-based titrations, wherein DNA oligomers with 2-AP labeling at the A11 (FIG.25A), A18 (FIG.25B), or A24 (FIG.25C) positions were titrated with a series of concentrations of compound MY-1.
- FIGS.26A-26N show the results of binding assays performed with 14 different compounds of the present disclosure using SPR.
- FIGS.27A-27N show the results of binding assays performed with 14 different compounds of the present disclosure using 2-AP labeled DNA at the A11 position.
- FIGS.28A-28G show the effects of compound MY-8 on MYCN/MYCNOS expression in NBEB cells, wherein FIG.28A is images of cell confluency after treatment with the compound at different concentrations; FIG.28B shows time-dependent cell confluence curves at the different concentrations; FIG. 28C is an MTS assay analysis of cell viability; FIGS.28D-28F are graphs of MYCN (FIG.28D), MYCNOS001 (FIG.28E), and MYCNOS002 (FIG.28F) mRNA expression after MY-8 treatments; and FIG. 28G is a Western blot showing MYCN levels after MY-8 treatments.
- FIG.29 is a table summarizing representative hairpin G4 sequences in cancer-relevant genes.
- FIG.30 is a schematic diagram showing binding activity of a bivalent compound (compound B33) comprising a non-canonical G4-binding component and a G4-stacker component.
- FIGS.31A and 31B are graphs of surface plasmon resonance response as a function of time (FIG. 31A) and concentration (FIG.31B) showing MYCN hairpin G4 binding affinity for acridine ICR 191.
- FIGS.32A and 32B are graphs of surface plasmon resonance response as a function of time (FIG.
- FIGS.33A and 33B are graphs of surface plasmon resonance response as a function of time showing dsDNA binding affinity of acridine ICR 191 (FIG.33A) and a bivalent compound according to the present disclosure (compound B33) (FIG.33B).
- FIGS.34A and 34B are graphs of fluorescent intensity as a function of DNA concentration showing dsDNA binding affinity of acridine ICR 191 (FIG.34A) and a bivalent compound according to the present disclosure (compound B33) (FIG.34B) using FIA.
- FIGS.35A-35F show results of binding selectivity profiling using a G4 microarray and three different compounds, including a bivalent compound according to the present disclosure (compound B33), thiazole orange, and amsacrine; wherein FIGS.35A, 35C, and 35E are optical images showing fluorescence observed with the bivalent compound, thiazole orange, and amsacrine, respectively, and different targets; and FIGS.35B, 35D, and 35F are bar graphs showing the fluorescence intensity values for the binding selectivity of the bivalent compound, thiazole orange, and amsacrine, respectively, and the different targets.
- a bivalent compound according to the present disclosure compound B33
- FIGS.35A, 35C, and 35E are optical images showing fluorescence observed with the bivalent compound, thiazole orange, and amsacrine, respectively, and different targets
- FIGS.35B, 35D, and 35F are bar graphs showing the fluorescence intensity values for the binding selectivity of the
- FIG.36 is a spectrum of obtained using circular dichroism spectroscopy, which shows results of a thermal melting assay of MYCN G4 DNA exposed to a control (DMSO), acridine ICR, and a bivalent compound according to the present disclosure (compound B33).
- FIGS.37A-37G are images of results obtained from binding selectivity profile testing of a bivalent compound of the present disclosure (compound B33) and thiazole orange using a high-density DNA oligo microarray, wherein FIG.37A is an optical image showing fluorescence observed with these two different compounds; FIG.37B is a kernel density estimate (KDE) plot and FIG.37C is a violin plot representing the distribution of the binding signals throughout the microarray; FIGS.37D and 37E provide plots summarizing the binding behavior of the two compounds; and FIGS.37F (thiazole orange) and 37G (bivalent compound) are graphs providing the Gini coefficients for the two different compounds.
- KDE kernel density estimate
- FIGS.38A and 38B provide a DMS footprint of MYCN G4 DNA with and without a bivalent compound (compound B33) (FIG.38A) and a proposed folded structure of the hairpin-containing G4 (FIG. 38B).
- FIGS.39A and 39B are FIA graphs of results for binding a bivalent compound (compound B33) to MYCN G4s with an unwound hairpin (FIG.39A) and a truncated hairpin (FIG.39B).
- FIG.40 is a graph of SPR response as a function of time for binding of a bivalent compound (compound B33) to MANGO II RNA G4, wherein weak binding was observed.
- FIGS.41A and 41B show results of a binding mode evaluation of a bivalent compound (compound B33) and a hairpin G4 having a parallel structure (BCL2).
- FIGS.42A and 42B show results of a binding mode evaluation of a bivalent compound (compound B33) and a hairpin G4 having a (3+1) hybrid structure (HIV).
- FIGS.43A and 43B show results of a binding mode evaluation of a bivalent compound (compound B33) and a hairpin G4 having a (3+1) hybrid structure (PIM1-form 1).
- FIGS.44A and 44B show results of a binding mode evaluation of a bivalent compound (compound B33) and a hairpin G4 having a (2+2) chair-type structure (PIM1-form 2).
- FIG.45 shows a summary of MYCN HP-G4 binding activity results (as assessed using FIA and SPR) for different bivalent compounds (B32, B33, B34, B35, and B38) having different linker groups.
- FIGS.46A-46D are graphs of FIA results for different bivalent compounds (B32, B33, B34, B35, and B38) having different linker groups.
- FIGS.47A-47H are graphs of SPR results for different bivalent compounds (B32, B33, B34, B35, and B38) having different linker groups.
- FIGS.48A and 48B are graphs of SPR results for amsacrine.
- FIGS.49A and 49B are graphs of SPR results for a bivalent compound (B32) (FIG.49A) and amsacrine (FIG.49B) with dsDNA.
- SEQUENCES The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. ⁇ 1.822.
- SEQ ID NO: 1 is an exemplary genomic DNA sequence encoding human MYCN.
- SEQ ID NOs: 2-6 are exemplary nucleic acid sequences of G-quadruplex oligonucleotides for BCL2, KRAS, mTOR, NRAS, and telomeric DNA, respectively.
- SEQ ID NO: 7 is an exemplary MYCN G4 wild-type oligonucleotide.
- SEQ ID NO: 8 is an exemplary MYCN G4 mutated oligonucleotide.
- SEQ ID NO: 9 is an exemplary MYCN G4 truncated oligonucleotide.
- SEQ ID NO: 10 is an exemplary nucleic acid sequence of a primer for the sense strand of MYCNOs-01.
- SEQ ID NO: 11 is an exemplary nucleic acid sequence of a primer for the antisense strand of MYCNOs-01.
- SEQ ID NO: 12 is an exemplary nucleic acid sequence of a primer for the sense strand of MYCNOs-02.
- SEQ ID NO: 13 is an exemplary nucleic acid sequence of a primer for the antisense strand of MYCNOs-02.
- SEQ ID NO: 14 is an exemplary nucleic acid sequence of a primer for the sense strand of MYCN protein isoform 1.
- SEQ ID NO: 15 is an exemplary nucleic acid sequence of a primer for the antisense strand of MYCN protein isoform 1.
- SEQ ID NO: 16 is an exemplary nucleic acid sequence of a primer for the sense strand of MYCN protein isoform 2.
- SEQ ID NO: 17 is an exemplary nucleic acid sequence of a primer for the antisense strand of MYCN protein isoform 2.
- SEQ ID NO: 18 is an exemplary nucleic acid sequence of a MYCN G4 quadruplex forming sequence.
- SEQ ID NO: 19 is an exemplary nucleic acid sequence of the G4-forming sequence in MYCNOS.
- SEQ ID NOs: 20-23 are exemplary nucleic acid sequences of potential G4s in MYCNOS.
- SEQ ID NOs: 24-30 are exemplary nucleic acid sequences of hairpin G4 sequences in FOXA3, KRAS, MYCL, BRD4, BCL2, LINC01018, and SOX12, respectively.
- SEQ ID NO: 31 is an exemplary hTERT G4 oligonucleotide.
- SEQ ID NO: 32 is an exemplary BCL2 G4 oligonucleotide.
- SEQ ID NO: 33 is an exemplary RB1 G4 oligonucleotide.
- SEQ ID NO: 34 is an exemplary VEGF G4 oligonucleotide.
- SEQ ID NO: 35 is an exemplary c-MYC G4 oligonucleotide.
- SEQ ID NO: 36 is an exemplary c-KIT G4 oligonucleotide.
- SEQ ID NO: 37 is an exemplary dsDNA oligonucleotide.
- SEQ ID NO: 38 is an exemplary HIF1-a G4 oligonucleotide.
- SEQ ID NO: 39 is an exemplary ssDNA oligonucleotide.
- SEQ ID NO: 40 is an exemplary genomic DNA sequence encoding human MYCNOS. DETAILED DESCRIPTION I. Definitions and Abbreviations The following explanations of terms and abbreviations are provided to better describe the present disclosure and to guide those of ordinary skill in the art in the practice of the present disclosure. As used herein, “comprising” means “including” and the singular forms “a” or “an” or “the” include plural references unless the context clearly dictates otherwise. The term “or” refers to a single element of stated alternative elements or a combination of two or more elements, unless the context clearly indicates otherwise.
- Any functional group disclosed herein and/or defined above can be substituted or unsubstituted, unless otherwise indicated herein. Definitions of common terms in chemistry may be found in Richard J. Lewis, Sr. (ed.), Hawley’s Condensed Chemical Dictionary, published by John Wiley & Sons, Inc., 2016 (ISBN 978-1-118-13515-0).
- the presently disclosed compounds also include all isotopes of atoms present in the compounds, which can include, but are not limited to, deuterium, tritium, 18 F, 14 C, etc.
- a person of ordinary skill in the art will appreciate that compounds may exhibit the phenomena of tautomerism, conformational isomerism, geometric isomerism, and/or optical isomerism.
- certain disclosed compounds can include one or more chiral centers and/or double bonds and as a consequence can exist as stereoisomers, such as double-bond isomers (i.e., geometric isomers), enantiomers, diastereomers, and mixtures thereof, such as racemic mixtures.
- certain disclosed compounds can exist in several tautomeric forms, including the enol form, the keto form, and mixtures thereof.
- any or all hydrogens present in the compound, or in a particular group or moiety within the compound may be replaced by a deuterium or a tritium.
- a recitation of alkyl includes deuterated alkyl, where from one to the maximum number of hydrogens present may be replaced by deuterium.
- methyl refers to both CH3 or CH3 wherein from 1 to 3 hydrogens are replaced by deuterium, such as in CDxH3-x.
- substituted refers to all subsequent modifiers in a term, for example in the term “substituted aliphatic-aromatic,” substitution may occur on the “aliphatic” portion, the “aromatic” portion or both portions of the aliphatic-aromatic group. “Substituted,” when used to modify a specified group or moiety, means that at least one, and perhaps two or more, hydrogen atoms of the specified group or moiety is independently replaced with the same or different substituent groups.
- a group, moiety, or substituent may be substituted or unsubstituted, unless expressly defined as either “unsubstituted” or “substituted.” Accordingly, any of the functional groups specified herein may be unsubstituted or substituted unless the context indicates otherwise or a particular structural formula precludes substitution. In particular implementations, a substituent may or may not be expressly defined as substituted but is still contemplated to be optionally substituted. For example, an “aliphatic” or a “cyclic” moiety may be unsubstituted or substituted, but an “unsubstituted aliphatic” or an “unsubstituted cyclic” is not substituted.
- a group that is substituted has at least one substituent up to the number of substituents possible for a particular moiety, such as 1 substituent, 2 substituents, 3 substituents, or 4 substituents.
- Any group or moiety defined herein can be connected to any other portion of a disclosed structure, such as a parent or core structure, as would be understood by a person of ordinary skill in the art, such as by considering valence rules, comparison to exemplary species, and/or considering functionality, unless the connectivity of the group or moiety to the other portion of the structure is expressly stated, or is implied by context.
- Acyl Halide -C(O)X, wherein X is a halogen, such as Br, F, I, or Cl.
- Administration To provide or give to a subject an agent, for example, a compound (e.g., a small compound) that selectively binds to a non-canonical G4, such as a non-canonical G4 of MYCN (encoding N- Myc), by any effective route.
- administration can comprise providing or giving to a subject an agent, for example, a small molecule compound that selectively binds to G4 quadruplex DNA in the c-MYC promoter, by any effective route.
- Exemplary routes of administration include, but are not limited to, oral, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, and intravenous), sublingual, rectal, transdermal (for example, topical), intranasal, vaginal, and inhalation routes.
- Co-administration or co-administering refers to administration of at least two therapeutic compounds within the same general time period, and does not require administration at the same exact moment in time (although co-administration is inclusive of administering at the same exact moment in time). Thus, co-administration may be on the same day or on different days, or in the same week or in different weeks.
- the therapeutic compounds disclosed herein may be included in the same composition or they may each individually be included in separate compositions.
- the two compounds may be administered during a time frame wherein their respective periods of biological activity overlap.
- administering should be understood to mean providing a compound, a prodrug of a compound, or a pharmaceutical composition as described herein.
- the compound or composition can be administered by another person to the subject (e.g., intravenously) or it can be self- administered by the subject (e.g., tablets).
- Agent Any substance or any combination of substances that is useful for achieving an end or result; for example, a substance or combination of substances useful for decreasing or reducing tumor growth in a subject. Agents include effector molecules and detectable markers.
- the agent is a chemotherapeutic agent.
- chemotherapeutic agent The skilled artisan will understand that particular agents may be useful to achieve more than one result; for example, an agent may be useful as both a detectable marker and a chemotherapeutic agent.
- Aliphatic A hydrocarbon group (e.g., a substantially hydrocarbon-based compound) having at least one carbon atom to 50 carbon atoms (C1-50), such as one to 25 carbon atoms (C1-25), or one to ten carbon atoms (C1-10), or one to six carbon atoms (C1-6), or one to four carbon atoms (C1-4), and which includes alkanes (or alkyl), alkenes (or alkenyl), alkynes (or alkynyl), including cyclic versions thereof, and further including straight- and branched-chain arrangements, and all stereo and position isomers as well.
- C1-50 carbon atom to 50 carbon atoms
- C1-25 such as one to 25 carbon atoms (C1-25), or one to ten carbon atoms (C1-10), or one to six carbon atoms (C1-6), or one to four carbon atoms (C1-4)
- alkanes or alkyl
- alkenes or alkenyl
- Aliphatic groups may be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- substituents include, but are not limited to, alkyl, alkenyl, alkynyl, alkoxy, alkylamino, alkylthio, acyl, aldehyde, amide, amino, aminoalkyl, aryl, arylalkyl, carboxyl, cyano, cycloalkyl, dialkylamino, halo, haloaliphatic, heteroaliphatic, heteroaryl, heterocycloaliphatic, hydroxyl, oxo, sulfonamide, sulfhydryl, thioalkoxy, or other functionality.
- Alkenyl An unsaturated monovalent hydrocarbon having at least two carbon atom to 50 carbon atoms (C 2-50 ), such as two to 25 carbon atoms (C 2-25 ), or two to ten carbon atoms (C 2-10 ), and at least one carbon-carbon double bond, wherein the unsaturated monovalent hydrocarbon can be derived from removing one hydrogen atom from one carbon atom of a parent alkene.
- An alkenyl group can be branched, straight-chain, cyclic (e.g., cycloalkenyl), cis, or trans (e.g., E or Z).
- Alkenyl groups may be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Alkoxy -O-aliphatic, such as -O-alkyl, -O-alkenyl, -O-alkynyl; with exemplary implementations including, but not limited to, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, i-butoxy, t-butoxy, sec-butoxy, n-pentoxy, cyclopropoxy, cyclohexyloxy, and the like (wherein any of the aliphatic components of such groups can comprise no double or triple bonds, or can comprise one or more double and/or triple bonds).
- Alkoxy groups may be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Alkyl A saturated monovalent hydrocarbon having at least one carbon atom to 50 carbon atoms (C1-50), such as one to 25 carbon atoms (C1-25), or one to ten carbon atoms (C1-10), wherein the saturated monovalent hydrocarbon can be derived from removing one hydrogen atom from one carbon atom of a parent compound (e.g., alkane).
- An alkyl group can be branched, straight-chain, or cyclic (e.g., cycloalkyl).
- Alkyl groups may be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- a lower alkyl or (C1-C6)alkyl can be methyl, ethyl, propyl, isopropyl, butyl, iso-butyl, sec- butyl, pentyl, 3-pentyl, or hexyl;
- (C3-C6)cycloalkyl can be cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl;
- (C 3 -C 6 )cycloalkyl(C 1 -C 6 )alkyl can be cyclopropylmethyl, cyclobutylmethyl, cyclopentylmethyl, cyclohexylmethyl, 2-cyclopropylethyl, 2-cyclobutylethy
- Alkynyl An unsaturated monovalent hydrocarbon having at least two carbon atom to 50 carbon atoms (C 2-50 ), such as two to 25 carbon atoms (C 2-25 ), or two to ten carbon atoms (C 2-10 ), and at least one carbon-carbon triple bond, wherein the unsaturated monovalent hydrocarbon can be derived from removing one hydrogen atom from one carbon atom of a parent alkyne.
- An alkynyl group can be branched, straight- chain, or cyclic (e.g., cycloalkynyl).
- Alkenyl groups may be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- R e and R f independently is selected from hydrogen, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group, and can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Analog A molecule that differs in chemical structure from a parent compound, for example a homolog (differing by an increment in the chemical structure or mass, such as a difference in the length of an alkyl chain or the inclusion of one of more isotopes), a molecular fragment, a structure that differs by one or more functional groups, or a change in ionization.
- An analog is not necessarily synthesized from the parent compound.
- a derivative is a molecule derived from the base structure.
- Aromatic A cyclic, conjugated group or moiety of, unless specified otherwise, from 5 to 15 ring atoms having a single ring (e.g., phenyl) or multiple condensed rings in which at least one ring is aromatic (e.g., naphthyl, indolyl, or pyrazolopyridinyl); that is, at least one ring, and optionally multiple condensed rings, have a continuous, delocalized ⁇ -electron system.
- the number of out of plane ⁇ -electrons corresponds to the Hückel rule (4n + 2).
- the point of attachment to the parent structure typically is through an aromatic portion of the condensed ring system. For example, .
- context or express disclosure may indicate that the point of attachment is through a non-aromatic portion of the condensed ring system.
- An aromatic group or moiety may comprise only carbon atoms in the ring, such as in an aryl group or moiety, or it may comprise one or more ring carbon atoms and one or more ring heteroatoms comprising a lone pair of electrons (e.g. S, O, N, P, or Si), such as in a heteroaryl group or moiety.
- Aromatic groups may be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Aryl An aromatic carbocyclic group comprising at least five carbon atoms, and in some implementations having at least five carbon atoms to 15 carbon atoms (C 5 -C 15 ), such as five to ten carbon atoms (C5-C10), having a single ring or multiple condensed rings, which condensed rings can or may not be aromatic provided that the point of attachment to a remaining position of the compounds disclosed herein is through an atom of the aromatic carbocyclic group.
- Aryl groups may be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- the aryl group can be substituted with one or more groups including, but not limited to, alkyl, alkynyl, alkenyl, aryl, halide, nitro, amino, ester, ketone, aldehyde, hydroxy, carboxylic acid, or alkoxy.
- Aroxy -O-aromatic.
- Aroxy groups may be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Azo groups may be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Cancer A malignant tumor that has undergone characteristic anaplasia with loss of differentiation, increase rate of growth, invasion of surrounding tissue, and is capable of metastasis.
- thyroid cancer is a malignant tumor that arises in or from thyroid tissue
- breast cancer is a malignant tumor that arises in or from breast tissue (such as a ductal carcinoma).
- Residual cancer is cancer that remains in a subject after any form of treatment given to the subject to reduce or eradicate the cancer.
- Metastatic cancer is a tumor at one or more sites in the body other than the site of origin of the original (primary) cancer from which the metastatic cancer is derived. Cancer includes, but is not limited to, solid tumors.
- Carbamate -OC(O)NR e R f , wherein each of R e and R f independently is selected from hydrogen, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Carbamate groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Carbonate: -OC(O)OR d wherein R d is selected from aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Carbonate groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- R d can be hydrogen.
- Carboxylate -C(O)O- or salts thereof, wherein the negative charge of the carboxylate group may be balanced with an M + counterion, wherein M + may be an alkali ion, such as K + , Na + , Li + ; an ammonium ion, such as + N(R e )4 where R e is H, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, or aromatic; or an alkaline earth ion, such as [Ca 2+ ]0.5, [Mg 2+ ]0.5, or [Ba 2+ ]0.5.
- Chemotherapeutic agent Any chemical agent with therapeutic usefulness in the treatment of diseases characterized by abnormal cell growth.
- chemotherapeutic agents are useful for the treatment of neuroblastoma.
- additional therapeutic agents include microtubule binding agents, DNA intercalators or cross-linkers, DNA synthesis inhibitors, DNA and RNA transcription inhibitors, antibodies, enzymes, enzyme inhibitors, gene regulators, and angiogenesis inhibitors.
- a chemotherapeutic agent is a radioactive compound.
- chemotherapeutic agent of use see for example, Slapak and Kufe, Principles of Cancer Therapy, Chapter 86 in Harrison's Principles of Internal Medicine, 14th edition; Perry et al., Chemotherapy, Ch.17 in Abeloff, Clinical Oncology 2 nd ed., ⁇ 2000 Churchill Livingstone, Inc; Baltzer, L., Berkery, R. (eds): Oncology Pocket Guide to Chemotherapy, 2nd ed. St. Louis, Mosby-Year Book, 1995; Fischer, D.S., Knobf, M.F., Durivage, H.J. (eds): The Cancer Chemotherapy Handbook, 4th ed. St.
- Control A sample or standard used for comparison with an experimental sample.
- the control is a sample obtained from a healthy patient or a non-tumor tissue sample obtained from a patient diagnosed with cancer.
- the control is a tumor tissue sample obtained from a patient diagnosed with cancer.
- control is a tumor tissue sample obtained from a patient diagnosed with cancer, where the patient has not received treatment with a G4 stabilizing agent as disclosed herein.
- control is a historical control or standard reference value or range of values (such as a previously tested control sample, such as a group of cancer patients with known prognosis or outcome, or group of samples that represent baseline or normal values, such as the expression level of the MYCN or MYC gene in a non-tumor tissue).
- Cyano -CN. Decrease or Reduce: To reduce the quality, amount, or strength of something; for example a reduction in tumor burden.
- a therapy reduces a tumor (such as the size of a tumor, the number of tumors, the metastasis of a tumor, or combinations thereof), or one or more symptoms associated with a tumor, for example as compared to the response in the absence of the therapy.
- a therapy decreases the size of a tumor, the number of tumors, the metastasis of a tumor, or combinations thereof, subsequent to the therapy, such as a decrease of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. Such decreases can be measured using the methods disclosed herein.
- Determining or detecting the level of expression of a gene product Detection of a level of expression in either a qualitative or quantitative manner, for example by detecting nucleic acid molecules or proteins, for instance using routine methods known in the art. Diagnosis: The process of identifying a disease by its signs, symptoms and results of various tests. The conclusion reached through that process is also called “a diagnosis.” Forms of testing commonly performed include blood tests, medical imaging, urinalysis, and biopsy. Disulfide: -SSR d , wherein R d is selected from hydrogen, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Disulfide groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Dithiocarboxylic groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Ester -C(O)OR d or -OC(O)R d , wherein R d is selected from aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- R d is selected from aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- CO2C1-3alkyl groups are preferred, such as for example, methylester (CO2Me), ethylester (CO2Et), and propylester (CO2Pr) and includes reverse esters thereof (e.g. –OC(O)Me, -OC(O)Et and –OC(O)Pr).
- Ester groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Ether -aliphatic-O-aliphatic, -aliphatic-O-aromatic, -aromatic-O-aliphatic, or -aromatic-O- aromatic.
- Ether groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Hairpin refers to a DNA structure in which two regions of the same strand, usually complementary in sequence when read in opposite directions, base-pair to form a double helix with an unpaired loop at the distal end of the hairpin:
- Halo or halide or halogen
- Fluoro, chloro, bromo, or iodo In some implementations, halo can also include astatine.
- Haloaliphatic An aliphatic group wherein one or more hydrogen atoms, such as one to 10 hydrogen atoms, independently is replaced with a halogen atom, such as fluoro, bromo, chloro, or iodo.
- Haloaliphatic groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Haloalkyl An alkyl group wherein one or more hydrogen atoms, such as one to 10 hydrogen atoms, independently is replaced with a halogen atom, such as fluoro, bromo, chloro, or iodo.
- Haloalkyl groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- haloalkyl can be a CX 3 group, wherein each X independently can be selected from fluoro, bromo, chloro, or iodo.
- Haloheteroaliphatic A heteroaliphatic group wherein one or more hydrogen atoms, such as one to 10 hydrogen atoms, independently is replaced with a halogen atom, such as fluoro, bromo, chloro, or iodo.
- Haloheteroaliphatic groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Heteroaliphatic An aliphatic group comprising at least one heteroatom to 20 heteroatoms, such as one to 15 heteroatoms, or one to 5 heteroatoms, which can be selected from, but not limited to oxygen, nitrogen, sulfur, silicon, boron, selenium, phosphorous, and oxidized forms thereof within the group. Alkoxy, ether, amino, disulfide, peroxy, and thioether groups are exemplary (but non-limiting) examples of heteroaliphatic. Heteroaliphatic groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Heteroaryl An aromatic group (e.g., an aryl group) comprising at least one heteroatom to six heteroatoms, such as one to four heteroatoms, which can be selected from, but not limited to oxygen, nitrogen, sulfur, silicon, boron, selenium, phosphorous, and oxidized forms thereof within the ring.
- Such heteroaryl groups can have a single ring or multiple condensed rings, wherein the condensed rings may or may not be aromatic and/or contain a heteroatom, provided that the point of attachment is through an atom of the aromatic heteroaryl group.
- Heteroaryl groups may be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Heteroatom An atom other than carbon or hydrogen, such as (but not limited to) oxygen, nitrogen, sulfur, silicon, boron, selenium, or phosphorous. In particular disclosed implementations, such as when valency constraints do not permit, a heteroatom does not include a halogen atom.
- Heterocycle/heterocycloaliphatic A cycloaliphatic group having at least one carbon atom and at least one heteroatom, i.e., one or more carbon atoms has been replaced with an atom having at least one lone pair of electrons, typically nitrogen, oxygen, phosphorus, silicon, or sulfur.
- Heterocyclic groups can be mono-cyclic or bi-cyclic.
- Hydroxy A group represented by the formula –OH.
- Isolated or Purified An biological component is a component that has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, i.e., other chromosomal and extra-chromosomal DNA and RNA, proteins, lipids, and organelles.
- isolated biological component does not require absolute purity.
- the desired isolated biological component may represent at least 50%, particularly at least about 75%, more particularly at least about 90%, and most particularly at least about 98%, of the total content of the preparation.
- Isolated biological components as described herein can be isolated by many methods such as salt fractionation, phenol extraction, precipitation with organic solvents (for example, hexadecyltrimethylammonium bromide or ethanol), affinity chromatography, ion-exchange chromatography, hydrophobic chromatography, high performance liquid chromatography, gel filtration, iso-electric focusing, physical separation (e.g., centrifugation or stirring), and the like.
- the term purified does not require absolute purity; rather, it is intended as a relative term.
- a purified peptide preparation is one in which the peptide or protein is more enriched than the peptide or protein is in its natural environment within a cell.
- a compound preparation is purified such that the desired polysaccharide protein conjugate represents at least 50%, more particularly at least about 90%, and most particularly at least about 98%, of the total content of the preparation.
- Ketone: -C(O)R d wherein R d is selected from aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Ketone groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Nitrogen-Containing Group A group that comprises at least one nitrogen atom.
- the nitrogen-containing group is an amide group or an amino group.
- the nitrogen-containing group can comprise mono or bicyclic rings, or ring systems, that include at least one nitrogen atom.
- the rings or ring systems generally include 1 to 9 carbon atoms in addition to the heteroatom(s) and may be saturated, unsaturated or aromatic (including pseudoaromatic).
- Aromatic refers to a ring system that is stabilized by means of delocalization of electrons and behaves in a similar manner to aromatic rings.
- Aromatic includes pseudoaromatic ring systems, such as pyrrolyl rings.
- nitrogen-containing groups include heteroaryl groups and/or cycloheteroaliphatic groups, such as pyrrolyl, H-pyrrolyl, pyrrolinyl, pyrrolidinyl, oxazolyl, oxadiazolyl, (including 1,2,3- and 1,2,4-oxadiazolyls) isoxazolyl, furazanyl, thiazolyl, isothiazolyl, pyrazolyl, pyrazolinyl, pyrazolidinyl, imidazolyl, imidazolinyl, triazolyl (including 1,2,3- and 1,3,4-triazolyls), tetrazolyl, thiadiazolyl (including 1,2,3- and 1,3,4-thiadiazolyls), dithiazolyl, pyridyl, pyrimidinyl, pyridazinyl, pyrazinyl, piperidinyl, morpholinyl, thio
- Such nitrogen-containing groups can be fused to a carbocyclic ring such as phenyl, naphthyl, indenyl, azulenyl, fluorenyl, and anthracenyl.
- optionally substituted cyclic nitrogen-containing group include pyridinium salts and the N-oxide form of suitable ring nitrogen atoms.
- the nitrogen-containing group can be optionally substituted with a broad range of substituents, and preferably with C1-6 alkyl, C1-6 alkoxy, C2-6 alkenyl, C2-6 alkynyl, halo, hydroxy, mercapto, trifluoromethyl, amino, cyano or mono or di(C1-6alkyl)amino.
- N-Myc N-Myc protein is encoded by the MYCN gene. MYCN has been shown to be critical to fetal development and is highly expressed in neural tissue. MYCN is often overexpressed or mutated in cancers and is considered an oncogene, particularly in neuroblastoma and small cell lung cancers.
- MYCN opposite strand (MYCNOS) is located on the antisense strand of MYCN.
- MYCNOS MYCN opposite strand
- Expression of MYCNOS has been shown to decrease promoter occupancy of MYCN and control MYCN transcript stability through sequence complementarity.
- NCYM the variant 2 of the MYCNOS transcript, can also be translated to produce a small protein.
- This polypeptide known as NCYM, has been characterized to have diverse regulatory activities, including controlling the stability of N-Myc protein, inhibiting GSK3 ⁇ , and influencing Wnt/ ⁇ catenin signaling.
- Organic Functional Group A functional group that may be provided by any combination of aliphatic, heteroaliphatic, aromatic, haloaliphatic, and/or haloheteroaliphatic groups, or that may be selected from, but not limited to, aldehyde; aroxy; acyl halide; halogen; nitro; cyano; azide; carboxyl (or carboxylate); amide; ketone; carbonate; imine; azo; carbamate; hydroxyl; thiol; sulfonyl (or sulfonate); oxime; ester; thiocyanate; thioketone; thiocarboxylic acid; thioester; dithiocarboxylic; phosphonate; phosphate; silyl ether; sulfinyl; s
- Organic functional groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Oxime: -CR d NOH, wherein R d is hydrogen, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Oxime groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Peroxy -O-OR d wherein R d is hydrogen, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group. Peroxy groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Pharmaceutical composition A composition including an amount (for example, a unit dosage) of one or more of the disclosed compounds together with one or more non-toxic pharmaceutically acceptable additives, including carriers, diluents, and/or adjuvants, and optionally other biologically active ingredients.
- compositions can be prepared by standard pharmaceutical formulation techniques such as those disclosed in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA (19th Edition).
- Pharmaceutically acceptable carrier The pharmaceutically acceptable carriers of use are conventional. Remington’s Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 19th Edition, 1995, describes compositions and formulations suitable for pharmaceutical delivery of the disclosed immunogens. In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
- non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate.
- pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- suitable for administration to a subject the carrier may be sterile, and/or suspended or otherwise contained in a unit dosage form containing one or more measured doses of the composition suitable to induce the desired tumor response. It may also be accompanied by medications for its use for treatment purposes.
- the unit dosage form may be, for example, in a sealed vial that contains sterile contents or a syringe for injection into a subject, or lyophilized for subsequent solubilization and administration or in a solid or controlled release dosage.
- Pharmaceutically acceptable salt or ester Salts or esters prepared by conventional means that include salts, e.g., of inorganic and organic acids, including but not limited to hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, methanesulfonic acid, ethanesulfonic acid, malic acid, acetic acid, oxalic acid, tartaric acid, citric acid, lactic acid, fumaric acid, succinic acid, maleic acid, salicylic acid, benzoic acid, phenylacetic acid, mandelic acid and the like.
- Pharmaceutically acceptable salts of the presently disclosed compounds also include those formed from cations such as sodium, potassium, aluminum, calcium, lithium, magnesium, zinc, and from bases such as ammonia, ethylenediamine, N-methyl-glutamine, lysine, arginine, ornithine, choline, N,N'- dibenzylethylenediamine, chloroprocaine, diethanolamine, procaine, N-benzylphenethylamine, diethylamine, piperazine, tris(hydroxymethyl)aminomethane, and tetramethylammonium hydroxide.
- bases such as ammonia, ethylenediamine, N-methyl-glutamine, lysine, arginine, ornithine, choline, N,N'- dibenzylethylenediamine, chloroprocaine, diethanolamine, procaine, N-benzylphenethylamine, diethylamine, piperazine, tris(hydroxymethyl)amin
- any chemical compound recited in this specification may alternatively be administered as a pharmaceutically acceptable salt thereof.
- “Pharmaceutically acceptable salts” are also inclusive of the free acid, base, and zwitterionic forms. Descriptions of suitable pharmaceutically acceptable salts can be found in Handbook of Pharmaceutical Salts, Properties, Selection and Use, Wiley VCH (2002). When compounds disclosed herein include an acidic function such as a carboxy group, then suitable pharmaceutically acceptable cation pairs for the carboxy group are well known to those skilled in the art and include alkaline, alkaline earth, ammonium, quaternary ammonium cations and the like. Such salts are known to those of skill in the art. For additional examples of pharmacologically acceptable salts, see Berge et al., J.
- esters include those derived from compounds described herein that are modified to include a carboxyl group.
- An in vivo hydrolysable ester is an ester, which is hydrolysed in the human or animal body to produce the parent acid or alcohol.
- esters thus include carboxylic acid esters in which the non-carbonyl moiety of the carboxylic acid portion of the ester grouping is selected from straight or branched chain alkyl (for example, methyl, n-propyl, t-butyl, or n-butyl), cycloalkyl, alkoxyalkyl (for example, methoxymethyl), aralkyl (for example benzyl), aryloxyalkyl (for example, phenoxymethyl), aryl (for example, phenyl, optionally substituted by, for example, halogen, C.sub.1-4 alkyl, or C.sub.1-4 alkoxy) or amino); sulphonate esters, such as alkyl- or aralkylsulphonyl (for example, methanesulphonyl); or amino acid esters (for example, L-valyl or L-isoleucyl).
- alkyl for example, methyl, n-propyl, t
- a “pharmaceutically acceptable ester” also includes inorganic esters such as mono-, di-, or tri-phosphate esters.
- any alkyl moiety present advantageously contains from 1 to 18 carbon atoms, particularly from 1 to 6 carbon atoms, more particularly from 1 to 4 carbon atoms.
- Any cycloalkyl moiety present in such esters advantageously contains from 3 to 6 carbon atoms.
- Any aryl moiety present in such esters advantageously comprises a phenyl group, optionally substituted as shown in the definition of carbocycylyl above.
- esters thus include C 1 -C 22 fatty acid esters, such as acetyl, t-butyl or long chain straight or branched unsaturated or omega-6 monounsaturated fatty acids such as palmoyl, stearoyl and the like.
- Alternative aryl or heteroaryl esters include benzoyl, pyridylmethyloyl and the like any of which may be substituted, as defined in carbocyclyl above.
- Additional pharmaceutically acceptable esters include aliphatic L-amino acid esters such as leucyl, isoleucyl and especially valyl.
- salts of the compounds are those wherein the counter-ion is pharmaceutically acceptable.
- salts of acids and bases which are non-pharmaceutically acceptable may also find use, for example, in the preparation or purification of a pharmaceutically acceptable compound.
- the pharmaceutically acceptable acid and base addition salts as mentioned hereinabove are meant to comprise the therapeutically active non-toxic acid and base addition salt forms which the compounds are able to form.
- the pharmaceutically acceptable acid addition salts can conveniently be obtained by treating the base form with such appropriate acid.
- Appropriate acids comprise, for example, inorganic acids such as hydrohalic acids, e.g.
- hydrochloric or hydrobromic acid sulfuric, nitric, phosphoric and the like acids; or organic acids such as, for example, acetic, propanoic, hydroxyacetic, lactic, pyruvic, oxalic (i.e. ethanedioic), malonic, succinic (i.e. butanedioic acid), maleic, fumaric, malic (i.e.
- salt forms can be converted by treatment with an appropriate base into the free base form.
- the compounds containing an acidic proton may also be converted into their non-toxic metal or amine addition salt forms by treatment with appropriate organic and inorganic bases.
- Appropriate base salt forms comprise, for example, the ammonium salts, the alkali and earth alkaline metal salts, e.g.
- the lithium, sodium, potassium, magnesium, calcium salts and the like salts with organic bases, e.g. the benzathine, N- methyl-D-glucamine, hydrabamine salts, and salts with amino acids such as, for example, arginine, lysine and the like.
- the term addition salt as used hereinabove also comprises the solvates which the compounds described herein are able to form. Such solvates are for example hydrates, alcoholates and the like.
- quaternary amine as used hereinbefore defines the quaternary ammonium salts which the compounds are able to form by reaction between a basic nitrogen of a compound and an appropriate quaternizing agent, such as, for example, an optionally substituted alkylhalide, arylhalide or arylalkylhalide, e.g. methyliodide or benzyliodide.
- an appropriate quaternizing agent such as, for example, an optionally substituted alkylhalide, arylhalide or arylalkylhalide, e.g. methyliodide or benzyliodide.
- Other reactants with good leaving groups may also be used, such as alkyl trifluoromethanesulfonates, alkyl methanesulfonates, and alkyl p-toluenesulfonates.
- a quaternary amine has a positively charged nitrogen.
- prodrugs of the disclosed compounds also are contemplated herein.
- a prodrug is an active or inactive compound that is modified chemically through in vivo physiological action, such as hydrolysis, metabolism and the like, into an active compound following administration of the prodrug to a subject.
- prodrug as used throughout this text means the pharmacologically acceptable derivatives such as esters, amides and phosphates, such that the resulting in vivo biotransformation product of the derivative is the active drug as defined in the compounds described herein.
- Prodrugs preferably have excellent aqueous solubility, increased bioavailability and are readily metabolized into the active inhibitors in vivo.
- Prodrugs of a compounds described herein may be prepared by modifying functional groups present in the compound in such a way that the modifications are cleaved, either by routine manipulation or in vivo, to the parent compound.
- the suitability and techniques involved in making and using prodrugs are well known by those skilled in the art.
- For a general discussion of prodrugs involving esters see Svensson and Tunek, Drug Metabolism Reviews 165 (1988) and Bundgaard, Design of Prodrugs, Elsevier (1985).
- prodrug also is intended to include any covalently bonded carriers that release an active parent drug of the present invention in vivo when the prodrug is administered to a subject. Since prodrugs often have enhanced properties relative to the active agent pharmaceutical, such as, solubility and bioavailability, the compounds disclosed herein can be delivered in prodrug form. Thus, also contemplated are prodrugs of the presently disclosed compounds, methods of delivering prodrugs and compositions containing such prodrugs. Prodrugs of the disclosed compounds typically are prepared by modifying one or more functional groups present in the compound in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to yield the parent compound.
- Prodrugs include compounds having a phosphonate and/or amino group functionalized with any group that is cleaved in vivo to yield the corresponding amino and/or phosphonate group, respectively.
- Examples of prodrugs include, without limitation, compounds having an acylated amino group and/or a phosphonate ester or phosphonate amide group.
- a prodrug is a lower alkyl phosphonate ester, such as an isopropyl phosphonate ester.
- Protected derivatives of the disclosed compounds also are contemplated. A variety of suitable protecting groups for use with the disclosed compounds are disclosed in Greene and Wuts, Protective Groups in Organic Synthesis; 3rd Ed.; John Wiley & Sons, New York, 1999.
- protecting groups are removed under conditions that will not affect the remaining portion of the molecule. These methods are well known in the art and include acid hydrolysis, hydrogenolysis and the like.
- One preferred method involves the removal of an ester, such as cleavage of a phosphonate ester using Lewis acidic conditions, such as in TMS-Br mediated ester cleavage to yield the free phosphonate.
- a second preferred method involves removal of a protecting group, such as removal of a benzyl group by hydrogenolysis utilizing palladium on carbon in a suitable solvent system such as an alcohol, acetic acid, and the like or mixtures thereof.
- a t-butoxy-based group, including t-butoxy carbonyl protecting groups can be removed utilizing an inorganic or organic acid, such as HCl or trifluoroacetic acid, in a suitable solvent system, such as water, dioxane and/or methylene chloride.
- a suitable solvent system such as water, dioxane and/or methylene chloride.
- Another exemplary protecting group, suitable for protecting amino and hydroxy functions amino is trityl.
- Other conventional protecting groups are known and suitable protecting groups can be selected by those of skill in the art in consultation with Greene and Wuts, Protective Groups in Organic Synthesis; 3rd Ed.; John Wiley & Sons, New York, 1999. When an amine is deprotected, the resulting salt can readily be neutralized to yield the free amine.
- the compound when an acid moiety, such as a phosphonic acid moiety is unveiled, the compound may be isolated as the acid compound or as a salt thereof.
- the R d groups of the phosphate can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- the R d groups of the phosphonate group can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Silyl Ether -OSiR e R f , wherein each of R e and R f independently is selected from hydrogen, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Silyl ether groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Small molecule refers to a molecule with a molecular weight of 1000 daltons or less (for example 900 daltons or less, 800 daltons or less, 700 daltons or less, 600 daltons or less, 500 daltons or less, 400 daltons or less, 300 daltons or less, 200 daltons or less, or 100 daltons or less). In some examples, a small molecule has a molecular weight of 100-1000 daltons, 200-900 daltons, 200-700 daltons, or 200-500 daltons.
- Subject Includes both human and non-human subjects, including birds and non-human mammals, such as non-human primates, companion animals (such as dogs and cats), livestock (such as pigs, sheep, cows), as well as non-domesticated animals, such as the big cats.
- non-human mammals such as non-human primates, companion animals (such as dogs and cats), livestock (such as pigs, sheep, cows), as well as non-domesticated animals, such as the big cats.
- livestock such as pigs, sheep, cows
- non-domesticated animals such as the big cats.
- subject applies regardless of the stage in the organism’s life-cycle. Thus, the term subject applies to an organism in utero or in ovo, depending on the organism (that is, whether the organism is a mammal or a bird, such as a domesticated or wild fowl).
- Sulfinyl -S(O)R d , wherein R d is selected from hydrogen, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Sulfinyl groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Sulfonyl -SO2R d , wherein R d is selected from hydrogen, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Sulfonyl groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Sulfonamide -SO2NR e R or -N(R e )SO2R f , wherein each of R e and R f independently is selected from hydrogen, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Sulfonamide groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Therapeutically effective amount The amount of an agent that alone, or together with one or more additional agents, induces the desired response, such as, for example treatment of a tumor in a subject.
- a therapeutically effective amount provides a therapeutic effect without causing a substantial cytotoxic effect in the subject.
- a desired response is to decrease the size, volume, or number (such as metastases) of a tumor in a subject.
- the agent or agents can decrease the size, volume, or number of tumors by a desired amount, for example by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 50%, at least 75%, at least 90%, or at least 95% as compared to a response in the absence of the agent.
- a therapeutically effective amount of a disclosed compound that is administered to a human or veterinary subject will vary depending upon a number of factors associated with that subject, for example the overall health of the subject.
- a therapeutically effective amount can be determined by varying the dosage and measuring the resulting therapeutic response, such as the regression of a tumor.
- Therapeutically effective amounts also can be determined through various in vitro, in vivo or in situ immunoassays.
- the disclosed agents can be administered in a single dose, or in several doses, as needed to obtain the desired response. However, the therapeutically effective amount of can be dependent on the source applied, the subject being treated, the severity and type of the condition being treated, and the manner of administration. Thial: -C(S)H.
- Thiocarboxylic acid -C(O)SH, or –C(S)OH.
- Thioester -C(O)SR d or –C(S)OR d wherein R d is selected from hydrogen, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Thioester groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Thioether -S-aliphatic or –S-aromatic, such as -S-alkyl, -S-alkenyl, -S-alkynyl, -S-aryl, or -S- heteroaryl; or -aliphatic-S-aliphatic, -aliphatic-S-aromatic, -aromatic-S-aliphatic, or -aromatic-S-aromatic.
- Thioether groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Thioketone -C(S)R d wherein R d is selected from hydrogen, aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Thioketone groups can be substituted with one or more groups other than hydrogen, such as aliphatic, heteroaliphatic, haloaliphatic, haloheteroaliphatic, aromatic, or an organic functional group.
- Treating or Inhibiting a Disease A therapeutic intervention that reduces a sign or symptom of a disease or pathological condition related to a disease (such as a tumor). Treatment can also induce remission or cure of a condition, such as a tumor.
- treatment includes preventing a tumor, for example by inhibiting the full development of a tumor, such as preventing development of a metastasis or the development of a primary tumor. Prevention does not require a total absence of a tumor. Reducing a sign or symptom of a disease or pathological condition related to a disease, refers to any observable beneficial effect of the treatment.
- Reducing a sign or symptom associated with a tumor can be evidenced, for example, by a delayed onset of clinical symptoms of the disease in a susceptible subject (such as a subject having a tumor which has not yet metastasized), a reduction in severity of some or all clinical symptoms of the disease, a slower progression of the disease (for example by prolonging the life of a subject having tumor), a reduction in the number of relapses of the disease, an improvement in the overall health or well-being of the subject, or by other parameters well known in the art that are specific to the particular tumor.
- a “prophylactic” treatment is a treatment administered to a subject who does not exhibit signs of a disease or exhibits only early signs for the purpose of decreasing the risk of developing pathology.
- Tumor An abnormal growth of cells, which can be benign or malignant. Cancer is a malignant tumor, which is characterized by abnormal or uncontrolled cell growth. Other features often associated with malignancy include metastasis, interference with the normal functioning of neighboring cells, release of cytokines or other secretory products at abnormal levels and suppression or aggravation of inflammatory or immunological response, invasion of surrounding or distant tissues or organs, such as lymph nodes, etc. “Metastatic disease” refers to cancer cells that have left the original tumor site and migrate to other parts of the body for example via the bloodstream or lymph system. Thus, a metastatic cancer is a cancer at one or more sites in the body other than the site of origin of the original (primary) cancer from which the metastatic cancer is derived.
- the amount of a tumor in an individual is the “tumor burden” which can be measured as the number, volume, or weight of the tumor.
- a tumor that does not metastasize is referred to as “benign.”
- the amount of a tumor in an individual is the “tumor burden” which can be measured as the number, volume, or weight of the tumor.
- a tumor that does not metastasize is referred to as “benign.”
- a tumor that invades the surrounding tissue and/or can metastasize is referred to as “malignant.”
- hematological tumors include leukemias, including acute leukemias (such as 11q23-positive acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, acute myelogenous leukemia and myeloblastic, promyelocytic, myelomonocytic, monocytic and erythroleukemia), chronic leukemias (such as chronic myelocytic (granulocytic) leukemia, chronic myelogenous leukemia, and chronic lymphocytic leukemia), polycythemia vera, lymphoma, Hodgkin's disease, non-Hodgkin's lymphoma (indolent and high grade forms), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease,
- solid tumors such as sarcomas and carcinomas
- solid tumors include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic cancer, breast cancer (including basal breast carcinoma, ductal carcinoma and lobular breast carcinoma), lung cancers, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, salivary gland carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytomas sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma
- an “established” or “existing” tumor is an existing tumor that can be discerned by diagnostic tests.
- an established tumor can be palpated.
- an “established tumor” is at least 500 mm 3 , such as at least 600 mm 3 , at least 700 mm 3 , or at least 800 mm 3 in size.
- the tumor is at least 1 cm long.
- an established tumor generally has a robust blood supply, and has induced Tregs and myeloid derived suppressor cells (MDSCs).
- a tumor is neuroblastoma or small-cell lung cancer. II.
- G4s G-quadruplexes
- N-Myc undruggable proteins
- G4-containing proteins such as N-Myc and other G4-containing proteins
- selective binders to G4s are challenging to identify due to the structural similarity of many G4s.
- Many canonical G4 structures are relatively simple: they contain tetrads of guanines that are stabilized by central potassium ions, and small 1-7 nucleotide loops.
- Genome-wide probing studies have also experimentally confirmed the existence of a G4 in the MYCN gene, though it does not occur in the promoter region of MYCN like many other regulatory G4s.
- New small molecule compounds that target non-canonical G4 structures such as hairpin-containing G4s, are described herein.
- the compounds target non-canonical G4s in the MYC gene family, such as MYCN.
- Pharmaceutical compositions comprising the compounds and methods of making and using the compounds also are disclosed. Also disclosed are methods of using such compounds for therapeutic treatment, such as in methods of treating diseases and/or disorders, like cancer.
- treatment with the disclosed compounds results in decreases in both the MYCN and MYCNOS transcripts as well as the N-Myc protein levels.
- the compounds are small molecule compounds (including stereoisomers, tautomers, or pharmaceutically acceptable salts or esters thereof) that can target and bind non- canonical G4s.
- the compounds are small molecules that selectively bind directly to structurally complex non-canonical G4s, such as hairpin-containing G4s.
- the hairpin-containing G4 is present in DNA.
- the compounds do not bind RNA (or mRNA) that does not comprise a G4 structure.
- Some compounds, such as the bivalent compounds disclosed herein can bind G4s present in RNA (e.g., mRNA), but they do not bind simple RNA (or mRNA), such as simple RNA (or mRNA) comprising stem-loop structures, bulge structure, or hairpin structures without a G4.
- Exemplary genes that can be targeted using the compounds disclosed herein can include, but are not limited to, the MYC-family (e.g., MYCN, MYCNOS, MYCL, MYC, and the like), FOXA3, KRAS, BRD4, and any oncogenes and/or non-coding RNAs (e.g., long non-coding RNAs (lncRNA)) thereof, such as BCL2, SOX2, and/or LINC01018.
- the compounds can bind G4s present in helicases (e.g., DHX15).
- the compounds selectively bind near a junction at a G4 hairpin found in such genes.
- the compound, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof has a structure according to Formula I.
- Formula I With respect to Formula I, the following variable recitations can apply: ring A is a 5-membered heteroaryl ring and in particular independent implementations is not a thiophenyl, thiazolyl, furanyl, triazolyl, or thiadiazolyl; ring B is a 6-membered heteroaryl ring containing at least two nitrogen atoms; R 1 is -(linker) t -R b wherein R b is aromatic, heteroaliphatic, or aliphatic; the linker is an aliphatic or heteroaliphatic group; and t is 0 or 1; R 2 is H or aliphatic; each R 3 independently is heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo (e.g., Cl, F, Br, or I) and in
- ring A is oxadiazolyl, and in particular independent implementations is not a 1,3,4-oxadiazolyl
- ring B is selected from diazinyl (e.g., pyridazinyl, pyrimidinyl, or pyrazinyl)
- R 1 is -(linker)t-R b wherein R b is aryl, heteroaryl, cycloheteroaliphatic, acycloheteroaliphatic, cycloaliphatic, acycloaliphatic; t is 0 or 1; and the linker is -(CR a 2 ) q - or –[(CR a 2 ) q Y] r -(CR a 2 ) s - , wherein each R a independently is H, aliphatic, or halo; Y is oxygen, sulfur, or NR’, wherein R’ is H or
- R 1 is -(linker)t-R b wherein R b is phenyl, piperazinyl, pyridinyl, azepinyl, cyclopentyl, amino (e.g., NH2, N(alkyl)2, and NH(alkyl)), piperidinyl, pyrrolidinyl, oxadiazolyl, triazinyl, amide (e.g., -C(O)NH 2 ), morpholinyl, acridinyl (e.g., 9-aminoacridine, acridine Cl, and acridine NH 2 , acridine ICR 191); t is 0 or 1; and the linker is -(CH 2 ) q -, -CH(Me)-, -(CH 2 ) q -CH(Me)-, -[(
- the compound has a structure according to Formula I, wherein ring A is a 5-membered heteroaryl ring; ring B is a 6-membered heteroaryl ring containing at least two nitrogen atoms; R 1 is -(CR a 2 ) m -R b or –[(CR a 2 ) m O] r -(CH 2 ) s- R b , where each R a independently is H, alkyl, or halo, m is 1, 2, 3, 4, or 5, r is 1 or 2, s is 2, and R b is a cycloalkyl group, an aryl group, or a nitrogen-containing group (e.g., an N-containing cyclic group, such as a heteroaryl group comprising nitrogen or a cycloheteroaliphatic group comprising a nitrogen atom; an amide group; or an amino group); R 2 is H or aliphatic; each R 3 independently is alkoxy or hydroxy, and
- the compound does not comprise the following compounds, but can include any pharmaceutically acceptable salt or ester thereof: 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazin-3-amine; N-(3-([1,4'-bipiperidin]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3- amine; 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazin-3- amine; N1-(6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyr
- the compound can have a structure according to Formula IA Formula IA wherein each bond represented by ----- is a single or double bond as needed to satisfy valence requirements; each of X 1 , X 2 , and X 3 independently is N, O, S, or C(R c ) where R c is H, alkyl, or halo, provided that at least one of X 1 , X 2 , and X 3 is other than C(R c ); R 1 is -(linker)t-R b wherein R b is aromatic, heteroaliphatic, or aliphatic; the linker is an aliphatic or heteroaliphatic group; and t is 0 or 1; R 2 is H or aliphatic; each R 3 independently is heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo (e.g., Cl, F, Br, or I) and in an independent implementation, R 3 is not fluoro; each R 4 independently is H,
- the compound does not comprise a thiophenyl, thiazolyl, furanyl, triazolyl, thiadiazolyl, or a 1,3,4-oxadiazolyl ring.
- the compound comprises a 1,2,4-oxadiazolyl ring.
- ring A may be , where each bond represented by is a single or double bond as needed to satisfy valence requirements; and each of X 1 , X 2 , and X 3 independently is N, O, S, or C(R c ) where R c is H, alkyl, or halo, provided that at least one of X 1 , X 2 , and X 3 is other than C(R c ).
- R c is H or alkyl, such as C1-C3 alkyl (methyl, ethyl, propyl, or isopropyl).
- R c is H.
- at least one of X 1 , X 2 , and X 3 is N.
- at least one of X 1 , X 2 , and X 3 is N and one of X 1 , X 2 , and X 3 is O or S.
- the five-membered ring of Formula I and/or IA is selected from , or In certain examp les, the five-membered ring of Formula I and/or IA is .
- ring B of Formula I may be where each of Y 1 , Y 2 , Y 3 , and Y 4 independently is N or C(R c ) where R c is H, alkyl, or halo, provided that at least one of Y 1 , Y 2 , Y 3 , and Y 4 are N.
- R c is H, alkyl, or halo, provided that at least one of Y 1 , Y 2 , Y 3 , and Y 4 are N.
- two of Y 1 , Y 2 , Y 3 , and Y 4 are N, and the other of Y 1 , Y 2 , Y 3 , and Y 4 are C(R c ).
- Each R c independently may be H, -alkyl, or halo. In particular examples, R c is H.
- ring B is , , In certain implementations of Formula I, ring B is .
- the disclosed compounds typically comprise a number of R 3 groups (represented as “x” in Formula I), wherein x is 0, 1, 2, 3, 4, or 5, and each R 3 independently is alkoxy, hydroxy, haloalkyl, aliphatic, or halo. In an independent implementation, R 3 is not fluoro. In some implementations, x is 1, 2, or 3. In certain implementations, x is 1. In some implementations, at least one R 3 group is in a para position relative to ring A. In any of the foregoing or following implementations, R 3 may be C 1 -C 3 alkoxy or hydroxy. In some implementations, R 3 is methoxy.
- x is 1 and R 3 is para to ring A.
- each R 4 independently is H, alkyl (e.g., C1-C3 alkyl), or halo.
- R 4 is H or methyl.
- R 4 is H.
- n is 0 or 1.
- n is 0, and - N(R 1 )(R 2 ) is attached directly to ring B.
- the compound has a structure according to Formula II: Formula II. With reference to Formula II, each of R 1 , R 2 , and R 3 are as defined according to any of the above implementations.
- R 2 is H or C1-C3 alkyl. In certain implementations, R 2 is H. In some implementations, the compound has a structure according to Formula III: Formula III.
- R 1 is -(CR a 2)m-R b or - [(CR a 2)mO]r-(CH2)2-R b where each R a independently is H, alkyl, or halo, m is 1, 2, 3, 4, or 5, r is 1, 2, 3, 4, or 5, and R b is a nitrogen-containing group. In some implementations, each R a independently is H or C1-C3 alkyl.
- each R a is H, and R 1 is -(CH 2 ) m -R b . In certain implementations, each R a is H, and R 1 is -[(CR a 2 ) m O] r -(CH 2 ) 2 -R b , wherein r is 1, 2, or 3. In some implementations, m is 1, 2, or 3, particularly 2 or 3. In any of the foregoing or following implementations, m + n may be 1, 2, 3, 4, or 5. In some implementations, m + n is 2, 3, or 4, particularly 2 or 3. In certain implementations, n is 0 and m is 2 or 3.
- R b is a nitrogen-containing group.
- R b is an N-containing cyclic group, -N(R c )2, or -C(O)N(R c )2 where each R c is H, alkyl, or halo.
- the N-containing cyclic group may be saturated or unsaturated (including aromatic), and may include from 5 to 15 atoms, such as 5 to 14 atoms, or 5 to 10 atoms, or 5 to 8 atoms.
- the N-containing cyclic group further comprises one or more substituents, such as substituents selected from halo, heteroaliphatic, or aliphatic.
- the N-containing cyclic group is attached to –(CR a 2)m- or -[(CR a 2)mO]r-(CH2)2- via a nitrogen atom in the heterocycle.
- exemplary N-containing cyclic groups include 1 or 2 nitrogen atoms, and may include another heteroatom, such as a S or O atom.
- Suitable N-containing cyclic groups include, but are not limited to, acridinyl groups (or other G4 stacking compounds, such as BRACO-19 and the like), hexahydroazepinyl groups, piperazinyl groups, morpholino groups, and piperidinyl groups.
- R b is -N(R c )2 or -C(O)N(R c )2, where R c is H or alkyl, such as H or C1-C3 alkyl; or acridinyl groups, such as acridine ICR 191, 9- aminoacridine, acridine Cl, or acridine NH2.
- the compound can be a “bivalent” compound comprising two G4-responsive groups, including a non-canonical G4-binding component and a G4-stacker component.
- the non-canonical G4-binding component comprises portion of the compound that includes rings A, B, and/or the R 3 -bearing phenyl ring; and the G4-stacker component comprises the acridinyl group.
- Scheme 1 the bivalent compound has a structure according to Formula IV: Formula IV wherein R b is a G4-stacker group, such as an aromatic group (e.g., an acridinyl group); and the linker group is -(CR a 2 ) m - or -[(CR a 2 ) m O] r -(CH 2 ) s - wherein each of R a , m, r, and s are as recited herein, such as provided for Formulas I and/or II.
- R b is a G4-stacker group, such as an aromatic group (e.g., an acridinyl group)
- the linker group is -(CR a 2 ) m -
- the bivalent compound has a structure according to Formula V: Formula V wherein R b is an acridinyl group; and the linker group is -(CH2)m- or -[(CH a 2)mO]r-(CH2)s- wherein each of m, r, and s are as recited herein, such as provided for Formulas I and/or II.
- R 1 is selected from the following:
- R 1 is selected from the following:
- R 2 is H or C1-C3 alkyl and R 1 is as defined according to any of the above implementations.
- R 2 is H.
- R 3 is methoxy, and R 1 is as defined according to any of the above implementations.
- the compound is MY-5, MY-6, MY-7, MY-8, MY-13, MY-14, B32, B33, B34, B35, or B38. In certain examples, the compound is MY-8 or B33.
- the compound does not comprise, or is not or is other than, the following: 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazin-3-amine; N-(3-([1,4'-bipiperidin]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3- amine; 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl)pyridazin-3- amine; N1-(6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-yl)-N2,N2-di
- reaction mixture is concentrated in vacuo and the resulting residue was purified by Isco flash column chromatography to afford MY-6; A mixture of P2, 3-aminopropanamide hydrochloride and K 2 CO 3 in EtOH is heated to 80 °C and stirred overnight. The reaction mixture is concentrated in vacuo and the resulting residue is purified by Isco flash column chromatography to afford MY-7; A mixture of P2, 3-(1-azepanyl)-1-propanamine and NH 4 Cl in EtOH is heated to 80 °C and stirred overnight. The reaction mixture is concentrated in vacuo and the resulting residue is purified by Isco flash column chromatography to afford MY-8.
- MY-8 was then stirred in TFA for 30 min to yield the corresponding TFA salt;
- a mixture of P2, 2-morpholinoethan-1-amine and NH4Cl in EtOH is heated to 80 °C and stirred overnight.
- the reaction mixture is concentrated in vacuo and the resulting residue is purified by Isco flash column chromatography to afford MY-13; and
- a mixture of P2, 2-(4-methylpiperazin-1-yl)ethan-1-amine and NH4Cl in EtOH is heated to 80 °C and stirred overnight.
- the reaction mixture is concentrated in vacuo and the resulting residue is purified by Isco flash column chromatography to afford MY-14.
- Bivalent compounds disclosed herein can be made according to the method provided by Scheme 4, below, wherein R is used to represent R 1 as described herein.
- Scheme 4 A representative method for making bivalent compound embodiments disclosed herein is provided below in Scheme 5.
- Scheme 5 With reference to Scheme 5, the following procedures are used (reagent amounts, reaction times, and temperatures described in the Examples Section herein can be used in some implementations) and R refers to a linker-G4 stacker motif as recited for certain R 1 substituents disclosed herein: A solution of 7 in DMSO is combined with DIPEA followed by 2. The reaction is heated and maintained at 110 °C for 18 hours.
- the crude reaction mixture is allowed to cool to room temperature and purified by reverse phase flash chromatography to afford B33 as yellow solid; A solution of 7 in DMSO is combined with DIPEA followed by 2. The reaction is heated and maintained at 110 °C for 18 hours. The crude reaction mixture is allowed to cool to room temperature and purified by reverse phase flash chromatography to afford B33 as yellow solid; A solution of 7 in DMSO is combined with DIPEA followed by 3. The reaction is heated and maintained at 110 °C for 18 hours. The crude reaction mixture is allowed to cool to room temperature and is purified by reverse phase flash chromatography to afford B34 as yellow solid; A solution of 7 in DMSO is combined with DIPEA followed by 4. The reaction is heated and maintained at 110 °C for 18 hours.
- the cell may be a cell present in a subject or in a sample (e.g., a biological sample containing cells, such as cancerous or non-cancerous cells).
- Controlling a level of a gene and/or gene expression can involve decreasing expression of a gene (e.g., MYCN or MYC), for example, decreasing accumulation of a gene product, such as RNA (e.g., mRNA or lncRNA), associated protein, or combinations thereof.
- RNA e.g., mRNA or lncRNA
- the gene can be selected from the MYC-family (e.g., MYCN, MYCNOS, MYCL, MYC, and the like), FOXA3, KRAS, BRD4, and any related oncogenes.
- the method can comprise administering a therapeutically effective amount of a compound according to the present disclosure (or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof) to a subject with cancer (or a tumor), thereby treating the cancer (or tumor).
- the method can comprise contacting a cell with an effective amount of a compound according to the present disclosure (or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof).
- the cell may be contacted in vitro, ex vivo, or in vivo.
- the compound according to the present disclosure enters the cell upon contact.
- the method can further comprise detecting a decrease in gene, protein, and/or lncRNA expression after exposing the subject or the sample to the compound.
- a method for decreasing protein expression of N-Myc in a cell is disclosed. The method may include contacting the cell with an effective amount of a disclosed compound, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof. The cell may be contacted in vitro, ex vivo, or in vivo. The compound selectively binds to a G4 nucleic acid region in the MYCN gene, which, in particular implementations, is the G4 nucleic acid region comprising a non-canonical G4 structure.
- the compound binds such non-canonical G4s in DNA of the gene, but does not bind RNA (e.g., mRNA), of the gene that does not also comprise a G4.
- the compound selectively binds at or near a G4 hairpin.
- the cell may be a cell characterized at least in part by overexpression of the MYCN gene.
- expression of the MYCN gene in the cell is reduced at least 25%, such as at least 50%, at least 75%, at least 80%, at least 85%, or even at least 90% relative to expression in the absence of the compound.
- the compound also may reduce growth and/or proliferation of the cell.
- growth and/or proliferation is reduced at least 25%, such as at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, or even at least 95% relative to growth and/or proliferation in the absence of the compound.
- a method for decreasing protein expression of c-Myc in a cell is disclosed. The method may include contacting the cell with an effective amount of a disclosed compound, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof. The cell may be contacted in vitro, ex vivo, or in vivo.
- the compound selectively binds to a G4 nucleic acid region in the MYC gene, which, in particular implementations, is a G4 nucleic acid region comprising a non-canonical G4 structure.
- the compound binds such non-canonical G4s in DNA of the gene, but does not bind RNA (e.g., mRNA), of the gene that does not also comprise a G4.
- the cell may be a cell characterized at least in part by overexpression of the MYC gene.
- expression of the MYC gene in the cell is reduced at least 25%, such as at least 50%, at least 75%, at least 80%, at least 85%, or even at least 90% relative to expression in the absence of the compound.
- the compound also may reduce growth and/or proliferation of the cell.
- growth and/or proliferation is reduced at least 25%, such as at least 50%, at least 75%, at least 80%, at least 85%, at least 90%, or even at least 95% relative to growth and/or proliferation in the absence of the compound.
- the cell may be a tumor and/or cancer cell in a subject, and the method may further comprise treating or preventing cancer in the subject by administering to a subject in need thereof a therapeutically effective amount of the compound, or the pharmaceutically acceptable salt or ester thereof, to decrease protein (e.g., N-Myc, c-Myc, or the like) expression in the tumor and/or cancer cell, thereby treating or preventing the cancer in the subject.
- a therapeutically effective amount of the compound, or the pharmaceutically acceptable salt or ester thereof to decrease protein (e.g., N-Myc, c-Myc, or the like) expression in the tumor and/or cancer cell, thereby treating or preventing the cancer in the subject.
- Subjects that can benefit from the disclosed methods include human and veterinary subjects.
- the cancer cell is a neurological cancer cell or a lung cancer cell.
- the cancer is neuroblastoma or small cell lung cancer.
- treating the cancer in the subject decreases growth and/or proliferation of the cancer cell or a tumor comprising the cancer cell.
- Treatment of the cancer is generally initiated after the diagnosis of the cancer, or after the initiation of a precursor condition (such as dysplasia or development of a benign tumor).
- Treatment can be initiated at the early stages of cancer, for instance, can be initiated before a subject manifests symptoms of a condition, such as during a stage I diagnosis or at the time dysplasia is diagnosed.
- treatment can be initiated during any stage of the disease, such as but not limited to stage I, stage II, stage III and stage IV cancers.
- treatment is administered to these subjects with a benign tumor that can convert into a malignant or even metastatic tumor.
- Treatment initiated after the development of a condition may result in decreasing the severity of one or more symptoms of the condition, or completely removing the symptoms, or reducing metastasis, tumor volume, and/or number of tumors.
- the tumor becomes undetectable following treatment.
- the formation of tumors, such as metastasis is delayed, prevented or decreased.
- the size of the primary tumor is decreased.
- a symptom of the tumor is decreased.
- tumor volume is decreased.
- Subjects can be screened prior to initiating the disclosed therapies, for example to determine whether the subject has a tumor and/or cancer.
- the presence of a tumor can be determined by methods known in the art, and typically include cytological and morphological evaluation.
- the tumor can be an established tumor.
- the cells can be in vivo or ex vivo, including cells obtained from a biopsy.
- the presence of a tumor indicates that the tumor can be treated using the methods provided herein.
- a subject with an N-Myc-positive or c-Myc-positive tumor is selected for treatment, for example, by detecting N-Myc or c-Myc expression and/or activity in a biological sample obtained from the subject.
- upregulated expression of the MYCN gene (for example, as detected by an increase in mRNA of MYCN, N-Myc protein, or the expression of genes up-regulated by N-Myc compared to a control) can be detected, and in some examples quantified.
- the MYCN gene expression in the biological sample is compared to a control (such as a normal, non-tumor sample).
- An increase in the expression of the MYCN gene (such as an increase in mRNA of MYCN, N-Myc protein, or the expression of genes up-regulated by N- Myc) in the biological sample relative to the control indicates the presence of a N-Myc-positive tumor, and can be used to select a subject for treatment with one or more of the compounds or compositions disclosed herein.
- an increase in the test sample of at least 50%, at least 75%, at least 80%, at least 90%, at least 100%, at least 200% or even greater than 500%, relative to the control, indicates the subject (such as a human subject) is likely to respond favorably to treatment with one or more of the agents disclosed herein.
- Suitable methods for detecting and/or monitoring a N-Myc-positive tumor in a subject can be selected by a treating physician.
- a sample is obtained from a subject, and the presence of a cell that expresses N-Myc is assessed in vitro.
- upregulated expression of the MYC gene (for example, as detected by an increase in mRNA of MYC, c-Myc protein, or the expression of genes up-regulated by c-Myc compared to a control) can be detected, and in some examples quantified.
- the MYC gene expression in the biological sample is compared to a control (such as a normal, non-tumor sample).
- An increase in the expression of the MYC gene indicates the presence of a c- Myc-positive tumor, and can be used to select a subject for treatment with one or more of the compounds or compositions disclosed herein.
- an increase in the test sample of at least 50%, at least 75%, at least 80%, at least 90%, at least 100%, at least 200% or even greater than 500%, relative to the control indicates the subject (such as a human subject) is likely to respond favorably to treatment with one or more of the agents disclosed herein.
- Suitable methods for detecting and/or monitoring a c-Myc-positive tumor in a subject can be selected by a treating physician.
- a sample is obtained from a subject, and the presence of a cell that expresses c-Myc is assessed in vitro.
- the subject can be selected for treatment that has, is suspected of having or is at risk of developing a tumor or tumors, such as neuroblastoma or small cell lung cancer.
- a compound according to any one of Formulas I, IA, II, III, IV, or V as well as any representative compound species (e.g., MY-1, MY-2, MY-5, MY-6, MY-7, MY-8, MY-10, MY-11, MY- 12, MY-13, MY-14, B32, B33, B34, B35, or B38) disclosed herein (or a pharmaceutical composition containing same) of the disclosure can be for either prophylactic or therapeutic purpose.
- the compound is provided in advance of any symptom of an initial occurrence of a tumor and/or cancer or of a recurrence of a previously treated tumor and/or cancer.
- the prophylactic administration of the compound serves to prevent or ameliorate any subsequent disease process.
- the compound is provided at (or shortly after) the onset of a symptom of disease or infection.
- a disclosed compound according to any one of Formulas I, IA, II, III, IV, or V, as well as any representative compound species (e.g., MY-1, MY-2, MY-5, MY-6, MY-7, MY-8, MY-10, MY- 11, MY-12, MY-13, MY-14, B32, B33, B34, B35, or B38) disclosed herein (or a pharmaceutical composition containing same) can be administered to a subject to slow or inhibit the growth or metastasis of a tumor and/or cancer.
- a therapeutically effective amount of the compound (or pharmaceutical composition thereof) can be administered to the subject in an amount and under conditions sufficient to bind to a non-canonical G4, such as a non-canonical G4 present in DNA of the MYCN gene, and reduce N-Myc expression, thereby slowing or inhibiting the growth or the metastasis of a tumor, or to inhibit a sign or a symptom of a tumor.
- suitable subjects include those diagnosed with or suspecting of having cancer (for example, a subject having a tumor), for example a subject having a neuroblastoma or small cell lung cancer.
- a disclosed compound according to any one of Formulas I, IA, II, III, IV, or V can be administered to a subject to slow or inhibit the growth or metastasis of a tumor and/or cancer.
- any representative compound species e.g., MY-1, MY-2, MY-5, MY-6, MY-7, MY-8, MY-10, MY- 11, MY-12, MY-13, MY-14, B32, B33, B34, B35, or B38
- a pharmaceutical composition containing same can be administered to a subject to slow or inhibit the growth or metastasis of a tumor and/or cancer.
- a therapeutically effective amount of the compound (or pharmaceutical composition thereof) can be administered to the subject in an amount and under conditions sufficient to bind to a non-canonical G4, such as a non-canonical G4 present in DNA of the MYC gene, and reduce c-Myc expression, thereby slowing or inhibiting the growth or the metastasis of a tumor, or to inhibit a sign or a symptom of a tumor.
- suitable subjects include those diagnosed with or suspecting of having cancer (for example, a subject having a tumor)
- the subject has a cancer that expresses MYCN and/or c-MYC.
- Non-limiting exemplary cancers include sarcomas, carcinomas, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, Kaposi sarcoma, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic cancer, breast cancer, lung cancers, ovarian cancer, uterine cancer, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, adrenal carcinoma, sweat gland carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytomas sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct
- Cancer also includes hematological (or hematogenous) cancers, such as leukemia, such as lymphoma, Hodgkin's disease, non-Hodgkin's lymphoma (indolent or high grade forms), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, myelodysplastic syndrome, hairy cell leukemia or myelodysplasia.
- leukemia such as lymphoma, Hodgkin's disease, non-Hodgkin's lymphoma (indolent or high grade forms), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, myelodysplastic syndrome, hairy cell leukemia or myelodysplasia.
- the cancer is neuroblastoma, rhabdomyosarcoma, prostate cancer, or small cell lung cancer.
- the therapeutically effective amount will depend upon the severity of the disease and the general state of the subject’s health.
- a therapeutically effective amount is that which provides either subjective relief of one or more symptoms or an objectively identifiable improvement as noted by the clinician or other qualified observer.
- a therapeutically effective amount is the amount necessary to inhibit tumor growth, or the amount that is effective at reducing a sign or a symptom of the tumor.
- the therapeutically effective amount of the agents administered can vary depending upon the desired effects and the subject to be treated. In some examples, therapeutic amounts are amounts which eliminate or reduce the patient's tumor burden, or which prevent or reduce the proliferation of metastatic cells.
- the actual dosage of the compound can vary according to factors such as the disease indication and particular status of the subject (for example, the subject’s age, size, fitness, extent of symptoms, susceptibility factors, and the like), time and route of administration, other drugs or treatments being administered concurrently, as well as the specific pharmacology of the compound for eliciting the desired activity or biological response in the subject. Dosage regimens can be adjusted to provide an optimum prophylactic or therapeutic response. A therapeutically effective amount is also one in which any toxic or detrimental side effects of the compound and/or other biologically active agent is outweighed in clinical terms by therapeutically beneficial effects.
- a non-limiting range for a therapeutically effective amount of a compound and/or other biologically active agent within the methods and formulations of the disclosure is about 0.01 mg/kg body weight to about 20 mg/kg body weight, such as about 0.05 mg/kg to about 5 mg/kg body weight, or about 0.2 mg/kg to about 2 mg/kg body weight.
- Dosage can be varied by the attending clinician to maintain a desired concentration at a target site (for example, the lungs or systemic circulation). Higher or lower concentrations can be selected based on the mode of delivery, for example, trans-epidermal, rectal, oral, pulmonary, intraosseous, or intranasal delivery versus intravenous or subcutaneous or intramuscular delivery.
- Dosage can also be adjusted based on the release rate of the administered formulation, for example, of an intrapulmonary spray versus powder, sustained release oral versus injected particulate or transdermal delivery formulations, and so forth.
- Any method of administration can be used for the disclosed therapeutic agents, including local and systemic administration.
- topical, oral, intravascular such as intravenous, intramuscular, intraperitoneal, intranasal, intradermal, intrathecal and subcutaneous administration can be used.
- the particular mode of administration and the dosage regimen will be selected by the attending clinician, taking into account the particulars of the case (for example the subject, the disease, the disease state involved, and whether the treatment is prophylactic). In cases in which more than one agent or composition is being administered, one or more routes of administration may be used.
- administration is oral, intravascular such as intravenous, intramuscular, intraperitoneal, intranasal, or intrathecal.
- the compound can be administered to the subject by the oral route or in a single bolus delivery, via continuous delivery (for example, continuous intravenous delivery) over an extended time period, or in a repeated administration protocol (for example, by an hourly, daily or weekly, repeated administration protocol).
- the therapeutically effective dosage of the compound can be provided as repeated doses within a prolonged prophylaxis or treatment regimen that will yield clinically significant results to alleviate one or more symptoms or detectable conditions associated with a targeted disease or condition as set forth herein.
- Determination of effective dosages in this context is typically based on animal model studies followed up by human clinical trials and is guided by administration protocols that significantly reduce the occurrence or severity of targeted disease symptoms or conditions in the subject.
- Suitable models in this regard include, for example, murine, rat, avian, dog, sheep, porcine, feline, non-human primate, and other accepted animal model subjects known in the art.
- effective dosages can be determined using in vitro models. Using such models, only ordinary calculations and adjustments are required to determine an appropriate concentration and dose to administer a therapeutically effective amount of the compound (for example, amounts that are effective to alleviate one or more symptoms of a targeted disease).
- an effective amount or effective dose of the compound may simply inhibit or enhance one or more selected biological activities correlated with a disease or condition, as set forth herein, for either therapeutic or diagnostic purposes.
- local administration of the disclosed compounds can be used, for instance by applying a disclosed compound to a region of tissue from which a tumor has been removed, or a region suspected of being prone to tumor development.
- sustained intra-tumoral (or near- tumoral) release of the pharmaceutical preparation that includes a therapeutically effective amount of a disclosed compound may be beneficial.
- the disclosed compounds can be formulated in unit dosage form suitable for individual administration of precise dosages.
- the disclosed compounds may be administered in a single dose or in a multiple dose schedule.
- a multiple dose schedule is one in which a primary course of treatment may be with more than one separate dose, for instance 1-10 doses, followed by other doses given at subsequent time intervals as needed to maintain or reinforce the action of the compositions.
- Treatment can involve daily or multi-daily doses of compound(s) over a period of a few days to months, or even years.
- the dosage regimen will also, at least in part, be determined based on the particular needs of the subject to be treated and will be dependent upon the judgment of the administering practitioner.
- the subject is administered a therapeutic composition that includes one or more of the disclosed compounds on a multiple daily dosing schedule, such as at least two consecutive days, 10 consecutive days, and so forth, for example for a period of weeks, months, or years.
- the subject is administered the composition for a period of at least 30 days, such as at least 2 months, at least 4 months, at least 6 months, at least 12 months, at least 24 months, or at least 36 months.
- the disclosed methods include providing surgery, radiation therapy, and/or chemotherapeutics to the subject in combination with administration of a disclosed compound or composition containing same. Methods and therapeutic dosages of such agents and treatments are known to those skilled in the art, and can be determined by a skilled clinician. Preparation and dosing schedules for the additional agent may be used according to manufacturer's instructions or as determined empirically by the skilled practitioner. Preparation and dosing schedules for such chemotherapy are also described in Chemotherapy Service, (1992) Ed., M. C.
- Non-limiting examples of additional therapeutic agents that can be used with the combination therapy include microtubule binding agents, DNA intercalators or cross-linkers, DNA synthesis inhibitors, DNA and RNA transcription inhibitors, antibodies, enzymes, enzyme inhibitors, gene regulators, angiogenesis inhibitors, and proteosome inhibitors (such as bortezomib or carfilzomib). These agents (which are administered at a therapeutically effective amount) and treatments can be used alone or in combination. For example, any suitable anti-cancer or anti-angiogenic agent can be administered in combination with the compounds disclosed herein. Methods and therapeutic dosages of such agents are known to those skilled in the art, and can be determined by a skilled clinician.
- Additional chemotherapeutic agents include, but are not limited to alkylating agents, such as nitrogen mustards (for example, chlorambucil, chlormethine, cyclophosphamide, ifosfamide, and melphalan), nitrosoureas (for example, carmustine, fotemustine, lomustine, and streptozocin), platinum compounds (for example, carboplatin, cisplatin, oxaliplatin, and BBR3464), busulfan, dacarbazine, mechlorethamine, procarbazine, temozolomide, thiotepa, and uramustine; antimetabolites, such as folic acid (for example, methotrexate, pemetrexed, and raltitrexed), purine (for example, cladribine, clofarabine, fludarabine, mercaptopurine, and tioguanine), pyrimidine (for example, capecitabine),
- the combination therapy may provide synergy and prove synergistic, that is, the effect achieved when the active ingredients used together is greater than the sum of the effects that results from using the compounds separately.
- a synergistic effect may be attained when the active ingredients are: (1) co- formulated and administered or delivered simultaneously in a combined, unit dosage formulation; (2) delivered by alternation or in parallel as separate formulations; or (3) by some other regimen.
- a synergistic effect may be attained when the compounds are administered or delivered sequentially, for example by different injections in separate syringes.
- an effective dosage of each active ingredient is administered sequentially, i.e.
- the compound that is used in the method can be any compound according to the present disclosure and including 6-(3-(4-methoxyphenyl)-1,2,4- oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazin-3-amine; N-(3-([1,4'-bipiperidin]-1'-yl)propyl)-6-(3- (4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine; 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)- N-(3-(4-methylpiperazin-1-yl)propyl)pyridazin-3-amine; N1-(6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl)propyl
- compositions prepared for administration to a cell, such as an ex vivo, in vivo, or in vitro cell, and which include a therapeutically effective amount of one or more of the compounds disclosed herein.
- the therapeutically effective amount of a disclosed compound will depend on the route of administration, the species of subject and the physical characteristics of the subject being treated. Specific factors that can be taken into account include disease severity and stage, weight, diet and concurrent medications. The relationship of these factors to determining a therapeutically effective amount of the disclosed compounds is understood by those of skill in the art.
- compositions for administration to a subject can include at least one further pharmaceutically acceptable additive such as carriers, thickeners, diluents, buffers, preservatives, surface active agents and the like in addition to the molecule of choice.
- Pharmaceutical compositions can also include one or more additional active ingredients such as antimicrobial agents, anti-inflammatory agents, anesthetics, and the like.
- additional active ingredients such as antimicrobial agents, anti-inflammatory agents, anesthetics, and the like.
- the pharmaceutically acceptable carriers useful for these formulations are conventional. Remington’s Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 19th Edition (1995), describes compositions and formulations suitable for pharmaceutical delivery of the compounds herein disclosed. In general, the nature of the carrier will depend on the particular mode of administration being employed.
- parenteral formulations usually contain injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
- pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
- conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate.
- pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- compositions disclosed herein include those formed from pharmaceutically acceptable salts and/or solvates of the disclosed compounds.
- Pharmaceutically acceptable salts include those derived from pharmaceutically acceptable inorganic or organic bases and acids. Particular disclosed compounds possess at least one basic group that can form acid–base salts with acids. Examples of basic groups include, but are not limited to, amino and imino groups. Examples of inorganic acids that can form salts with such basic groups include, but are not limited to, mineral acids such as hydrochloric acid, hydrobromic acid, sulfuric acid or phosphoric acid.
- Basic groups also can form salts with organic carboxylic acids, sulfonic acids, sulfo acids or phospho acids or N-substituted sulfamic acid, for example acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic acid, 2-phenoxybenzoic acid, 2- acetoxybenzoic acid, embonic acid, nicotinic acid or isonicotinic acid, and, in addition, with amino acids, for example with ⁇ -amino acids, and also with methanesulfonic acid, ethanesulfonic acid, 2- hydroxymethanesulfonic acid, ethane-1,2-disulf
- suitable salts include those derived from alkali metals such as potassium and sodium, alkaline earth metals such as calcium and magnesium, among numerous other acids well known in the pharmaceutical art.
- Certain compounds include at least one acidic group that can form an acid–base salt with an inorganic or organic base.
- salts formed from inorganic bases include salts of the presently disclosed compounds with alkali metals such as potassium and sodium, alkaline earth metals, including calcium and magnesium and the like.
- salts of acidic compounds with an organic base such as an amine
- an organic base such as an amine
- an organic base such as an amine
- salts formed with basic amino acids aliphatic amines, heterocyclic amines, aromatic amines, pyridines, guanidines and amidines.
- aliphatic amines the acyclic aliphatic amines, and cyclic and acyclic di- and tri- alkyl amines are particularly suitable for use in the disclosed compounds.
- quaternary ammonium counterions also can be used.
- Suitable amine bases for use in the present compounds include, without limitation, pyridine, N,N-dimethylaminopyridine, diazabicyclononane, diazabicycloundecene, N-methyl-N-ethylamine, diethylamine, triethylamine, diisopropylethylamine, mono-, bis- or tris- (2-hydroxyethyl)amine, 2-hydroxy-tert-butylamine, tris(hydroxymethyl)methylamine, N,N- dimethyl-N-(2- hydroxyethyl)amine, tri-(2-hydroxyethyl)amine and N-methyl-D-glucamine.
- Compounds disclosed herein can be crystallized and can be provided in a single crystalline form or as a combination of different crystal polymorphs. As such, the compounds can be provided in one or more physical form, such as different crystal forms, crystalline, liquid crystalline or non-crystalline (amorphous) forms. Such different physical forms of the compounds can be prepared using, for example different solvents or different mixtures of solvents for recrystallization. Alternatively or additionally, different polymorphs can be prepared, for example, by performing recrystallizations at different temperatures and/or by altering cooling rates during recrystallization.
- compositions can be administered to subjects by a variety of mucosal administration modes, including by oral, rectal, intranasal, intrapulmonary, or transdermal delivery, or by topical delivery to other surfaces.
- mucosal administration modes including by oral, rectal, intranasal, intrapulmonary, or transdermal delivery, or by topical delivery to other surfaces.
- the compositions can be administered by non-mucosal routes, including by intramuscular, subcutaneous, intravenous, intra-arterial, intra-articular, intraperitoneal, intrathecal, intracerebroventricular, or parenteral routes.
- the compound can be administered ex vivo by direct exposure to cells, tissues or organs originating from a subject.
- the compound can be combined with various pharmaceutically acceptable additives, as well as a base or vehicle for dispersion of the compound.
- Desired additives include, but are not limited to, pH control agents, such as arginine, sodium hydroxide, glycine, hydrochloric acid, citric acid, and the like.
- local anesthetics for example, benzyl alcohol
- isotonizing agents for example, sodium chloride, mannitol, sorbitol
- adsorption inhibitors for example, Tween 80 or Miglyol 812
- solubility enhancing agents for example, cyclodextrins and derivatives thereof
- stabilizers for example, serum albumin
- reducing agents for example, glutathione
- Adjuvants such as aluminum hydroxide (for example, Amphogel, Wyeth Laboratories, Madison, NJ), Freund’s adjuvant, MPL ⁇ (3-O-deacylated monophosphoryl lipid A; Corixa, Hamilton, IN) and IL-12 (Genetics Institute, Cambridge, MA), among many other suitable adjuvants well known in the art, can be included in the compositions.
- MPL ⁇ 3-O-deacylated monophosphoryl lipid A; Corixa, Hamilton, IN
- IL-12 Geneetics Institute, Cambridge, MA
- the tonicity of the solution is adjusted to a value of about 0.3 to about 3.0, such as about 0.5 to about 2.0, or about 0.8 to about 1.7.
- the compound can be dispersed in a base or vehicle, which can include a hydrophilic compound having a capacity to disperse the compound, and any desired additives.
- the base can be selected from a wide range of suitable compounds, including but not limited to, copolymers of polycarboxylic acids or salts thereof, carboxylic anhydrides (for example, maleic anhydride) with other monomers (for example, methyl (meth)acrylate, acrylic acid and the like), hydrophilic vinyl polymers, such as polyvinyl acetate, polyvinyl alcohol, polyvinylpyrrolidone, cellulose derivatives, such as hydroxymethylcellulose, hydroxypropylcellulose and the like, and natural polymers, such as chitosan, collagen, sodium alginate, gelatin, hyaluronic acid, and nontoxic metal salts thereof.
- copolymers of polycarboxylic acids or salts thereof include but not limited to, copolymers of polycarboxylic acids or salts thereof, carboxylic anhydrides (for example, maleic anhydride) with other monomers (for example, methyl (meth)acrylate, acrylic acid and the like), hydrophilic vinyl polymers,
- a biodegradable polymer is selected as a base or vehicle, for example, polylactic acid, poly(lactic acid-glycolic acid) copolymer, polyhydroxybutyric acid, poly(hydroxybutyric acid- glycolic acid) copolymer and mixtures thereof.
- synthetic fatty acid esters such as polyglycerin fatty acid esters, sucrose fatty acid esters and the like can be employed as vehicles.
- Hydrophilic polymers and other vehicles can be used alone or in combination, and enhanced structural integrity can be imparted to the vehicle by partial crystallization, ionic bonding, cross-linking and the like.
- the vehicle can be provided in a variety of forms, including fluid or viscous solutions, gels, pastes, powders, microspheres and films for direct application to a mucosal surface.
- the compound can be combined with the base or vehicle according to a variety of methods, and release of the compound can be by diffusion, disintegration of the vehicle, or associated formation of water channels.
- the compound is dispersed in microcapsules (microspheres) or nanocapsules (nanospheres) prepared from a suitable polymer, for example, isobutyl 2-cyanoacrylate (see, for example, Michael et al., J.
- compositions of the disclosure can alternatively contain as pharmaceutically acceptable vehicles substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, and triethanolamine oleate.
- pharmaceutically acceptable vehicles substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, and triethanolamine oleate.
- nontoxic pharmaceutically acceptable vehicles can be used which include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.
- Pharmaceutical compositions for administering the compound can also be formulated as a solution, microemulsion, or other ordered structure suitable for high concentration of active ingredients.
- the vehicle can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), and suitable mixtures thereof.
- Proper fluidity for solutions can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of a desired particle size in the case of dispersible formulations, and by the use of surfactants.
- a coating such as lecithin
- surfactants for example, sugars, polyalcohols, such as mannitol and sorbitol, or sodium chloride in the composition.
- Prolonged absorption of the compound can be brought about by including in the composition an agent which delays absorption, for example, monostearate salts and gelatin.
- the compound can be administered in a time release formulation, for example in a composition which includes a slow release polymer.
- compositions can be prepared with vehicles that will protect against rapid release, for example a controlled release vehicle such as a polymer, microencapsulated delivery system or bioadhesive gel. Prolonged delivery in various compositions of the disclosure can be brought about by including in the composition agents that delay absorption, for example, aluminum monostearate hydrogels and gelatin.
- controlled release binders suitable for use in accordance with the disclosure include any biocompatible controlled release material which is inert to the active agent and which is capable of incorporating the compound and/or other biologically active agent. Numerous such materials are known in the art.
- Useful controlled-release binders are materials that are metabolized slowly under physiological conditions following their delivery (for example, at a mucosal surface, or in the presence of bodily fluids).
- Appropriate binders include, but are not limited to, biocompatible polymers and copolymers well known in the art for use in sustained release formulations. Such biocompatible compounds are non-toxic and inert to surrounding tissues, and do not trigger significant adverse side effects, such as nasal irritation, immune response, inflammation, or the like. They are metabolized into metabolic products that are also biocompatible and easily eliminated from the body.
- Exemplary polymeric materials for use in the present disclosure include, but are not limited to, polymeric matrices derived from copolymeric and homopolymeric polyesters having hydrolyzable ester linkages.
- Exemplary polymers include polyglycolic acids and polylactic acids, poly(DL- lactic acid-co-glycolic acid), poly(D-lactic acid-co-glycolic acid), and poly(L-lactic acid-co-glycolic acid).
- biodegradable or bioerodable polymers include, but are not limited to, such polymers as poly(epsilon-caprolactone), poly(epsilon-aprolactone-CO-lactic acid), poly(epsilon.-aprolactone-CO-glycolic acid), poly(beta-hydroxy butyric acid), poly(alkyl-2-cyanoacrilate), hydrogels, such as poly(hydroxyethyl methacrylate), polyamides, poly(amino acids) (for example, L-leucine, glutamic acid, L-aspartic acid and the like), poly(ester urea), poly(2-hydroxyethyl DL-aspartamide), polyacetal polymers, polyorthoesters, polycarbonate, polymaleamides, polysaccharides, and copolymers thereof.
- polymers such as polymers as poly(epsilon-caprolactone), poly(epsilon-aprolactone-CO-lactic acid
- compositions of the disclosure typically are sterile and stable under conditions of manufacture, storage and use.
- Sterile solutions can be prepared by incorporating the compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated herein, as required, followed by filtered sterilization.
- dispersions are prepared by incorporating the compound and/or other biologically active agent into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated herein.
- methods of preparation include vacuum drying and freeze-drying which yields a powder of the compound plus any additional desired ingredient from a previously sterile-filtered solution thereof.
- kits, packages and multi-container units containing the herein described pharmaceutical compositions, active ingredients, and/or means for administering the same for use in the prevention and treatment of diseases and other conditions in mammalian subjects.
- Kits for diagnostic use are also provided.
- these kits include a container or formulation that contains one or more of the compounds described herein.
- this component is formulated in a pharmaceutical preparation for delivery to a subject.
- the compound is optionally contained in a bulk dispensing container or unit or multi-unit dosage form.
- Optional dispensing means can be provided, for example a pulmonary or intranasal spray applicator.
- Packaging materials optionally include a label or instruction indicating for what treatment purposes and/or in what manner the pharmaceutical agent packaged therewith can be used.
- the compound implementation that is used in the composition can be any compound according to the present disclosure and including 6-(3-(4- methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-yl)propyl)pyridazin-3-amine; N-(3-([1,4'- bipiperidin]-1'-yl)propyl)-6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-amine; 6-(3-(4- methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(4-methylpiperazin-1-yl
- ring A is a 5-membered heteroaryl ring other than thiophenyl, thiazolyl, furanyl, triazolyl, thiadiazolyl, and 1,3,4-oxadiazolyl
- ring B is a 6-membered heteroaryl ring containing at least two nitrogen atoms
- R 1 is -(linker)t-R b wherein R b is aromatic, heteroaliphatic, or aliphatic; the linker is an aliphatic or heteroaliphatic group; and t is 0 or 1
- R 2 is H or aliphatic; each R 3 independently is heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; each R 4 independently is H, aliphatic, or halo;
- x is an integer selected from 0 to 5; and n is an integer selected
- ring A is a 5-membered heteroaryl ring
- ring B is a 6-membered heteroaryl ring containing at least two nitrogen atoms
- R 1 is –(CR a 2 ) m -R b where each R a independently is H, alkyl, or halo, m is 1, 2, 3, 4, or 5, and R b is a nitrogen-containing group
- R 2 is H or alkyl
- each R 3 independently is alkoxy, hydroxy, aliphatic, or halo
- each R 4 independently is H, alkyl, or halo
- n is 0, 1, 2, or 3
- x is 0, 1, 2, 3, 4, or 5, with the proviso that the compound does not comprise the structure set forth as any one of MY-1, MY-2, MY-10, MY-11, or MY-12.
- ring A is a 5-membered heteroaryl ring
- ring B is a 6-membered heteroaryl ring containing at least two nitrogen atoms
- R 1 is -(CR a 2 ) m -R b or -[(CR a 2 ) m O] r -(CH 2 ) s -R b , wherein each R a independently is H, aliphatic, or halo; t is 1, 2, 3, 4, or 5; r is 1, 2, 3, 4, or 5; s is 0 or 1; and R b is an acridinyl group;
- R 2 is H or aliphatic; each R 3 independently is heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; each R 4 independently is H, aliphatic, or halo;
- x is an integer
- ring A is , where: each bond represented by ----- is a single or double bond as needed to satisfy valence requirements; and each of X 1 , X 2 , and X 3 independently is N, O, S, or C(R c ) where R c is H, alkyl, or halo, provided that at least one of X 1 , X 2 , and X 3 is other than C(R c ).
- ring A is , , In any or all of these representative implementations, ring A is .
- each of Y 1 , Y 2 , Y 3 , and Y 4 independently is N or C(R c ) where R c is H, alkyl, or halo, provided that at least two of Y 1 , Y 2 , Y 3 , and Y 4 are N.
- ring B is , , or .
- ring B is .
- (i) x is 1, 2, or 3; or (ii) one R 3 is in a para position to ring A; or (iii) both (i) and (ii).
- n is 0.
- each R 3 independently is C1-C3 alkoxy or hydroxy.
- x is 1 and R 3 is methoxy.
- the compound has a structure according to Formula II Formula II.
- R 2 is H.
- the compound has a structure according to Formula III Formula III.
- R 1 is –(CH2)m-R b .
- m is 2 or 3.
- R b is an N-containing cyclic group -N(R c ) 2 , or -C(O)N(R c ) 2 where each R c is H or alkyl.
- R 1 is: In any or all of these representative implementations, the compound is:
- the compound has a structure according to Formula IV Formula IV wherein the linker is -(CR a 2 ) m - or -[(CR a 2 ) m O] r -(CR a 2 ) s - wherein each R a independently is H, aliphatic, or halo; m is 1, 2, 3, 4, or 5; r is 1, 2, 3, 4, or 5; and s is 0 or 1.
- the compound has a structure according to Formula V Formula V wherein the linker is -(CH2)m- or -[(CH2)mO]r-(CH2)s- wherein m is 1, 2, 3, 4, or 5; r is 1, 2, 3, 4, or 5; and s is 0 or 1.
- R 1 is:
- the compound is: .
- a pharmaceutical composition comprising a compound according to any or all of the representative implementations described above and at least one pharmaceutically acceptable additive.
- the pharmaceutical composition comprises a unit dosage form of a therapeutic amount of the compound.
- the pharmaceutical composition further comprises an anticancer agent.
- a method of decreasing cancer-relevant protein expression in a cell comprising contacting the cell with an effective amount of a compound, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, according to Formula IA
- R 1 is -(linker)t-R b wherein R b is aromatic, heteroaliphatic, or aliphatic; the linker is an aliphatic or heteroaliphatic group; and t is 0 or 1
- R 2 is H or aliphatic; each R 3 independently is heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo;
- x is an integer selected from 0 to 5; and provided that the compound is not 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl
- Also disclosed is a method of decreasing cancer-relevant protein expression in a cell comprising contacting the cell with an effective amount of a compound, or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, according to any or all of the above listed representative implementations concerning Formulas, I, II, III, IV, and V.
- each bond represented by is a single or double bond as needed to satisfy valence requirements, and each of X 1 , X 2 , and X 3 independently is N, O, S, or C(R c ) where R c is H or alkyl, provided that at least one of X 1 , X 2 , and X 3 is other than C(R c ); or (ii) ring B is where each of Y 1 , Y 2 , Y 3 , and Y 4 independently is N or C(R c ) where R c is H or alkyl, provided that at least two of Y 1 , Y 2 , Y 3 , and Y 4 are N; or (iii) both (i) and (ii).
- ring A is ; or (ii) ring B is ; or (iii) both (i) and (ii).
- R 2 is H; or (ii) R 3 is C1-C3 alkoxy or hydroxy; or (iii) x is 1, 2, or 3; or (iv) one R 3 is in a para position to ring A; (v) n is 0; or (vi) any combination of (i), (ii), (iii), (iv), and (v).
- the compound has a structure according to any one of Formulas II, III, IV, or V Formula V wherein for Formulas VI and V, the linker is -(CR a 2)m- or -[(CR a 2)mO]r-(CR a 2)s- wherein each R a independently is H, aliphatic, or halo; m is 1, 2, 3, 4, or 5; r is 1, 2, 3, 4, or 5; and s is 0 or 1.
- the compound is:
- the compound is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl
- the compound is .
- the cell is in vitro.
- the cell is in vivo.
- decreasing cancer-relevant protein expression in the cell decreases growth and/or proliferation of the cell.
- the cell is a cell with overexpression of the MYCN gene.
- the compound selectively binds to a non-canonical G4 quadruplex nucleic acid region in the MYCN gene.
- the non-canonical G4 quadruplex nucleic acid region comprises a hairpin structure.
- the cell is a cancer cell in a subject, and wherein the method further comprising treating or preventing cancer in the subject, comprising the step of administering to a subject in need thereof a therapeutically effective amount of the compound, or the pharmaceutically acceptable salt or ester thereof, to decrease N-Myc expression in the cancer cell, thereby treating or preventing the cancer in the subject.
- the cancer cell is a neurological cancer cell or a lung cancer cell.
- the cancer is neuroblastoma, rhabdomyosarcoma, prostate cancer, or small cell lung cancer.
- treating the cancer comprises decreasing tumor volume, decreasing the number or size of metastases, or lessening a symptom of the cancer.
- the method further comprises administering a therapeutically effective amount of an additional anticancer agent to the subject.
- a use of a compound or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, according to Formula IA, for decreasing N-Myc expression in a cell comprising contacting the cell with an effective amount of the compound according to Formula IA Formula IA wherein each of X 1 , X 2 , and X 3 independently is N or O; R 1 is -(linker)t-R b wherein R b is aromatic, heteroaliphatic, or aliphatic; the linker is an aliphatic or heteroaliphatic group; and t is 0 or 1; R 2 is H or aliphatic; each R 3 independently is heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; x is an integer selected from 0 to 5; and provided that the compound is not 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1-
- a use of a compound or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, according to any or all representative implementations described herein for Formulas I, II, III, IV, and V for decreasing N-Myc expression in a cell comprising contacting the cell with an effective amount of the compound according any or all representative implementations described herein for Formulas I, II, III, IV, and V.
- a compound or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, according to Formula IA, for treating or preventing cancer in a subject wherein the compound has a structure according to Formula IA: Formula IA wherein each of X 1 , X 2 , and X 3 independently is N or O; R 1 is -(linker) t -R b wherein R b is aromatic, heteroaliphatic, or aliphatic; the linker is an aliphatic or heteroaliphatic group; and t is 0 or 1; R 2 is H or aliphatic; each R 3 independently is heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; x is an integer selected from 0 to 5; and provided that the compound is not 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin-1- yl)
- a compound or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof, according to Formula IA in the manufacture of a medicament for treating or preventing cancer in a subject, wherein the compound has a structure according to Formula IA Formula IA wherein each of X 1 , X 2 , and X 3 independently is N or O; R 1 is -(linker) t -R b wherein R b is aromatic, heteroaliphatic, or aliphatic; the linker is an aliphatic or heteroaliphatic group; and t is 0 or 1; R 2 is H or aliphatic; each R 3 independently is heteroaliphatic, hydroxy, aliphatic, haloaliphatic, or halo; x is an integer selected from 0 to 5; and provided that the compound is not 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)-N-(3-(pyrrolidin
- a compound or a stereoisomer, tautomer, or pharmaceutically acceptable salt or ester thereof according to any or all representative implementations described herein for Formulas I, II, III, IV, and V in the manufacture of a medicament for treating or preventing cancer in a subject, wherein the compound has a structure according to any or all representative implementations described herein for Formulas I, II, III, IV, and V. VIII. Examples The following examples are provided to illustrate particular features of certain implementations, but the scope of the claims should not be limited to those features exemplified.
- MYCN G4 oligonucleotides (5′-AGG GGG TGG GAG GGG GCA TGC AGA TGC AGG GGG T- 3′, SEQ ID NO: 7) with or without labeling were purchased from Integrated DNA Technology.
- Other sequences of DNA/RNA samples used for binding specificity study are summarized in FIGS.1-2: Hit compounds for binding validation were purchased from ChemDiv and Chembridge. Analogs of compound MY-1 were synthesized in house or purchased.
- the RNA extraction kit RNeasy Plus Mini kit (#74134) was purchased from Qiagen, CA.
- the cDNA synthesis kit High-Capacity RNA-to-cDNATM Kit (#4387406) was purchased from Life Technologies (Invitrogen), New York.
- the Fast SYBRTM Green Master Mix was purchased from Life Technologies (Invitrogen), NY.
- the anti-N-Myc (B8.4.B): sc-53993 antibody (1:4000 dilution; Santa Cruz Biotechnology (SCB), USA), the anti-GAPDH (0411): sc-47724 antibody (1:2000 dilution; SCB, USA), and the goat anti-mouse IgG-HRP: sc-2005 antibody (1:1000 dilution; SCB, USA) were used for immunoblots.
- General chemistry methods All chemical reagents were obtained from commercial suppliers and used without further purification.
- the analytes were eluted using a water/acetonitrile gradient with 0.1% formic acid. Data were acquired at high resolution (1,700 m/z), 4 GHz. To maintain mass accuracy during the run time, an internal mass calibration sample was infused continuously during the LC/MS runs. Data acquisition and analysis were performed using MassHunter Workstation Data Software, LCMS Data Acquisition (version B.06.01) and Qualitative Analysis (version B.07.00). Small molecule microarray screening. Small molecule microarrays (SMMs) were prepared on 2D epoxy glass slides (Schott).
- 5′Cy5-labeled MYCN G4 DNA sample was first prepared in the annealing buffer (10 mM Tris, pH 7.0, 100 mM KCl) at 10 ⁇ M concentration.
- the DNA sample was incubated in a heating block at 95 °C for 5 min, then slowly cooled down to room temperature for more than 1 h.
- the folded DNA was diluted into the screening buffer (10 mM Tris, pH 7.0, 100 mM KCl, 0.005% Tween 20) to meet the final concentration of 50 nM.
- a SMM slide was placed into a 4-well slide holder and incubated with 3 mL 10 ⁇ tRNA (500 nM in screening buffer) for 2 h.
- the slide was carefully washed by screening buffer and incubated with 3 mL MYCN G4 DNA solution (including 10 ⁇ tRNA) for another 2 h. After incubation, the slide was transferred into a 50 mL conical tube and gently washed with PBST and ddH2O for 3 times in each buffer solution. Then, the slide was dried by centrifuging at 1,700 g for 2 minutes. Finally, the slide with SMM was imaged by a fluorescence scanner (InnoScan 1100 AL) at 647 nm, with a resolution of 5 ⁇ m.
- a fluorescence scanner InnoScan 1100 AL
- fluorescence intensity assay was used for both validation of hit binding at a single dose and binding affinity determination.
- compounds were considered binders when a change of >10% change in fluorescence intensity was observed compared to that of negative control (DMSO solution).
- DMSO solution negative control
- small molecule solutions were prepared as serial dilutions in DMSO. Then a final test plate was prepared by adding 5 ⁇ L small molecule solutions and 10 ⁇ L annealed DNA samples into 85 ⁇ L buffer solutions, resulting in the final small molecule concentrations from 0 to 250 ⁇ M (5% final DMSO concentration).
- the fluorescence intensities were normalized, and the binding affinity was calculated by fitting the curve using one-site total model in GraphPad Prism 8.3.1 software.
- the fluorescence titration using 3′-labeled oligonucleotides was also performed the same way.
- Fluorescence displacement assay Fluorescence displacement assays were carried out by using two classical minor groove binders (Hoechst 33258 and netropsin). Hoechst 33258, as a fluorophore, was prepared at 5 ⁇ M concentration in the buffer (10 mM Tris, pH7.0, 100 mM KCl), and then titrated with different concentrations of unlabeled MYCN G4 oligonucleotides. For displacement, either compound MY-1 or netropsin was added into the solution resulting in a final concentration of 5 ⁇ M or 50 ⁇ M. Fluorescence signals were obtained with an excitation wavelength of 352 nm and an emission wavelength of 500 nm. Surface plasmon resonance (SPR) analysis.
- SPR Surface plasmon resonance
- the SPR binding assays were performed with a BIAcore 3000 (GE Healthcare) instrument.
- a CM5 SPR biochip was loaded into the system and primed with running buffer (10 mM Tris, pH7.0, 100 mM KCl, 0.005% Tween 20, 5% DMSO) with a flow rate of 5 ⁇ L/min.
- running buffer 10 mM Tris, pH7.0, 100 mM KCl, 0.005% Tween 20, 5% DMSO
- Fc 1 and 2 were activated by EDC/NHS (0.4 M/0.1 M) aqueous solution for 15 min, followed with an injection of streptavidin (SA) solution (0.2 mg/mL in 10 mM sodium acetate buffer, pH4.5) for 30 minutes.
- SA streptavidin
- the surface was deactivated by flowing 1 M Ethanolamine aqueous solution (pH 8.5) for 10 min and regenerated with 10 mM NaOH for 2 min to remove the unbound SA.
- biotinylated MYCN G4 DNA was prepared at 5 ⁇ M in the annealing buffer and heated up to 95 °C for 5 min and slowly cooled down. After annealing, a total of 150 ⁇ L solution was injected in the Fc 2 of SPR system for 30 min to immobilize DNA onto the chip surface. The small molecule solutions were tested once the baseline was stable.
- KD binding affinity
- a series of diluted compound solutions were injected and K D was calculated by BIAevaluation 4.0 software (GE Healthcare) using Langmuir 1:1 binding model.
- the folded G-quadruplex structure was characterized by circular dichroism using a J-1500 circular dichroism spectrometer (Jasco).
- Unlabeled MYCN oligonucleotide (5′-AGG GGG TGG GAG GGG GCA TGC AGA TGC AGG GGG T-3′, SEQ ID NO: 7) was prepared in annealing buffer (10 mM Tris, pH7.0, 100 mM KCl) at 5 ⁇ M concentration.
- DNA samples diluted in Li + -containing buffer (10 mM Tris, pH7.0, 100 mM LiCl) and H2O were also used as negative controls.
- the annealing procedure was the same as mentioned above.
- CD spectra were recorded from 320 nm to 200 nm at 25 °C with a step of 1 nm. Each spectrum was obtained by averaging the signals of three replicate samples.
- MYCN oligonucleotides were prepared in a low KCl buffer (10 mM Tris, pH7.0, 5 mM KCl) at 5 ⁇ M concentration. To test the stabilization effect, G4 samples were incubated with and without 20 ⁇ M compound (final solution containing 5% DMSO).
- MYCN G4 oligonucleotide with a 2-AP substitution at either A11 or A18 position was annealed by heating the sample to 95 °C for 5 min and cooling down to RT slowly.
- the oligonucleotide with folded structure was diluted to 10 ⁇ M in Tris buffer (10 mM Tris, pH7.0, 100 mM KCl, 0.005% Tween 20) and prepared in a black 96-well plate (Costar) in triplicate as designed.
- binding signals were normalized and the K D value was determined by fitting the curve using a nonlinear sigmoidal dose-response model with a variable slope in GraphPad Prism 8.3.1 software. Job plot analysis. To determine the stoichiometry of binding, a continuous variation method was used by changing the faction of the compound in the solution (Renny et al., Angewandte Chemie 2013, 52:11998-12013). Briefly, stock solutions (5% DMSO containing) of 5 ⁇ M annealed A112-AP labeled MYCN G4 DNA sample and 5 ⁇ M compound were prepared, respectively.
- the 3′-Cy5 MYCN G4 DNA solutions were prepared in 10 mM Tris (pH 7.5), 100 mM KCl, 0.005% T20, annealed (according to the above-mentioned method), and diluted to 100 nM (2 ⁇ ).
- the DMSO solutions of small molecules were prepared in the buffer with a series 1:1 dilution, resulting in 2 ⁇ of designed concentrations (10% DMSO).
- DNA samples were 1:1 (v/v) mixed with corresponding small molecule solutions, resulting in 50 nM DNA and 5% DMSO.
- MST signals were detected in triplicate capillaries, and the dissociation constant was determined by fitting the curve using a single-site model (MO.Affinity Analysis v2.3).
- the folded DNA samples were treated with 0.5% DMS for 10 min at RT and the reaction was stopped by adding 200 ⁇ L stop buffer (2.5 M NH4OAc, 0.1 M ⁇ -mercaptoethanol, 1 mg/mL calf thymus DNA). After phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation, the DNAs were dissolved in 50 ⁇ L of nuclease free water. An equal volume of 10% piperidine was added to each tube, and the mixed solutions were heated at 90 °C for 30 min, followed by quick chilling on ice. The DNAs were again subjected to phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation.
- the precipitated DNAs were dissolved in 10 ⁇ L of nuclease free water, denatured at 95 °C for 5 min, and resolved on a 17% denaturing polyacrylamide gel. After gel running, Cy5-labeled DNA fragments were visualized on a Typhoon Imager (Amersham) and digitized using Image J software. Cell lines and cell culture.
- the neuroblastoma cell line NBEB (Single Copy MYCN) cells were used to evaluate the efficacy of the MYCN/MYCNOs G-quadruplex binding molecules.
- NBEB Single Copy MYCN
- NBEB (300K) cells were treated with MY-8 in 6-well dish for 48 h.
- MYCNOs 32.5 ⁇ M and 45 ⁇ M MY-8 and analyzed at various times (0, 4, 24, 48, 72 and 96 h).
- a Trypan Blue exclusion test was performed following treatment at 48 h and 96 h post treatment and the proportion of live versus dead cells was calculated using a hemocytometer. Cell survival.
- Incucyte measured cell confluence from pre-defined processing definitions for NBEB NB cells.
- the Incucyte Zoom Live-cell Imaging System scanned three phase contrast images per well every 6 h for the duration of treatment (0-120 h).
- Quantitative RT-PCR Total RNA was extracted from NBEB cells according to manufacturer’s instructions (RNeasy Plus Mini Extraction kit (#74134) (Qiagen, CA). RNA (1 ⁇ g) was reverse transcribed into cDNA using the cDNA synthesis High-Capacity RNA-to-cDNATM Kit. Quantitative PCR was performed using Fast SYBRTM Green Master Mix according to the manufacturer’s protocol. Beta-actin was used as a housekeeping gene.
- Relative expression was calculated using the 2( ⁇ Ct) method.
- the qPCR primer sequences can be found in supplementary materials.
- Protein assay Forty-eight hours post-MY-8 treatment in 6-well plates, single copy MYCN cells were lysed directly in the plate with Radioimmunoprecipitation assay buffer (Beyotime, China), pelleted, and chilled at -80 °C. Attributed to poor cellular adhesion, NBEB cells were collected into 1.5 mL microcentrifuge tubes, washed with Phosphate Buffer Solution (Sigma-Aldrich, USA) twice, pelleted, and chilled at -80 °C.
- Nitrocellulose membranes were incubated in 5% milk in Tris-buffered saline supplemented with 0.5% Tween 20 for 1 h at room temperature and incubated with anti-N-Myc: sc-53993 (1:4000) and anti-GAPDH: sc-47724 (1:2000) antibodies overnight at 4 °C. Following incubation, the membranes were washed with Tris-buffered saline supplemented with 0.5% Tween 20 and probed with a goat anti-mouse (1:1000) antibody conjugated to peroxidase and incubated for 1 h at room temperature.
- Chemiluminescent signal was detected using ClarityTM Western ECL Substrate (Bio-Rad, USA) or SupersignalTM West Femto Maximum Sensitivity Substrate (ThermoFisher Scientific, USA) with a ChemiDoc gel imaging system (Bio-Rad, USA). Bioinformatics study. Two files were downloaded from the Gene Expression Omnibus (GSE63874) pertaining to the experimental G4 data (files named “Na_K_PDS_minus_hits_intersect.bed.gz” and “Na_K_PDS_plus_hits_intersect.bed.gz”) (1).
- GSE63874 Gene Expression Omnibus
- the genomic sequences of the bed files were extracted from GRCh37 (hg19) reference genome using bedtools getfasta (bedtools 2.30.0) (2).
- bedtools getfasta bedtools 2.30.0
- the complementary strand sequence was extracted due to the G4 sequences existing on the negative strand of the genome assembly.
- G4-forming sequences were identified from the extracted unique OQs using the regular expression formula: ((G3-6 (N1-33)3 G3-6). The potential for hairpin-forming loops within the G4 sequences was then calculated.
- UNAFold 4.0 was used to calculate hairpin formation from sequences flanked by two G-tracts of length 3 nt in the G4s.
- UNAFold was run using “hybrid-ss-min --NA DNA” setting to output probabilities of each nt position forming a single strand at 37 °C under DNA energy rules (3). Sequences with more than 50% of their nucleotides base paired were identified as hairpin-forming sequences. Then, the hairpin-forming G4s were identified and traced back to the OQs they were extracted from. Coordinates of the G4-hairpin-containing OQs were then converted to GRCh38 (hg38) coordinates using the UCSC Lift Genome Annotations tool (liftOver) (4). The resulting hg38 coordinates were annotated with the GENCODE, hg38 version 36 comprehensive gene annotation GFF3 file (5).
- Promoters were also added to the annotation defined as regions 1000 nt upstream of TSS sites of GENCODE genes. Introns were also added to the GENCODE annotation using the Genome Tools package (genometools 1.6.1) “gt gff3 -addintrons” command (6). Overlapping genomic features with GQ-hairpin-containing OQs were identified using bedtools intersect command. Python 3.8 was used for computational operations not performed by the mentioned software packages. qPCR experiments. The primer sequences for qPCR experiments are detailed as follows: MYCNOs-01 (ENST00000641263.1 – 1,313, bps) Sense 5’- AGGCTCAGTCTCCCTCACTA 3’, SEQ.
- the reaction was stirred at room temperature for 10 min, followed by the addition of 4-methoxybenzamidoxime (605 mg, 3.64 mmol). The reaction mixture was then heated to 120°C and stirred. After 3 h, the reaction mixture was filtered and washed with DMF (3 mL ⁇ 3). The filtrate was collected and dried to yield the target product P1 (344 mg, 46%).
- N 1 -(6-chloro-2-methoxyacridin-9-yl)ethane-1,2-diamine (1): Combine 6,9-dichloro-2-methoxycridine (99.2 mg, 0.357 mmol, 1 equiv), phenol (33.6 mg, 0.357 mmol, 1 equiv) and 1,2-diaminoethane (214 mg, 3.57 mmol, 10 equiv) in a sealed vial and heat at 110 °C for 8 h in the dark. Upon completion by LCMS, the reaction was allowed to cool to room temperature and concentrated onto celite.
- 6-(3-(4-methoxyphenyl)-1,2,4-oxadiazol-5-yl)pyridazin-3-ol (6) To a solution of 6-hydroxypyridazine-3-carboxylic acid (1.50 g, 11 mmol, 1 equiv) in DMF (48 mL) was added triethylamine (3.0 mL, 21 mmol, 2 equiv), HOBt (1.60 g, 11 mmol, 1 equiv) and EDC•HCl (2.40 g, 11 mmol, 1 equiv).
- Example 1 Analysis of G-Quadruplexes in the MYCN Gene
- the MYCN G4 discussed herein is located in the negative strand and near the transcription start site (TSS) of MYCNOS.
- TSS transcription start site
- the MYCN G4 contains a hairpin flanking the tetrads (Benabou et al., Biochim. et Biophys. Acta 2014, 1840(41-52).
- single-concentration binding assays were performed by fluorescence intensity assay (FIA) and surface plasmon resonance (SPR). Compounds were evaluated at 100 ⁇ M concentration in each assay. In this example, a positive binding was defined with a criteria of > 10% quenching in FIA study, while SNR > 3 was used as the cut-off in SPR experiments.
- Compounds 1, 2, MY-1, 5, 10, 11, 12, and 14 were hits in the FIA study; compounds 1-3, MY-1, 5, 9 and 13 were hits in the SPR study. From these assays four compounds (1, 2, MY-1, and 5) were identified that showed positive responses in both binding assays (FIGS.6-8).
- KD Equilibrium dissociation binding constant
- MYCN G4 DNA samples were prepared in 3 different buffer conditions (10 mM Tris with 100 mM KCl, 10 mM Tris with 100 mM LiCl, and H 2 O). As shown in FIG.11A, the MYCN G4 DNA exhibited a positive peak at 263 nm and a negative peak at 240 nm, characteristic of a properly folded parallel G-quadruplex structure in KCl buffer. In contrast, spectra of DNA samples in LiCl buffer and H2O showed a much weaker peak at 263 nm while the peak at 240 nm was negligible. Next, a melting assay was demonstrated on the CD instrument using MYCN G4 DNA incubated without/with small molecule binders that were validated.
- MY-1 was tested together with other two classical minor groove binders (Hoechst 33258 and netropsin) by fluorescence displacement assay (Alniss, J. Medicinal Chemistry 2019, 62:385-402). Since Hoechst 33258 has been reported as a fluorophore and widely used as DNA staining reagent, it was first incubated and titrated with different concentrations of unlabeled MYCN G4 DNAs. By utilizing excitation wavelength of 352 nm and an emission wavelength of 500 nm, the fluorescence intensity was enhanced with the increasing DNA concentration as expected (FIG.24E).
- This assay exploits the ability of DMS to methylate the free N7 within guanines (Gs), which can subsequently be cleaved using piperidine (43,44). In contrast, Hoogsteen bonded Gs in the quadruplex structure remain protected from modification. Further, changes in modification upon incubation with small molecules can be observed near binding sites. 5′Cy5-labeled MYCN G4 was annealed in the presence of 5 mM KCl, and subsequently compounds were added at concentrations according to observed K D s. As shown in FIG.24F, bands corresponding to G10-G12 were dim due to protection indicating that those Gs were incorporated within tetrads in the quadruplex.
- G13-G16 remained unprotected showing much brighter bands, due to hairpin formation via Watson-Crick base pairing.
- concentration-dependent protection of various Gs was observed, indicating that the compound stabilized the G4 structure.
- MY-1, G8, G9, G16, G17 were protected considerably, while G13-G15 were slightly protected. This result suggested that MY-1 was binding to the junction between quadruplex and hairpin, in agreement with multiple results described above. (FIG.24B).
- the biophysical analyses using multiple orthogonal techniques described herein establish that compounds, such as compound MY-1 and MY-8, bind to the MYCN G4 in an atypical manner by interacting with the unique fold formed by the G-tetrad and hairpin. And, in some examples, biological evaluation of MY-8 revealed that it decreased levels of MYCN as well as MYCNOS, downregulating levels of both gene products at the RNA and protein level. Data and information disclosed herein establish that targeting higher order structure within DNA G4s provides a new avenue for developing selective inhibitors that control the expression of undruggable oncogenes. Indeed, higher complexity RNA G4s have been successful frameworks for highly selective small molecule binding.
- hairpin-containing G4s were located in genes of cancer-relevant proteins (such as FOXA3, KRAS, MYCL, and BRD4), (see FIG.29 for representative hairpin-G4s).
- cancer-relevant proteins such as FOXA3, KRAS, MYCL, and BRD4
- FIG.29 for representative hairpin-G4s.
- SPR binding assays were performed to analyze binding activity of representative bivalent compounds of the present disclosure.
- the compounds of this example included a non-canonical binder component and a G4 stacker component.
- a BIAcore 3000 (GE Healthcare) instrument was used.
- CM5 SPR biochip was used and primed with running buffer (10 mM Tris, pH7.0, 100 mM KCl, 0.005% Tween 20, 5% DMSO). To immobilize the compounds onto the chip surface, the flow rate was set as 5 ⁇ L/min. Then the carboxylated dextran on the chip surface was activated by EDC/NHS (0.4 M/0.1 M) aqueous solution for 15 min, followed with an injection of streptavidin (SA) solution (0.2 mg/mL in 10 mM sodium acetate buffer, pH 4.5) for 30 minutes.
- SA streptavidin
- the surface was quenched by injecting 1 M ethanolamine (EA) aqueous solution (pH 8.5) for 10 min and regenerated with 10 mM NaOH for 2 min to remove the physical adsorption.
- EA ethanolamine
- biotinylated MYCN G4 DNA was prepared at 5 ⁇ M in the annealing buffer and heated up to 95°C for 5 min followed with slowly cooling down to room temperature within 1 h. After annealing, a total of 150 ⁇ L solution was injected in the Fc 2 of SPR system for 30 min to immobilize DNA onto the chip surface. The compound solutions were then tested once the baseline was stable.
- FIGS.30, 31A, 31B, 32A, and 32B A schematic illustrating the binding of the bivalent compounds of the present example, as is currently understood, is provided by FIG.30.
- Acridine ICR 191 had good binding signals during the titration (other acridinyl compounds that were evaluated included 9-aminoacridine, acridine Cl, and acridine NH2), showing a KD of 821 ⁇ 184 nM (FIGS.31A and 31B).
- FIGS.33A and 33B show dose-dependent binding signals to the dsDNA, due to the groove-binding and intercalation.
- FIGS.33A and 33B show that compound B33 had an excellent binding preference toward G4 structure over B-DNA structure, which would lead to a better specificity in complex solutions.
- Example 9 In this study, FIA was used for validating the bindings between certain bivalent and MYCN G4 oligos. To measure the binding affinity, a solution of each compound was prepared in triplicate in a 96 well- plate (Costar, black side clear bottom), resulting in a final concentration of 100 nM (5% final DMSO in the working solution).
- Unlabeled MYCN G4 DNA was folded based on the above-mentioned annealing method, then added into the well plate resulting in different concentrations by a seral dilution.
- the plate was incubated at room temperature for 30 min, followed by centrifuging at 500 rpm for 2 minutes.
- the fluorescence intensity was then quantitatively recorded by a Synergy Mx microplate reader (BioTek) at Ex 340 nm/Em 500 nm.
- the fluorescence intensities were then normalized, and the binding affinity was calculated by fitting the curve using one-site total model in GraphPad Prism 8.3.1 software.
- the FIA study was also conducted by taking advantage of the fluorescent property of acridine- derived molecules.
- a SA-coated glass surface was prepared.
- An amino-functionalized glass slide was firstly modified with a solution of N, N'- disuccinimidyl carbonate (DSC, 1.0 M) and N, N- diisopropylethylamine (DIPEA, 1.0 M) in DMF overnight at room temperature. After being washed successively with EtOH, Milli-Q water (5 min each) and dried with N 2 gas, the slide was incubated with 1 mg/mL of SA solution for 12 h (overnight) in a 4°C fridge, followed by blocking the surface with EA buffer for 30 minutes. Then, the slide was rinsed with PBS buffer and Milli-Q water, and dried by centrifugation (1,700 g, 2 min).
- biotin-labeled DNA/RNA oligos were prepared in annealing buffer resulting in 5 ⁇ M stock solutions, followed by annealing (according to above methods). Then all the oligo solutions were transferred into a 384-well plate.
- the microarray printing was conducted by a robotic arrayer (Nanoprint, Arrayit, USA) with a humidity of 60%. After the microarray was fabricated, the slide was placed in a slide box with a piece of wet Kimwipe tissue and incubated at 4°C for 2 h.
- the slide was thoroughly rinsed with PBST, PBS, and water to remove the unbounded oligos. Then, the slide was dried by centrifugation (1,700 g, 2 min) and quickly assembled with microarray gaskets (Agilent, USA), followed by loading the compound solutions. After 1 h incubation, the slide was washed and dried with the above-mentioned method. Finally, the microarray slide was imaged by a fluorescence scanner (Mapix) using green channel and the fluorescence intensities were quantified.
- a fluorescence scanner Mapix
- compound B33 showed relative higher signal-to-noise ratio (SNR) and lower background, compared to other incubating concentrations (data not shown).
- SNR signal-to-noise ratio
- compound B33 treated microarray indicating a promising binding selectivity against the corresponding target (FIGS.35A-35F).
- hTERT and BCL2 another two reported hairpin containing G4 DNAs (hTERT and BCL2) didn’t show fluorescence, suggesting that the molecular recognition highly depended on the hairpin in MYCN G4.
- no binding to dsDNA/ssDNA was observed, which was consistent with the G4-binding behavior of compound B33.
- Example 11 the folding of G-quadruplex structure was characterized by circular dichroism using a J-1500 circular dichroism spectrometer (Jasco).
- J-1500 circular dichroism spectrometer Jasco
- unlabeled MYCN oligonucleotide was prepared in different annealing buffer conditions at 5 ⁇ M concentration. The annealing procedure was the same as mentioned above.
- CD spectra were recorded from 320 to 200 nm at 25°C with an interval of 1 nm. Each spectrum was obtained by averaging the signals of three replicate scans.
- MYCN oligonucleotides were prepared in KCl buffer (10 mM sodium phosphate, pH7.0, 5 mM KCl) at 5 ⁇ M concentration.
- MYCN G4 DNA samples were mixed with/without the compound (final solution containing 5% DMSO) at designed concentration. Then a total of 300 ⁇ L solution was added in a cuvette and heated from 20 to 80°C in a CD spectrometer with an interval of 1°C. To calculate the melting temperature (Tm), the peak of CD spectrum at 263 nm was tracked, and ellipsometry vs temperature was plotted and fitted using a nonlinear sigmoidal dose-response model with a variable slope in GraphPad Prism 8 software. The thermal melting assay using CD was carried out to investigate the effect of the compound on MYCN G4 stability.
- This result agreed to our hypothesis that the bivalent interaction could not only improve the binding affinity but also increase the thermal stability of the MYCN hairpin-G4, due to the introduction of more contacts between the small molecule and the oligo.
- high-density and large-scale DNA microarrays that contained ⁇ 19,000 different G4 sequences were fabricated and used.
- G4s G-rich sequences
- 280 non-G4s C-rich sequences
- canonical G4 oligos with short loops (1 ⁇ 7 nt) were also designed and synthesized by varying the loop sequences to meet the diversity of G4 structure.
- TO and compound B33 solutions 500 nM were incubated with the microarray, respectively. Then the slides were thoroughly washed, dried, and imaged by a fluorescent scanner using green channel.
- Example 12 DMS-footprinting was conducted by using 5′-Cy5-labeled MYCN hairpin-G4 DNA.5 ⁇ M of the oligo was annealed in optimized buffer condition (10 mM Tris, pH 7.0, 10 mM LiCl and 10 mM NaCl) by heating up to 95°C followed with slow cooling.
- the folded DNA was subsequently incubated with compound B33 at different concentrations (0, 10, 25, 50, 100 nM) for 30 minutes. Then, the solutions were subjected to 1% DMS treatment for 10 min at room temperature and the reaction was stopped by 2.5 M NH 4 OAc and 0.1 M ⁇ -mercaptoethanol. The treated DNA was purified by phenol/chloroform/isoamyl alcohol and ethanol precipitated. The DMS-modified DNA was then cleaved using 10% piperidine at 90°C for 30 minutes. The solution was dried and washed twice with 100 ⁇ L water using SpeedVac vacuum concentrator and dissolved in nuclease-free water.
- the treated DNA samples were resolved on a 17% denaturing polyacrylamide gel and visualized on a Typhoon Imager (Amersham) followed by processing with ImageJ software. Buffer optimization was conducted to observe the small molecule induced G4 formation.
- 10 mM LiCl + 10 mM NaCl was selected as the salt condition in Tris-HCl buffer.
- the DMS-footprinting assay was carried out (FIG.38A). In absence of the compound, bands of G13-15 were more intense corresponding to the hairpin region, while some bands of the Gs were dim because of the quadruplex formation (FIG.38B).
- BCL2 HP-G4 showed a KD of 258 ⁇ 39 nM, which was almost 4 times weaker than that of MYCN HP-G4.
- HIV and PIM1-form1 HP-G4s showed 151 ⁇ 26 nM and 279 ⁇ 32 nM bindings to the small molecule.
- PIM1-form2 HP- G4 showed a much weaker binding affinity (1.1 ⁇ 0.4 ⁇ M) toward compound B33, which totally lost the synergistic effect of the two fragments. This observation might be attributed to the conformational difference from parallel MYCN G4 that separated the plain G-tetrad and the groove.
- B35 showed the lowest K D (38 ⁇ 5 nM by FIA, 14 ⁇ 6 nM by SPR), exhibiting an >10-fold improvement compared to B32 (311 ⁇ 52 nM by FIA, 303 ⁇ 32 nM by SPR).
- This dissociation constant was comparable with that of the reported antibodies (scFV: KD ⁇ 30 nM) that bound to parallel G4 structures.
- the linker was further elongated (e.g., using a PEG2 group, such as in compound B38), a weaker binding was observed (69 ⁇ 21 nM by FIA, 87 ⁇ 39 nM by SPR), no tighter than that of B33.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Peptides Or Proteins (AREA)
- Nitrogen And Oxygen Or Sulfur-Condensed Heterocyclic Ring Systems (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP22741091.7A EP4352054A1 (en) | 2021-06-09 | 2022-06-09 | Compounds that bind non-canonical g-quadruplex structures and methods of making and using the same |
| US18/568,738 US20240287054A1 (en) | 2021-06-09 | 2022-06-09 | Compounds that bind non-canonical g-quadruplex structures and methods of making and using the same |
| JP2023575827A JP2024522183A (ja) | 2021-06-09 | 2022-06-09 | 非標準g四重鎖構造に結合する化合物ならびにそれを作製および使用する方法 |
| AU2022288631A AU2022288631A1 (en) | 2021-06-09 | 2022-06-09 | Compounds that bind non-canonical g-quadruplex structures and methods of making and using the same |
| CA3222837A CA3222837A1 (en) | 2021-06-09 | 2022-06-09 | Compounds that bind non-canonical g-quadruplex structures and methods of making and using the same |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202163208918P | 2021-06-09 | 2021-06-09 | |
| US63/208,918 | 2021-06-09 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2022261296A1 true WO2022261296A1 (en) | 2022-12-15 |
Family
ID=82492690
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2022/032798 Ceased WO2022261296A1 (en) | 2021-06-09 | 2022-06-09 | Compounds that bind non-canonical g-quadruplex structures and methods of making and using the same |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US20240287054A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4352054A1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2024522183A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2022288631A1 (cg-RX-API-DMAC7.html) |
| CA (1) | CA3222837A1 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2022261296A1 (cg-RX-API-DMAC7.html) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025184571A1 (en) * | 2024-03-01 | 2025-09-04 | City Of Hope | Pcna inhibitors for the treatment of myc family associated cancers |
| WO2026068848A1 (en) * | 2024-09-30 | 2026-04-02 | Mycural Therapeutics Ab | N-substituted 9-aminoacridines and their use in the treatment of cancer |
| WO2026068852A1 (en) * | 2024-09-30 | 2026-04-02 | Mycural Therapeutics Ab | N-substituted 9-aminoacridines and their use in the treatment of cancer |
| WO2026068857A1 (en) * | 2024-09-30 | 2026-04-02 | Mycural Therapeutics Ab | N-substituted 9-aminoacridines and their use in the treatment of cancer |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4652441A (en) | 1983-11-04 | 1987-03-24 | Takeda Chemical Industries, Ltd. | Prolonged release microcapsule and its production |
| US4675189A (en) | 1980-11-18 | 1987-06-23 | Syntex (U.S.A.) Inc. | Microencapsulation of water soluble active polypeptides |
| US4677191A (en) | 1984-07-06 | 1987-06-30 | Wada Pure Chemical Ind., Ltd. | Copolymer and method for producing the same |
| US4728721A (en) | 1985-05-07 | 1988-03-01 | Takeda Chemical Industries, Ltd. | Polymer, production and use thereof |
| WO2009146343A1 (en) * | 2008-05-30 | 2009-12-03 | Merck & Co., Inc. | Novel substituted pyrazoles, 1,2,4-oxadiazoles, and 1,3,4-oxadiazoles |
| WO2016200726A1 (en) * | 2015-06-08 | 2016-12-15 | Texas Tech University System | Inhibitors of mci-1 as drugs to overcome resistance to braf inhibitors and mek inhibitors |
-
2022
- 2022-06-09 US US18/568,738 patent/US20240287054A1/en active Pending
- 2022-06-09 WO PCT/US2022/032798 patent/WO2022261296A1/en not_active Ceased
- 2022-06-09 AU AU2022288631A patent/AU2022288631A1/en active Pending
- 2022-06-09 JP JP2023575827A patent/JP2024522183A/ja active Pending
- 2022-06-09 EP EP22741091.7A patent/EP4352054A1/en active Pending
- 2022-06-09 CA CA3222837A patent/CA3222837A1/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4675189A (en) | 1980-11-18 | 1987-06-23 | Syntex (U.S.A.) Inc. | Microencapsulation of water soluble active polypeptides |
| US4652441A (en) | 1983-11-04 | 1987-03-24 | Takeda Chemical Industries, Ltd. | Prolonged release microcapsule and its production |
| US4917893A (en) | 1983-11-04 | 1990-04-17 | Takeda Chemical Industries, Ltd. | Prolonged release microcapsules |
| US4677191A (en) | 1984-07-06 | 1987-06-30 | Wada Pure Chemical Ind., Ltd. | Copolymer and method for producing the same |
| US4728721A (en) | 1985-05-07 | 1988-03-01 | Takeda Chemical Industries, Ltd. | Polymer, production and use thereof |
| WO2009146343A1 (en) * | 2008-05-30 | 2009-12-03 | Merck & Co., Inc. | Novel substituted pyrazoles, 1,2,4-oxadiazoles, and 1,3,4-oxadiazoles |
| WO2016200726A1 (en) * | 2015-06-08 | 2016-12-15 | Texas Tech University System | Inhibitors of mci-1 as drugs to overcome resistance to braf inhibitors and mek inhibitors |
Non-Patent Citations (32)
| Title |
|---|
| "Chemotherapy Service", 1992, WILLIAMS & WILKINS |
| "Handbook of Pharmaceutical Salts, Properties, Selection and Use", 2002, MACK PUBLISHING CO. |
| "Sustained and Controlled Release Drug Delivery Systems", 1978, MARCEL DEKKER, INC |
| "The Cancer Chemotherapy Handbook", 1993, MOSBY-YEAR BOOK |
| ABULWERDI ET AL., METHODS, vol. 103, 2016, pages 188 - 195 |
| ALNISS, J. MEDICINAL CHEMISTRY, vol. 62, 2019, pages 385 - 402 |
| BENABOU ET AL., BIOCHIM. ET BIOPHYS. ACTA, vol. 1840, 2014, pages 41 - 52 |
| BERGE ET AL., J. PHARM. SCI., vol. 66, 1977, pages 1 |
| BROOKS ET AL., DRUG DISCOVERY TODAY, vol. 19, 2014, pages 1040 - 1044 |
| BUNDGAARD: "Design of Prodrugs", 1985, ELSEVIER |
| CHABNERLONGO: "Cancer Chemotherapy and Biotherapy: Principles and Practice", 2005, LIPPINCOTT WILLIANS & WILKINS |
| CHAMBERS ET AL., NATURE BIOTECHNOLOGY, vol. 33, 2015, pages 877 - 881 |
| CONNELLY ET AL., ACS CHEMICAL BIOLOGY, vol. 12, 2017, pages 435 - 443 |
| CONNELLY ET AL., NATURE COMMUNICATIONS, vol. 10, 2019, pages 1501 |
| E. W. MARTIN: "ncology Pocket Guide to Chemotherapy,", 1995, MACK PUBLISHING CO. |
| GREENEWUTS: "Protective Groups in Organic Synthesis", 1999, JOHN WILEY & SONS |
| KANG ET AL., JACS, vol. 138, no. 2563, 2016, pages 13673 - 13692 |
| KUMARI ET AL., NATURE CHEMICAL BIOLOGY, vol. 3, 2007, pages 218 - 221 |
| LI ET AL., PNAS, vol. 112, 2015, pages 14581 - 14586 |
| LIM ET AL., NUCLEIC ACIDS RES., vol. 43, 2015, pages 5630 - 5646 |
| MICHAEL ET AL., J. PHARMACY PHARMACOL., vol. 43, 1991, pages 1 - 5 |
| NGOC NGUYEN ET AL., NUCLEIC ACIDS RES., vol. 48, 2020, pages 10567 - 10575 |
| OHNMACHT STEPHAN A ET AL: "Small-molecule quadruplex-targeted drug discovery", BIOORGANIC & MEDICINAL CHEMISTRY LETTERS, ELSEVIER, AMSTERDAM NL, vol. 24, no. 12, 18 April 2014 (2014-04-18), pages 2602 - 2612, XP028665077, ISSN: 0960-894X, DOI: 10.1016/J.BMCL.2014.04.029 * |
| PERRYABELOFF ET AL.: "Clinical Oncology", CHURCHILL LIVINGSTONE, INC, article "Chemotherapy" |
| RENNY ET AL., ANGEWANDTE CHEMIE, vol. 52, 2013, pages 11998 - 12013 |
| SEENISAMY, JACS, vol. 126, 2004, pages 8702 - 8709 |
| SKEEL: "Handbook of Cancer Chemotherapy", 2003, LIPPINCOTT WILLIAMS & WILKINS |
| SLAPAKKUFE: "Principles of Cancer Therapy", HARRISON'S PRINCIPLES OF INTERNAL MEDICINE |
| SPURNY ET AL., PNAS, vol. 112, pages E2543 - 2552 |
| SVENSSONTUNEK, DRUG METABOLISM REVIEWS, 1988, pages 165 |
| ZHANG ET AL., JACS, vol. 136, 2014, pages 1381 - 1390 |
| ZHANG JING-TAO ET AL: "Selective recognition of DNA parallel G-quadruplexes by 3,8a-disubstituted indolizinones", BIOORGANIC & MEDICINAL CHEMISTRY, ELSEVIER, AMSTERDAM, NL, vol. 29, 8 November 2020 (2020-11-08), XP086455817, ISSN: 0968-0896, [retrieved on 20201108], DOI: 10.1016/J.BMC.2020.115848 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025184571A1 (en) * | 2024-03-01 | 2025-09-04 | City Of Hope | Pcna inhibitors for the treatment of myc family associated cancers |
| WO2026068848A1 (en) * | 2024-09-30 | 2026-04-02 | Mycural Therapeutics Ab | N-substituted 9-aminoacridines and their use in the treatment of cancer |
| WO2026068852A1 (en) * | 2024-09-30 | 2026-04-02 | Mycural Therapeutics Ab | N-substituted 9-aminoacridines and their use in the treatment of cancer |
| WO2026068857A1 (en) * | 2024-09-30 | 2026-04-02 | Mycural Therapeutics Ab | N-substituted 9-aminoacridines and their use in the treatment of cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| CA3222837A1 (en) | 2022-12-15 |
| JP2024522183A (ja) | 2024-06-11 |
| EP4352054A1 (en) | 2024-04-17 |
| AU2022288631A1 (en) | 2024-01-18 |
| US20240287054A1 (en) | 2024-08-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240287054A1 (en) | Compounds that bind non-canonical g-quadruplex structures and methods of making and using the same | |
| CN108314677B (zh) | 一种ezh2抑制剂及其用途 | |
| JP6789239B2 (ja) | Krasの縮合三環系インヒビターおよびその使用の方法 | |
| CN102906090B (zh) | 1-(5-叔丁基-2-苯基-2h-吡唑-3-基)-3-[2-氟-4-(1-甲基-2-氧代-2,3-二氢-1h-咪唑并[4,5-b]吡啶-7-基氧基)-苯基]-脲和相关化合物及它们在治疗中的应用 | |
| KR20210045998A (ko) | 헤테로사이클릭 스피로 화합물 및 암 치료를 위한 그의 사용 방법 | |
| KR20200010306A (ko) | Kras의 공유적 억제제 | |
| WO2020160192A1 (en) | Compounds and uses thereof | |
| US11014902B2 (en) | MYC G-quadruplex stabilizing small molecules and their use | |
| KR20220133259A (ko) | 화합물 및 이의 용도 | |
| WO2020160198A1 (en) | Compounds and uses thereof | |
| CN110869357A (zh) | 化合物及其用于治疗癌症的使用方法 | |
| JP2018520195A (ja) | 置換キナゾリン化合物ならびにそのg12c変異kras、hrasおよび/またはnrasタンパク質の阻害剤としての使用 | |
| JP2018513853A (ja) | 置換キナゾリン化合物およびその使用方法 | |
| JP2016500107A (ja) | グルタマーゼ阻害剤およびその使用方法 | |
| JP2021504314A (ja) | Mystファミリーヒストンアセチルトランスフェラーゼ阻害剤 | |
| JP2026053706A (ja) | Cd206モジュレーター、その使用、および調製方法 | |
| CN116568671A (zh) | 杂环Cullin-RING泛素连接酶化合物及其用途 | |
| Song et al. | Proteolysis targeting chimera of BI-2536 induces potent dual degradation of PLK1 and BET proteins | |
| JP2006518726A (ja) | G四重鎖dna構造に極めて特異的に結合する化学誘導体、および、特異的な抗ガン剤としてのそれらの使用 | |
| KR20200035029A (ko) | 이질염색질 유전자 억제 저해제 | |
| WO2017192228A1 (en) | Pak1 inhibitors and uses thereof | |
| US20140073637A1 (en) | Amino-substituted-alkyloxy-benzo[e]pyrido[4,3-b]indole derivatives as new potent kinase inhibitors | |
| WO2025017207A1 (en) | Inhibitors of smndc1 and their therapeutic use | |
| HK40025458A (en) | Covalent inhibitors of kras | |
| HK40025457A (en) | Compounds and methods of use thereof for treatment of cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22741091 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2023575827 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 18568738 Country of ref document: US Ref document number: 3222837 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2022288631 Country of ref document: AU Ref document number: AU2022288631 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2022741091 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2022741091 Country of ref document: EP Effective date: 20240109 |
|
| ENP | Entry into the national phase |
Ref document number: 2022288631 Country of ref document: AU Date of ref document: 20220609 Kind code of ref document: A |