WO2022237621A1

WO2022237621A1 - Reagent for diagnosing and treating tumor and use thereof

Info

Publication number: WO2022237621A1
Application number: PCT/CN2022/091005
Authority: WO
Inventors: 高大明; 李龙
Original assignee: 中国科学院分子细胞科学卓越创新中心
Priority date: 2021-05-13
Filing date: 2022-05-05
Publication date: 2022-11-17
Also published as: CN115337400A

Abstract

A reagent for diagnosing and treating a tumor and the use thereof. Provided is the use of an inhibitor of FBXW2 in preparation of a drug for preventing or treating a cancer and inhibiting growth of tumor cells. Disclosed is the function of an FBXW2 proto-oncogene. A new strategy is provided for clinical treatment.

Description

Reagents for diagnosing and treating tumors and uses thereof

technical field

The invention belongs to the field of biotechnology; more specifically, the invention relates to reagents and methods for treating tumors.

Background technique

F-box protein is a kind of substrate recognition protein of SCF (SKP1-Cullin 1-F-box) complex. Common F-box proteins include FBXW7 and TRCP. These F-box proteins ubiquitinate and degrade many important regulatory proteins in cells, thus playing a vital role in the development of tumors. As a member of the F-box family, FBXW2 (coding gene name: Fbxw2 or Fbw2, F-box and WD repeat domain containing 2, gene ID: 26190; Uniprot database protein ID: Q9UKT8) has relatively few functional studies, especially Function of FBXW2 in tumor cells. Recently, studies have pointed out that FBXW2 acts as a tumor suppressor gene in lung cancer by degrading SKP2 and β-catenin. Therefore, the function of FBXW2 in tumors and whether it can be used as an anti-tumor target need to be clarified urgently.

Contents of the invention

The inventors found that FBXW2 is a proto-oncoprotein that can promote the growth and migration of tumor cells. Knockdown of FBXW2 can reduce the proliferation and clone formation of tumor cells, and inhibit the invasion and metastasis of tumor cells. Therefore, FBXW2 is a potential target for antitumor therapy.

The purpose of the present invention is to provide a drug target for cancer and a reagent and method for preventing and treating cancer, especially FBXW2-related cancer.

The first aspect of the present invention provides a use of an inhibitor of FBXW2 in the preparation of a drug for preventing or treating cancer and inhibiting tumor cell growth.

In one or more embodiments, the cancer is a FBXW2-mediated cancer.

In one or more embodiments, the cancer is a cancer with increased expression of FBXW2.

In one or more embodiments, the cancer is a cancer involving the interaction of FBXW2 and SKP1.

In one or more embodiments, the cancer is breast cancer.

In one or more embodiments, the tumor cells are tumor cells with increased expression of FBXW2.

In one or more embodiments, the inhibitor of FBXW2 is an agent that inhibits the expression and/or activity of FBXW2. In one or more embodiments, the activity is an activity that interacts with SKP1.

In one or more embodiments, the inhibitor of FBXW2 is:

Antibodies or ligands that specifically bind to FBXW2;

Inhibitory molecules that specifically interfere with the transcription and/or expression of the FBXW2 gene; or

Compounds that inhibit the interaction of FBXW2 with SKP1.

In one or more embodiments, the antibody that specifically binds to FBXW2 is a polyclonal antibody or a monoclonal antibody.

In one or more embodiments, the inhibitory molecule targets the FBXW2 gene or its transcript.

In one or more embodiments, the inhibitory molecule targets the 3'UTR or CDS region of the FBXW2 gene.

In one or more embodiments, the inhibitory molecule uses the sequence tcacgcagtgcacaatcattt (SEQ ID NO: 4) in the 3'UTR of the FBXW2 gene or gcctttgaaacctcgtcatta (SEQ ID NO: 5) in the CDS region as an inhibitory target.

In one or more embodiments, the sequence of the FBXW2 gene or its transcript is shown in gene ID: 26190.

In one or more embodiments, the sequence of the FBXW2 protein is shown in the Uniprot database protein ID: Q9UKT8.

In one or more embodiments, the inhibitory molecule is selected from the group consisting of (1) small molecule compounds, antisense nucleic acids, microRNA, siRNA, shRNA, RNAi, dsRNA, sgRNA or combinations thereof, and (2) capable of expressing Or form the nucleic acid construct of (1). Preferably, the inhibitory molecule is FBXW2 gene or its transcript (such as the 3'UTR or CDS region of FBXW2 gene, preferably SEQ ID NO:4 in the 3'UTR or SEQ ID NO:5 in the CDS region) as shRNA or construct that inhibits the target.

In one or more embodiments, the inhibitor is an agent, such as sgRNA, that knocks down or knocks out FBXW2 using a technology selected from ZFNs, TALENs, and CRISPR. In one or more embodiments, the inhibitor also comprises a Cas enzyme (such as Cas9), its coding sequence, and/or a nucleic acid construct expressing the Cas enzyme.

In one or more embodiments, the inhibitory molecule is shRNA or its nucleic acid construct, and the construct contains the structure shown in formula IV:

Seq _Forward -X-Seq _Reverse IV,

In formula IV, the _forward direction of Seq is a polynucleotide that recognizes the FBXW2 gene or its transcript, and the _{reverse direction} of Seq is a polynucleotide that is _forward and reverse complementary to Seq;

X is a spacer sequence located between Seq forward and Seq reverse, and the spacer sequence is not complementary to Seq _forward and Seq _reverse .

In one or more embodiments, the Seq _forward length is 5-20 bp, preferably 8-15 bp.

In one or more embodiments, Seq _forward comprises SEQ ID NO: 1 or 2.

In one or more embodiments, X comprises SEQ ID NO:3.

In one or more embodiments, the compound that inhibits the interaction between FBXW2 and SKP1 is a compound shown in formula I:

Wherein R1, R2, R4, R5 and R6 are each independently selected from C1-C4 alkyl, hydroxyl, halogen or amino,

R3 is heteroaryl optionally substituted with 1-2 substituents selected from C1-C4 alkyl, hydroxy, halogen and amino.

In one or more embodiments, R1, R2 and R5 are each independently selected from hydroxyl or halo.

In one or more embodiments, R1, R2 and R5 are hydroxyl.

In one or more embodiments, R4 and R6 are each independently selected from C1-C4 alkyl.

In one or more embodiments, R4 and R6 are methyl.

In one or more embodiments, R3 is thiophene optionally substituted with 1-2 substituents selected from C1-C4 alkyl, hydroxy, halogen and amino.

In one or more embodiments, the compound that inhibits the interaction between FBXW2 and SKP1 is a compound represented by formula II:

Wherein, R7 and R8 are each independently selected from C1-C4 alkyl, hydroxyl, halogen or amino.

In one or more embodiments, R7 and R8 are each independently selected from C1-C4 alkyl, hydroxyl.

In one or more embodiments, R7 is C1-C4 alkyl.

In one or more embodiments, R8 is hydroxyl.

In one or more embodiments, the compound that inhibits the interaction between FBXW2 and SKP1 is a compound represented by formula III:

Wherein, R9-R11 are each independently selected from C1-C4 alkyl, hydroxyl, halogen or amino.

In one or more embodiments, R9 and R12 are each independently selected from hydroxyl, halogen.

In one or more embodiments, R10 and R11 are each independently selected from C1-C4 alkyl, hydroxyl.

In one or more embodiments, R10 is C1-C4 alkyl.

In one or more embodiments, R11 is hydroxyl.

In one or more embodiments, the compound that inhibits the interaction between FBXW2 and SKP1 is selected from

In another aspect of the present invention, a method for screening potential substances for preventing or treating cancer is provided, the method comprising:

(1) treating a system expressing FBXW2 and optionally SKP1 with a candidate substance; and

(2) Detecting the expression or activity of FBXW2 in the system, or detecting whether the candidate substance targets cells in which the expression of FBXW2 is increased.

In one or more embodiments, the activity is an activity that interacts with SKP1.

In one or more embodiments, if the candidate substance can reduce the expression or activity of FBXW2, or the candidate substance targets cells with high FBXW2 expression, it indicates that the candidate substance is a potential substance for preventing or treating cancer.

In one or more embodiments, the cancer is a FBXW2-mediated cancer.

In one or more embodiments, the cancer is breast cancer.

In one or more embodiments, step (1) includes: in the test group, adding the candidate substance to the system expressing FBXW2 and optionally SKP1.

In one or more embodiments, step (2) includes: detecting the expression or activity of FBXW2 in the system of the test group, and comparing it with the control group, wherein the control group is the expression of FBXW2 and the expression of FBXW2 without adding the candidate substance Optional SKP1 system.

In one or more embodiments, if the expression or activity of FBXW2 in the test group is statistically lower (preferably significantly lower, such as lower than 20%, preferably lower than 50%; more preferably lower than 80%) above) the control group, it shows that the candidate is a potential substance for the prevention or treatment of cancer.

In one or more embodiments, the system for expressing FBXW2 and optional SKP1 is selected from: cell system (or cell culture system), subcellular system, solution system, tissue system, organ system or animal system.

In one or more embodiments, the system expressing FBXW2 and optionally SKP1 is a cancer cell or a solution system.

In another aspect, the present invention provides a method for preventing or treating cancer, the method comprising: down-regulating the expression or activity of FBXW2 in the mammalian cells.

In one or more embodiments, the method comprises administering an inhibitor of FBXW2 to a patient in need thereof.

In one or more embodiments, the method is further characterized as described in the first aspect herein.

Another aspect of the present invention provides the use of the reagent for detecting the expression or activity of FBXW2 in the preparation of a kit for diagnosing cancer.

In one or more embodiments, the cancer is a FBXW2-mediated cancer.

In one or more embodiments, the cancer is FBXW2-mediated breast cancer.

In one or more embodiments, reagents for detecting expression or activity of FBXW2 include:

(1) primers or probes targeting FBXW2 or its transcripts, or

(2) Antibodies or ligands that specifically bind to FBXW2.

In one or more embodiments, the kit further includes reagents required for RT-PCR, such as reverse transcriptase, RNA extraction reagent, nucleic acid polymerase, dNTP, PCR buffer and the like.

In one or more embodiments, the kit further includes reagents required for Northern, such as RNA extraction reagents, ribonuclease inhibitors, Northern buffer, and the like.

In one or more embodiments, the kit further includes reagents required for Western, such as protein extraction reagents, acrylamide, guanidine isothiocyanate, Tris, SDS, TEMED, and the like.

In another aspect of the present invention, there is provided a method of diagnosing cancer, the method comprising detecting the expression of FBXW2 in a subject.

In one or more embodiments, the method includes:

(1) Obtain a sample of the object,

(2) detecting FBXW2 expression or activity in a sample from the subject, and

(3) Comparing the FBXW2 expression or activity of the subject with the FBXW2 expression or activity of the healthy control, if the FBXW2 expression or activity of the subject increases, it is diagnosed that the subject has cancer.

In one or more embodiments, the sample is a bodily fluid or tissue biopsy.

In one or more embodiments, the cancer is a FBXW2-mediated cancer.

In one or more embodiments, the cancer is FBXW2-mediated breast cancer.

In another aspect, the present invention also provides a substance that reduces the expression of FBXW2, and the substance contains a structure represented by formula IV:

Seq _Forward -X-Seq _Reverse IV,

In formula IV, the _forward direction of Seq is a polynucleotide that recognizes the FBXW2 coding sequence, and the _{reverse direction} of Seq is a polynucleotide that is complementary to the _{_forward} and reverse directions of Seq;

In one or more embodiments, Seq _forward comprises SEQ ID NO: 1 or 2.

In one or more embodiments, X comprises SEQ ID NO:3.

Another aspect of the present invention also provides a pharmaceutical composition, comprising the substance for reducing the expression of FBXW2 described herein and pharmaceutically acceptable auxiliary materials.

Other aspects of the invention will be apparent to those skilled in the art from the disclosure herein.

Description of drawings

Figure 1 shows that FBXW2 accelerates tumor cell growth.

(A) MDA-MB-231 and HS578T FBXW2 knockdown stable transfection cell lines constructed with shRNA were detected by immunoblotting;

(B) Cell growth curve assay to detect MDA-MB-231 (left) and HS578T (right) cell lines stably transfected with PLKO.1 or FBXW2 shRNA;

(C, D) Representative graphs (C) and data statistics (D) of clonal cell experiments in control and FBXW2 knockdown cell lines in MDA-MB-231 and HS578T cell lines;

(E, F) Microscopic images of MDA-MB-231FBXW2 knockdown cell lines and control cell lines in soft agar colony formation assay. (F) shows the statistics of each microscopic image (n=3);

(G, H) Transwell assay to detect the migration ability of FBXW2 knockdown and control cells. (G) is a statistical map of cell migration efficiency in each field of view (n=10), (H) is a representative picture;

(1) is the tumor volume growth curve (n=9) of nude mice orthotopic injection tumor formation experiment;

(J, K) are statistical results of tumor weight in nude mice orthotopic injection tumor formation experiment (n=9). (K) is a tumor picture;

In (B, D, F, H, I, J), the student’s test was used for statistical analysis, and the results were expressed as mean ± standard error. Results are from three independent replicates. *0.01<p<0.05, **0.001<P<0.01, ***P<0.001.

Figure 2 shows that Teniposide targets FBXW2 to inhibit tumor cell growth.

(A) Western blot detection of whole cell lysates and immunoprecipitation detection of 293T cells transfected with the indicated plasmids and treated with DMSO or other compounds;

(B) Relative inhibition curve of Teniposide. FBXW2 knockdown MDA-MB-231 cells and controls were treated with different concentrations of Teniposide for 72 hours. Cell number was detected by CCK8. Statistical analysis was performed using the student's test, and the results were expressed as mean ± standard error. Results are from three independent replicates. *0.01<p<0.05, **0.001<p<0.01.

Detailed ways

In order to better clinically treat FBXW2, the inventors screened 1,600 FDA-approved small molecule compounds. It was found that the anticancer drug Teniposide can inhibit the binding of FBXW2 to its interacting protein SKP1, resulting in the inactivation of FBXW2. In addition, the inventors also found that Teniposide specifically targets cells with high expression of FBXW2, thereby inhibiting the growth of tumor cells. These findings reveal the function of the FBXW2 proto-oncogene and provide a new strategy for clinical treatment. The invention provides a cancer drug target (FBXW2) and a reagent and method for preventing and treating cancer, especially FBXW2-related cancer.

Based on the above findings, inhibitors of FBXW2 can prevent or treat cancer and inhibit tumor cell growth. Cancers described herein are primarily cancers that are associated with FBXW2 function, eg, cancers that have increased expression of FBXW2 and/or cancers that involve the interaction of FBXW2 with SKP1. In an exemplary embodiment, the cancer is breast cancer, and the tumor cells are tumor cells with increased expression of FBXW2.

FBXW2 and its inhibitors

As used herein, "FBXW2 gene", "Fbxw2" or "Fbw2" are used interchangeably and the gene ID is 26190. The polypeptide encoded by this gene is named "FBXW2", and the protein ID of Uniprot database: Q9UKT8. In the present invention, the term "FBXW2" refers to a polypeptide having the sequence shown in Uniprot ID Q9UKT8 having FBXW2 activity. The term also includes variants of the sequence shown in Uniprot ID Q9UKT8 that have the same function as FBXW2. These variations include (but are not limited to): several (usually 1-50, preferably 1-30, 1-20, 1-10, 1-8, 1-5) amino acids Deletion, insertion and/or substitution, and addition or deletion of one or several (usually within 20, preferably within 10, more preferably within 5) amino acids at the C-terminal and/or N-terminal. For example, in the art, substitutions with amino acids with similar or similar properties generally do not change the function of the protein. In this field, amino acids with similar properties often refer to amino acid families with similar side chains, which have been clearly defined in this field. These families include amino acids with basic side chains (e.g. lysine, arginine, histidine), amino acids with acidic side chains (e.g. aspartic acid, glutamic acid), Amino acids with side chains (e.g. glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with non-polar side chains (e.g. alanine, valine, leucine, isoleucine, lactic acid, phenylalanine, methionine, tryptophan), amino acids with β-branched side chains (e.g. threonine, valine, isoleucine) and Amino acids with aromatic side chains (eg tyrosine, phenylalanine, tryptophan, histidine). As another example, adding one or several amino acids at the amino terminus and/or carboxyl terminus usually does not change the function of the polypeptide or protein. Conservative amino acid substitutions are known in the art for many common known non-genetically encoded amino acids. Conservative substitutions for other non-coded amino acids can be determined based on a comparison of their physical properties with those of the genetically encoded amino acid.

Variants of polypeptides include: homologous sequences, conservative variants, allelic variants, natural mutants, and induced mutants.

Any high homology with said FBXW2 (for example, the homology with the sequence shown in Q9UKT8 is 70% or higher; preferably, the homology is 80% or higher; more preferably, the homology is 90% % or higher, such as homology 95%, 98% or 99%), and polypeptides having similar or identical functions to FBXW2 are also included in the present invention. The "same or similar function" mainly refers to the function of interacting with SKP1 and promoting the growth and invasion of tumor cells.

The invention also includes analogs of the claimed polypeptides. The difference between these analogues and natural FBXW2 may be the difference in the amino acid sequence, or the difference in the modified form that does not affect the sequence, or both. Analogs of these proteins include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by radiation or exposure to mutagens, site-directed mutagenesis, or other techniques known to be divided into biology. Analogs also include analogs with residues other than natural L-amino acids (eg, D-amino acids), and analogs with non-naturally occurring or synthetic amino acids (eg, β, γ-amino acids). It should be understood that the proteins of the present invention are not limited to the representative proteins exemplified above.

The polypeptide fragments, derivatives or analogs of the present invention can also be: (i) a polypeptide formed by fusing a mature polypeptide with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (ii) an additional A polypeptide formed by fusing an amino acid sequence to the polypeptide sequence (such as a leader sequence or a secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or a fusion protein). These fragments, derivatives and analogs are within the purview of those skilled in the art as defined herein.

The present invention also relates to polynucleotide sequences encoding FBXW2 of the present invention or its variants, analogs and derivatives. The polynucleotide may be in the form of DNA or RNA. Forms of DNA include cDNA, genomic DNA or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be either the coding strand or the non-coding strand. The coding region sequence encoding the mature polypeptide may be identical to the coding region sequence shown in gene ID 26190 or a degenerate variant.

The present invention also relates to variants of the above polynucleotides, which encode fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the present invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide which may be a substitution, deletion or insertion of one or more nucleotides without substantially altering the function of the polypeptide it encodes . As used herein, a degenerate variant refers to a nucleic acid sequence that encodes a protein with Uniprot ID Q9UKT8 in the present invention, but differs from the sequence of the coding region shown in gene ID 26190. A "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, or may also include additional coding and/or non-coding sequences.

The present invention also relates to polynucleotides which hybridize to the above-mentioned sequences and which have at least 50%, preferably at least 70%, more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides hybridizable under stringent conditions to the polynucleotides of the present invention. In the present invention, "stringent conditions" refers to: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) hybridization with There are denaturing agents, such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll, etc.; or (3) only if the identity between the two sequences is at least 90%, more Preferably, hybridization occurs above 95%. Moreover, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO:1.

The full-length sequence of FBXW2 nucleotides or its fragments (such as primers or probes) of the present invention can usually be obtained by PCR amplification, recombination or artificial synthesis. For the PCR amplification method, primers can be designed according to the relevant nucleotide sequences disclosed in the present invention, especially the open reading frame sequence, and the cDNA prepared by a commercially available DNA library or a conventional method known to those skilled in the art can be used. The library is used as a template to amplify related sequences. In addition, artificial synthesis methods can also be used to synthesize related sequences, especially when the fragment length is relatively short, such as primers or probes. Methods known in the art for designing primer and probe sequences can be used herein, for example by the software Primer Express.

The present invention also relates to FBXW2 inhibitors and uses thereof. Since FBXW2 inhibitors can regulate the expression and/or activity of FBXW2, etc., the inhibitors can also inhibit tumor growth by affecting FBXW2.

Any substance that can reduce the activity of FBXW2, reduce its stability, inhibit its expression, reduce its effective action time, reduce its interaction with associated proteins (such as SKP1), or reduce its transcription and translation can be used in the present invention , as a down-regulator, antagonist or inhibitor of FBXW2. Exemplary inhibitors include antibodies or ligands that specifically bind to FBXW2; inhibitory molecules that specifically interfere with the transcription and/or expression of FBXW2 genes (such as interfering molecules that can form shRNA); or compounds that inhibit FBXW2 activity.

Any antibody or ligand known in the art that specifically binds FBXW2 can be used in the present invention. Said antibody can be a monoclonal antibody or a polyclonal antibody. FBXW2 protein can be used to immunize animals, such as rabbits, mice, rats, camels, etc. to produce polyclonal antibodies; various adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Similarly, cells expressing FBXW2 or antigenic fragments thereof can be used to immunize animals to produce antibodies. Said antibody can also be a monoclonal antibody, and such monoclonal antibody can be prepared by hybridoma technology or single cell screening. In addition, after the sequence of the antibody is known, the coding sequence of the antibody can be loaded into an expression vector, so that the antibody gene is operably linked to a promoter, a terminator, etc., and expressed in a host cell to produce the antibody. Other components required for expression vectors, such as promoters, terminators, expression vectors can be bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses or other vectors. In conclusion, any plasmid and vector can be used as long as it can be replicated and stabilized in the host. Those of ordinary skill in the art will know how to select appropriate vectors, promoters, enhancers and host cells.

Once the target sequence is known, methods for preparing interfering molecules that interfere with the expression of a specific gene are well known in the art. As a preferred mode of the present invention, the FBXW2 inhibitor is a FBXW2-specific shRNA or its construct, wherein the shRNA specifically recognizes the FBXW2 gene or its transcript. Herein, a "transcript" comprises a UTR region (eg 3' UTR) and a CDS region. For example, the shRNA can be the sequence tcacgcagtgcacaatcattt (SEQ ID NO: 4) in the 3'UTR of the FBXW2 gene or gcctttgaaacctcgtcatta (SEQ ID NO: 5) in the CDS region as an inhibitory target. An exemplary shRNA has the following structure: (SEQ ID NO:1)-(SEQ ID NO:3)-(reverse complement of SEQ ID NO:1) or (SEQ ID NO:2)-(SEQ ID NO:3 )-(reverse complement of SEQ ID NO:2).

In addition, in order to down-regulate the expression or activity of the FBXW2 gene, the gene knockout vector can be transferred into the cells, and/or the gene can be edited using gene editing technologies such as ZFN, TALEN or CRISPR/Cas9. ZFN, TALEN and CRISPR/Cas9 technologies suitable for use in the present invention are well known in the art. Each technology realizes the knockout of the target gene through the joint action of the DNA recognition domain and the endonuclease.

The activity of FBXW2 described herein includes its interaction with SKP1. Accordingly, compounds that inhibit the activity of FBXW2 include compounds that inhibit the interaction between FBXW2 and SKP1. The inventors found that Teniposide, Camptothecin and Chloquinan can inhibit the interaction between FBXW2 and SKP1. Therefore, the compound that inhibits the interaction between FBXW2 and SKP1 can be a compound shown in formula I, formula II or formula III

Wherein R1, R2, R4, R5 and R6 are each independently selected from C1-C4 alkyl, hydroxyl, halogen or amino, and R3 is optionally substituted by 1-2 selected from C1-C4 alkyl, hydroxyl, halogen and amino R7 and R8 are each independently selected from C1-C4 alkyl, hydroxyl, halogen or amino, and R9-R11 are each independently selected from C1-C4 alkyl, hydroxyl, halogen or amino.

As used herein, the term "alkyl" used alone or in combination with other terms refers to a saturated aliphatic alkyl group, including straight or branched chain alkyl groups of 1-20 carbon atoms and cyclic groups. Preferably, the alkyl group refers to a medium alkyl group containing 1-10 carbon atoms, such as methyl, ethyl, propyl, 2-isopropyl, n-butyl, isobutyl, tert-butyl, pentyl and Similar to alkyl. More preferably, it refers to a lower alkyl group having 1 to 4 carbon atoms, such as methyl, ethyl, propyl, 2-isopropyl, n-butyl, isobutyl, t-butyl and the like. Cyclic groups may be monocyclic or polycyclic, and preferably have 3-10 ring carbon atoms. Exemplary cyclic groups include cyclopropyl, cyclopropylmethyl, cyclopentyl, cyclohexyl, adamantyl, and substituted and unsubstituted bornyl, norbornyl, and norbornenyl groups. Alkyl groups may be substituted or unsubstituted. When substituted, the number of substituents is 1 or more, preferably 1-3, more preferably 1 or 2, and the substituents are independently selected from halogen, carboxyl, hydroxyl, lower alkoxy, aromatic base.

Unless otherwise stated, the term "aryl" refers to a polyunsaturated, aromatic hydrocarbon substituent which may be a single ring or multiple rings fused together (ie, fused ring aryl) or covalently linked (preferably 1 -3 rings). The term "heteroaryl" refers to an aryl group (or ring) containing at least one heteroatom such as N, O or S, wherein the nitrogen and sulfur atoms are optionally oxidized, and the nitrogen atom is optionally quaternized. A heteroaryl group can be attached to the rest of the molecule through a carbon or a heteroatom. Non-limiting examples of aryl and heteroaryl groups include phenyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrrolyl, Azolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isox Azolyl, 4-isoxazolyl, 5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thiophene Base, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl, 2-quinoxalinyl, 5-quinoxalinyl, 3-quinolinyl and 6-quinolinyl. The above examples may be substituted or unsubstituted, and the divalent groups exemplified by each of the above heteroaryl groups are non-limiting examples of heteroarylene groups. The above aryl or heteroaryl may be substituted with a substituent selected from optionally substituted C1-C4 alkyl, hydroxy, halogen, amino, heterocyclic or heteroaryl.

The term "halogen" as used herein refers to F, Cl, Br, or I. The term "hydroxyl" denotes a -OH group. The term "oxo" or the group "oxygen" denotes the =O group. The term "amino" refers to a -NH2 group.

pharmaceutical composition

The present invention also provides a composition, which contains an effective amount (such as 0.000001-50wt%; preferably 0.00001-20wt%; more preferably, 0.0001-10wt%) of the FBXW2 inhibitor, and pharmaceutically Acceptable excipients. The composition can be used to prevent and treat FBXW2-related cancers. Any of the aforementioned inhibitors of FBXW2 may be used in the preparation of the composition.

As used herein, the "effective amount" refers to an amount that can produce functions or activities on humans and/or animals and that can be accepted by humans and/or animals. The "pharmaceutically acceptable carrier" refers to a carrier for the administration of therapeutic agents, including various excipients and diluents. The term refers to pharmaceutical carriers which, by themselves, are not essential active ingredients and which are not unduly toxic upon administration. Suitable vectors are well known to those of ordinary skill in the art. Pharmaceutically acceptable carriers in compositions may contain liquids, such as water, saline, buffers. In addition, there may also be auxiliary substances in these carriers, such as fillers, lubricants, glidants, wetting agents or emulsifiers, pH buffering substances, and the like. The carrier may also contain cell transfection reagents.

After knowing the use of the FBXW2 gene or protein inhibitor, various methods well known in the art can be used to administer the inhibitor or its coding gene, or its pharmaceutical composition to mammals. Including but not limited to: subcutaneous injection, intramuscular injection, transdermal administration, local administration, implantation, sustained-release administration, etc.; preferably, the administration method is parenteral administration.

Preferably, it can be carried out by means of gene therapy. For example, the inhibitor of FBXW2 can be directly administered to the subject through methods such as injection; or, the expression unit carrying the inhibitor of FBXW2 (such as an antibody expression vector or virus, etc., or shRNA construct ) to the target (such as tumor cells) and make it express an active FBXW2 inhibitor, the specific situation depends on the type of the inhibitor, which are well known to those skilled in the art.

The effective amount of the inhibitor of FBXW2 in the present invention can vary with the mode of administration and the severity of the disease to be treated. The selection of a preferred effective amount can be determined by those of ordinary skill in the art based on various factors (eg, through clinical trials). The factors include but are not limited to: the pharmacokinetic parameters of the inhibitor of the FBXW2 gene or protein such as bioavailability, metabolism, half-life, etc.; the severity of the disease to be treated by the patient, the patient's body weight, the patient's immune status, route of administration, etc. Usually, satisfactory effects can be obtained when the FBXW2 inhibitor of the present invention is administered daily at a dose of about 0.00001 mg-50 mg/kg animal body weight (eg, 0.0001 mg-10 mg/kg animal body weight). For example, several divided doses may be administered daily or the dose may be proportionally reduced as the exigencies of the therapeutic situation dictate.

drug screening

After knowing the close correlation between FBXW2 and related cancers, substances that inhibit the expression or activity of FBXW2 can be screened based on this feature. Drugs useful for the prevention or treatment of FBXW2-related cancers can be found from said substances.

Therefore, the present invention provides a method for screening potential substances for preventing or treating FBXW2-related cancers, the method comprising: treating a system expressing FBXW2 and optionally SKP1 with a candidate substance; and detecting the expression of FBXW2 in the system or active. Such activity is, for example, the interaction of FBXW2 with SKP1. If the candidate substance can reduce the expression or activity of FBXW2, it indicates that the candidate substance is a potential substance for preventing or treating cancer.

The system for expressing FBXW2 may be, for example, a cell (or cell culture) system, and the cells may be cells expressing FBXW2 endogenously; or cells expressing FBXW2 recombinantly. The system for expressing FBXW2 can also be a subcellular system, a solution system, a tissue system, an organ system or an animal system (such as an animal model, preferably an animal model of a non-human mammal, such as a mouse, a rabbit, a sheep, a monkey, etc.), etc. .

In a preferred mode of the present invention, when screening, in order to more easily observe changes in the expression or activity of MCP-1, a control group can also be set, and the control group can be the expression of FBXW2 without adding the candidate substance. system.

The present invention has no special limitation on the detection method of the expression, activity, amount or secretion of FBXW2 protein. Conventional protein quantitative or semi-quantitative detection techniques can be used, such as (but not limited to): SDS-PAGE method, Western-Blot method and the like.

In addition, after it is known that the FBXW2 can target cells in which FBXW2 expression is increased, the substance can be screened by detecting whether the candidate substance targets cells in which FBXW2 expression is increased. Therefore, the present invention provides a method of screening a potential substance for preventing or treating FBXW2-related cancers, the method comprising: treating a system expressing FBXW2 with a candidate substance; and detecting whether the candidate substance targets cells in which FBXW2 expression is increased . If the candidate substance targets cells with high FBXW2 expression, it indicates that the candidate substance is a potential substance for preventing or treating cancer.

Diagnostics and Kits

Based on the fact that FBXW2 can promote the growth and invasion of tumor cells, thereby promoting the occurrence and development of tumors, the present invention also provides a method for diagnosing cancer, which includes detecting the expression of FBXW2 in a subject. The method comprises: (1) obtaining a sample of the subject, (2) detecting the expression or activity of FBXW2 in the sample of the subject, and (3) comparing the expression or activity of FBXW2 of the subject with the expression or activity of FBXW2 of a healthy control, if the FBXW2 expression or activity of the subject is If the expression or activity is increased, the diagnosed subject has cancer, especially FBXW2-related cancer.

Generally, the reagents used to detect the expression or activity of FBXW2 include: (1) primers or probes targeting FBXW2 or its transcripts, or (2) antibodies or ligands that specifically bind to FBXW2. Primers, probes, antibodies and ligands are as described elsewhere herein.

The present invention provides a kit for diagnosing FBXW2-related cancers, including reagents for detecting the expression or activity of FBXW2. In addition, the kit can also include reagents needed for RT-PCR, such as reverse transcriptase, RNA extraction reagents, nucleic acid polymerase, dNTP, PCR buffer, etc.; or, the kit can also include reagents needed for Northern , such as RNA extraction reagents, ribonuclease inhibitors, Northern buffer, etc.; or, the kit also contains reagents required for Western, such as protein extraction reagents, acrylamide, guanidine isothiocyanate, Tris, SDS, TEMED, etc. .

An exemplary embodiment of the present invention is as follows:

Item 1. The use of an inhibitor of FBXW2 in the preparation of drugs for preventing or treating cancer and inhibiting tumor cell growth,

Preferably, the cancer is FBXW2-mediated cancer, and/or the tumor cells are tumor cells with increased FBXW2 expression, and/or the inhibitor of FBXW2 is an agent that inhibits the expression and/or activity of FBXW2,

More preferably, the inhibitor of FBXW2 is selected from: antibodies or ligands that specifically bind to FBXW2, inhibitory molecules that specifically interfere with the transcription and/or expression of FBXW2 genes, and compounds that inhibit the interaction between FBXW2 and SKP1.

Item 2. The use as described in Item 1, wherein the inhibitory molecule uses the FBXW2 gene or its transcript as an inhibitory target,

Preferably, the inhibitory molecule is selected from the group consisting of: (1) small molecule compounds, antisense nucleic acids, microRNA, siRNA, shRNA, RNAi, dsRNA, sgRNA or combinations thereof, and (2) compounds capable of expressing or forming (1) nucleic acid constructs,

More preferably, the inhibitory molecule is an shRNA or a nucleic acid construct thereof with the FBXW2 gene as shown in gene ID 26190 or its transcript as an inhibitory target.

Item 3. The use as described in Item 1, wherein the compound that inhibits the interaction between FBXW2 and SKP1 is selected from one or more of the compounds shown in formula I-III:

in,

R1, R2, R4, R5 and R6 are each independently selected from C1-C4 alkyl, hydroxyl, halogen or amino,

R3 is heteroaryl optionally substituted by 1-2 substituents selected from C1-C4 alkyl, hydroxy, halogen and amino,

R7 and R8 are each independently selected from C1-C4 alkyl, hydroxyl, halogen or amino,

R9-R11 are each independently selected from C1-C4 alkyl, hydroxyl, halogen or amino.

Item 4. The use as described in item 3, characterized in that,

R1, R2 and R5 are each independently selected from hydroxyl or halogen,

R4 and R6 are each independently selected from C1-C4 alkyl,

R3 is thiophene optionally substituted by 1-2 substituents selected from C1-C4 alkyl, hydroxyl, halogen and amino,

R7 and R8 are each independently selected from C1-C4 alkyl, hydroxyl,

R9 and R12 are each independently selected from hydroxyl, halogen,

R10 and R11 are each independently selected from C1-C4 alkyl and hydroxyl.

Item 5. A method of screening potential substances for the prevention or treatment of cancer, the method comprising:

(2) detecting the expression or activity of FBXW2 in the system, or detecting whether the candidate substance targets cells in which the expression of FBXW2 is increased,

Wherein, if the candidate substance can reduce the expression or activity of FBXW2, or the candidate substance targets cells with high FBXW2 expression, it indicates that the candidate substance is a potential substance for preventing or treating cancer.

Item 6. The method as described in Item 5, wherein,

the cancer is a FBXW2-mediated cancer, and/or

Step (1) includes: in the test group, adding the candidate substance to the system expressing FBXW2 and optional SKP1, and/or

Step (2) includes: detecting the expression or activity of FBXW2 in the system of the test group, and comparing it with the control group, wherein the control group is a system expressing FBXW2 and optional SKP1 without adding the candidate substance, and/or or

The system for expressing FBXW2 and optional SKP1 is selected from: cell system, subcellular system, solution system, tissue system, organ system or animal system.

Item 7. The use of the reagent for detecting the expression or activity of FBXW2 in the preparation of a kit for diagnosing cancer,

Preferably,

the cancer is a FBXW2-mediated cancer, and/or

Reagents for detecting the expression or activity of FBXW2 include: (1) primers or probes targeting FBXW2 or its transcripts, and/or (2) antibodies or ligands specifically binding to FBXW2.

Item 8. The use as described in Item 7, wherein the sequence of the FBXW2 gene or its transcript is shown in gene ID 26190, and the sequence of the FBXW2 protein is shown in the Uniprot database protein ID Q9UKT8.

Item 9. A substance that reduces the expression of FBXW2, said substance having a structure represented by formula IV:

Seq _Forward -X-Seq _Reverse IV,

In formula IV, the _forward direction of Seq is a polynucleotide that recognizes the FBXW2 coding sequence, and the _{reverse direction} of Seq is a polynucleotide that is complementary to the _{_forward} direction and reverse direction of Seq; X is an interval sequence between the forward direction of Seq and the reverse direction of Seq, and The spacer sequence is non-complementary to Seq _forward and Seq _reverse ,

Preferably, Seq _forward comprises SEQ ID NO: 1 or 2.

Item 10. A pharmaceutical composition, comprising the substance for reducing FBXW2 expression described in Item 9 and pharmaceutically acceptable excipients.

Below in conjunction with specific embodiment, further illustrate the present invention. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental method that does not indicate specific conditions in the following examples, usually according to conventional conditions such as Sambrook et al., molecular cloning: the conditions described in the laboratory guide (NewYork: Cold Spring Harbor Laboratory Press, 2002), or according to the conditions suggested by the manufacturer . Percentages and parts are by weight unless otherwise indicated.

Unless otherwise defined, all professional and scientific terms used herein have the same meanings as commonly understood by those skilled in the art. In addition, any methods and materials similar or equivalent to those described can also be applied in the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

Example

experimental method:

shRNA

The shRNA sequence of FBXW2 used in the experiment is

shFBXW2 1: (SEQ ID NO:1)-(SEQ ID NO:3)-(reverse complement of SEQ ID NO:1), targeting tcacgcagtgcacaatcattt of FBXW2 3'UTR (SEQ ID NO:4);

shFBXW2 2: (SEQ ID NO:2)-(SEQ ID NO:3)-(reverse complement of SEQ ID NO:2), targeting gcctttgaaacctcgtcatta (SEQ ID NO:5) of the FBXW2 CDS region.

Cell Proliferation and Soft Agar Colony Formation Assay

In the cell growth curve experiment, 500 cells were inoculated per well in a 96-well plate, and counted with Cell Counting Kit-8 (C0039, Beyotime Biotechnology) every day. For colony formation experiments, 500 cells per well of 6-well plates were seeded, stained with crystal violet and counted after 14 days. In soft agar colony formation experiments, 2000 cells were plated in the supernatant gel, stained with crystal violet and counted after 21 days.

Transwell experiment

A Transwell chamber with a filter membrane of 8.0 μm was selected. 5000 cells were inoculated with DMEM medium without FBS in the upper chamber, and DMEM complete medium containing 10% FBS was added in the lower chamber. After 12 hours, cells were stained with crystal violet to observe cell migration.

Mammalian Two-Hybrid Screening

Construct VP16AD-SKP1 fusion protein, and GAL4DBD-FBXW2 fusion protein. VP16AD-SKP1, GAL4DBD-FBXW2 and the Luciferase reporter gene plasmid controlled by 9X UAS promoter were co-transfected into 293T cell line, the inhibitor was added after 12 hours, and the intensity of Luciferase was detected after 24 hours.

Co-immunoprecipitation experiment

The 293T cell line was transfected with HA-FBXW2 and Flag-SKP1 plasmids, and the corresponding inhibitors and proteasome inhibitor MG132 were added 24 hours later. After 12 hours, the cells were lysed and Anti-HA beads were added for co-immunoprecipitation. Afterwards, SDS-PAGE experiments were performed to detect protein binding.

Orthotopic injection experiment in nude mice

^1x107 cells were resuspended in PBS and injected into the fourth pair of mammary fat pads of 6-week-old female nude mice. Experimental animals were purchased from Shanghai Experimental Animal Center and kept in SPF environment. The tumor was measured every 3 days, and the tumor volume was calculated according to the formula of L×W2×0.52. All animal operations were performed in accordance with the guidelines of the Shanghai Life Science Animal Protection Committee.

Example 1, FBXW2 accelerates tumor cell growth and promotes tumorigenesis.

In order to study the function of FBXW2 in tumor cells, we constructed two breast cancer cell lines, MDA-MB-231 and HS578T, by using lentiviral packaging shRNA to construct FBXW2 knockdown stable transfection lines, and detected the expression of these stable transfection cell lines. Growth and clonogenicity (Fig. 1, A). The results showed that knockdown of FBXW2 in two cell lines, MDA-MB-231 and HS578T, could significantly inhibit cell growth and reduce cell colony formation efficiency (Fig. 1, B-D). Moreover, MDA-MB-231 cells with low FBXW2 expression formed fewer colonies in the soft agar colony formation assay, indicating that knockdown of FBXW2 could inhibit the growth and invasion ability of tumor cells (Fig. 1, E and F). When the cell migration ability was measured by Transwell assay, we found that the FBXW2 knockdown cell migration ability was significantly weakened (Fig. 1, G and H). In the orthotopic injection tumorigenic experiment in nude mice, we found that the tumorigenic ability of MDA-MB-231 cells knocked down by FBXW2 was significantly weakened (Fig. 1, I-K). Therefore, FBXW2 can promote the growth and invasion of tumor cells, and then promote the occurrence and development of tumors.

Example 2, Teniposide is a specific inhibitor of FBXW2

In order to study the therapeutic methods targeting FBXW2, we used the mammalian two-hybrid screening system to screen 1600 FDA-approved small molecule compounds to find FBXW2 inhibitors. As a result, we found many inhibitors that could inhibit the binding of SKP1 and FBXW2, such as Teniposide, Camptothecin and Chloquinan. Through co-immunoprecipitation experiments (Fig. 2, A), we verified that Teniposide can significantly inhibit the combination of FBXW2 and SKP1. In addition, we treated MDA-MB-231 cells with different concentrations of Teniposide for 72 hours, and found that Teniposide could significantly inhibit the growth of tumor cell MDA-MB-231 (CCK8 detection). However, when FBXW2 was knocked down, the inhibitory effect of Teniposide on MDA-MB-231 was weakened (Fig. 2, B). Therefore, Teniposide can inhibit tumor cell growth by specifically inhibiting the function of FBXW2.

Claims

A use of an FBXW2 inhibitor in the preparation of drugs for preventing or treating cancer and inhibiting tumor cell growth,

Preferably,

the cancer is a FBXW2-mediated cancer, and/or

The tumor cells are tumor cells with increased expression of FBXW2, and/or

The inhibitor of FBXW2 is an agent that inhibits the expression and/or activity of FBXW2,

More preferably, the inhibitor of FBXW2 is selected from: antibodies or ligands that specifically bind to FBXW2, inhibitory molecules that specifically interfere with the transcription and/or expression of FBXW2 genes, and compounds that inhibit the interaction between FBXW2 and SKP1.
The use according to claim 1, wherein the inhibitory molecule uses the FBXW2 gene or its transcript as an inhibitory target,

Preferably, the inhibitory molecule is selected from the group consisting of: (1) small molecule compounds, antisense nucleic acids, microRNA, siRNA, shRNA, RNAi, dsRNA, sgRNA or combinations thereof, and (2) compounds capable of expressing or forming (1) nucleic acid constructs,

More preferably, the inhibitory molecule is an shRNA or a nucleic acid construct thereof with the FBXW2 gene as shown in gene ID 26190 or its transcript as an inhibitory target.
The use according to claim 1, wherein the compound that inhibits the interaction between FBXW2 and SKP1 is selected from one or more of the compounds shown in Formula I-Formula III:

in,

R1, R2, R4, R5 and R6 are each independently selected from C1-C4 alkyl, hydroxyl, halogen or amino,

R3 is heteroaryl optionally substituted by 1-2 substituents selected from C1-C4 alkyl, hydroxy, halogen and amino,

R7 and R8 are each independently selected from C1-C4 alkyl, hydroxyl, halogen or amino,

R9-R11 are each independently selected from C1-C4 alkyl, hydroxyl, halogen or amino.
purposes as claimed in claim 3, is characterized in that,

R1, R2 and R5 are each independently selected from hydroxyl or halogen,

R4 and R6 are each independently selected from C1-C4 alkyl,

R3 is thiophene optionally substituted by 1-2 substituents selected from C1-C4 alkyl, hydroxyl, halogen and amino,

R7 and R8 are each independently selected from C1-C4 alkyl, hydroxyl,

R9 and R12 are each independently selected from hydroxyl, halogen,

R10 and R11 are each independently selected from C1-C4 alkyl and hydroxyl.
A method of screening potential substances for the prevention or treatment of cancer, the method comprising:

(1) treating a system expressing FBXW2 and optionally SKP1 with a candidate substance; and

(2) detecting the expression or activity of FBXW2 in the system, or detecting whether the candidate substance targets cells in which the expression of FBXW2 is increased,

Wherein, if the candidate substance can reduce the expression or activity of FBXW2, or the candidate substance targets cells with high FBXW2 expression, it indicates that the candidate substance is a potential substance for preventing or treating cancer.
The method of claim 5, wherein

the cancer is a FBXW2-mediated cancer, and/or

Step (1) includes: in the test group, adding the candidate substance to the system expressing FBXW2 and optional SKP1, and/or

Step (2) includes: detecting the expression or activity of FBXW2 in the system of the test group, and comparing it with the control group, wherein the control group is a system expressing FBXW2 and optional SKP1 without adding the candidate substance, and/or or

The system for expressing FBXW2 and optional SKP1 is selected from: cell system, subcellular system, solution system, tissue system, organ system or animal system.
Use of a reagent for detecting FBXW2 expression or activity in the preparation of a kit for diagnosing cancer,

Preferably,

the cancer is a FBXW2-mediated cancer, and/or

Reagents for detecting the expression or activity of FBXW2 include: (1) primers or probes targeting FBXW2 or its transcripts, and/or (2) antibodies or ligands specifically binding to FBXW2.
The use according to claim 7, wherein the sequence of the FBXW2 gene or its transcript is as shown in gene ID 26190, and the sequence of the FBXW2 protein is as shown in the Uniprot database protein ID Q9UKT8.
A substance that reduces the expression of FBXW2, said substance containing the structure shown in formula IV:

Seq Forward -X-Seq Reverse IV,

In formula IV, the forward direction of Seq is a polynucleotide that recognizes the FBXW2 coding sequence, and the reverse direction of Seq is a polynucleotide that is complementary to the forward direction and reverse direction of Seq; X is an interval sequence between the forward direction of Seq and the reverse direction of Seq, and The spacer sequence is non-complementary to Seq forward and Seq reverse ,

Preferably, Seq forward comprises SEQ ID NO: 1 or 2.
A pharmaceutical composition comprising the substance for reducing the expression of FBXW2 according to claim 9 and pharmaceutically acceptable auxiliary materials.