CN115337400A

CN115337400A - Reagent for diagnosing and treating tumor and its use

Info

Publication number: CN115337400A
Application number: CN202110522064.8A
Authority: CN
Inventors: 高大明; 李龙
Original assignee: Center for Excellence in Molecular Cell Science of CAS
Current assignee: Center for Excellence in Molecular Cell Science of CAS
Priority date: 2021-05-13
Filing date: 2021-05-13
Publication date: 2022-11-15
Also published as: WO2022237621A1

Abstract

The invention relates to a reagent for diagnosing and treating tumors and application thereof. The invention provides an application of an FBXW2 inhibitor in preparing a medicament for preventing or treating cancer and inhibiting the growth of tumor cells. The invention discloses the function of the FBXW2 protooncogene and provides a new strategy for clinical treatment.

Description

Reagent for diagnosing and treating tumor and its use

Technical Field

The invention belongs to the field of biotechnology; more particularly, the invention relates to agents and methods for treating tumors.

Background

The F-box protein is a substrate recognition protein of a SCF (SKP 1-Cullin 1-F-box) complex, and common F-box proteins include FBXW7, TRCP and the like. These F-box proteins ubiquitinate degrade many important regulatory proteins in the cell and thus play a crucial role in tumorigenesis and development. As a member of the F-box family, FBXW2 (encoding gene names: fbxw2 or Fbw2, F-box and WD repeat domain binding 2, gene ID 26190. Uniprot database protein ID: Q9UKT 8) has been studied less functionally, especially FBXW2 function in tumor cells. Recently, it has been shown that FBXW2 plays a role as an anti-cancer gene in lung cancer by degrading SKP2 and β -catenin. Therefore, the function of FBXW2 in tumors and whether it can be used as an anti-tumor target are urgently needed to be determined.

Disclosure of Invention

The inventor finds that FBXW2 is protooncoprotein and can promote the growth and migration of tumor cells. Knocking down FBXW2 can reduce the proliferation and clone formation of tumor cells and inhibit the invasion and metastasis capacity of the tumor cells. Therefore, FBXW2 is a potential anti-tumor therapeutic target.

The invention aims to provide a cancer drug target and a reagent and a method for preventing and treating cancer, in particular to FBXW 2-related cancer.

The invention provides the application of an FBXW2 inhibitor in preparing a medicament for preventing or treating cancer and inhibiting the growth of tumor cells.

In one or more embodiments, the cancer is a FBXW 2-mediated cancer.

In one or more embodiments, the cancer is a cancer with increased expression of FBXW 2.

In one or more embodiments, the cancer is a cancer involving the interaction of FBXW2 with SKP 1.

In one or more embodiments, the cancer is breast cancer.

In one or more embodiments, the tumor cell is a tumor cell with increased expression of FBXW 2.

In one or more embodiments, the inhibitor of FBXW2 is an agent that inhibits expression and/or activity of FBXW 2. In one or more embodiments, the activity is an activity that interacts with SKP 1.

In one or more embodiments, the inhibitor of FBXW2 is:

an antibody or ligand that specifically binds to FBXW 2;

inhibitory molecules that specifically interfere with the transcription and/or expression of the FBXW2 gene; or

A compound that inhibits the interaction of FBXW2 with SKP 1.

In one or more embodiments, the antibody that specifically binds FBXW2 is a polyclonal antibody or a monoclonal antibody.

In one or more embodiments, the inhibitory molecule targets the FBXW2 gene or a transcript thereof.

In one or more embodiments, the inhibitory molecule is targeted for inhibition at the 3' utr or CDS region of the FBXW2 gene.

In one or more embodiments, the inhibitory molecule has as an inhibitory target the sequence tcacgcagtgacaacaatctt (SEQ ID NO: 4) in the 3' utr of the FBXW2 gene or gccttttgaaacctcgtcatta (SEQ ID NO: 5) in the CDS region.

In one or more embodiments, the sequence of the FBXW2 gene or transcript thereof is as described in gene ID: 26190.

In one or more embodiments, the sequence of the FBXW2 protein is as described in Uniprot database protein ID: q9UKT8.

In one or more embodiments, the inhibitory molecule is selected from the group consisting of: (1) A small molecule compound, an antisense nucleic acid, a microRNA, a siRNA, a shRNA, an RNAi, a dsRNA, a sgRNA, or a combination thereof, and (2) a nucleic acid construct capable of expressing or forming (1). Preferably, the inhibitory molecule is a shRNA or construct targeting the inhibition by the FBXW2 gene or a transcript thereof (e.g.3 'UTR or CDS region of the FBXW2 gene, preferably SEQ ID NO:4 in the 3' UTR or SEQ ID NO:5 in the CDS region).

In one or more embodiments, the inhibitor is an agent, such as an sgRNA, that knocks down or knocks down FBXW2 using a technique selected from ZFNs, TALENs, and CRISPRs. In one or more embodiments, the inhibitor further comprises a Cas enzyme (e.g., cas 9), its coding sequence, and/or a nucleic acid construct expressing the Cas enzyme.

In one or more embodiments, the inhibitory molecule is a shRNA or a nucleic acid construct thereof comprising a structure according to formula IV:

Seq _{forward direction} -X-Seq _{Reverse direction} In the formula IV, the compound is shown in the formula,

in formula IV, seq _{Forward direction of rotation} For identifying the polynucleotides of the FBXW2 gene or its transcripts Seq _{Reverse direction} Is and Seq _{Forward direction of rotation} A reverse complement of the polynucleotide;

x is a spacer sequence between the forward direction of Seq and the reverse direction of Seq, and the spacer sequence is in parallel with Seq _{Forward direction} And Seq _{Reverse direction} Are not complementary.

In one or more embodiments, seq _{Forward direction of rotation} The length is 5-20bp, preferably 8-15bp.

In one or more embodiments, seq _{Forward direction} Comprises

SEQ ID NO

1 or 2.

In one or more embodiments, X comprises SEQ ID NO 3.

In one or more embodiments, the compound that inhibits the interaction of FBXW2 with SKP1 is a compound of formula I:

wherein R1, R2, R4, R5 and R6 are each independently selected from C1-C4 alkyl, hydroxy, halogen or amino,

r3 is heteroaryl optionally substituted with 1-2 substituents selected from C1-C4 alkyl, hydroxy, halogen and amino.

In one or more embodiments, R1, R2, and R5 are each independently selected from hydroxy or halogen.

In one or more embodiments, R1, R2, and R5 are hydroxy.

In one or more embodiments, R4 and R6 are each independently selected from C1-C4 alkyl.

In one or more embodiments, R4 and R6 are methyl.

In one or more embodiments, R3 is thiophene optionally substituted with 1-2 substituents selected from C1-C4 alkyl, hydroxy, halogen, and amino.

In one or more embodiments, the compound that inhibits the interaction of FBXW2 with SKP1 is a compound of formula II:

wherein R7 and R8 are each independently selected from C1-C4 alkyl, hydroxy, halogen or amino.

In one or more embodiments, R7 and R8 are each independently selected from C1-C4 alkyl, hydroxy.

In one or more embodiments, R7 is C1-C4 alkyl.

In one or more embodiments, R8 is hydroxy.

In one or more embodiments, the compound that inhibits the interaction of FBXW2 with SKP1 is a compound of formula III:

wherein R9-R11 are each independently selected from C1-C4 alkyl, hydroxy, halogen or amino.

In one or more embodiments, R9 and R12 are each independently selected from hydroxy, halo.

In one or more embodiments, R10 and R11 are each independently selected from C1-C4 alkyl, hydroxy.

In one or more embodiments, R10 is C1-C4 alkyl.

In one or more embodiments, R11 is hydroxy.

In one or more embodiments, the compound that inhibits the interaction of FBXW2 with SKP1 is selected from

In another aspect of the present invention, there is provided a method of screening for a potential substance for preventing or treating cancer, the method comprising:

(1) Treating a system expressing FBXW2 and optionally SKP1 with a candidate substance; and

(2) Detecting expression or activity of FBXW2 in said system, or detecting whether said candidate agent targets a cell in which FBXW2 expression is increased.

In one or more embodiments, the activity is an activity that interacts with SKP 1.

In one or more embodiments, if the candidate agent can reduce expression or activity of FBXW2, or the candidate agent targets cells that highly express FBXW2, then the candidate agent is indicative of a potential agent for preventing or treating cancer.

In one or more embodiments, the cancer is a FBXW 2-mediated cancer.

In one or more embodiments, the cancer is a cancer involving interaction of FBXW2 with SKP 1.

In one or more embodiments, the cancer is breast cancer.

In one or more embodiments, step (1) comprises: in the test group, the candidate substance is added to a system expressing FBXW2 and optionally SKP 1.

In one or more embodiments, step (2) comprises: detecting the expression or activity of FBXW2 in the test group of systems and comparing it with a control group, wherein said control group is a system expressing FBXW2 and optionally SKP1 without the addition of said candidate substance.

In one or more embodiments, a candidate is a potential agent for preventing or treating cancer if the expression or activity of FBXW2 in the test group is statistically lower (preferably significantly lower, e.g., more than 20% lower, preferably more than 50% lower, more preferably more than 80% lower) than in the control group.

In one or more embodiments, the system expressing FBXW2 and optionally SKP1 is selected from: cell systems (or cell culture systems), subcellular systems, solution systems, tissue systems, organ systems, or animal systems.

In one or more embodiments, the system expressing FBXW2 and optionally SKP1 is a cancer cell or a solution system.

In another aspect, the present invention provides a method for preventing or treating cancer, the method comprising: downregulating expression or activity of said mammalian cell FBXW 2.

In one or more embodiments, the methods comprise administering an inhibitor of FBXW2 to a patient in need thereof.

In one or more embodiments, the other features of the method are as described in the first aspect herein.

Another aspect of the present invention provides the use of an agent for detecting FBXW2 expression or activity in the manufacture of a kit for diagnosing cancer.

In one or more embodiments, the cancer is a FBXW 2-mediated cancer.

In one or more embodiments, the cancer is FBXW 2-mediated breast cancer.

In one or more embodiments, the agent for detecting FBXW2 expression or activity comprises:

(1) A primer or probe targeting FBXW2 or a transcript thereof, or

(2) An antibody or ligand that specifically binds FBXW 2.

In one or more embodiments, the kit further comprises reagents required for RT-PCR, such as reverse transcriptase, RNA extraction reagents, nucleic acid polymerase, dntps, PCR buffer, and the like.

In one or more embodiments, the kit further comprises reagents required for Northern, such as RNA extraction reagents, ribonuclease inhibitors, northern buffers, and the like.

In one or more embodiments, the kit further comprises reagents required for Western blotting, such as protein extraction reagents, acrylamide, guanidinium isothiocyanate, tris, SDS, TEMED, and the like.

In another aspect of the present invention, there is provided a method for diagnosing cancer, the method comprising detecting expression of FBXW2 in a subject.

In one or more embodiments, the method comprises:

(1) A sample of the subject is obtained and,

(2) Detecting FBXW2 expression or activity in a subject sample, and

(3) Comparing the subject's FBXW2 expression or activity to that of a healthy control, and diagnosing the subject as having cancer if the subject's FBXW2 expression or activity is increased.

In one or more embodiments, the sample is a bodily fluid or tissue biopsy.

In one or more embodiments, the cancer is a FBXW 2-mediated cancer.

In one or more embodiments, the cancer is FBXW 2-mediated breast cancer.

In yet another aspect, the present invention provides a substance that reduces expression of FBXW2, said substance comprising a structure according to formula IV:

Seq _{forward direction of rotation} -X-Seq _{Reverse direction} In the formula IV, the compound is shown in the formula,

in formula IV, seq _{Forward direction of rotation} Seq for identification of the polynucleotide coding sequence of FBXW2 _{Reverse direction} Is and Seq _{Forward direction} A reverse complement polynucleotide;

In one or more embodiments, seq _{Forward direction} The length is 5-20bp, preferably 8-15bp.

In one or more embodiments, seq _{Forward direction of rotation} Comprises

SEQ ID NO

1 or 2.

In one or more embodiments, X comprises SEQ ID NO 3.

In another aspect of the invention, there is provided a pharmaceutical composition comprising an agent that reduces FBXW2 expression as described herein and a pharmaceutically acceptable excipient.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

Fig. 1 shows that FBXW2 accelerates tumor cell growth.

(A) Detecting MDA-MB-231 and HS578T FBXW2 knockdown stable cell lines constructed by shRNA by an immunoblotting method;

(B) Cell growth curve experiments tested MDA-MB-231 (left) and HS578T (right) cell lines that stably transformed unloaded PLKO.1 or FBXW2 shRNA;

(C, D) representative graph (C) and data statistics (D) in control and FBXW2 knockdown cell line clonal cell experiments in MDA-MB-231 and HS578T cell lines;

(E, F) microscopy images of MDA-MB-231FBXW2 knockdown cell lines and control cell lines in soft agar colony formation experiments. (F) Data statistics for each microscopic image are presented (n = 3);

(G, H) Transwell assay test the migratory capacity of FBXW2 knockdown and control cells. (G) As a statistical graph (n = 10) of cell migration efficiency in each field, (H) is a representative picture;

(I) Tumor volume growth curve for in situ injection tumorigenesis experiments in nude mice (n = 9);

(J, K) is the statistical result of the tumor weight of the nude mice in situ injection tumor forming experiment (n = 9). (K) is a tumor picture;

statistical analysis was performed in (B, D, F, H, I, J) using student's test, and the results were expressed as mean. + -. Standard error. Results were taken from three independent replicates. * 0.01-P (t) -knot bundles 0.05, 0.001-P (t) -knot bundles 0.01 and P <0.001.

Figure 2 shows that Teniposide targets FBXW2 to inhibit tumor cell growth.

(A) Immunoblot detection of whole cell lysates and immunoprecipitation detection of 293T cells transfected with the graphic plasmid and treated with DMSO or other compounds;

(B) Relative inhibition curves for Teniposide. FBXW2 knockdown MDA-MB-231 cells and controls were treated with different concentrations of Teniposide for 72 hours. Cell number was measured by CCK 8. Statistical analysis was performed using student's test and results are expressed as mean ± standard error. Results were taken from three independent replicates. * 0.01-P (woven fabric) woven fabric (0.05) and 0.001-P woven fabric (0.01).

Detailed Description

To better target FBXW2 for clinical treatment, the inventors screened 1600 FDA-approved small molecule compounds. As a result, the anticancer drug Teniposide can inhibit the combination of FBXW2 and an interaction protein SKP1 thereof, thereby leading to the inactivation of FBXW 2. In addition, the inventors have found that Teniposide specifically targets cells highly expressed by FBXW2, thereby inhibiting tumor cell growth. These findings reveal the function of FBXW2 protooncogene, providing a new strategy for clinical treatment. The invention provides a drug target (FBXW 2) of cancer, and a reagent and a method for preventing and treating cancer, in particular to FBXW 2-related cancer.

Based on the above findings, the FBXW2 inhibitor can prevent or treat cancer and inhibit tumor cell growth. The cancers described herein are primarily cancers associated with FBXW2 function, e.g., cancers with increased expression of FBXW2 and/or cancers involving interaction of FBXW2 with SKP 1. In an exemplary embodiment, the cancer is breast cancer and the tumor cell is a tumor cell with increased expression of FBXW 2.

FBXW2 and inhibitors thereof

As used herein, "FBXW2 gene", "FBXW2" or "Fbw2" are used interchangeably with gene ID 26190. The polypeptide coded by the gene is named as 'FBXW 2', uniprot database protein ID: q9UKT8. In the present invention, the term "FBXW2" refers to a polypeptide having the sequence shown in Uniprot ID Q9UKT8 having FBXW2 activity. The term also includes variants of the sequence shown in Uniprot ID Q9UKT8 that have the same function as FBXW 2. These variants include (but are not limited to): deletion, insertion and/or substitution of several (usually 1 to 50, preferably 1 to 30, 1 to 20, 1 to 10, 1 to 8, 1 to 5) amino acids, and addition or deletion of one or several (usually up to 20, preferably up to 10, more preferably up to 5) amino acids at the C-terminal and/or N-terminal. For example, in the art, substitutions with amino acids that are similar or analogous in performance do not typically alter the function of the protein. In the art, amino acids with similar properties are often referred to as families of amino acids with similar side chains, which are well defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, lactic acid, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine tryptophan, histidine). Also, for example, the addition of one or more amino acids at the amino-and/or carboxy-terminus will not generally alter the function of the polypeptide or protein. Conservative amino acid substitutions for many commonly known non-genetically encoded amino acids are known in the art. Conservative substitutions of other non-coding amino acids may be determined based on a comparison of their physical properties with those of genetically coded amino acids.

Variants of the polypeptides include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants.

Any polypeptide having a high homology to said FBXW2 (such as 70% or more homology to the sequence represented by Q9UKT 8; preferably 80% or more homology; more preferably 90% or more homology, such as 95%,98% or 99% homology) and having a similar or identical function to FBXW2 is also encompassed by the present invention. The "same or similar function" mainly refers to a function of interacting with SKP1 and promoting growth and invasion of tumor cells.

The invention also includes analogs of the claimed polypeptides. These analogs can differ from native FBXW2 by amino acid sequence differences, by modifications that do not affect the sequence, or by both. Analogs of these proteins include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by irradiation or exposure to mutagens, site-directed mutagenesis, or other well-known biological techniques. Analogs also include analogs having residues other than the natural L-amino acids (e.g., D-amino acids), as well as analogs having non-naturally occurring or synthetic amino acids (e.g., beta, gamma-amino acids). It is to be understood that the proteins of the present invention are not limited to the representative proteins exemplified above.

The polypeptide fragment, derivative or analogue of the invention may also be: (i) A polypeptide formed by fusing a mature polypeptide to another compound (such as a compound that increases the half-life of the polypeptide, e.g., polyethylene glycol); or (ii) a polypeptide in which an additional amino acid sequence is fused to the polypeptide sequence (e.g., a leader or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or a fusion protein). Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the definitions herein.

The invention also relates to polynucleotide sequences encoding the FBXW2 of the invention or variants, analogues, derivatives thereof. The polynucleotide may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide may be identical to the sequence of the coding region shown in gene ID 26190 or may be a degenerate variant.

The invention also relates to variants of the above polynucleotides which encode fragments, analogs and derivatives of the polypeptides having the same amino acid sequence as the invention. The variant of the polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the polypeptide encoded thereby. As used herein, degenerate variants refer herein to nucleic acid sequences that encode a protein having Uniprot ID Q9UKT8, but differ from the coding region sequence shown in gene ID 26190. A "polynucleotide encoding a polypeptide" may be a polynucleotide comprising a sequence encoding the polypeptide, or may be a polynucleotide further comprising additional coding and/or non-coding sequences.

The present invention also relates to polynucleotides which hybridize to the sequences described above and which have at least 50%, preferably at least 70%, more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the polynucleotides of the present invention. In the present invention, "stringent conditions" refer to (1) hybridization and elution at lower ionic strength and higher temperature, e.g., 0.2 XSSC, 0.1% SDS,60 ℃; or (2) adding a denaturing agent such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll,42 ℃ etc. at the time of hybridization; or (3) hybridization only when the identity between two sequences is at least 90% or more, preferably 95% or more. Moreover, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO. 1.

The full-length nucleotide sequence of FBXW2 of the present invention or a fragment thereof (e.g., a primer or a probe) can be obtained by PCR amplification, recombination, or artificial synthesis. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the sequences can be amplified using a commercially available DNA library or a cDNA library prepared by conventional methods known to those skilled in the art as a template. Alternatively, the sequence of interest may be synthesized by artificial synthesis, particularly where the fragment is of a shorter length, such as a primer or probe. Methods known in the art for designing Primer and probe sequences are all useful herein, for example by software Primer Express.

The invention also relates to FBXW2 inhibitors and uses thereof. Since FBXW2 inhibitors can modulate the expression and/or activity, etc. of FBXW2, the inhibitors can also inhibit tumor growth through the effect on FBXW 2.

Any substance that reduces the activity, reduces the stability, inhibits the expression, reduces the effective duration of action, reduces the interaction with a cognate protein (e.g., SKP 1), or reduces transcription and translation of FBXW2 can be used in the present invention as a down-regulator, antagonist or inhibitor of FBXW 2. Exemplary inhibitors include antibodies or ligands that specifically bind to FBXW 2; inhibitory molecules that specifically interfere with the transcription and/or expression of the FBXW2 gene (e.g., interfering molecules that can form shRNA); or a compound that inhibits FBXW2 activity.

Any antibody or ligand known in the art that specifically binds FBXW2 can be used in the present invention. The antibody may be a monoclonal antibody or a polyclonal antibody. The FBXW2 protein can be used for immunizing animals such as rabbits, mice, rats, camels and the like to produce polyclonal antibodies; various adjuvants may be used to enhance the immune response, including but not limited to Freund's adjuvant and the like. Similarly, cells expressing FBXW2 or antigenic fragments thereof can be used to immunize animals to produce antibodies. The antibody may also be a monoclonal antibody, and such monoclonal antibodies may be prepared using hybridoma technology or single cell screening. Furthermore, after the sequence of the antibody is known, the coding sequence of the antibody may be loaded into an expression vector, whereby the antibody gene is operably linked to a promoter, a terminator, and the like, and expressed in a host cell, thereby producing the antibody. Other components required for expression vectors, such as promoters, terminators, expression vectors may be bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses, or other vectors. In general, any plasmid and vector may be used as long as they are capable of replication and stability in the host. It will be clear to one of ordinary skill in the art how to select appropriate vectors, promoters, enhancers and host cells.

Methods for making interfering molecules that interfere with the expression of a particular gene, once the target sequence is known, are well known to those skilled in the art. In a preferred embodiment of the present invention, the FBXW2 inhibitor is an shRNA specific to FBXW2 or a construct thereof, wherein the shRNA specifically recognizes FBXW2 gene or a transcript thereof. Herein, "transcript" comprises a UTR region (e.g., 3' UTR) and a CDS region. For example, the shRNA may be targeted for inhibition by the sequence tcacgcaggtgcacaatcittt (SEQ ID NO: 4) in the 3' UTR of the FBXW2 gene or gcctttgaaacctcgtcatata (SEQ ID NO: 5) in the CDS region. Exemplary shrnas have the following structure: (reverse complement of SEQ ID NO: 1) - (SEQ ID NO: 3) - (SEQ ID NO: 1) or (reverse complement of SEQ ID NO: 2) - (SEQ ID NO: 3) - (SEQ ID NO: 2).

Furthermore, to down-regulate FBXW2 gene expression or activity, gene knockout vectors can be introduced into the cell and/or the gene can be edited using gene editing techniques such as ZFNs, TALENs or CRISPR/Cas9, and the like. ZFN, TALEN and CRISPR/Cas9 technologies suitable for use in the present invention are well known in the art. Each technique realizes the knockout of a target gene through the combined action of a DNA recognition domain and an endonuclease.

FBXW2 activity as described herein includes its interaction with SKP 1. Thus, compounds that inhibit FBXW2 activity include compounds that inhibit the interaction between FBXW2 and SKP 1. The inventors found that Teniposide, camptothecin and Chloroquinan inhibited the interaction between FBXW2 and SKP 1. Thus, the compound that inhibits the interaction of FBXW2 with SKP1 can be a compound of formula I, formula II, or formula III

Wherein R1, R2, R4, R5 and R6 are each independently selected from C1-C4 alkyl, hydroxy, halogen or amino, R3 is heteroaryl optionally substituted with 1-2 substituents selected from C1-C4 alkyl, hydroxy, halogen and amino, R7 and R8 are each independently selected from C1-C4 alkyl, hydroxy, halogen or amino, and R9-R11 are each independently selected from C1-C4 alkyl, hydroxy, halogen or amino.

As used herein, the term "alkyl", alone or in combination with other terms, refers to saturated aliphatic alkyl groups, including straight or branched chain alkyl groups of 1-20 carbon atoms, as well as cyclic groups. Preferably, alkyl means a medium alkyl group containing 1 to 10 carbon atoms, such as methyl, ethyl, propyl, 2-isopropyl, n-butyl, isobutyl, tert-butyl, pentyl and the like. More preferably, it means a lower alkyl group having 1 to 4 carbon atoms, such as methyl, ethyl, propyl, 2-isopropyl, n-butyl, isobutyl, tert-butyl and the like. The cyclic group may be monocyclic or polycyclic, and preferably has 3 to 10 ring carbon atoms. Exemplary cyclic groups include cyclopropyl, cyclopropylmethyl, cyclopentyl, cyclohexyl, adamantyl, and substituted and unsubstituted bornyl, norbornyl, and norbornenyl groups. The alkyl group may be substituted or unsubstituted. When substituted, the number of substituents is 1 or more, preferably 1 to 3, more preferably 1 or 2, and the substituents are independently selected from the group consisting of halogen, carboxyl, hydroxy, lower alkoxy, aryl.

Unless otherwise indicated, the term "aryl" refers to a polyunsaturated, aromatic hydrocarbon substituent which may be a single ring or multiple rings (preferably 1-3 rings) which are fused together (i.e., a fused ring aryl) or covalently linked. The term "heteroaryl" refers to an aryl (or ring) containing at least one heteroatom such as N, O, or S, wherein the nitrogen and sulfur atoms are optionally oxidized, and the nitrogen atoms are optionally quaternized. The heteroaryl group may be attached to the remainder of the molecule through a carbon or heteroatom. Non-limiting examples of aryl and heteroaryl groups include phenyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl, 2-quinoxalyl, 5-quinoxalyl, 3-quinolyl and 6-quinolyl. The above examples may be substituted or unsubstituted, and the divalent groups exemplified for each of the above heteroaryl groups are non-limiting examples of heteroarylene groups. The above aryl or heteroaryl group may be substituted with a substituent selected from an optionally substituted C1-C4 alkyl group, hydroxyl group, halogen, amino group, heterocyclic group or heteroaryl group.

The term "halogen" as used herein refers to F, cl, br, or I. The term "hydroxy" denotes the-OH group. The term "oxo" or the group "oxy" denotes the = O group. The term "amino" refers to the group-NH 2.

Pharmaceutical composition

The invention also provides a composition comprising an effective amount (e.g., 0.000001-50wt%, preferably 0.00001-20wt%, more preferably 0.0001-10 wt%) of the FBXW2 inhibitor, and a pharmaceutically acceptable excipient. The composition can be used for preventing and treating FBXW 2-related cancers. Any of the foregoing inhibitors of FBXW2 may be used in the preparation of the composition.

As used herein, the "effective amount" refers to an amount that produces a function or activity in and is acceptable to humans and/or animals. The "pharmaceutically acceptable carrier" refers to a carrier for administration of the therapeutic agent, including various excipients and diluents. The term refers to such pharmaceutical carriers: they are not essential active ingredients per se and are not unduly toxic after administration. Suitable carriers are well known to those of ordinary skill in the art. Pharmaceutically acceptable carriers in the composition may comprise liquids such as water, saline, buffers. In addition, auxiliary substances, such as fillers, lubricants, glidants, wetting or emulsifying agents, pH buffering substances and the like may also be present in these carriers. The vector may also contain a cell transfection reagent.

Once the use of the FBXW2 gene or protein inhibitor is known, various methods well known in the art can be used to administer the inhibitor or gene encoding it, or a pharmaceutical composition thereof, to a mammal. Including but not limited to: subcutaneous injection, intramuscular injection, transdermal administration, topical administration, implantation, sustained release administration, and the like; preferably, the mode of administration is parenteral.

Preferably, the method can be carried out by means of gene therapy. For example, an inhibitor of FBXW2 can be administered directly to a subject by a method such as injection; alternatively, expression units carrying an inhibitor of FBXW2 (such as antibody expression vectors or viruses, etc., or shRNA constructs) can be delivered to a target (e.g., tumor cell) in a manner that allows expression of the active FBXW2 inhibitor, depending on the type of inhibitor, as is well known to those skilled in the art.

The effective amount of the FBXW2 inhibitor of the present invention may vary depending on the mode of administration and the severity of the disease to be treated, etc. The selection of a preferred effective amount can be determined by one of ordinary skill in the art based on a variety of factors (e.g., by clinical trials). Such factors include, but are not limited to: pharmacokinetic parameters of the inhibitor of the FBXW2 gene or protein such as bioavailability, metabolism, half-life, etc.; the severity of the disease to be treated, the weight of the patient, the immune status of the patient, the route of administration, and the like. Generally, satisfactory results are obtained when the inhibitor of FBXW2 of the invention is administered daily at a dosage of about 0.00001mg to 50mg per kg of animal body weight (e.g., 0.0001mg to 10mg per kg of animal body weight). For example, divided doses may be administered several times per day, or the dose may be proportionally reduced, as urgently required by the condition being treated.

Drug screening

After close correlation of FBXW2 with the relevant cancer is known, substances that inhibit expression or activity of FBXW2 can be screened based on this feature. From the substances, a drug useful for preventing or treating FBXW 2-related cancers can be found.

Accordingly, the present invention provides a method for screening a potential substance for preventing or treating FBXW 2-related cancer, the method comprising: treating a system expressing FBXW2 and optionally SKP1 with a candidate substance; and detecting expression or activity of FBXW2 in said system. The activity is for example the interaction of FBXW2 with SKP 1. If the candidate substance reduces the expression or activity of FBXW2, the candidate substance is a potential substance for preventing or treating cancer.

The system expressing FBXW2 may be, for example, a cell (or cell culture) system, the cell may be a cell endogenously expressing FBXW 2; or may be a cell recombinantly expressing FBXW 2. The system for expressing FBXW2 can also be a subcellular system, a solution system, a tissue system, an organ system or an animal system (such as an animal model, preferably a non-human mammal animal model, such as a mouse, a rabbit, a sheep, a monkey, etc.), and the like.

In a preferred embodiment of the present invention, a control group may be provided in order to more easily observe the change in the expression or activity of MCP-1 during screening, and the control group may be a system expressing FBXW2 without adding the candidate substance.

The method for detecting the expression, activity, amount of expression or secretion of FBXW2 protein in the present invention is not particularly limited. Conventional protein quantitative or semi-quantitative detection techniques may be employed, such as (but not limited to): SDS-PAGE, western-Blot, etc.

Furthermore, once it is known that FBXW2 can target cells with increased FBXW2 expression, a substance can be screened by detecting whether the candidate substance targets cells in which FBXW2 expression is increased. Accordingly, the present invention provides a method of screening for a potential substance for preventing or treating FBXW 2-associated cancer, the method comprising: treating a system expressing FBXW2 with a candidate substance; and detecting whether the candidate agent targets a cell in which FBXW2 expression is increased. If the candidate substance targets cells highly expressing FBXW2, the candidate substance is indicated to be a potential substance for preventing or treating cancer.

Diagnostics and kits

Based on the fact that FBXW2 can promote the growth and invasion of tumor cells, and further promote the occurrence and development of tumors, the invention also provides a method for diagnosing cancer, which comprises detecting the expression of FBXW2 in a subject. The method comprises the following steps: (1) obtaining a sample from the subject, (2) detecting FBXW2 expression or activity in the sample from the subject, and (3) comparing FBXW2 expression or activity in the subject to FBXW2 expression or activity in a healthy control, and if FBXW2 expression or activity in the subject is increased, diagnosing the subject as having cancer, particularly FBXW 2-associated cancer.

Typically, reagents used to detect FBXW2 expression or activity include: (1) A primer or probe that targets FBXW2 or its transcript, or (2) an antibody or ligand that specifically binds FBXW 2. Primers, probes, antibodies and ligands are as described elsewhere herein.

The present invention provides a kit for diagnosing FBXW 2-associated cancer comprising reagents for detecting FBXW2 expression or activity. In addition, the kit may further comprise reagents required for RT-PCR, such as reverse transcriptase, RNA extraction reagents, nucleic acid polymerase, dNTP, PCR buffer, and the like; alternatively, the kit may further comprise reagents required for Northern, such as RNA extraction reagents, ribonuclease inhibitors, northern buffers, and the like; alternatively, the kit further comprises reagents required for Western blotting, such as protein extraction reagents, acrylamide, guanidinium isothiocyanate, tris, SDS, TEMED and the like.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: conditions described in the laboratory Manual (New York: coldSpringHarbor laboratory Press, 2002), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are by weight.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition, any methods and materials similar or equivalent to those described herein can be used in the practice of the present invention. The preferred embodiments and materials described herein are exemplary only.

Examples

The experimental method comprises the following steps:

shRNA

shRNA sequence of FBXW2 used in experiment is

shFBXW2 (reverse complement of SEQ ID NO: 1) - (SEQ ID NO: 3) - (SEQ ID NO: 1), tcacgcaggcacaatcittt targeting FBXW2 3' UTR (SEQ ID NO: 4);

shFBXW2 (reverse complement of SEQ ID NO: 2) - (SEQ ID NO: 3) - (SEQ ID NO: 2), gcctttgaaacctcgttatat (SEQ ID NO: 5) targeting the FBXW2 CDS region.

Cell proliferation and soft agar colony formation assay

In the Cell growth curve experiment, 500 cells per well were seeded in 96-well plates and counted daily with Cell Counting Kit-8 (C0039, beyotime Biotechnology). In the colony formation experiment, 6-well plates were seeded with 500 cells per well, and 14 days later stained with crystal violet and counted. In the soft agar colony formation experiment, 2000 cells were seeded in the supersize, stained with crystal violet after 21 days and counted.

Transwell experiment

A Transwell chamber with 8.0 μm filter was used. 5000 cells were inoculated with FBS-free DMEM medium in the upper chamber, and 10% FBS-containing DMEM complete medium was added to the lower chamber. After 12 hours, the cells were stained with crystal violet and observed for migration.

Two-hybrid screening of mammals

Constructing VP16AD-SKP1 fusion protein and GAL4DBD-FBXW2 fusion protein. Co-transfecting 293T cell lines with Luciferase reporter gene plasmids controlled by VP16AD-SKP1, GAL4DBD-FBXW2 and 9X UAS promoters, adding an inhibitor after 12 hours, and detecting the Luciferase strength after 24 hours.

Co-immunoprecipitation experiment

HA-FBXW2 and Flag-SKP1 plasmids are transfected in a 293T cell line, corresponding inhibitors and proteasome inhibitors MG132 are added after 24 hours, cells are lysed after 12 hours, and Anti-HA beads are added for co-immunoprecipitation. SDS-PAGE experiments were then performed to detect protein binding.

Nude mouse in situ injection experiment

1x10 ⁷ Individual cells were resuspended in PBS and injected into the fourth pair of mammary fat pads of 6-week-old female nude mice. The experimental animals were purchased from Shanghai laboratory animal center and kept in SPF environment. Tumors were measured every 3 days and tumor volumes were calculated according to the formula L.times.W2.0.52. All animal handling was performed according to the Shanghai Life sciences animal protection Committee guidelines.

Example 1, fbxw2 accelerates tumor cell growth and promotes tumorigenesis.

To investigate the function of FBXW2 in tumor cells, we constructed FBXW 2-knockdown stable transformants of both breast cancer cell lines MDA-MB-231 and HS578T with lentivirus-packaged shRNA and examined the growth and clonogenic capacity of these stable transformants (fig. 1, a). The results show that knocking down FBXW2 in both MDA-MB-231 and HS578T cell lines can significantly inhibit cell growth and reduce the efficiency of cell clonogenic (FIG. 1, B-D). Furthermore, FBXW 2-low expressing MDA-MB-231 cells formed fewer clones in the soft agar colony formation experiment, suggesting that knockdown of FBXW2 may inhibit the growth and invasiveness of tumor cells (fig. 1, e and F). When the migratory capacity of cells was measured in the Transwell experiment, we found that the migratory capacity of cells knocked down by FBXW2 was significantly reduced (FIGS. 1, G and H). In the nude mouse in-situ injection tumor formation experiment, we found that MDA-MB-231 cells knocked down by FBXW2 have obviously weakened tumor formation capability (FIG. 1, I-K). Therefore, FBXW2 can promote the growth and invasion of tumor cells, and further promote the occurrence and development of tumors.

Example 2 Teniposide is a FBXW2 specific inhibitor

To investigate therapeutic approaches to FBXW2, we screened 1600 FDA-approved small molecule compounds using a mammalian two-hybrid screening system to find inhibitors of FBXW 2. As a result, we have found a number of inhibitors that inhibit the binding of SKP1 to FBXW2, such as Teniposide, camptothecin and Chloroquinan. Through co-immunoprecipitation experiments (fig. 2, a), we verified that Teniposide can significantly inhibit the binding of FBXW2 and SKP 1. Furthermore, we treated MDA-MB-231 cells with Teniposide at different concentrations for 72 hours, and found that Teniposide could significantly inhibit the growth of tumor cells MDA-MB-231 (CCK 8 assay). While the inhibitory effect of Teniposide on MDA-MB-231 was reduced after FBXW2 knockdown (FIG. 2, B). Therefore, teniposide can inhibit tumor cell growth by specifically inhibiting the function of FBXW 2.

Sequence listing

<110> prominent innovation center of molecular cell science of Chinese academy of sciences

<120> reagents for diagnosing and treating tumors and uses thereof

<130> 209682

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 1

tcacgcagtg cacaatcatt t 21

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 2

gcctttgaaa cctcgtcatt a 21

<210> 3

<211> 6

<212> DNA

<213> Artificial Sequence

<400> 3

ctcgag 6

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 4

tcacgcagtg cacaatcatt t 21

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 5

gcctttgaaa cctcgtcatt a 21

Claims

1. The use of an FBXW2 inhibitor in the preparation of a medicament for preventing or treating cancer and inhibiting tumor cell growth,

preferably, the first and second electrodes are formed of a metal,

the cancer is an FBXW 2-mediated cancer, and/or

The tumor cell is a tumor cell with increased FBXW2 expression, and/or

The inhibitor of FBXW2 is an agent that inhibits the expression and/or activity of FBXW2,

more preferably, the inhibitor of FBXW2 is selected from: antibodies or ligands that bind specifically to FBXW2, inhibitory molecules that specifically interfere with the transcription and/or expression of the FBXW2 gene, and compounds that inhibit the interaction of FBXW2 with SKP 1.

2. The use according to claim 1, wherein the inhibitor molecule targets the FBXW2 gene or its transcript,

preferably, the inhibitory molecule is selected from the group consisting of: (1) A small molecule compound, an antisense nucleic acid, a microRNA, a siRNA, a shRNA, an RNAi, a dsRNA, a sgRNA or a combination thereof, and (2) a nucleic acid construct capable of expressing or forming (1),

more preferably, the inhibitor molecule is shRNA or its nucleic acid construct targeting the inhibition of FBXW2 gene or its transcript as gene ID 26190.

3. The use according to claim 1, wherein the compound inhibiting the interaction of FBXW2 with SKP1 is selected from one or more of the compounds of formulae I to III:

wherein the content of the first and second substances,

r1, R2, R4, R5 and R6 are each independently selected from C1-C4 alkyl, hydroxy, halogen or amino,

r3 is heteroaryl optionally substituted with 1-2 substituents selected from C1-C4 alkyl, hydroxy, halogen and amino,

r7 and R8 are each independently selected from C1-C4 alkyl, hydroxy, halogen or amino,

R9-R11 are each independently selected from C1-C4 alkyl, hydroxy, halogen or amino.

4. The use according to claim 3,

r1, R2 and R5 are each independently selected from hydroxy or halogen,

r4 and R6 are each independently selected from C1-C4 alkyl,

r3 is thiophene optionally substituted with 1-2 substituents selected from C1-C4 alkyl, hydroxy, halogen and amino,

r7 and R8 are each independently selected from C1-C4 alkyl, hydroxy,

r9 and R12 are each independently selected from hydroxy, halogen,

r10 and R11 are each independently selected from C1-C4 alkyl, hydroxy.

5. A method of screening for potential agents for preventing or treating cancer, the method comprising:

(2) Detecting the expression or activity of FBXW2 in said system, or detecting whether said candidate substance targets cells in which FBXW2 expression is increased,

wherein, if the candidate substance can reduce the expression or activity of FBXW2, or the candidate substance targets cells highly expressing FBXW2, the candidate substance is a potential substance for preventing or treating cancer.

6. The method of claim 5,

the cancer is an FBXW 2-mediated cancer, and/or

The step (1) comprises the following steps: in the test group, the candidate substance is added to a system expressing FBXW2 and optionally SKP1, and/or

The step (2) comprises the following steps: detecting the expression or activity of FBXW2 in the test group's system and comparing it with a control group, wherein the control group is a system expressing FBXW2 and optionally SKP1 without the addition of the candidate substance, and/or

The system for expressing FBXW2 and optional SKP1 is selected from: a cell system, a subcellular system, a solution system, a tissue system, an organ system, or an animal system.

7. Use of an agent for detecting FBXW2 expression or activity in the manufacture of a kit for diagnosing cancer,

preferably, the first and second electrodes are formed of a metal,

the cancer is an FBXW 2-mediated cancer, and/or

Agents for detecting FBXW2 expression or activity include: (1) A primer or probe that targets FBXW2 or a transcript thereof, and/or (2) an antibody or ligand that specifically binds FBXW 2.

8. Use according to claim 7 wherein the sequence of the FBXW2 gene or its transcript is as indicated in gene ID 26190 and the sequence of the FBXW2 protein is as indicated in the Uniprot database protein ID Q9UKT8.

9. An agent that reduces expression of FBXW2, said agent comprising a structure according to formula IV:

in formula IV, seq _{Forward direction} Seq for identification of the polynucleotide coding sequence of FBXW2 _{Reverse direction} Is and Seq _{Forward direction of rotation} A reverse complement of the polynucleotide; x is a spacer sequence between the forward direction of Seq and the reverse direction of Seq, and the spacer sequence is in parallel with Seq _{Forward direction} And Seq _{Reverse direction} The two parts are not complementary to each other,

preferably, seq _{Forward direction} Comprises SEQ ID NO 1 or 2.

10. A pharmaceutical composition comprising the substance that reduces FBXW2 expression of claim 9 and a pharmaceutically acceptable excipient.