WO2022236020A1

WO2022236020A1 - An isothermal amplification system and method of use of the same for detecting pathogenic infection in a subject

Info

Publication number: WO2022236020A1
Application number: PCT/US2022/028026
Authority: WO
Inventors: Arun Prasad MANOHARAN; Francesco Marino
Original assignee: Prime Discoveries, Inc.
Priority date: 2021-05-07
Filing date: 2022-05-06
Publication date: 2022-11-10

Abstract

The disclosure relates to method and kit for determining presence or absence of pathogenic infection, including SARS-CoV-2 infection in subjects by detecting expression level of a gene or a set of genes associated with the infectious agent. The disclosure relates to a cost effective and time sensitive method and system for managing epidemics and pandemics, including COVID-19.

Description

AN ISOTHERMAL AMPLIFICATION SYSTEM AND METHOD OF USE OF THE SAME FOR DETECTING PATHOGENIC INFECTION IN A SUBJECT

CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of U.S. Provisional Application No.

63/185,571, filed on May 7, 2021, the contents of which are hereby incorporated by reference in their entirety.

INCORPORATION-BY-REFERENCE OF SEQUENCE LISTING [0002] The instant application contains a Sequence Listing which has been submitted in

ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on May 5, 2022, is named “PRDI-001_01WO_Seq_Listing_ST25.txt” and is 34.6 kilobytes in size.

FIELD OF THE INVENTION

[0003] The present invention relates to the methods and systems for detecting pathogenic infection including SARS-CoV-2 infection. The present inventions relate to a simple, quick and high-throughput isothermal cycling nucleic acid amplification system of detecting genetic material from pathogenic microorganisms, e.g. SARS-COV-2 in samples from patients. The present invention also provides tools for use in the method provided herein.

BACKGROUND OF THE INVENTION [0004] The emergence of widespread epidemics and pandemics caused by virulent microorganisms has led to the growing need for rapid, cost-effective and efficient methods for detection of pathogenic infections in patient samples, in order to administer the appropriate treatment for curing the pathogenic infection. The severe acute respiratory syndrome initiated by coronavirus-2 (SARS-CoV-2) emerged toward the end of 2019, and by March 2020 was declared a global pandemic. The disease resulting from SARS-CoV-2 is referred to as COVID-19 and has a range of clinical effects on infected populations, ranging from mild symptoms to potentially life-threatening clinical expressions of the disease. The fatality rate for COVID-19 is currently estimated to be approximately 3.7% overall, and is age-dependent, disproportionately affecting those over 60 years of age or who have pre-existing conditions, including cardiovascular disease, uncontrolled diabetes mellitus, and hypertension. COVID-19 pathophysiology has overlapping characteristics with diseases associated with previous coronavirus outbreaks, such as SARS and MERS. As with SARS and MERS, COVID-19 affects the pulmonary system, and severe cases are associated with aggressive inflammation and cytokine release syndrome (CRS) produced by viral replication and exuberant inflammatory responses. Uncontrolled pulmonary inflammation and CRS are complications resulting in severe symptoms and death in certain COVID-19 patients. RT-PCR is one of the widely used methods for detecting the presence of genetic material from pathogenic microorganisms including SARS-CoV-2 in patient samples. However, variable factors like template quality due to nucleic acid extraction process, operator variability and the complicated and costly RT steps, that make real-time RT-PCR appear to be a fragile assay that makes accurate data interpretation difficult. Thus, there exists a need in the art for additional methods for detecting pathogenic infections like SARS-CoV-2 infections. This disclosure provides methods, systems and tools for the detection of the presence of pathogenic genetic material, like SARS-CoV-2 RNA in patient samples, for administering effective treatment.

SUMMARY OF THE INVENTION

[0005] The disclosure provides methods for detecting the presence or absence of pathogenic infections caused by viruses and bacteria in a subject. The disclosure provides methods for detecting the presence or absence of a SARS-COV-2 infection in a subject.

[0006] The disclosure provides a method of detecting the presence or absence of a SARS-

CoV-2 infection in a subject, the method comprising: a) determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay; b) determining the expression level of 18s RNA in the biological sample using a LAMP assay; c) comparing the combined expression level of SARS-Cov-2 ORF1, SARS-Cov-2 N and SARS-Cov-2 E , to a first predetermined expression cutoff value; d) comparing the expression level of 18s RNA to a second predetermined expression cutoff value; e) determining i) the presence of a SARS-CoV-2 infection in the subject when the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E is greater than the first predetermined expression cutoff value and the expression level of 18S RNA is greater than the second predetermined expression cutoff value; or ii) the absence of a SARS-CoV-2 in the subject when the when the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E is less than the first predetermined expression cutoff value and the expression level of 18S RNA is greater than the second predetermined expression cutoff value.

[0007] The disclosure also provides primer sequences for use in the method of detecting combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay, as follows:

Table 1. Primer sequences for use in the method of detecting combined expression level of SARS-CoV-2 Orfl, SARS-CoV-2 N, and SARS-CoV-2 E

[0008] The disclosure also provides a method of detecting the presence or absence of an infection in a subject, the method comprising: a) determining the expression level of at least one gene associated with the infection in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay; b) comparing the expression level of the at least one gene associated with the infection to a corresponding predetermined expression cutoff value; c) determining i) the presence of the infection in the subject when the expression level of the at least one gene associated with the infection is greater than the first predetermined expression cutoff value; or ii) the absence of the infection in the subject when the expression level of the at least one gene associated with the infection is less than the first predetermined expression cutoff value.

[0009] The disclosure also provided a method of detecting the presence or absence of an infection in a subject, the method comprising: a) determining the expression level of at least one gene associated with the infection in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay; b) determining the expression level of 18S RNA in the biological sample using a LAMP assay; c) comparing the expression level of the at least one gene associated with the infection to a corresponding predetermined expression cutoff value; d) comparing the expression level of 18S RNA to a predetermined control expression cutoff value; c) determining i) the presence of the infection in the subject when the expression level of the at least one gene associated with the infection is greater than the first predetermined expression cutoff value and the expression level of 18s RNA is greater than the predetermined control expression cutoff value; or ii) the absence of the infection in the subject when the expression level of the at least one gene associated with the infection is less than the first predetermined expression cutoff value and the expression level of 18s RNA is greater than the predetermined control expression cutoff value.

[00010] The disclosure also provides primer sequences for use in the method of detecting expression level of at least one gene associated with influenza A infection, influenza B infection, respiratory syncytial virus A infection, respiratory syncytial virus B infection, gonorrhea infection, chlamydia infection, trichomoniasis infection, herpes simplex 1 infection, herpes simplex 2 infection, syphilis infection, Gardnerella vaginalis infection, Candida albicans infection, Mycoplasma genitalia infection, Mycobacterium tuberculosis infection, Ureaplasma parvum infection, Ureaplasma urealyticum infection, Human T-lymphotropic vims 1 (HTLV-1) infection, Human T-lymphotropic vims 2 (HTLV-2) infection, Hepatitis A vims infection, Hepatitis B vims infection, Hepatitis C vims infection, human papilloma vims type 16 (HPV 16) infection and human papilloma vims type 18 (HPV 18) infection, in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay in Table 2, as follows:

Table 2. Primer sequences for use in the method of detecting combined expression level of genes associated with non-SARS-COV2 infections

[00011] The disclosure also provided a kit for detecting the presence or absence of a SARS- CoV-2 infection in a sample from a subject, wherein the kit comprises: a) a test primer mix, wherein the primer mix comprises (i) a set of at least six primers that bind to a SARS-CoV-2 ORF1 gene, a SARS-CoV-2 N gene, or a SARS-CoV-2 E gene or a combination thereof, in the SARS-Cov-2 single strand RNA genome and (ii) a set of at least six primers, wherein the primers bind to 18S RNA; b) enzyme mixture of a reverse transcriptase and a Bst (Bacillus Stearothermophilus) DNA polymerase; c) an intercalating DNA dye; and d) a nucleotide mixture.

[00012] In some embodiments of the kit of the disclosure, the test primer mix of (a) comprises a set of eighteen primers that bind to a SARS-CoV-2 ORE 1 gene, a SARS-CoV-2 N gene, or a SARS-CoV-2 E gene or a combination thereof, in the SARS-Cov-2 single strand RNA genome.

In some embodiments of the kit of the disclosure, the test primer mix of (a) comprises a set of six primers, wherein the primers bind to 18S RNA. In some embodiments of the kit of the disclosure, the test primer mix of (a) comprises (i) a set of eighteen primers that bind to a SARS- CoV-2 ORF1 gene, a SARS-CoV-2 N gene, or a SARS-CoV-2 E gene or a combination thereof, in the SARS-Cov-2 single strand RNA genome and (ii) a set of six primers, wherein the primers bind to 18S RNA.

[00013] The disclosure also provided a kit for detecting the presence or absence of a SARS- CoV-2 infection in a sample from a subject, wherein the kit comprises: a) a test primer mix, wherein the primer mix comprises (i) a set of at least one primer, or two primers, or three primers, or four primers, or five primers, or six primers selected from SEQ ID NOs: 1-18 of TABLE 1, that bind to a SARS-CoV-2 ORF1 gene, a SARS-CoV-2 N gene, or a SARS-CoV-2 E gene or a combination thereof, in the SARS-Cov-2 single strand RNA genome and (ii) a set of at least at least one primer, or two primers, or three primers, or four primers, or five primers, or six primers selected from SEQ ID NOs: 19-24 of TABLE 1, that bind to 18S RNA; b) enzyme mixture of a reverse transcriptase and a Bst (Bacillus Stearothermophilus) DNA polymerase; c) an intercalating DNA dye; and d) a nucleotide mixture. In some embodiment of the kit of the disclosure, each primer of the primer mix is any one of the primers of nucleic acid sequence according to SEQ ID NOs: 1-24 from Table 1. [00014] The disclosure also provided a kit for detecting the presence or absence of an infection in a sample from a subject, wherein the kit comprises: a) a test primer mix, wherein the primer mix comprises (i) a set of at least six primers that bind to a at least one gene, in the genome of the biological agent causing the infection, and (ii) a set of at least six primers, wherein the primers bind to 18S RNA; b) enzyme mixture of a reverse transcriptase and a Bst (Bacillus Stearothermophilus) DNA polymerase; c) an intercalating DNA dye; and d) a nucleotide mixture.

[00015] In some embodiments of the kit of the disclosure, the infection is an influenza A infection. In some embodiments of the kit of the disclosure, the infection is an influenza B infection. In some embodiments of the kit of the disclosure, the infection is a respiratory syncytial virus A infection. In some embodiments of the kit of the disclosure, the infection is a respiratory syncytial virus B infection. In some embodiments of the kit of the disclosure, the infection is a gonorrhea infection. In some embodiments of the kit of the disclosure, the infection is a chlamydia infection. In some embodiments of the kit of the disclosure, the infection is a trichomoniasis infection. In some embodiments of the kit of the disclosure, the infection is a herpes simplex 1 infection. In some embodiments of the kit of the disclosure, the infection is a herpes simplex 2 infection. In some embodiments of the kit of the disclosure, the infection is a syphilis infection. In some embodiments of the kit of the disclosure, the infection is a Gardnerella vaginalis infection. In some embodiments of the kit of the disclosure, the infection is a Candida albicans infection. In some embodiments of the kit of the disclosure, the infection is a Mycoplasma genitalium infection. In some embodiments of the kit of the disclosure, the infection is a Mycobacterium tuberculosis infection. In some embodiments of the kit of the disclosure, the infection is a Ureaplasma parvum infection. In some embodiments of the kit of the disclosure, the infection is a Human T-lymphotropic virus infection. In some embodiments of the kit of the disclosure, the infection is a Hepatitis A virus infection. In some embodiments of the kit of the disclosure, the infection is a Hepatitis B virus infection. In some embodiments of the kit of the disclosure, the infection is a Hepatitis C virus infection. In some embodiments of the kit of the disclosure, the infection is a Human Papilloma Virus type 16 infection. In some embodiments of the kit of the disclosure, the infection is a Human Papilloma Virus type 18 infection. [00016] In some embodiment of the kit of the disclosure, each primer of the primer mix is any one of the primers of nucleic acid sequence according to SEQ ID NOs: 19-24 from Table 1 and SEQ ID NOs: 25-179 from Table 2.

BRIEF DESCRIPTION OF THE INVENTION [00017] FIGs. 1 A-1F depict a schematic of the workflow for the RT-LAMP assay described herein.

[00018] FIG. 2 is a chart depicting the clinical validation of 283 clinical samples of SARS-CoV-2 positive and negative subjects from two sources as indicated in the chart, using the RT-LAMP assay described herein. All samples in the chart were tested in 3 replicates. Accuracy in detecting SARS-CoV-2 positive and negative subjects is depicted in the last column of the chart, as indicated.

[00019] FIG. 3 is a chart depicting the validation of the SARS-CoV-2 positive and negative subjects based on RT-PCR, by using the RT-LAMP assay described herein. Total number of unique samples identified and validated as positive and negative are as indicated. RT- PCR Ct values for positive samples are provided in the first column, and percentage accuracy is provided in the last column. All samples in the chart were tested in 3 replicates.

[00020] FIG. 4 is a chart depicting the sensitivity of the RT-LAMP assay described herein, in detecting the presence of SARS-CoV-2 gene expression in samples. The copies of DNA per pi of the sample replicates and the corresponding number of replicates detected in which combined expression of ORF1/E1/N2 genes were detected, are as indicated. All samples in the chart were tested in 24 replicates.

[00021] FIG. 5 is a chart depicting the Limit of Detection for the RT-LAMP assay described herein, in detecting the presence of SARS-CoV-2 gene expression in samples. The copies of DNA per mΐ of the sample replicates and the corresponding number of replicates detected in which combined expression of ORF1/E1/N2 genes were detected in viral transport medium (VTM) and MAWI extraction-less medium, are as indicated. All samples in the chart were tested in 24 replicates.

[00022] FIGs. 6A-6E depicts efficacy and sensitivity of the RT-LAMP assay described herein, for detection of Influenza A virus in samples. FIG. 6A depicts an amplification plot for the RT-LAMP assay done using primers specific for Influenza A, in samples provided by BEI resources. The ARn values are indicated on the y-axis and the cycle numbers are indicated on the x-axis of the plot. FIG. 6B is a chart depicting the product information, the input genetic material type for the assay, and the influenza A virus strain in the samples, as indicated. All samples were analyzed in 3 replicates. FIG. 6C is a chart comparing the number of replicates of the various Influenza A DNA samples that detected by the RT-LAMP assay described herein, using either Influenza A primers or Influenza B primers, as indicated. Two replicates were analyzed for each sample tested. FIG. 6D depicts an amplification plot for the RT-LAMP assay done using primers specific for Influenza A, in representative samples from FIG. 6C, provided by BEI resources.

The ARn values are indicated on the y-axis and the cycle numbers are indicated on the x-axis of the plot. FIG. 6E is a chart depicting the product information, the input genetic material type for the assay, the influenza A virus strain and the number of detected replicates of the tested samples, as indicated.

[00023] FIGs. 7A-7B depicts efficacy and sensitivity of the RT-LAMP assay described herein, for detection of Influenza B virus in samples. FIG. 7A is a chart comparing the number of replicates of the various Influenza B DNA samples detected by the RT-LAMP assay described herein, using either Influenza A primers or Influenza B primers, as indicated. Two replicates were analyzed for each sample tested. FIG. 7B depicts an amplification plot for the RT-LAMP assay done using primers specific for Influenza B, in representative samples from FIG. 7A, provided by BEI resources. The ARn values are indicated on the y-axis and the cycle numbers are indicated on the x-axis of the plot.

[00024] FIGs. 8A-8C depict efficacy and sensitivity of the RT-LAMP assay described herein, for detection of respiratory syncytial virus (RSV) A and B in samples. FIGs. 8A-8B depict a multicomponent plot showing detection of cDNA synthesized from RSV-A and RSV-B samples, respectively. FIG. 8C is a chart comparing the number of replicates of RSV-A and RSV-B samples detected using either RSV-A primers or RSV-B primers, as indicated. All samples were tested in 3 replicates.

[00025] FIGs. 9A-9S depict detecting sexually transmitted pathogens in samples using the RT-LAMP assay described herein. FIG. 9 A depicts an amplification plot for detecting genomic DNA from Neisseria gonorrhoeae genomic DNA ATCC cat# 700825D-5. FIG. 9B depicts an amplification plot for detecting cDNA from Chlamydia VR885 ATCC. FIG. 9C depicts an amplification plot for detecting genomic DNA from Trichomonas vaginalis G3 Genomic DNA cat# PRA-98D. FIG. 9D and 9E depict amplification plots for detecting cDNA from Human herpesvirus 1 (HSV-1) Strain MacIntyre [ATCC® VR-539™] and HSV-2 strain G [ATCC® VR-734™], respectively. FIG. 9E depicts an amplification plot for detecting Treponema pallidum genomic DNA from ATCC. The ARn values are indicated on the y-axis and the cycle numbers are indicated on the x-axis of the plot. FIG. 9F to FIG.9S depicts an amplification plot for detecting Syphilis, Gardnerella vaginalis , Candida albicans, Mycobacterium tuberculosis, Ureaplasma parvum, Ureaplasma urealyticum, HTLV-1, HTLV-2, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, HPV16, andHPV18 as indicated, on positive controls obtained as gene fragments purchased from Integrated DNA technologies. The ARn values are indicated on the y- axis and the cycle numbers are indicated on the x-axis of the plot.

DETAILED DESCRIPTION OF THE INVENTION [00026] The sudden global spread of coronavirus disease of 2019 (COVID-19), the disease associated with severe acute respiratory infection syndrome coronavirus 2 (SARS-CoV-2) viral infection, has spurred a need for new methods of diagnosis, treatment, and risk assessment. Over 1 million cases in over 200 countries have been reported as of April 2020, less than 6 months following the original outbreak reported in Wuhan, China. While symptoms are mild for many COVID-19 patients, severe disease occurs in up to 20% of cases and the fatality rate is estimated to be between 3-4%. With no validated antiviral treatments currently available, there exists a desperate need for new methods and systems for diagnosis of COVID-19, treatment, and risk assessment (Zhang 2020). Recent pandemics and epidemics, including the ongoing COVID-19 pandemic has highlighted the importance of diagnostic testing in outbreak control. Ending the pandemic involves the accurate application of diagnostic testing in high volumes and the rapid use of the results to help implement the appropriate therapy and prevent further spread. (Vandenberg 2020). There is an urgent need and value of diagnostics in the management of the current COVID-19 pandemic as well as epidemics caused by other pathogens, especially for the molecular detection of the pathogen. Test design, validation and verification, emergency use approval and the manufacturing of test kits in high numbers are just a few examples of obstacles in implementation of such diagnostics. The setting up of high-throughput diagnostic pipelines, the logistics involved and the optimization of pragmatic use of test results were encountered as important problems in a routine-diagnostic microbiology laboratory, during any epidemic or pandemic, including the COVID-19 pandemic.

[00027] Direct diagnostic testing to detect active SARS-CoV-2 infections mostly involves reverse transcriptase real-time PCR (RT-PCR), although different molecular technologies, such as CRISPR-mediated detection or loop mediated isothermal amplification, have also been applied. However, in comparison with RT-PCR, rapid antigen detection tests lack sensitivity, and owing to the increased risk of false-negative results, they are considered as an adjunct to RT- PCR tests. (Vandenberg 2020; Lalli, M. A, medRxiv 2020; Kitagawa, Y., J. Clin. Virol., 2020; Lamb, L. E., PLoS ONE, 2020, Huang, Z., Biosens. Bioelectron., 2020; Guo, L., Cell Discov. 2020; Nagura- Ikeda, M. et ah, J. Clin. Microbiol., 2020). Thus, there is a need for rapid, cost effective and accurate diagnostic methods and tools for accurately determining the presence of SARS-COV-2 infections in patients, to provide effective treatment options.

[00028] Accordingly, the disclosure provides methods, systems and tools for detecting the presence or absence of pathogenic infections caused by viruses and bacteria, including SARS- COV-2 infection in a subject. The disclosure provides methods, systems and tools for determining the expression levels of a combination of genes specific for pathogenic microorganism, like SARS-CoV-2 in order to detect the presence or absence of the pathogen in a subject. The methods, systems, and tools provided in the present disclosure can be used to determine need for administering effective treatment to the subjects in whom the presence of SARS-Cov-2 is detected, and to provide guidance in the development of therapeutics and vaccines.

[00029] The disclosure provides a method of detecting the presence or absence of a SARS- CoV-2 infection in a subject, the method comprising: a) determining the combined expression level of SARS-CoV-2 Orfl, SARS-CoV-2 N, and SARS-CoV-2 E in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay; b) determining the expression level of 18S RNA in the biological sample using a LAMP assay; c) comparing the combined expression level of SARS-Cov-2 ORF1, SARS-Cov-2 N and SARS-Cov-2 E, to a first predetermined expression cutoff value; d) comparing the expression level of 18s RNA to a second predetermined expression cutoff value; e) determining i) the presence of a SARS-CoV-2 infection in the subject when the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E is greater than the first predetermined expression cutoff value and the expression level of 18S RNA is greater than the second predetermined expression cutoff value; or ii) the absence of a SARS-CoV-2 in the subject when the when the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E is less than the first predetermined expression cutoff value and the expression level of 18s RNA is greater than the second predetermined expression cutoff value.

[00030] In some embodiments of the method disclosed herein, determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of ACCAGGAACTAATCAGACAAG (SEQ ID NO: 1), a second primer comprising a nucleic acid sequence of GACTTGATCTTTGAAATTTGGATCT (SEQ ID NO: 2), a third primer comprising a nucleic acid sequence of

TTCC GA AGA ACGC T GA AGCGGA AC T GATT AC A A AC ATTGGC C (SEQ ID NO: 3), a fourth primer comprising a nucleic acid sequence of

CGC ATT GGC ATGGAAGTC AC AATTT GAT GGC ACCTGTGT A (SEQ ID NO: 4).

[00031] In some embodiments of the method of the disclosure, the step of determining the combined expression level of SARS-CoV-2 Orfl , SARS-CoV-2 N, and SARS-CoV-2 E using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of TGAGTACGAACTTATGTACTCAT (SEQ ID NO: 7); an eighth primer comprising a nucleic acid sequence of TTCAGATTTTTAACACGAGAGT (SEQ ID NO: 8); a ninth primer comprising a nucleic acid sequence of

ACC ACGAA AGC AAGAAA AAGAAGTTCGTTTCGGA AGAGAC AG (SEQ ID NO: 9); a tenth primer comprising a nucleic acid sequence of

TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT (SEQ ID NO: 10). [00032] In some embodiments of the method of the disclosure, the step of determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E using a LAMP assay further comprises using: an eleventh primer comprising a nucleic acid sequence of CGCTATTAACTATTAACG (SEQ ID NO: 11); a twelfth primer comprising a nucleic acid sequence of CGCGCTTCGATTGTGTGCGT (SEQ ID NO: 12).

[00033] In some embodiments of the method of the disclosure, determining the combined expression level of SARS-CoV-2 Orfl , SARS-CoV-2 N, and SARS-CoV-2 E using a LAMP assay comprises using: a thirteenth primer comprising a nucleic acid sequence of CGGTGGACAAATTGTCAC (SEQ ID NO: 13); a fourteenth primer comprising a nucleic acid sequence of CTTCTCTGGATTTAACAC ACTT (SEQ ID NO: 14); a fifteenth primer comprising a nucleic acid sequence of

TCAGCACACAAAGCCAAAAATTTATTTTTCTGTGCAAAGGAAATTAAGGAG (SEQ ID NO: 15); a sixteenth primer comprising a nucleic acid sequence of

TATTGGTGGAGCTAAACTTAAAGCCTTTTCTGTACAATCCCTTTGAGTG (SEQ ID NO: 16).

[00034] In some embodiments of the method of the disclosure, the step of determining the combined expression level of SARS-CoV-2 Orfl , SARS-CoV-2 N, and SARS-CoV-2 E using a LAMP assay further comprises using: a seventeenth primer comprising a nucleic acid sequence of TTACAAGCTTAAAGAATGTCTGAACACT (SEQ ID NO: 17); an eighteenth primer comprising a nucleic acid sequence of TTGAATTTAGGTGAAACATTTGTCACG (SEQ ID NO: 18).

[00035] In some embodiments of the method of the disclosure, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a nineteenth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); a twentieth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a twenty-first primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a twenty-second primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22).

[00036] In some embodiments of the method of the disclosure, the step of determining the expression level of 18S RNA using a LAMP assay further comprises using: a twenty -third primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23); a twenty-fourth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[00037] In some embodiments of the method of the disclosure, determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of ACCAGGAACTAATCAGACAAG (SEQ ID NO: 1); a second primer comprising a nucleic acid sequence of GACTTGATCTTTGAAATTTGGATCT (SEQ ID NO: 2); a third primer comprising a nucleic acid sequence of

TTCCGAAGAACGCTGAAGCGGAACTGATTACAAACATTGGCC (SEQ ID NO: 3); a fourth primer comprising a nucleic acid sequence of

CGC ATT GGC AT GGA AGT C AC A ATTT GAT GGC AC CTGT GT A (SEQ ID NO: 4); a fifth primer comprising a nucleic acid sequence of GGGGGCAAATTGTGCAATTTG (SEQ ID NO: 5); a sixth primer comprising a nucleic acid sequence of CTTCGGGAACGTGGTTGACC (SEQ ID NO: 6); a seventh primer comprising a nucleic acid sequence of

TGAGTACGAACTTATGTACTCAT (SEQ ID NO: 7); an eighth primer comprising a nucleic acid sequence of TTCAGATTTTTAACACGAGAGT (SEQ ID NO: 8); a ninth primer comprising a nucleic acid sequence of

TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT (SEQ ID NO: 10); an eleventh primer comprising a nucleic acid sequence of CGCTATTAACTATTAACG (SEQ ID NO: 11); a twelfth primer comprising a nucleic acid sequence of

CGCGCTTCGATTGTGTGCGT (SEQ ID NO: 12); a thirteenth primer comprising a nucleic acid sequence of CGGTGGACAAATTGTCAC (SEQ ID NO: 13); a fourteenth primer comprising a nucleic acid sequence of CTTCTCTGGATTTAACACACTT (SEQ ID NO: 14); a fifteenth primer comprising a nucleic acid sequence of

TATTGGTGGAGCTAAACTTAAAGCCTTTTCTGTACAATCCCTTTGAGTG (SEQ ID NO: 16); a seventeenth primer comprising a nucleic acid sequence of TTACAAGCTTAAAGAATGTCTGAACACT (SEQ ID NO: 17); and an eighteenth primer comprising a nucleic acid sequence of TTGAATTTAGGTGAAACATTTGTCACG (SEQ ID NO: 18).

[00038] In some embodiments of the method of the disclosure, determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of ACCAGGAACTAATCAGACAAG (SEQ ID NO: 1); a second primer comprising a nucleic acid sequence of GACTTGATCTTTGAAATTTGGATCT (SEQ ID NO: 2); a third primer comprising a nucleic acid sequence of

TATTGGTGGAGCTAAACTTAAAGCCTTTTCTGTACAATCCCTTTGAGTG (SEQ ID NO: 16); a seventeenth primer comprising a nucleic acid sequence of

TTACAAGCTTAAAGAATGTCTGAACACT (SEQ ID NO: 17); and an eighteenth primer comprising a nucleic acid sequence of TTGAATTTAGGTGAAACATTTGTCACG (SEQ ID NO: 18), wherein determining the expression level of 18S RNA using a LAMP assay comprises using: a nineteenth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); a twentieth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a twenty-first primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a twenty-second primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), and a twenty-third primer comprising a nucleic acid sequence of

AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twenty-fourth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24). In some embodiments, the step (e) of the method disclosed herein further comprises determining that the method is erroneous in step (b), when the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E is less than the first predetermined expression cutoff value and the expression level of 18S RNA is less than the second predetermined expression cutoff value.

[00039] In some embodiments, the method of the disclosure, further comprises repeating steps (a)-(e) of the method disclosed herein, using a different biological sample from the subject. In some embodiments, the method of the disclosure is performed in two replicates. In some embodiments, step (e) of the method disclosed herein comprises determining i) the presence of a SARS-CoV-2 infection in the subject when the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E is greater than the first predetermined expression cutoff value in both replicates and the expression level of 18s RNA is greater than the second predetermined expression cutoff value in both replicates; or ii) the absence of a SARS-CoV-2 in the subject when the when the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E is less than the first predetermined expression cutoff value in both replicates and the expression level of 18S RNA is greater than the second predetermined expression cutoff value in both replicates. [00040] In some embodiments, step (e) of the method disclosed herein further comprises determining that the method is erroneous in step (b), when the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E is less than the first predetermined expression cutoff value in both replicates and the expression level of 18S RNA is less than the second predetermined expression cutoff value in both replicates.

[00041] In some embodiments, step (e) of the method disclosed herein further comprises determining that the method is inconclusive as the to the presence or absence of a SARS-CoV-2 infection in the subject when: i) the combined expression level of SARS-CoV-2 ORF1, SARS- CoV-2 N and SARS-CoV-2 E is greater than the first predetermined expression cutoff value in one replicate and less than the predetermined expression cutoff value in the other replicate; and/or ii) the expression level of 18S RNA is greater than the second predetermined expression cutoff value in one replicate and less than the predetermined expression cutoff value in a second replicate.

[00042] In some embodiments of the method of the disclosure, the LAMP assay is a reverse transcriptase LAMP (RT-LAMP) assay. In some embodiments of the method of the disclosure, the RT-LAMP assay comprises the use of Bacillus Stearothermophilus (Bst) DNA Polymerase. [00043] In some embodiments of the method of the disclosure, the LAMP assay comprises the use of a fluorescent intercalating DNA dye. In some embodiments of the method of the disclosure, the fluorescent intercalating DNA dye is any one of SYBR green, LC-Green and Eva- Green.

[00044] In some embodiments, the method of the disclosure further comprises performing at least one positive control reaction, wherein the positive control reactions comprises: a) determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS- CoV-2 E in a positive control sample using a LAMP assay, wherein the positive control sample comprises a known amount of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 A; b) comparing the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS- CoV-2 E to a positive control expression cutoff value; and c) determining that the positive control was successful when the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E is greater than the positive control expression cutoff value. [00045] In some embodiments, the method of the disclosure further comprises performing at least one positive control reaction, wherein the positive control reactions comprises: a) determining the expression level of 18S RNA in a positive control sample using a LAMP assay, wherein the positive control sample comprises a known amount of 18S RNA; b) comparing the combined expression level of 18S RNA to a positive control expression cutoff value; and c) determining that the positive control was successful when the expression level of 18S RNA is greater than the positive control expression cutoff value.

[00046] In some embodiments, the method of the disclosure further comprises performing at least one negative control reaction, wherein the negative control reactions comprises: a) determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS- CoV-2 E in a negative control sample using a LAMP assay, wherein the negative control sample does not comprise SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 A; b) comparing the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E to a negative control expression cutoff value; and c) determining that the negative control was successful when the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E is greater than the negative control expression cutoff value.

[00047] In some embodiments, the method of the disclosure further comprises performing at least one negative control reaction, wherein the negative control reactions comprises: a) determining the expression level of 18S RNA in a negative control sample using a LAMP assay, wherein the negative control sample does not comprise 18S RNA; b) comparing the combined expression level of 18S RNA to a negative control expression cutoff value; and c) determining that the negative control was successful when the expression level of 18S RNA is less than the negative control expression cutoff value.

[00048] LAMP and RT-LAMP assay

[00049] Loop-mediated isothermal amplification (LAMP) is a technology that provides nucleic acid amplification in a short time using 6 specially designed primers for each target gene, and a DNA polymerase with chain displacement activity. The specialized version of DNA polymerase with strand displacement activity bypasses the need of DNA denaturation by heat. Since the LAMP method only needs one constant temperature (usually in the range 60-70 °C), the performance device can be simpler and therefore cheaper and smaller than a thermal cycler. [00050] If the template is RNA, the amplification reaction can be accomplished in one step by adding a reverse transcriptase and is therefore called reverse transcription LAMP (RT-LAMP). Compared to commonly used polymerases for PCR, the Bacillus stearothermophilus ( Bst ) polymerase used in LAMP is highly tolerable to inhibitors present in clinical samples. Typically, 4 different primers are used to amplify 6 distinct regions on the target gene, which increases specificity. An additional pair of "loop primers" can further accelerate the reaction. Two of the primers are inner primers (FIP and BIP), which serve as base for the Bst enzyme to copy the template into a new DNA. The outer primers (F3 and B3) anneal to the template strand and help the reaction to proceed.

[00051] The RT-LAMP procedure starts by making DNA from the sample RNA. This conversion is made by a reverse transcriptase, derived from a retrovirus to generate a complementary DNA (cDNA). The FIP primer is used by the reverse transcriptase to build a single-strand DNA complementary to the target DNA. The F3 primer binds to this side of the template strand as well, and displaces the previously made copy. This displaced, single-stranded copy DNA is a mixture of sequences from the target RNA and the primers. The primers are designed to have a sequence that binds to the sequence itself, forming a loop. The BIP primer binds to the other end of this single strand and is used by the Bst DNA polymerase to build a complementary strand, making double-strand DNA. The F3 primer binds to this end and displaces, once again, this newly generated single-stranded DNA molecule.

[00052] This new single strand that has been released will act as the starting point for the LAMP cycling amplification. This single- stranded DNA has a dumbbell-like structure as the ends fold and self-bind, forming two loops. The DNA polymerase and the FIP or BIP primers keep amplifying this strand and the LAMP -reaction product is extended. This cycle can be started from either the forward or backward side of the strand using the appropriate primer. Once this cycle has begun, the strand undergoes self-primed DNA synthesis during the elongation stage of the amplification process. This amplification takes place in less an hour, under isothermal conditions between 60 and 70 °C.

[00053] The read out of RT-LAMP tests can be done using either a) colorimetric methods by measuring either drop in pH or drop in magnesium ions in the reaction mixture or b) fluorometric methods by measuring level of binding of intercalating DNA dye to the DNA loop structures generated by the amplification process. See Becherer L. et al., Anal. Methods, 2020, Vol. 12, p. 717, and Notomi T. et al., Nucleic Acid Res, 2000 Vol 28 Nol2, the contents of each of the foregoing are incorporated herein by reference in their entirety.

[00054] In some embodiments, the combined expression level of SARS-CoV-2 ORF1, SARS- CoV-2 N and SARS-CoV-2 E, and the expression level of 18S RNA, in a biological sample, is determined by measuring the number of cycles of amplification required for the RT-LAMP reaction with the sample to cross a predetermined threshold value of the fluorescence signal (Ct), detected via binding of an intercalating DNA dye into amplified product.

[00055] In some embodiments, presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is less than a first predetermined threshold Ct value, and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value. In some embodiments, absence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is greater than a first predetermined threshold Ct value, and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value.

[00056] In some embodiments, the first and the second predetermined threshold Ct values are the first and the second predetermined expression cutoff values respectively, that are specific for a particular gene or sets of genes, calculated based on the specific reaction conditions and the thermocycler used for the LAMP assay.

[00057] In some embodiments, the method of the present disclosure is determined to be erroneous in step (b), when a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is greater than a first predetermined threshold Ct value, and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is greater than a second predetermined threshold Ct value. [00058] In some embodiments, presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is less than a first predetermined threshold Ct value, in both replicates of the method of the disclosure, and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value, in both replicates of the method of the disclosure.

[00059] In some embodiments, absence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV- 2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is greater than a first predetermined threshold Ct value, in both replicates of the method of the disclosure and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value, in both replicates of the method of the disclosure.

[00060] In some embodiments, the method of the present disclosure is determined as erroneous in step (b), when a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is greater than a first predetermined threshold Ct value, in both replicates of the method of the disclosure and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is greater than a second predetermined threshold Ct value, in both replicates of the method of the disclosure.

[00061] In some embodiments, the method of the present disclosure is determined to be inconclusive as to the presence or absence of a SARS-CoV-2 infection in the subject, if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is greater than a first predetermined threshold Ct value, in one replicate and less than a first predetermined threshold Ct value, in the other replicate, and b) the Ct value of a LAMP assay for determining the combined expression level of 18S RNA in the sample from the patient is greater than a second predetermined threshold Ct value, in one replicate and less than a second predetermined threshold Ct value, in the other replicate. [00062] In some embodiments of the method of the disclosure, the determination of the presence or absence of SARS-CoV-2 in a sample is determined as inconclusive due to a) improperly collecting, transporting or handling of a sample; b) mutations in the primer target regions in the viral genome or c) inhibitors and other types of interference or a combination thereof. In some embodiments of the method of the disclosure, the determination of the presence or absence of SARS-CoV-2 in a sample is determined as inconclusive, the method further comprises repeating steps (a)-(d) using a new sample.

[00063] In some embodiments of the method of the disclosure, the method is determined as erroneous in step (b), due to a) less than optimal quantity or quality of 18S RNA that is needed for the LAMP assay to determine expression of 18S expression in reaction; b) less than optimal conditions or parameters (e.g., temperature, threshold) that is needed for the LAMP assay to determine expression of 18S in reaction; c) degradation of primers specific for 18S RNA used for the LAMP assay to determine expression of 18S RNA in reaction, or a combination thereof. In some embodiments of the method of the disclosure, the method is determined as erroneous in step (b), the method further comprises step (f): repeating step (b) after: (i) discarding reagents used for LAMP assay to determine expression of 18S RNA and using new reagents; (ii) determining and setting optimal conditions or parameters (e.g., temperature, threshold) that is needed for the LAMP assay to determine expression of 18S in reaction, or a combination thereof. [00064] In some embodiments, the predetermined threshold Ct value is 40 cycles. In some embodiments, the presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is Ct<40 and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value. In some embodiments, the presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N , and SARS-CoV-2 E in the sample from the patient is 20-40 and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value. In some embodiments, the presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is 30-40 and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value. In some embodiments, the presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is 32- 40 and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value. In some embodiments, the presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is any one of 30-32 and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value. In some embodiments, the presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is 28-30 and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value. In some embodiments, the presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is 26-28 and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value. In some embodiments, the presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is 24- 26 and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value. In some embodiments, the presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is less than 24 and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value.

[00065] In some embodiments, absence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV- 2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is more than 40, in both replicates of the method of the disclosure and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value, in both replicates of the method of the disclosure.

[00066] In some embodiments, the predetermined threshold Ct value is 80 cycles. In some embodiments, the presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is Ct<80 and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value. In some embodiments, the presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N , and SARS-CoV-2 E in the sample from the patient is 20-80 and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value. In some embodiments, the presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is 30-80 and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value.

[00067] In some embodiments, the presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is 40-80 and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value. In some embodiments, the presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is any one of 50-80 and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value. In some embodiments, the presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is 60-80 and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value.

[00068] In some embodiments, the presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is 70-80 and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value. In some embodiments, the presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is 75-80 and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value. In some embodiments, the presence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS- CoV-2 E in the sample from the patient is less than 80 and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value.

[00069] In some embodiments, absence of a SARS-CoV-2 infection in a subject is determined if a) the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV- 2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in the sample from the patient is more than 80, in both replicates of the method of the disclosure and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value, in both replicates of the method of the disclosure. [00070] In some embodiments of the method of the present disclosure further comprising performing at least one positive control reaction, the positive control is determined to be successful when the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E is less than a positive control predetermined threshold Ct value.

[00071] In some embodiments of the method of the present disclosure further comprising performing at least one positive control reaction, the positive control is determined to be successful when the Ct value of a LAMP assay for determining the combined expression level of 18S RNA is less than a positive control predetermined threshold Ct value.

[00072] In some embodiments of the method of the present disclosure further comprising performing at least one negative control reaction, the negative control is determined to be successful when the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E is greater than a negative control predetermined threshold Ct value.

[00073] In some embodiments of the method of the present disclosure further comprising performing at least one negative control reaction, the negative control is determined to be successful when the Ct value of a LAMP assay for determining the combined expression level of 18S RNA is greater than a negative control predetermined threshold Ct value.

[00074] In some embodiments, the positive control predetermined threshold Ct value is about 80 cycles, wherein the positive control is determined as successful when the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E is < 80 cycles. In some embodiments, the positive control predetermined threshold Ct value is about 80 cycles, wherein the positive control is determined as successful when the Ct value of a LAMP assay for determining the combined expression level of 18S RNA is < 80 cycles.

[00075] In some embodiments, the negative control predetermined threshold Ct value is about 80 cycles, wherein the negative control is determined as successful when the Ct value of a LAMP assay for determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E is > 80 cycles. In some embodiments, the negative control predetermined threshold Ct value is about 80 cycles, wherein the negative control is determined as successful when the Ct value of a LAMP assay for determining the combined expression level of 18S RNA is > 80 cycles.

[00076] A skilled artisan would easily comprehend that the Ct value of a RT-LAMP reaction using a specific sample is inversely proportional to the level of expression of the target genes ( SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E) in the sample. (Mautner L, Virol J, 2020). In some embodiments, the fluorescent signal detected from the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E, and the expression level of 18S RNA, in a biological sample, is measured as a delta Rn (ARn) value. The Rn value, or normalized reporter value, is the fluorescent signal from the fluorescent a fluorescent intercalating DNA dye normalized to (divided by) the signal of the passive reference dye for a specific reaction. The ARn value is the Rn value of an experimental reaction minus the Rn value of the baseline signal generated by the instrument. This parameter reliably calculates the magnitude of the specific signal generated from a given set of PCR conditions. In some embodiments, the ARn value can be measured as a function of either cycle of a specific RT- LAMP reaction, to determine the Ct value. (Mautner L, Virol J, 2020). A skilled artisan would readily understand that the ARn value is directly proportional to the level of expression of the target gene in a biological sample.

[00077] In some embodiments, the sample is any one of an upper respiratory specimens including oropharyngeal and nasopharyngeal swabs, anterior nasal and mid-turbinate nasal swabs, nasopharyngeal washes/aspirates or nasal aspirates as well as bronchoalveolar lavage (BAL).

[00078] In some embodiments, the method of the disclosure further comprises a step of administering an effective treatment to the subject in which the presence of a SARS-CoV-2 infection is detected. In some embodiments, the effective treatment is an antiviral drug, an antibody or fragment thereof, a steroid medication, convalescent plasma or a combination thereof. In some embodiments, the antibody or fragment thereof is bamlanivimab, casirivimab, imdevimab, or a combination thereof. In some embodiments, the antiviral drug is remdesivir. In some embodiments, the steroid medication is dexamethasone.

[00079] The disclosure also provides a method of detecting the presence or absence of an infection in a subject, the method comprising: a) determining the expression level of at least one gene associated with the infection in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay; b) comparing the expression level of the at least one gene associated with the infection to a corresponding predetermined expression cutoff value; c) determining i) the presence of the infection in the subject when the expression level of the at least one gene associated with the infection is greater than the first predetermined expression cutoff value; or ii) the absence of the infection in the subject when the expression level of the at least one gene associated with the infection is less than the first predetermined expression cutoff value.

[00080] The disclosure also provides a method of detecting the presence or absence of an infection in a subject, the method comprising: a) determining the expression level of at least one gene associated with the infection in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay; b) determining the expression level of 18S RNA in the biological sample using a LAMP assay; c) comparing the expression level of the at least one gene associated with the infection to a corresponding predetermined expression cutoff value; d) comparing the expression level of 18S RNA to a predetermined control expression cutoff value; c) determining i) the presence of the infection in the subject when the expression level of the at least one gene associated with the infection is greater than the first predetermined expression cutoff value and the expression level of 18S RNA is greater than the predetermined control expression cutoff value; or ii) the absence of the infection in the subject when the expression level of the at least one gene associated with the infection is less than the first predetermined expression cutoff value and the expression level of 18S RNA is greater than the predetermined control expression cutoff value.

[00081] In some embodiments of the method of the disclosure, the infection is an influenza A infection. In some embodiments of the method of the disclosure, the infection is an influenza B infection. In some embodiments of the method of the disclosure, the infection is a respiratory syncytial virus A infection. In some embodiments of the method of the disclosure, the infection is a respiratory syncytial virus B infection. In some embodiments of the method of the disclosure, the infection is a gonorrhea infection. In some embodiments of the method of the disclosure, the infection is a chlamydia infection. In some embodiments of the method of the disclosure, the infection is a trichomoniasis infection. In some embodiments of the method of the disclosure, the infection is a herpes simplex 1 infection. In some embodiments of the method of the disclosure, the infection is a herpes simplex 2 infection. In some embodiments of the method of the disclosure, the infection is a syphilis infection. In some embodiments of the method of the disclosure, the infection is a Gardnerella vaginalis infection. In some embodiments of the method of the disclosure, the infection is a Candida albicans infection. In some embodiments of the method of the disclosure, the infection is a Mycoplasma genitalium infection. In some embodiments of the method of the disclosure, the infection is a Mycobacterium tuberculosis infection. In some embodiments of the method of the disclosure, the infection is a Ureaplasma parvum infection. In some embodiments of the method of the disclosure, the infection is a Human T-lymphotropic virus infection. In some embodiments of the method of the disclosure, the infection is a Hepatitis A virus infection. In some embodiments of the method of the disclosure, the infection is a Hepatitis B virus infection. In some embodiments of the method of the disclosure, the infection is a Hepatitis C virus infection. In some embodiments of the method of the disclosure, the infection is a Human Papilloma Virus type 16 infection. In some embodiments of the method of the disclosure, the infection is a Human Papilloma Virus type 18 infection.

[00082] In some embodiments of the method disclosed herein, determining the expression level of at least one gene associated with the influenza A infection in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay: a first primer comprising a nucleic acid sequence of GACTTGAAGATGTCTTTGC (SEQ ID NO: 25), a second primer comprising a nucleic acid sequence of TRTTATTTGGGTCTCCATT (SEQ ID NO: 26), a third primer comprising a nucleic acid sequence of

TTAGTCAGAGGTGACARRATTGCAGATCTTGAGGCTCTC (SEQ ID NO: 27), a fourth primer comprising a nucleic acid sequence of

TTGTKTTCACGCTCACCGTGTTTGGACAAAGCGTCTACG (SEQ ID NO: 28).

[00083] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the influenza A infection in a biological sample from the subject using a LAMP assay further comprises using: a fifth primer comprising a nucleic acid sequence of GTCTTGTCTTTAGCCA (SEQ ID NO: 29), a sixth primer comprising a nucleic acid sequence of CMAGTGAGCGAGGACTG (SEQ ID NO: 30). [00084] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the influenza A infection in a biological sample from the subject using a LAMP assay further comprises using: a seventh primer comprising a nucleic acid sequence of GACTGGAAAGTGTCTTTGC (SEQ ID NO: 31), an eighth primer comprising a nucleic acid sequence of TRTTGTTTGGGTCCCCATT (SEQ ID NO: 32).

[00085] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the influenza A infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GACTTGAAGATGTCTTTGC (SEQ ID NO: 25), a second primer comprising a nucleic acid sequence of TRTTATTTGGGTCTCCATT (SEQ ID NO: 26), a third primer comprising a nucleic acid sequence of

TTGTKTTCACGCTCACCGTGTTTGGACAAAGCGTCTACG (SEQ ID NO: 28), a fifth primer comprising a nucleic acid sequence of GTCTTGTCTTTAGCCA (SEQ ID NO: 29), a sixth primer comprising a nucleic acid sequence of CMAGTGAGCGAGGACTG (SEQ ID NO: 30), a seventh primer comprising a nucleic acid sequence of GACTGGAAAGTGTCTTTGC (SEQ ID NO: 31), an eighth primer comprising a nucleic acid sequence of TRTTGTTTGGGTCCCCATT (SEQ ID NO: 32).

[00086] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is an influenza A infection, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a ninth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); a tenth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); an eleventh primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a twelfth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), and a thirteenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a fourteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[00087] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is an influenza A infection, the step of determining the expression level of at least one gene associated with the influenza A infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GACTTGAAGATGTCTTTGC (SEQ ID NO: 25), a second primer comprising a nucleic acid sequence of TRTTATTTGGGTCTCCATT (SEQ ID NO: 26), a third primer comprising a nucleic acid sequence of

TTGTKTTCACGCTCACCGTGTTTGGACAAAGCGTCTACG (SEQ ID NO: 28), a fifth primer comprising a nucleic acid sequence of GTCTTGTCTTTAGCCA (SEQ ID NO: 29), a sixth primer comprising a nucleic acid sequence of CMAGTGAGCGAGGACTG (SEQ ID NO: 30), a seventh primer comprising a nucleic acid sequence of GACTGGAAAGTGTCTTTGC (SEQ ID NO: 31), an eighth primer comprising a nucleic acid sequence of TRTTGTTTGGGTCCCCATT (SEQ ID NO: 32), and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a ninth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); a tenth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); an eleventh primer comprising a nucleic acid sequence of

TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a twelfth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), and a thirteenth primer comprising a nucleic acid sequence of

AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a fourteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[00088] In some embodiments of the method disclosed herein, determining the expression level of at least one gene associated with the influenza B infection in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay: a first primer comprising a nucleic acid sequence of GCAACCAATGCCACCATA (SEQ ID NO: 33), a second primer comprising a nucleic acid sequence of TTCTCTCTTCAAGRGACATC (SEQ ID NO: 34), a third primer comprising a nucleic acid sequence of

TAGTCAAGGGCYCTTTGCCACTTTGAAGCAGGAATTCTGGA (SEQ ID NO: 35), a fourth primer comprising a nucleic acid sequence of

CAAGACCGCCTAAACAGACTAAACTTTTACTTTCAGGCTCACTT TGAAAGYCTTTCATAGCAC (SEQ ID NO: 36).

[00089] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the influenza B infection in a biological sample from the subject using a LAMP assay further comprises using: a fifth primer comprising a nucleic acid sequence of TGAAAGYCTTTCATAGCAC (SEQ ID NO: 37), a sixth primer comprising a nucleic acid sequence of CAAGAATAAAGACTCACAAC (SEQ ID NO: 38). [00090] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the influenza B infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GCAACCAATGCCACCATA (SEQ ID NO: 33), a second primer comprising a nucleic acid sequence of TTCTCTCTTCAAGRGACATC (SEQ ID NO: 34), a third primer comprising a nucleic acid sequence of

CAAGACCGCCTAAACAGACTAAACTTTTACTTTCAGGCTCACTT TGAAAGYCTTTCATAGCAC (SEQ ID NO: 36), a fifth primer comprising a nucleic acid sequence of TGAAAGYCTTTCATAGCAC (SEQ ID NO: 37), a sixth primer comprising a nucleic acid sequence of CAAGAATAAAGACTCACAAC (SEQ ID NO: 38).

[00091] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is an influenza B infection, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[00092] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is an influenza B infection, the step of determining the expression level of at least one gene associated with the influenza B infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GCAACCAATGCCACCATA (SEQ ID NO: 33), a second primer comprising a nucleic acid sequence of TTCTCTCTTCAAGRGACATC (SEQ ID NO: 34), a third primer comprising a nucleic acid sequence of

CAAGACCGCCTAAACAGACTAAACTTTTACTTTCAGGCTCACTT TGAAAGYCTTTCATAGCAC (SEQ ID NO: 36), a fifth primer comprising a nucleic acid sequence of TGAAAGYCTTTCATAGCAC (SEQ ID NO: 37), a sixth primer comprising a nucleic acid sequence of CAAGAATAAAGACTCACAAC (SEQ ID NO: 38), and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), and an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24). [00093] In some embodiments of the method disclosed herein, determining the expression level of at least one gene associated with the respiratory syncytial virus A infection in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay: a first primer comprising a nucleic acid sequence of GAGTTGAAGGGATTTTTGCA (SEQ ID NO: 39), a second primer comprising a nucleic acid sequence of TGGGTTGTTCAATATATGGTAGA (SEQ ID NO: 40), a third primer comprising a nucleic acid sequence of TAACTGATTTTGCTAAGACCCCCGGATTGTTTATGAATGCCTATGG (SEQ ID NO: 41), a fourth primer comprising a nucleic acid sequence of C A AGC AGA A AT GGA AC A AGTT GT GC T GC TTC TC C ACC C A ATT (SEQ ID NO: 42). [00094] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the respiratory syncytial virus A infection in a biological sample from the subject using a LAMP assay further comprises using: a fifth primer comprising a nucleic acid sequence of GAGGTGTATGAGTATGCTCAGA (SEQ ID NO: 43), a sixth primer comprising a nucleic acid sequence of CACCGTAACATCACTTG (SEQ ID NO: 44).

[00095] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the respiratory syncytial virus A infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GAGTTGAAGGGATTTTTGCA (SEQ ID NO: 39), a second primer comprising a nucleic acid sequence of TGGGTTGTTCAATATATGGTAGA (SEQ ID NO: 40), a third primer comprising a nucleic acid sequence of TAACTGATTTTGCTAAGACCCCCGGATTGTTTATGAATGCCTATGG (SEQ ID NO: 41), a fourth primer comprising a nucleic acid sequence of

CAAGCAGAAATGGAACAAGTTGTGCTGCTTCTCCACCCAATT (SEQ ID NO: 42), a fifth primer comprising a nucleic acid sequence of GAGGTGTATGAGTATGCTCAGA (SEQ ID NO: 43), a sixth primer comprising a nucleic acid sequence of CACCGTAACATCACTTG (SEQ ID NO: 44).

[00096] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is respiratory syncytial virus A infection, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), and an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[00097] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is respiratory syncytial virus A infection, the step of determining the expression level of at least one gene associated with the respiratory syncytial virus A infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GAGTTGAAGGGATTTTTGCA (SEQ ID NO: 39), a second primer comprising a nucleic acid sequence of TGGGTTGTTCAATATATGGTAGA (SEQ ID NO: 40), a third primer comprising a nucleic acid sequence of

TAACTGATTTTGCTAAGACCCCCGGATTGTTTATGAATGCCTATGG (SEQ ID NO: 41), a fourth primer comprising a nucleic acid sequence of

CAAGCAGAAATGGAACAAGTTGTGCTGCTTCTCCACCCAATT (SEQ ID NO: 42), a fifth primer comprising a nucleic acid sequence of GAGGTGTATGAGTATGCTCAGA (SEQ ID NO: 43), a sixth primer comprising a nucleic acid sequence of CACCGTAACATCACTTG (SEQ ID NO: 44), and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), and an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[00098] In some embodiments of the method disclosed herein, determining the expression level of at least one gene associated with the respiratory syncytial virus B infection in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay: a first primer comprising a nucleic acid sequence of

TGACATCAGAAATACAAGTCAAT (SEQ ID NO: 45), a second primer comprising a nucleic acid sequence of CGTTTTTTAAGACATTGTTTGCC (SEQ ID NO: 46), a third primer comprising a nucleic acid sequence of

C ATCC C AC AGT C T GGAGA AT C A AGA A AGTCCT AC A A A A A A AT GC (SEQ ID NO: 47), a fourth primer comprising a nucleic acid sequence of

GCTGCCCTTGTAATAACCAAATTAGCTCCTAATTACTGCAGTAAGACC (SEQ ID NO: 48).

[00099] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the respiratory syncytial virus B infection in a biological sample from the subject using a LAMP assay further comprises using: a fifth primer comprising a nucleic acid sequence of CAGCAGGAGATAGATCA (SEQ ID NO: 49), a sixth primer comprising a nucleic acid sequence of GAGCCACTTCTCCCATC (SEQ ID NO: 50). [000100] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the respiratory syncytial virus B infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TGACATCAGAAATACAAGTCAAT (SEQ ID NO: 45), a second primer comprising a nucleic acid sequence of CGTTTTTTAAGACATTGTTTGCC (SEQ ID NO: 46), a third primer comprising a nucleic acid sequence of C ATCC C AC AGT C T GGAGA AT C A AGA A AGTCCT AC A A A A A A AT GC (SEQ ID NO: 47), a fourth primer comprising a nucleic acid sequence of

GCTGCCCTTGTAATAACCAAATTAGCTCCTAATTACTGCAGTAAGACC (SEQ ID NO: 48), a fifth primer comprising a nucleic acid sequence of CAGCAGGAGATAGATCA (SEQ ID NO: 49), a sixth primer comprising a nucleic acid sequence of GAGCCACTTCTCCCATC (SEQ ID NO: 50). [000101] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is respiratory syncytial virus B infection, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), and an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000102] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is respiratory syncytial virus B infection, the step of determining the expression level of at least one gene associated with the respiratory syncytial virus B infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TGACATCAGAAATACAAGTCAAT (SEQ ID NO: 45), a second primer comprising a nucleic acid sequence of CGTTTTTTAAGACATTGTTTGCC (SEQ ID NO: 46), a third primer comprising a nucleic acid sequence of

GCTGCCCTTGTAATAACCAAATTAGCTCCTAATTACTGCAGTAAGACC (SEQ ID NO: 48), a fifth primer comprising a nucleic acid sequence of CAGCAGGAGATAGATCA (SEQ ID NO: 49), a sixth primer comprising a nucleic acid sequence of GAGCCACTTCTCCCATC (SEQ ID NO: 50), and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), and an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000103] In some embodiments of the method disclosed herein, determining the expression level of at least one gene associated with the gonorrhoeae infection in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay: a first primer comprising a nucleic acid sequence of CCATTGATCCTTGGGACAG (SEQ ID NO: 51), a second primer comprising a nucleic acid sequence of CAGACCGGCATAATACACAT (SEQ ID NO: 52), a third primer comprising a nucleic acid sequence of

GGGAATCGTAACGCACGGAAATAATGTGGCTTCGCAATTG (SEQ ID NO: 53), a fourth primer comprising a nucleic acid sequence of

AGCGGCAGCATTCAATTTGTTCCTGATTACTTTCCAGCGTGA (SEQ ID NO: 54). [000104] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the gonorrhoeae infection in a biological sample from the subject using a LAMP assay further comprises using: a fifth primer comprising a nucleic acid sequence of ATACCGTCGTGGCGTTTG (SEQ ID NO: 55), a sixth primer comprising a nucleic acid sequence of CGCCTATACGCCTGCTAC (SEQ ID NO: 56).

[000105] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the gonorrhoeae infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of CCATTGATCCTTGGGACAG (SEQ ID NO: 51), a second primer comprising a nucleic acid sequence of CAGACCGGCATAATACACAT (SEQ ID NO: 52), a third primer comprising a nucleic acid sequence of

AGCGGCAGCATTCAATTTGTTCCTGATTACTTTCCAGCGTGA (SEQ ID NO: 54), a fifth primer comprising a nucleic acid sequence of ATACCGTCGTGGCGTTTG (SEQ ID NO: 55), a sixth primer comprising a nucleic acid sequence of CGCCTATACGCCTGCTAC (SEQ ID NO: 56).

[000106] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the gonorrhoeae infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of CCATTGATCCTTGGGACAG (SEQ ID NO: 51), a second primer comprising a nucleic acid sequence of CAGACCGGCATAATACACAT (SEQ ID NO: 52), a third primer comprising a nucleic acid sequence of

[000107] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is gonorrhoeae infection, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000108] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is gonorrhoeae infection, the step of determining the expression level of at least one gene associated with the gonorrhoeae infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of CCATTGATCCTTGGGACAG (SEQ ID NO: 51), a second primer comprising a nucleic acid sequence of CAGACCGGCATAATACACAT (SEQ ID NO: 52), a third primer comprising a nucleic acid sequence of

AGCGGCAGCATTCAATTTGTTCCTGATTACTTTCCAGCGTGA (SEQ ID NO: 54), a fifth primer comprising a nucleic acid sequence of ATACCGTCGTGGCGTTTG (SEQ ID NO: 55), a sixth primer comprising a nucleic acid sequence of CGCCTATACGCCTGCTAC (SEQ ID NO: 56), and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000109] In some embodiments of the method disclosed herein, determining the expression level of at least one gene associated with the chlamydia infection in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay: a first primer comprising a nucleic acid sequence of AATATCATCTTTGCGGTTGC (SEQ ID NO: 57), a second primer comprising a nucleic acid sequence of TCTACAAGAGTACATCGGTCA (SEQ ID NO: 58), a third primer comprising a nucleic acid sequence of

TCGAGCAACCGCTGTGACGACCTTCATTATGTCGGAGTC (SEQ ID NO: 59), a fourth primer comprising a nucleic acid sequence of

GC AGC TT GT AGT C C TGC TT G AGGG AGC G AGT T AC G A AG A (SEQ ID NO: 60).

[000110] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the chlamydia infection in a biological sample from the subject using a LAMP assay further comprises using: a fifth primer comprising a nucleic acid sequence of TACAAACGCCTAGGGTGC (SEQ ID NO: 61), a sixth primer comprising a nucleic acid sequence of GTTAAGGCAAATCGCCCG (SEQ ID NO: 62).

[000111] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the chlamydia infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of AATATCATCTTTGCGGTTGC (SEQ ID NO: 57), a second primer comprising a nucleic acid sequence of TCTACAAGAGTACATCGGTCA (SEQ ID NO: 58), a third primer comprising a nucleic acid sequence of

GC AGC TT GT AGTCC T GCTT GAGGGAGC GAGTT AC GA AGA (SEQ ID NO: 60), a fifth primer comprising a nucleic acid sequence of TACAAACGCCTAGGGTGC (SEQ ID NO: 61), a sixth primer comprising a nucleic acid sequence of GTTAAGGCAAATCGCCCG (SEQ ID NO: 62).

[000112] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is chlamydia infection, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000113] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is chlamydia infection, the step of determining the expression level of at least one gene associated with the chlamydia infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of AATATCATCTTTGCGGTTGC (SEQ ID NO: 57), a second primer comprising a nucleic acid sequence of TCTACAAGAGTACATCGGTCA (SEQ ID NO: 58), a third primer comprising a nucleic acid sequence of

GC AGC TT GT AGTCC T GCTT GAGGGAGC GAGTT AC GA AGA (SEQ ID NO: 60), a fifth primer comprising a nucleic acid sequence of TACAAACGCCTAGGGTGC (SEQ ID NO: 61), a sixth primer comprising a nucleic acid sequence of GTTAAGGCAAATCGCCCG (SEQ ID NO: 62), and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000114] In some embodiments of the method disclosed herein, determining the expression level of at least one gene associated with the trichomoniasis infection in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay: a first primer comprising a nucleic acid sequence of GCTTCTCACAGAGCGTGG (SEQ ID NO: 63), a second primer comprising a nucleic acid sequence of GCTCATTGCCGATTGTGATG (SEQ ID NO: 64), a third primer comprising a nucleic acid sequence of

AGGGCGACATAGCAAAGCTTCTGCTTTCAACACAACAGCCG (SEQ ID NO: 65), a fourth primer comprising a nucleic acid sequence of

T GCTGAAATGGAGAAGGCCGCCGTTGCC ATCTGGA AGTGT G (SEQ ID NO: 66). [000115] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the trichomoniasis infection in a biological sample from the subject using a LAMP assay further comprises using: a fifth primer comprising a nucleic acid sequence of CTTGATGTCACGAACGATTTCCTTT (SEQ ID NO: 67), a sixth primer comprising a nucleic acid sequence of TACAGACTCCTCCATCAACGT (SEQ ID NO: 68).

[000116] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the trichomoniasis infection in a biological sample from the subject using a LAMP assay further comprises using: a first primer comprising a nucleic acid sequence of GCTTCTCACAGAGCGTGG (SEQ ID NO: 63), a second primer comprising a nucleic acid sequence of GCTCATTGCCGATTGTGATG (SEQ ID NO: 64), a third primer comprising a nucleic acid sequence of

TGCTGAAATGGAGAAGGCCGCCGTTGCCATCTGGAAGTGTG (SEQ ID NO: 66), a fifth primer comprising a nucleic acid sequence of CTTGATGTCACGAACGATTTCCTTT (SEQ ID NO: 67), a sixth primer comprising a nucleic acid sequence of TACAGACTCCTCCATCAACGT (SEQ ID NO: 68).

[000117] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is trichomoniasis infection, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000118] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is trichomoniasis infection, the step of determining the expression level of at least one gene associated with the trichomoniasis infection in a biological sample from the subject using a LAMP assay further comprises using: a first primer comprising a nucleic acid sequence of GCTTCTCACAGAGCGTGG (SEQ ID NO: 63), a second primer comprising a nucleic acid sequence of GCTCATTGCCGATTGTGATG (SEQ ID NO: 64), a third primer comprising a nucleic acid sequence of

TGCTGAAATGGAGAAGGCCGCCGTTGCCATCTGGAAGTGTG (SEQ ID NO: 66), a fifth primer comprising a nucleic acid sequence of CTTGATGTCACGAACGATTTCCTTT (SEQ ID NO: 67), a sixth primer comprising a nucleic acid sequence of

TACAGACTCCTCCATCAACGT (SEQ ID NO: 68), and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000119] In some embodiments of the method disclosed herein, determining the expression level of at least one gene associated with the herpes simplex 1 infection in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay: a first primer comprising a nucleic acid sequence of GCCGTTGTTCCCATTATCCC (SEQ ID NO: 69), a second primer comprising a nucleic acid sequence of TACTTGGCATGGGGGGTG (SEQ ID NO: 70), a third primer comprising a nucleic acid sequence of

GTTGGGT GGT GGAGGAGACGTCCTTTT GGTTCTTGTCGGT (SEQ ID NO: 71), a fourth primer comprising a nucleic acid sequence of

GGTCGTCCCTCGCATGAAGCGGCGTGGTAAGGCTGATG (SEQ ID NO: 72). [000120] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the herpes simplex 1 infection in a biological sample from the subject using a LAMP assay further comprises using: a fifth primer comprising a nucleic acid sequence of TTGGTGGGAACCCCCGATAC (SEQ ID NO:73), a sixth primer comprising a nucleic acid sequence of AACATGACCCAGACCGGCAC (SEQ ID NO: 74).

[000121] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the herpes simplex 1 infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GCCGTTGTTCCCATTATCCC (SEQ ID NO: 69), a second primer comprising a nucleic acid sequence of TACTTGGCATGGGGGGTG (SEQ ID NO: 70), a third primer comprising a nucleic acid sequence of

GGT C GT C C C TC GC AT G A AGC GGC GT GGT A AGGC T GAT G (SEQ ID NO: 72), a fifth primer comprising a nucleic acid sequence of TTGGTGGGAACCCCCGATAC (SEQ ID NO:73), a sixth primer comprising a nucleic acid sequence of AACATGACCCAGACCGGCAC (SEQ ID NO: 74).

[000122] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is herpes simplex 1 infection, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24). [000123] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is herpes simplex 1 infection, the step of determining the expression level of at least one gene associated with the herpes simplex 1 infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GCCGTTGTTCCCATTATCCC (SEQ ID NO:

69), a second primer comprising a nucleic acid sequence of TACTTGGCATGGGGGGTG (SEQ ID NO: 70), a third primer comprising a nucleic acid sequence of

GGT C GT C C C TC GC AT G A AGC GGC GT GGT A AGGC T GAT G (SEQ ID NO: 72), a fifth primer comprising a nucleic acid sequence of TTGGTGGGAACCCCCGATAC (SEQ ID NO:73), a sixth primer comprising a nucleic acid sequence of AACATGACCCAGACCGGCAC (SEQ ID NO: 74) and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000124] In some embodiments of the method disclosed herein, determining the expression level of at least one gene associated with the herpes simplex 2 infection in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay: a first primer comprising a nucleic acid sequence of TCAGCCCATCCTCCTTCG (SEQ ID NO: 75), a second primer comprising a nucleic acid sequence of CCCACCTCTACCCACAAC (SEQ ID NO: 76), a third primer comprising a nucleic acid sequence of

CCCTGGTACGTGTACGTGTACGAGTATGGAGGGTGTCGCG (SEQ ID NO: 77), a fourth primer comprising a nucleic acid sequence of

AAATGCTTCCCTGCTGGTGCCCGCCGAGTTCGATCTGGT (SEQ ID NO: 78).

[000125] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the herpes simplex 2 infection in a biological sample from the subject using a LAMP assay further comprises using: a fifth primer comprising a nucleic acid sequence of CACGTCTTTGGGGACGGCGGC (SEQ ID NO: 79), a sixth primer comprising a nucleic acid sequence of ATCTGGGACCGCGCCGCGGAGAC (SEQ ID NO: 80).

[000126] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the herpes simplex 2 infection in a biological sample from the subject using a LAMP assay further comprises using: a first primer comprising a nucleic acid sequence of TCAGCCCATCCTCCTTCG (SEQ ID NO: 75), a second primer comprising a nucleic acid sequence of CCCACCTCTACCCACAAC (SEQ ID NO: 76), a third primer comprising a nucleic acid sequence of

AAATGCTTCCCTGCTGGTGCCCGCCGAGTTCGATCTGGT (SEQ ID NO: 78), a fifth primer comprising a nucleic acid sequence of CACGTCTTTGGGGACGGCGGC (SEQ ID NO: 79), a sixth primer comprising a nucleic acid sequence of ATCTGGGACCGCGCCGCGGAGAC (SEQ ID NO: 80).

[000127] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is herpes simplex 2 infection, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000128] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is herpes simplex 2 infection, the step of determining the expression level of at least one gene associated with the herpes simplex 2 infection in a biological sample from the subject using a LAMP assay further comprises using: a first primer comprising a nucleic acid sequence of TCAGCCCATCCTCCTTCG (SEQ ID NO: 75), a second primer comprising a nucleic acid sequence of CCCACCTCTACCCACAAC (SEQ ID NO: 76), a third primer comprising a nucleic acid sequence of

AAATGCTTCCCTGCTGGTGCCCGCCGAGTTCGATCTGGT (SEQ ID NO: 78), a fifth primer comprising a nucleic acid sequence of CACGTCTTTGGGGACGGCGGC (SEQ ID NO: 79), a sixth primer comprising a nucleic acid sequence of

ATCTGGGACCGCGCCGCGGAGAC (SEQ ID NO: 80), and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000129] In some embodiments of the method disclosed herein, determining the expression level of at least one gene associated with the syphilis infection in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay: a first primer comprising a nucleic acid sequence of TGCAGTCTTTTTTTGTGCGG (SEQ ID NO: 81), a second primer comprising a nucleic acid sequence of TCAAATCATTGGTGGTGCGA (SEQ ID NO: 82), a third primer comprising a nucleic acid sequence of

CTGCGGGGCAATGCCTAGCTGCTCCCGGGGTTTGG (SEQ ID NO: 83), a fourth primer comprising a nucleic acid sequence of

GTAACTGGTCACGCCCAGCTGCCCGTGCGTGTACTCGTTC (SEQ ID NO: 84).

[000130] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the syphilis infection in a biological sample from the subject using a LAMP assay further comprises using: a fifth primer comprising a nucleic acid sequence of AGAAAAAACGGGCAGTGCG (SEQ ID NO: 85), a sixth primer comprising a nucleic acid sequence of GGGGCATTAAGTTTAAAAAGAACCC (SEQ ID NO: 86).

[000131] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the syphilis infection in a biological sample from the subject using a LAMP assay further comprises using: a seventh primer comprising a nucleic acid sequence of, TCCCTCGAGACTCGATTCC (SEQ ID NO: 87), an eighth primer comprising a nucleic acid sequence of GTACGCATCTGTCGGTAGC (SEQ ID NO: 88). [000132] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the syphilis infection in a biological sample from the subject using a LAMP assay further comprises using: a ninth primer comprising a nucleic acid sequence of CCACCCCCCTTCTGTGCAACCATCCTTCTGATGCGTCAGC (SEQ ID NO: 89), a tenth primer comprising a nucleic acid sequence of GTGCTTTTCGGGAGGATTCCCGAGTGCACTGCGCTCATCT (SEQ ID NO: 90).

[000133] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the syphilis infection in a biological sample from the subject using a LAMP assay further comprises using: a eleventh primer comprising a nucleic acid sequence of TTCCGCGTTCGGTGCTC (SEQ ID NO: 91), a twelfth primer comprising a nucleic acid sequence of CTTTCGGGACGATGAGATAATGC (SEQ ID NO: 92). [000134] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the syphilis infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TGCAGTCTTTTTTTGTGCGG (SEQ ID NO: 81), a second primer comprising a nucleic acid sequence of TCAAATCATTGGTGGTGCGA (SEQ ID NO: 82), a third primer comprising a nucleic acid sequence of

GTAACTGGTCACGCCCAGCTGCCCGTGCGTGTACTCGTTC (SEQ ID NO: 84), a fifth primer comprising a nucleic acid sequence of AGAAAAAACGGGCAGTGCG (SEQ ID NO: 85), a sixth primer comprising a nucleic acid sequence of

GGGGCATTAAGTTTAAAAAGAACCC (SEQ ID NO: 86), a seventh primer comprising a nucleic acid sequence of TCCCTCGAGACTCGATTCC (SEQ ID NO: 87), an eighth primer comprising a nucleic acid sequence of GTACGCATCTGTCGGTAGC (SEQ ID NO: 88), a ninth primer comprising a nucleic acid sequence of

CCACCCCCCTTCTGTGCAACCATCCTTCTGATGCGTCAGC (SEQ ID NO: 89), a tenth primer comprising a nucleic acid sequence of

GTGCTTTTCGGGAGGATTCCCGAGTGCACTGCGCTCATCT (SEQ ID NO: 90), a eleventh primer comprising a nucleic acid sequence of TTCCGCGTTCGGTGCTC (SEQ ID NO: 91), a twelfth primer comprising a nucleic acid sequence of CTTTCGGGACGATGAGATAATGC (SEQ ID NO: 92).

[000135] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is syphilis infection, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a thirteenth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an fourteenth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a fifteenth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a sixteenth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an seventeenth primer comprising a nucleic acid sequence of

AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a eighteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24). [000136] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is syphilis infection, the step of determining the expression level of at least one gene associated with the syphilis infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TGCAGTCTTTTTTTGTGCGG (SEQ ID NO: 81), a second primer comprising a nucleic acid sequence of TCAAATCATTGGTGGTGCGA (SEQ ID NO: 82), a third primer comprising a nucleic acid sequence of

GTGCTTTTCGGGAGGATTCCCGAGTGCACTGCGCTCATCT (SEQ ID NO: 90), a eleventh primer comprising a nucleic acid sequence of TTCCGCGTTCGGTGCTC (SEQ ID NO: 91), a twelfth primer comprising a nucleic acid sequence of CTTTCGGGACGATGAGATAATGC (SEQ ID NO: 92), and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a thirteenth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an fourteenth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a fifteenth primer comprising a nucleic acid sequence of

TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a sixteenth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an seventeenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), an eighteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000137] In some embodiments of the method of the disclosure, determining the expression level of at least one gene associated with the Gardnerella vaginalis infection in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay comprises using: a first primer comprising a nucleic acid sequence of

CGGGTTGATATTCCCGTACC (SEQ ID NO: 93), a second primer comprising a nucleic acid sequence of ACATCCCCCGGATTTACCT (SEQ ID NO: 94), a third primer comprising a nucleic acid sequence of

AACCCCGAAAGATAATCAACCAGGGTGTTACACCGTTCGAACTG (SEQ ID NO: 95), a fourth primer comprising a nucleic acid sequence of

AACCCCGAAAGGCAATCAACCAGGGTGTTACACCGTTCGAACTG (SEQ ID NO: 96), a fifth primer comprising a nucleic acid sequence of

AACCCCGAAAGGAAGCCAGCCTAGGTGTTACACCGTTCGAACTG (SEQ ID NO: 97), a sixth primer TCGGT AGT AGGTT AGCGT GGGAGGAC AGCCC AC ACGCTT AG (SEQ ID NO: 98).

[000138] In some embodiments of the method of the disclosure, determining the expression level of at least one gene associated with the Gardnerella vaginalis infection in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay comprises using: a seventh primer comprising a nucleic acid sequence of ATGAAGGTTAGTACTCTCAGATT (SEQ ID NO: 99), an eighth primer comprising a nucleic acid sequence of ACGAAGGTTAGTACTCTCAGATT (SEQ ID NO: 100), a ninth primer comprising a nucleic acid sequence of ATCAAGGTTAGTACTCTCAGATT (SEQ ID NO:

101), a tenth primer comprising a nucleic acid sequence of CGGCTGCGGAGGTGGTTTT (SEQ ID NO: 102).

[000139] In some embodiments of the method of the disclosure, determining the expression level of at least one gene associated with the Gardnerella vaginalis infection in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay comprises using: a first primer comprising a nucleic acid sequence of

AACCCCGAAAGGAAGCCAGCCTAGGTGTTACACCGTTCGAACTG (SEQ ID NO: 97), a sixth primer TCGGT AGT AGGTT AGCGT GGGAGGAC AGCCC AC ACGCTT AG (SEQ ID NO: 98), a seventh primer comprising a nucleic acid sequence of

ATGAAGGTTAGTACTCTCAGATT (SEQ ID NO: 99), an eighth primer comprising a nucleic acid sequence of ACGAAGGTTAGTACTCTCAGATT (SEQ ID NO: 100), a ninth primer comprising a nucleic acid sequence of ATCAAGGTTAGTACTCTCAGATT (SEQ ID NO:

[000140] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is Gardnerella vaginalis infection, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: an eleventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an twelfth primer comprising a nucleic acid sequence of

CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a thirteenth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a fourteenth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), a fifteenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a sixteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000141] In some embodiments of the method of the disclosure, determining the expression level of at least one gene associated with the Gardnerella vaginalis infection in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay comprises using: a first primer comprising a nucleic acid sequence of CGGGTTGATATTCCCGTACC (SEQ ID NO: 93), a second primer comprising a nucleic acid sequence of ACATCCCCCGGATTTACCT (SEQ ID NO: 94), a third primer comprising a nucleic acid sequence of

ATGAAGGTTAGTACTCTCAGATT (SEQ ID NO: 99), a eighth primer comprising a nucleic acid sequence of ACGAAGGTTAGTACTCTCAGATT (SEQ ID NO: 100), a ninth primer comprising a nucleic acid sequence of ATCAAGGTTAGTACTCTCAGATT (SEQ ID NO:

101), a tenth primer comprising a nucleic acid sequence of CGGCTGCGGAGGTGGTTTT (SEQ ID NO: 102); and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: an eleventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an twelfth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a thirteenth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a fourteenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), a fifteenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a sixteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000142] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Candida albicans infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of CAATGGAAAGACCCTTCTCAA (SEQ ID NO: 103), a second primer comprising a nucleic acid sequence of GTGGGACTAAGATATAAATTGACTT (SEQ ID NO: 104), a third primer AGGTTTCGTCGT AT GAAGTGGT ATTCTGAT GAAGAT AC AAATGCT (SEQ ID NO: 105), a fourth primer comprising a nucleic acid sequence of

C AACGAAGT C AATCTGGAACC AAAATTGCTGAA ATTTTCGT G (SEQ ID NO: 106). [000143] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Candida albicans infection in a biological sample from the subject using a LAMP assay comprises using: a fifth primer comprising a nucleic acid sequence of GGTGTTGGTGGAACTGA (SEQ ID NO: 107), a sixth primer comprising a nucleic acid sequence of GAGGCATTGACAGATATGAA (SEQ ID NO: 108). [000144] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Candida albicans infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of CAATGGAAAGACCCTTCTCAA (SEQ ID NO: 103), a second primer comprising a nucleic acid sequence of GTGGGACTAAGATATAAATTGACTT (SEQ ID NO: 104), a third primer

AGGTTTCGTCGT ATGAAGTGGTATTCTGATGAAGAT AC AAATGCT (SEQ ID NO: 105), a fourth primer comprising a nucleic acid sequence of

C AACGAAGTC AATCTGGAACC AAAATTGCTGAAATTTTCGTG (SEQ ID NO: 106), a fifth primer comprising a nucleic acid sequence of GGTGTTGGTGGAACTGA (SEQ ID NO: 107), a sixth primer comprising a nucleic acid sequence of GAGGCATTGACAGATATGAA (SEQ ID NO: 108).

[000145] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is Candida albicans infection, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000146] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Candida albicans infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of CAATGGAAAGACCCTTCTCAA (SEQ ID NO: 103), a second primer comprising a nucleic acid sequence of GTGGGACTAAGATATAAATTGACTT (SEQ ID NO: 104), a third primer

AGGTTTCGTCGT AT GAAGTGGT ATTCTGAT GAAGAT AC AAATGCT (SEQ ID NO: 105), a fourth primer comprising a nucleic acid sequence of

C AACGAAGT C AATCTGGAACC AAAATTGCTGAA ATTTTCGT G (SEQ ID NO: 106), a fifth primer comprising a nucleic acid sequence of GGTGTTGGTGGAACTGA (SEQ ID NO: 107), a sixth primer comprising a nucleic acid sequence of GAGGCATTGACAGATATGAA (SEQ ID NO: 108); and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000147] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Mycoplasma genitalium infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TGGTCACTTCACTCCCTAA (SEQ ID NO: 109), a second primer comprising a nucleic acid sequence of ACAACACAACTTACACCACTA (SEQ ID NO: 110), a third primer comprising a nucleic acid sequence of CATTGACTCAACCCAAGCTTTGGACTCAACCCCAATCACAC (SEQ ID NO: 111), a fourth primer comprising a nucleic acid sequence of

GTGCTTTTTCAAACCCTGGTAAAGTACAACATTATTGTTGCAACCG (SEQ ID NO:

112).

[000148] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Mycoplasma genitalium infection in a biological sample from the subject using a LAMP assay comprises using:, a fifth primer comprising a nucleic acid sequence of GAAGTTTGTTGTAGTTGGGGGA (SEQ ID NO: 113), a sixth primer comprising a nucleic acid sequence of AGTATCTTGGTCTTG (SEQ ID NO:

114).

[000149] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Mycoplasma genitalium infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TGGTCACTTCACTCCCTAA (SEQ ID NO: 109), a second primer comprising a nucleic acid sequence of ACAACACAACTTACACCACTA (SEQ ID NO: 110), a third primer comprising a nucleic acid sequence of CATTGACTCAACCCAAGCTTTGGACTCAACCCCAATCACAC (SEQ ID NO: 111), a fourth primer comprising a nucleic acid sequence of

GTGCTTTTTCAAACCCTGGTAAAGTACAACATTATTGTTGCAACCG (SEQ ID NO:

112), a fifth primer comprising a nucleic acid sequence of GAAGTTTGTTGTAGTTGGGGGA (SEQ ID NO: 113), a sixth primer comprising a nucleic acid sequence of AGTATCTTGGTCTTG (SEQ ID NO: 114).

[000150] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is Mycoplasma genitalium infection, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of

CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of

[000151] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Mycoplasma Genitalium infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TGGTCACTTCACTCCCTAA (SEQ ID NO: 109), a second primer comprising a nucleic acid sequence of ACAACACAACTTACACCACTA (SEQ ID NO: 110), a third primer comprising a nucleic acid sequence of CATTGACTCAACCCAAGCTTTGGACTCAACCCCAATCACAC (SEQ ID NO: 111), a fourth primer comprising a nucleic acid sequence of

GTGCTTTTTCAAACCCTGGTAAAGTACAACATTATTGTTGCAACCG (SEQ ID NO:

112), a fifth primer comprising a nucleic acid sequence of GAAGTTTGTTGTAGTTGGGGGA (SEQ ID NO: 113), a sixth primer comprising a nucleic acid sequence of AGTATCTTGGTCTTG (SEQ ID NO: 114); and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000152] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Mycobacterium tuberculosis infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GGGCTTGCCGGGTTTGA (SEQ ID NO: 115), a second primer comprising a nucleic acid sequence of TGGACCCGCCAACAAGAA (SEQ ID NO: 116), a third primer comprising a nucleic acid sequence of

TCCAACCGTCGGTCGGAGCATAGGCCGTTGATCGTCTCG (SEQ ID NO: 117), a fourth primer comprising a nucleic acid sequence of

CTCGCTGAACCGGATCGATGTGGCGTACTCGACCTGAAAG (SEQ ID NO: 118). [000153] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Mycobacterium tuberculosis infection in a biological sample from the subject using a LAMP assay comprises using: a fifth primer comprising a nucleic acid sequence of CCTATCCGTATGGTGGATAACG (SEQ ID NO: 119), a sixth primer comprising a nucleic acid sequence of GTCGGAAGCTCCTATGACAAT (SEQ ID NO: 120).

[000154] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Mycobacterium tuberculosis infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GGGCTTGCCGGGTTTGA (SEQ ID NO: 115), a second primer comprising a nucleic acid sequence of TGGACCCGCCAACAAGAA (SEQ ID NO:

116), a third primer comprising a nucleic acid sequence of

CTCGCTGAACCGGATCGATGTGGCGTACTCGACCTGAAAG (SEQ ID NO: 118), a fifth primer comprising a nucleic acid sequence of CCTATCCGTATGGTGGATAACG (SEQ ID NO: 119), a sixth primer comprising a nucleic acid sequence of GTCGGAAGCTCCTATGACAAT (SEQ ID NO: 120).

[000155] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is Mycobacterium tuberculosis infection, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000156] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Mycobacterium tuberculosis infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GGGCTTGCCGGGTTTGA (SEQ ID NO: 115), a second primer comprising a nucleic acid sequence of TGGACCCGCCAACAAGAA (SEQ ID NO:

116), a third primer comprising a nucleic acid sequence of

CTCGCTGAACCGGATCGATGTGGCGTACTCGACCTGAAAG (SEQ ID NO: 118), a fifth primer comprising a nucleic acid sequence of CCTATCCGTATGGTGGATAACG (SEQ ID NO: 119), a sixth primer comprising a nucleic acid sequence of GTCGGAAGCTCCTATGACAAT (SEQ ID NO: 120); and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000157] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Ureaplasma parvum infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TCAAGTCAATTTAGTCCAGGTA (SEQ ID NO: 121), a second primer comprising a nucleic acid sequence of GGAATATCGAAACGTCGTCC (SEQ ID NO: 122), a third primer comprising a nucleic acid sequence of

GACGGTCCCCAGTATTTTTAATACTGCAATTAATTTCGCTAGTGGTG (SEQ ID NO:

123), a fourth primer comprising a nucleic acid sequence of

CAAGTTGGATCACATTTTCACTTGTGCGTTCTTTATCTTCATTTCCTT (SEQ ID NO:

124).

[000158] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Ureaplasma parvum infection in a biological sample from the subject using a LAMP assay comprises using: a fifth primer comprising a nucleic acid sequence of AATTACTTTTGCCTCTCTACC (SEQ ID NO: 125), a sixth primer comprising a nucleic acid sequence of TGAAGTGAATAGTGCATTAG (SEQ ID NO: 126).

[000159] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Ureaplasma parvum infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TCAAGTCAATTTAGTCCAGGTA (SEQ ID NO: 121), a second primer comprising a nucleic acid sequence of GGAATATCGAAACGTCGTCC (SEQ ID NO: 122), a third primer comprising a nucleic acid sequence of

GACGGTCCCCAGTATTTTTAATACTGCAATTAATTTCGCTAGTGGTG (SEQ ID NO:

123), a fourth primer comprising a nucleic acid sequence of

CAAGTTGGATCACATTTTCACTTGTGCGTTCTTTATCTTCATTTCCTT (SEQ ID NO:

124); a fifth primer comprising a nucleic acid sequence of AATTACTTTTGCCTCTCTACC (SEQ ID NO: 125), a sixth primer comprising a nucleic acid sequence of TGAAGTGAATAGTGCATTAG (SEQ ID NO: 126).

[000160] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is Ureaplasma parvum infection, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of

[000161] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Ureaplasma parvum infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TCAAGTCAATTTAGTCCAGGTA (SEQ ID NO: 121), a second primer comprising a nucleic acid sequence of GGAATATCGAAACGTCGTCC (SEQ ID NO: 122), a third primer comprising a nucleic acid sequence of

GACGGTCCCCAGTATTTTTAATACTGCAATTAATTTCGCTAGTGGTG (SEQ ID NO:

123), a fourth primer comprising a nucleic acid sequence of

CAAGTTGGATCACATTTTCACTTGTGCGTTCTTTATCTTCATTTCCTT (SEQ ID NO:

124); a fifth primer comprising a nucleic acid sequence of AATTACTTTTGCCTCTCTACC (SEQ ID NO: 125), a sixth primer comprising a nucleic acid sequence of TGAAGTGAATAGTGCATTAG (SEQ ID NO: 126); and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000162] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Ureaplasma urealyticum infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GGTAAATTAGTACCAGGAGCA (SEQ ID NO: 127), a second primer comprising a nucleic acid sequence of AACGACGTCCATAAGCAA (SEQ ID NO: 128), a third primer comprising a nucleic acid sequence of

AGGACGGTCACCAGTATTTTTAATATTAACTTCGCTGAAGGCG (SEQ ID NO: 129), a fourth primer comprising a nucleic acid sequence of

CCAAGTTGGATCACATTTCCACTTCGTTCTTTGTCTTCGTTTCC (SEQ ID NO: 130). [000163] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Ureaplasma urealyticum infection in a biological sample from the subject using a LAMP assay comprises using: a fifth primer comprising a nucleic acid sequence of GCTTCTCTACCTTCGTTCAT (SEQ ID NO: 131), a sixth primer comprising a nucleic acid sequence of AGTGCATTAGTATTCTTTGATGA (SEQ ID NO: 132).

[000164] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Ureaplasma urealyticum infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GGTAAATTAGTACCAGGAGCA (SEQ ID NO: 127), a second primer comprising a nucleic acid sequence of AACGACGTCCATAAGCAA (SEQ ID NO: 128), a third primer comprising a nucleic acid sequence of

CCAAGTTGGATCACATTTCCACTTCGTTCTTTGTCTTCGTTTCC (SEQ ID NO: 130), a fifth primer comprising a nucleic acid sequence of GCTTCTCTACCTTCGTTCAT (SEQ ID NO: 131), a sixth primer comprising a nucleic acid sequence of AGTGCATTAGTATTCTTTGATGA (SEQ ID NO: 132).

[000165] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is Ureaplasma urealyticum infection, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of

[000166] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is Ureaplasma urealyticum infection, the step of determining the expression level of at least one gene associated with the Ureaplasma urealyticum infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GGTAAATTAGTACCAGGAGCA (SEQ ID NO: 127), a second primer comprising a nucleic acid sequence of AACGACGTCCATAAGCAA (SEQ ID NO: 128), a third primer comprising a nucleic acid sequence of AGGACGGTCACCAGTATTTTTAATATTAACTTCGCTGAAGGCG (SEQ ID NO: 129), a fourth primer comprising a nucleic acid sequence of

CCAAGTTGGATCACATTTCCACTTCGTTCTTTGTCTTCGTTTCC (SEQ ID NO: 130), a fifth primer comprising a nucleic acid sequence of GCTTCTCTACCTTCGTTCAT (SEQ ID NO: 131), a sixth primer comprising a nucleic acid sequence of

AGTGCATTAGTATTCTTTGATGA (SEQ ID NO: 132).; and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24). [000167] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Human T-lymphotropic virus 1 infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of CAGGGGCCCTAATAATTCTACC (SEQ ID NO: 133), a second primer comprising a nucleic acid sequence of AGGGCCCGGAAATCATAGG (SEQ ID NO: 134), a third primer comprising a nucleic acid sequence of

AAGGCCCGGAAATCATGGG (SEQ ID NO: 135), a fourth primer comprising a nucleic acid sequence of TGCCAGGCTGTTAGCGTGACGAAGACTGTTTGCCCACCA (SEQ ID NO: 136), a fifth primer comprising a nucleic acid sequence of

TGCCAGGCTGTCAGCGTGGCGAAGGCTGTTTACCCACCA (SEQ ID NO: 137), a sixth primer comprising a nucleic acid sequence of

AACGGCCTCCTTCCGTTCCACGTGCCATCGGTAAATGTCC (SEQ ID NO: 138),

[000168] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Human T-lymphotropic virus 1 infection in a biological sample from the subject using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of CCTAGCAGGCTGGAAAAGGG (SEQ ID NO: 139), an eighth primer comprising a nucleic acid sequence of CCTAACAGGCTGAAAAAGGG (SEQ ID NO: 140), a ninth primer comprising a nucleic acid sequence of CTCAACCCTCACCACTCCA (SEQ ID NO: 141).

[000169] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Human T-lymphotropic virus 1 infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of CAGGGGCCCTAATAATTCTACC (SEQ ID NO: 133), a second primer comprising a nucleic acid sequence of AGGGCCCGGAAATCATAGG (SEQ ID NO: 134), a third primer comprising a nucleic acid sequence of

TGCCAGGCTGTCAGCGTGGCGAAGGCTGTTTACCCACCA (SEQ ID NO: 137), a sixth primer comprising a nucleic acid sequence of AACGGCCTCCTTCCGTTCCACGTGCCATCGGTAAATGTCC (SEQ ID NO: 138), a seventh primer comprising a nucleic acid sequence of CCTAGCAGGCTGGAAAAGGG (SEQ ID NO: 139), an eighth primer comprising a nucleic acid sequence of

CCTAACAGGCTGAAAAAGGG (SEQ ID NO: 140), a ninth primer comprising a nucleic acid sequence of CTCAACCCTCACCACTCCA (SEQ ID NO: 141).

[000170] In some embodiments of the method of the disclosure of detecting the presence or absence of an infection in a subject, wherein the infection is Human T-lymphotropic virus 1 infection, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a tenth primer comprising a nucleic acid sequence of

GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eleventh primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a twelfth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a thirteenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), a fourteenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), an fifteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000171] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Human T-lymphotropic virus 1 infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of CAGGGGCCCTAATAATTCTACC (SEQ ID NO: 133), a second primer comprising a nucleic acid sequence of AGGGCCCGGAAATCATAGG (SEQ ID NO: 134), a third primer comprising a nucleic acid sequence of

AACGGCCTCCTTCCGTTCCACGTGCCATCGGTAAATGTCC (SEQ ID NO: 138), a seventh primer comprising a nucleic acid sequence of CCTAGCAGGCTGGAAAAGGG (SEQ ID NO: 139), an eighth primer comprising a nucleic acid sequence of

CCTAACAGGCTGAAAAAGGG (SEQ ID NO: 140), a ninth primer comprising a nucleic acid sequence of CTCAACCCTCACCACTCCA (SEQ ID NO: 141); and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a tenth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eleventh primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a twelfth primer comprising a nucleic acid sequence of

TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a thirteenth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), a fourteenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), an fifteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000172] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Human T-lymphotropic virus 2 infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TCACCAAGGTGCCTCTAA (SEQ ID NO: 142), an second primer comprising a nucleic acid sequence of GCAAGGGCCGGAAATCAT (SEQ ID NO: 143), a third primer comprising a nucleic acid sequence of

GATACAGGGAGCCCTCACGCACACAGGGGCAGTCATAG (SEQ ID NO: 144), a fourth primer comprising a nucleic acid sequence of

GATACAGGGAGCCCTCACGCACACAGGAGCGGTCATAG (SEQ ID NO: 145), a fifth primer comprising a nucleic acid sequence of

GCCTGGTGTACAGGACTTCTCCCGTCATTGAAGGTCCAT (SEQ ID NO: 146), a sixth primer comprising a nucleic acid sequence of

GCCTGGTGTACAGGACTTCTCCCATCGTTGAAGGTCCAT (SEQ ID NO: 147).

[000173] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Human T-lymphotropic virus 2 infection in a biological sample from the subject using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GGTTGGAACATTGTGGTGG (SEQ ID NO: 148), an eighth primer comprising a nucleic acid sequence of TCCATCTTAACAACCCCAGG (SEQ ID NO: 149).

[000174] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Human T-lymphotropic virus 2 infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TCACCAAGGTGCCTCTAA (SEQ ID NO: 142), an second primer comprising a nucleic acid sequence of GCAAGGGCCGGAAATCAT (SEQ ID NO: 143), a third primer comprising a nucleic acid sequence of

GCCTGGTGTACAGGACTTCTCCCATCGTTGAAGGTCCAT (SEQ ID NO: 147), a seventh primer comprising a nucleic acid sequence of GGTTGGAACATTGTGGTGG (SEQ ID NO: 148), an eighth primer comprising a nucleic acid sequence of TCCATCTTAACAACCCCAGG (SEQ ID NO: 149).

[000175] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Human T-lymphotropic virus 2 infection in a biological sample from the subject using a LAMP assay comprises using: the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a ninth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an tenth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); an eleventh primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a twelfth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), a thirteenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a fourteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000176] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Human T-lymphotropic virus 2 infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TCACCAAGGTGCCTCTAA (SEQ ID NO: 142), an second primer comprising a nucleic acid sequence of GCAAGGGCCGGAAATCAT (SEQ ID NO: 143), a third primer comprising a nucleic acid sequence of

GCCTGGTGTACAGGACTTCTCCCATCGTTGAAGGTCCAT (SEQ ID NO: 147), a seventh primer comprising a nucleic acid sequence of GGTTGGAACATTGTGGTGG (SEQ ID NO:

148), an eighth primer comprising a nucleic acid sequence of TCCATCTTAACAACCCCAGG (SEQ ID NO: 149); and the step of determining the expression level of at least one gene associated with the Human T-lymphotropic virus 2 infection in a biological sample from the subject using a LAMP assay comprises using: the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a ninth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an tenth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); an eleventh primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a twelfth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), a thirteenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a fourteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24). [000177] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Hepatitis A virus infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TGGATTTCTGACACTCCTTAC (SEQ ID NO: 150), a second primer comprising a nucleic acid sequence of TGTAGTAACATCCATAGCATGA (SEQ ID NO: 151), a third primer comprising a nucleic acid sequence of

AGCTTCCCAATGGCAGTGTACAGAGTGAACAGGTATACAAAGTC (SEQ ID NO: 152), a fourth primer comprising a nucleic acid sequence of

TTGACCTCTCCTTCTAACGTTGCACATTCCAAGTTAATTGCTGAA (SEQ ID NO: 153). [000178] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Hepatitis A virus infection in a biological sample from the subject using a LAMP assay comprises using: a fifth primer comprising a nucleic acid sequence of ACCTTTCTGATGTGC (SEQ ID NO: 154), a sixth primer comprising a nucleic acid sequence of TTCCCATGTCAGAGT (SEQ ID NO: 155). [000179] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Hepatitis A virus infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TGGATTTCTGACACTCCTTAC (SEQ ID NO: 150), a second primer comprising a nucleic acid sequence of TGTAGTAACATCCATAGCATGA (SEQ ID NO: 151), a third primer comprising a nucleic acid sequence of

TTGACCTCTCCTTCTAACGTTGCACATTCCAAGTTAATTGCTGAA (SEQ ID NO: 153), a fifth primer comprising a nucleic acid sequence of ACCTTTCTGATGTGC (SEQ ID NO: 154), a sixth primer comprising a nucleic acid sequence of TTCCCATGTCAGAGT (SEQ ID NO:

155).

[000180] In some embodiments of the method of the disclosure, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000181] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Hepatitis A virus infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TGGATTTCTGACACTCCTTAC (SEQ ID NO: 150), a second primer comprising a nucleic acid sequence of TGTAGTAACATCCATAGCATGA (SEQ ID NO: 151), a third primer comprising a nucleic acid sequence of

TTGACCTCTCCTTCTAACGTTGCACATTCCAAGTTAATTGCTGAA (SEQ ID NO: 153), a fifth primer comprising a nucleic acid sequence of ACCTTTCTGATGTGC (SEQ ID NO: 154), a sixth primer comprising a nucleic acid sequence of TTCCCATGTCAGAGT (SEQ ID NO: 155); and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000182] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Hepatitis B virus infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of CTAGACTCGTGGTGGACTTC (SEQ ID NO: 156), a second primer comprising a nucleic acid sequence of ACAAGAAGATGAGGCATAGCA (SEQ ID NO: 157), a third primer comprising a nucleic acid sequence of

ACTGGAGATTTGGGACTGCCTCAATTTTCTAGGGGGAAC (SEQ ID NO: 158), a fourth primer comprising a nucleic acid sequence of

TGTTGTCCTCCGATTTGTCGCAGGATGCAGAGGAAGA (SEQ ID NO: 159).

[000183] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Hepatitis B virus infection in a biological sample from the subject using a LAMP assay comprises using: a fifth primer comprising a nucleic acid sequence of GAATTTTGGCCAAGACACAC (SEQ ID NO: 160), a sixth primer comprising a nucleic acid sequence of TGTGTCTGCGGCGTT (SEQ ID NO: 161). [000184] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Hepatitis B virus infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of CTAGACTCGTGGTGGACTTC (SEQ ID NO: 156), a second primer comprising a nucleic acid sequence of ACAAGAAGATGAGGCATAGCA (SEQ ID NO: 157), a third primer comprising a nucleic acid sequence of

TGTTGTCCTCCGATTTGTCGCAGGATGCAGAGGAAGA (SEQ ID NO: 159), a fifth primer comprising a nucleic acid sequence of GAATTTTGGCCAAGACACAC (SEQ ID NO: 160), a sixth primer comprising a nucleic acid sequence of TGTGTCTGCGGCGTT (SEQ ID NO: 161). [000185] In some embodiments of the method of the disclosure, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000186] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Hepatitis B virus infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of CTAGACTCGTGGTGGACTTC (SEQ ID NO: 156), a second primer comprising a nucleic acid sequence of ACAAGAAGATGAGGCATAGCA (SEQ ID NO: 157), a third primer comprising a nucleic acid sequence of

TGTTGTCCTCCGATTTGTCGCAGGATGCAGAGGAAGA (SEQ ID NO: 159), a fifth primer comprising a nucleic acid sequence of GAATTTTGGCCAAGACACAC (SEQ ID NO: 160), a sixth primer comprising a nucleic acid sequence of TGTGTCTGCGGCGTT (SEQ ID NO: 161); and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of

[000187] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Hepatitis C virus infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TGGTCTGCGGAACCGG (SEQ ID NO: 162), a second primer comprising a nucleic acid sequence of GGGGCACTCGCAAGCA (SEQ ID NO: 163), a third primer comprising a nucleic acid sequence of

ACGCCCAAATCTCCAGGCATTGTTTTCATTGCCAGGACGACCGG (SEQ ID NO: 164), a fourth primer comprising a nucleic acid sequence of

CCGCGAGACTGCTAGCCGATTTTCCCTATCAGGCAGTA (SEQ ID NO: 165).

[000188] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Hepatitis C virus infection in a biological sample from the subject using a LAMP assay comprises using: a fifth primer comprising a nucleic acid sequence of AGCGGGTTGATCCAAGAAAGGAC (SEQ ID NO: 166), a sixth primer comprising a nucleic acid sequence of TGTTGGGTCGCGAAAGGCC (SEQ ID NO: 167).

[000189] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Hepatitis C virus infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TGGTCTGCGGAACCGG (SEQ ID NO: 162), a second primer comprising a nucleic acid sequence of GGGGCACTCGCAAGCA (SEQ ID NO: 163), a third primer comprising a nucleic acid sequence of

CCGCGAGACTGCTAGCCGATTTTCCCTATCAGGCAGTA (SEQ ID NO: 165), a fifth primer comprising a nucleic acid sequence of AGCGGGTTGATCCAAGAAAGGAC (SEQ ID NO: 166), a sixth primer comprising a nucleic acid sequence of TGTTGGGTCGCGAAAGGCC (SEQ ID NO: 167).

[000190] In some embodiments of the method of the disclosure, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000191] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Hepatitis C virus infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TGGTCTGCGGAACCGG (SEQ ID NO: 162), a second primer comprising a nucleic acid sequence of GGGGCACTCGCAAGCA (SEQ ID NO: 163), a third primer comprising a nucleic acid sequence of

CCGCGAGACTGCTAGCCGATTTTCCCTATCAGGCAGTA (SEQ ID NO: 165), a fifth primer comprising a nucleic acid sequence of AGCGGGTTGATCCAAGAAAGGAC (SEQ ID NO: 166), a sixth primer comprising a nucleic acid sequence of TGTTGGGTCGCGAAAGGCC (SEQ ID NO: 167); and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000192] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Human Papilloma Virus type 16 infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TTACATAATAGATTGGTGGTGTT (SEQ ID NO: 168), a second primer comprising a nucleic acid sequence of

GGTCACGTAGGTCTGTACT (SEQ ID NO: 169), a third primer comprising a nucleic acid sequence of GTCCTTGAGAAAAAGGATTTCCAGTTTCCTAATGAGTTTCC ATTTGA (SEQ ID NO: 170), a fourth primer comprising a nucleic acid sequence of TTAAGTTTGCACGAGGACGAGAGTATTTTGTCCTGACACACA (SEQ ID NO: 171). [000193] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Human Papilloma Virus type 16 infection in a biological sample from the subject using a LAMP assay comprises using: a fifth primer comprising a nucleic acid sequence of TCATTAAGCTCATACACTGG (SEQ ID NO: 172), a sixth primer comprising a nucleic acid sequence of ATGGAGACTCTTTGCCA (SEQ ID NO: 173).

[000194] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Human Papilloma Virus type 16 infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TTACATAATAGATTGGTGGTGTT (SEQ ID NO: 168), a second primer comprising a nucleic acid sequence of

GGTCACGTAGGTCTGTACT (SEQ ID NO: 169), a third primer comprising a nucleic acid sequence of GTCCTTGAGAAAAAGGATTTCCAGTTTCCTAATGAGTTTCC ATTTGA (SEQ ID NO: 170), a fourth primer comprising a nucleic acid sequence of TTAAGTTTGCACGAGGACGAGAGTATTTTGTCCTGACACACA (SEQ ID NO: 171), a fifth primer comprising a nucleic acid sequence of TCATTAAGCTCATACACTGG (SEQ ID NO: 172), a sixth primer comprising a nucleic acid sequence of ATGGAGACTCTTTGCCA (SEQ ID NO: 173).

[000195] In some embodiments of the method of the disclosure, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000196] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Human Papilloma Virus type 16 infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TTACATAATAGATTGGTGGTGTT (SEQ ID NO: 168), a second primer comprising a nucleic acid sequence of

GGTCACGTAGGTCTGTACT (SEQ ID NO: 169), a third primer comprising a nucleic acid sequence of GTCCTTGAGAAAAAGGATTTCCAGTTTCCTAATGAGTTTCC ATTTGA (SEQ ID NO: 170), a fourth primer comprising a nucleic acid sequence of TTAAGTTTGCACGAGGACGAGAGTATTTTGTCCTGACACACA (SEQ ID NO: 171), a fifth primer comprising a nucleic acid sequence of TCATTAAGCTCATACACTGG (SEQ ID NO: 172), a sixth primer comprising a nucleic acid sequence of ATGGAGACTCTTTGCCA (SEQ ID NO: 173); and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000197] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Human Papilloma Virus type 18 infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TACTGGCAGTGGTACAGG (SEQ ID NO: 174), a second primer comprising a nucleic acid sequence of GTGCCAGTAAACGTAGGC (SEQ ID NO: 175), a third primer comprising a nucleic acid sequence of

AGGACC AAC ATCC ACC ACTGGGTCGT AC AGGGT AC ATT C (SEQ ID NO: 176), a fourth primer comprising a nucleic acid sequence of

ACACGTCCCCCAGTGGTTATCCACACTGGAGTCCTCTA (SEQ ID NO: 177),

[000198] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Human Papilloma Virus type 18 infection in a biological sample from the subject using a LAMP assay comprises using: an fifth primer comprising a nucleic acid sequence of TACATTCCATTGGGTGGGC (SEQ ID NO:

178), a sixth primer comprising a nucleic acid sequence of TGTTACATTAATAGAGGA (SEQ ID NO: 179).

[000199] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Human Papilloma Virus type 18 infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TACTGGCAGTGGTACAGG (SEQ ID NO: 174), an second primer comprising a nucleic acid sequence of GTGCCAGTAAACGTAGGC (SEQ ID NO: 175), a third primer comprising a nucleic acid sequence of

ACACGTCCCCCAGTGGTTATCCACACTGGAGTCCTCTA (SEQ ID NO: 177), an fifth primer comprising a nucleic acid sequence of TACATTCCATTGGGTGGGC (SEQ ID NO:

[000200] In some embodiments of the method of the disclosure, the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000201] In some embodiments of the method of the disclosure, the step of determining the expression level of at least one gene associated with the Human Papilloma Virus type 18 infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TACTGGCAGTGGTACAGG (SEQ ID NO: 174), an second primer comprising a nucleic acid sequence of GTGCCAGTAAACGTAGGC (SEQ ID NO: 175), a third primer comprising a nucleic acid sequence of

178), a sixth primer comprising a nucleic acid sequence of TGTTACATTAATAGAGGA (SEQ ID NO: 179); and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24)

[000202] In some embodiments of the method of the disclosure, the LAMP assay is a reverse transcriptase LAMP (RT-LAMP) assay. In some embodiments of the method of the disclosure, the RT-LAMP assay comprises the use of Bacillus Stearothermophilus (Bst) DNA Polymerase.

In some embodiments of the method of the disclosure, the LAMP assay comprises the use of an intercalating DNA dye.

[000203] In some embodiments, the expression level of the at least one gene associated with the infection, and the expression level of 18S RNA, in a biological sample, is determined by measuring the number of cycles of amplification required for the RT-LAMP reaction with the sample to cross a predetermined threshold value of the fluorescence signal (Ct), detected via binding of an intercalating DNA dye into amplified product.

[000204] In some embodiments, presence of an infection in a subject is determined if the Ct value of a LAMP assay for determining the expression level of the at least one gene associated with the infection in the sample from the patient is less than a first predetermined threshold Ct value. In some embodiments, absence of an infection in a subject is determined if the Ct value of a LAMP assay for determining the expression level of the at least one gene associated with the infection in the sample from the patient is greater than a first predetermined threshold Ct value. [000205] In some embodiments, presence of an infection in a subject is determined if a) the Ct value of a LAMP assay for determining the expression level of the at least one gene associated with the infection in the sample from the patient is less than a first predetermined threshold Ct value, and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value. In some embodiments, absence of an infection in a subject is determined if a) the Ct value of a LAMP assay for determining the expression level of the at least one gene associated with the infection in the sample from the patient is greater than a first predetermined threshold Ct value, and b) the Ct value of a LAMP assay for determining the expression level of 18S RNA in the sample from the patient is less than a second predetermined threshold Ct value.

[000206] In some embodiments, the methods of the present disclosure can comprise using a multiplexed LAMP assay. A multiplexed LAMP assay as described herein, can be defined as a LAMP assay designed for observing or quantifying the amplification of multiple target genes simultaneously in the same reaction. In some embodiments, the multiplexed LAMP assay as described herein, comprises using a plurality of probes comprising a different probe for detecting each target gene, such that each probe upon detecting the target gene emits fluorescence at a specific wavelength that is different from the fluorescence emitted by any other probe or plurality of probes.

[000207] In some embodiments, the multiplexed LAMP assay as described herein, can use a plurality of locked nucleotide beacon probes. In some embodiments, each locked nucleotide beacon probe comprises a nucleic acid sequence that binds to amplicon of any one of the target genes, and is conjugated to a quencher and a fluorophore, such that upon binding to the amplicon of the target gene the probe releases the fluorophore which emits fluorescence at a wavelength that is different from the fluorescence emitted by a fluorophore released by another probe upon binding to an amplicon of a different target gene. In some embodiments, fluorophore of each locked nucleotide beacon probe emits fluorescence at a wavelength that is non-overlapping with the wavelength of fluorescence emitted by a fluorophore of the any of the other locked nucleotide beacon probes. In some embodiments, the locked nucleotide beacon probe of the present disclosure can bind to an amplicon of a SARS-CoV-2 ORF1 gene, a SARS-CoV-2 N gene, a SARS-CoV-2 E gene or a 18S RNA, disclosed herein. In a non-limiting example, the fluorophore of the locked nucleotide beacon probe that binds to the amplicon of SARS-CoV-2 ORE1 gene emits fluorescence at a first wavelength, the locked nucleotide beacon probe that binds to the amplicon of SARS-CoV-2 N gene emits fluorescence at a second wavelength, the locked nucleotide beacon probe that binds to the amplicon of SARS-CoV-2 E gene emits fluorescence at a third wavelength, and the locked nucleotide beacon probe that binds to the amplicon of 18S RNA emits fluorescence at a fourth wavelength, wherein the first, second, third and fourth wavelengths are non-overlapping wavelengths.

[000208] In some embodiments, the multiplexed LAMP assay as described herein, can use a plurality of quenched fluorophore probes. In some embodiments, each quenched fluorophore probe comprises a nucleic acid sequence that binds to any one of the target genes, and is conjugated to a quencher and a fluorophore, such that upon binding to the target gene the probe releases the fluorophore which emits fluorescence at a wavelength that is different from the fluorescence emitted by a fluorophore released by another probe upon binding to a different target gene. In some embodiments, fluorophore of each quenched fluorophore probe emits fluorescence at a wavelength that is non-overlapping with the wavelength of fluorescence emitted by a fluorophore of the any of the other quenched fluorophore probes. In some embodiments, the quenched fluorophore probe of the present disclosure can be any one of the primers that bind to a SARS-CoV-2 ORF1 gene, a SARS-CoV-2 N gene, a SARS-CoV-2 E gene or 18S RNA disclosed herein. In a non-limiting example, the quenched fluorophore that binds to the SARS-CoV-2 ORF1 gene emits fluorescence at a first wavelength, the quenched fluorophore probe that binds to the SARS-CoV-2 N gene emits fluorescence at a second wavelength, the quenched fluorophore probe that binds to the SARS-CoV-2 E gene emits fluorescence at a third wavelength, and the quenched fluorophore probe that binds to the 18S RNA emits fluorescence at a fourth wavelength, wherein the first, second, third and fourth wavelengths are non overlapping wavelengths.

[000209] In some embodiments, the fluorophore can be an organic dye, a biological fluorophore, a quantum dot or a tandem dye. In some embodiments, the fluorophore can be fluorescein isothiocyanate (FITC), rhodamine (tetramethyl rhodamine isothiocyanate, TRITC), phycoerythrin (PE), green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), cyan fluorescent protein (CFP), cherry red, phycobiliproteins (allophycocyanin), phycocyanin, phycoerythrin, phycoerythrocyanin, phycoerythrin-Cy7 (PE- Cy7), PerCP-Cy5.5 and Alexa-488.

[000210] The disclosure also provides a kit for detecting the presence or absence of a SARS- CoV-2 infection in a sample from a subject, wherein the kit comprises: a) a test primer mix, wherein the primer mix comprises (i) a set of at least six primers that bind to a SARS-CoV-2 ORF1 gene, a SARS-CoV-2 N gene, or a SARS-CoV-2 E gene or a combination thereof, in the SARS-Cov-2 single strand RNA genome and (ii) a set of at least six primers, wherein the primers bind to 18S RNA; b) enzyme mixture of a reverse transcriptase and a Bst (Bacillus Stearothermophilus) DNA polymerase; c) a fluorescent intercalating DNA dye; and d) a nucleotide mixture.

[000211] In some embodiments of the kit of the disclosure, the test primer mix of (a) comprises a set of eighteen primers that bind to a SARS-CoV-2 ORE 1 gene, a SARS-CoV-2 N gene, or a SARS-CoV-2 E gene or a combination thereof, in the SARS-Cov-2 single strand RNA genome.

[000212] The disclosure also provided a kit for detecting the presence or absence of a SARS- CoV-2 infection in a sample from a subject, wherein the kit comprises: a) a test primer mix, wherein the primer mix comprises (i) a set of at least one primer, or two primers, or three primers, or four primers, or five primers, or six primers selected from SEQ ID NOs: 1-18 of TABLE 1, that bind to a SARS-CoV-2 ORF1 gene, a SARS-CoV-2 N gene, or a SARS-CoV-2 E gene or a combination thereof, in the SARS-Cov-2 single strand RNA genome and (ii) a set of at least at least one primer, or two primers, or three primers, or four primers, or five primers, or six primers selected from SEQ ID NOs: 19-24 of TABLE 1, that bind to 18S RNA; b) enzyme mixture of a reverse transcriptase and a Bst (Bacillus Stearothermophilus) DNA polymerase; c) an intercalating DNA dye; and d) a nucleotide mixture. In some embodiments, any one of the primers can be selected from TABLE 1. In some embodiment of the kit of the disclosure, each primer of the primer mix is any one of the primers of nucleic acid sequence according to SEQ ID NOs: 1-24 from Table 1.

[000213] In some embodiments of the kit of the disclosure, the primer mix further comprises primers that bind to the SARS-CoV-2 N gene of the SARS-CoV-2 single strand RNA genome. In some embodiments of the kit of the disclosure, the primer mix further comprises primers that bind to the SARS-CoV-2 E gene of the SARS-CoV-2 single strand RNA genome. In some embodiments of the kit of the disclosure, the primer mix further comprises primers that bind to the SARS-CoV-2 ORF1 gene of the SARS-CoV-2 single strand RNA genome.

[000214] In some embodiments of the kit of the disclosure, the primer mix comprises a first primer comprising a nucleic acid sequence of ACCAGGAACTAATCAGACAAG (SEQ ID NO: 1), a second primer comprising a nucleic acid sequence of

GACTTGATCTTTGAAATTTGGATCT (SEQ ID NO: 2); a third primer comprising a nucleic acid sequence of TTCCGAAGAACGCTGAAGCGGAACTGATTACAAACATTGGCC (SEQ ID NO: 3); a fourth primer comprising a nucleic acid sequence of CGC ATT GGC ATGGAAGTC AC AATTT GAT GGC ACCTGTGT A (SEQ ID NO: 4).

[000215] In some embodiments of the kit of the disclosure, the primer mix comprises a fifth primer comprising a nucleic acid sequence of GGGGGCAAATTGTGCAATTTG (SEQ ID NO: 5), a sixth primer comprising a nucleic acid sequence of CTTCGGGAACGTGGTTGACC (SEQ ID NO: 6).

[000216] In some embodiments of the kit of the disclosure, the primer mix comprises a seventh primer comprising a nucleic acid sequence of TGAGTACGAACTTATGTACTCAT (SEQ ID NO: 7); an eighth primer comprising a nucleic acid sequence of

TTCAGATTTTTAACACGAGAGT (SEQ ID NO: 8); a ninth primer comprising a nucleic acid sequence of ACCACGAAAGCAAGAAAAAGAAGTTCGTTTCGGAAGAGACAG (SEQ ID NO: 9); a tenth primer comprising a nucleic acid sequence of

TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT (SEQ ID NO: 10). [000217] In some embodiments of the kit of the disclosure, the primer mix comprises an eleventh primer comprising a nucleic acid sequence of CGCTATTAACTATTAACG (SEQ ID NO: 11); a twelfth primer comprising a nucleic acid sequence of CGCGCTTCGATTGTGTGCGT (SEQ ID NO: 12).

[000218] In some embodiments of the kit of the disclosure, the primer mix comprises a thirteenth primer comprising a nucleic acid sequence of CGGTGGACAAATTGTCAC (SEQ ID NO: 13); a fourteenth primer comprising a nucleic acid sequence of

CTTCTCTGGATTTAACACACTT (SEQ ID NO: 14); a fifteenth primer comprising a nucleic acid sequence of

TATTGGTGGAGCTAAACTTAAAGCCTTTTCTGTACAATCCCTTTGAGTG (SEQ ID NO: 16).

[000219] In some embodiments of the kit of the disclosure, the primer mix comprises a seventeenth primer comprises a seventeenth nucleic acid sequence of TTACAAGCTTAAAGAATGTCTGAACACT (SEQ ID NO: 17); an eighteenth primer comprising a nucleic acid sequence of TTGAATTTAGGTGAAACATTTGTCACG (SEQ ID NO: 18).

[000220] In some embodiments of the kit of the disclosure, the primer mix comprises a primer comprises a nineteenth nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); a twentieth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a twenty-first primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a twenty-second primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22). In some embodiments of the kit of the disclosure, the primer mix comprises a twenty-third primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23); and a twenty-fourth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000221] In some embodiments of the kit of the disclosure, the set of primers that bind to a SARS-CoV-2 ORF1 gene, a SARS-CoV-2 N gene, or a SARS-CoV-2 E gene or a combination thereof comprises a first primer comprising a nucleic acid sequence of

ACCAGGAACTAATCAGACAAG (SEQ ID NO: 1); a second primer comprising a nucleic acid sequence of GACTTGATCTTTGAAATTTGGATCT (SEQ ID NO: 2); a third primer comprising a nucleic acid sequence of

TCAGCACACAAAGCCAAAAATTTATTTTTCTGTGCAAAGGAAATTAAGGAG (SEQ ID NO: 15); a sixteenth primer comprising a nucleic acid sequence of TATTGGTGGAGCTAAACTTAAAGCCTTTTCTGTACAATCCCTTTGAGTG (SEQ ID NO: 16); a seventeenth primer comprising a nucleic acid sequence of

TTACAAGCTTAAAGAATGTCTGAACACT (SEQ ID NO: 17), and an eighteenth primer comprising a nucleic acid sequence of TTGAATTTAGGTGAAACATTTGTCACG (SEQ ID NO: 18).

[000222] In some embodiments of the kit of the disclosure, the set of primers that bind to a SARS-CoV-2 ORF1 gene, a SARS-CoV-2 N gene, or a SARS-CoV-2 E gene or a combination thereof comprises a first primer comprising a nucleic acid sequence of

TATTGGTGGAGCTAAACTTAAAGCCTTTTCTGTACAATCCCTTTGAGTG (SEQ ID NO: 16); a seventeenth primer comprising a nucleic acid sequence of TTACAAGCTTAAAGAATGTCTGAACACT (SEQ ID NO: 17), an eighteenth primer comprising a nucleic acid sequence of TTGAATTTAGGTGAAACATTTGTCACG (SEQ ID NO: 18); and wherein the set of primers that bind to 18S RNA thereof comprises a nineteenth nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); a twentieth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a twenty-first primer comprising a nucleic acid sequence of

TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a twenty-second primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22); and a twenty-third primer comprising a nucleic acid sequence of

AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23); and a twenty-fourth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24). As used herein the term subject is meant to include any human subject [000223] The disclosure also provided a kit for detecting the presence or absence of an infection in a sample from a subject, wherein the kit comprises: a) a test primer mix, wherein the primer mix comprises (i) a set of at least six primers that bind to at least one gene, in the genome of the biological agent causing the infection, and (ii) a set of at least six primers, wherein the primers bind to 18S RNA; b) enzyme mixture of a reverse transcriptase and a Bst (Bacillus Stearothermophilus) DNA polymerase; c) an intercalating DNA dye; and d) a nucleotide mixture.

[000224] In some embodiments of the kit of the disclosure, the infection is an influenza A infection. In some embodiments of the kit of the disclosure, the infection is an influenza B infection. In some embodiments of the kit of the disclosure, the infection is a respiratory syncytial virus A infection. In some embodiments of the kit of the disclosure, the infection is a respiratory syncytial virus B infection. In some embodiments of the kit of the disclosure, the infection is a gonorrhea infection. In some embodiments of the kit of the disclosure, the infection is a chlamydia infection. In some embodiments of the kit of the disclosure, the infection is a trichomoniasis infection. In some embodiments of the kit of the disclosure, the infection is a herpes simplex 1 infection. In some embodiments of the kit of the disclosure, the infection is a herpes simplex 2 infection. In some embodiments of the kit of the disclosure, the infection is a syphilis infection. In some embodiments of the kit of the disclosure, the infection is a Gardnerella vaginalis infection. In some embodiments of the kit of the disclosure, the infection is a Candida albicans infection. In some embodiments of the kit of the disclosure, the infection is a Mycoplasma genitalium infection. In some embodiments of the kit of the disclosure, the infection is a Mycobacterium tuberculosis infection. In some embodiments of the kit of the disclosure, the infection is a Ureaplasma parvum infection. In some embodiments of the kit of the disclosure, the infection is a Human T-lymphotropic virus infection. In some embodiments of the kit of the disclosure, the infection is a Hepatitis A virus infection. In some embodiments of the kit of the disclosure, the infection is a Hepatitis B virus infection. In some embodiments of the kit of the disclosure, the infection is a Hepatitis C virus infection. In some embodiments of the kit of the disclosure, the infection is a Human Papilloma Virus type 16 infection. In some embodiments of the kit of the disclosure, the infection is a Human Papilloma Virus type 18 infection.

[000225] In some embodiment of the kit of the disclosure, each primer of the primer mix is any one of the primers of nucleic acid sequence according to SEQ ID NOs: 19-24 from Table 1 and SEQ ID NOs: 25-179 from Table 2.

[000226] In some embodiments of the kit of the disclosure, wherein the infection is an influenza A infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of GACTTGAAGATGTCTTTGC (SEQ ID NO: 25), a second primer comprising a nucleic acid sequence of TRTTATTTGGGTCTCCATT (SEQ ID NO: 26), a third primer comprising a nucleic acid sequence of

TTGTKTTCACGCTCACCGTGTTTGGACAAAGCGTCTACG (SEQ ID NO: 28).

[000227] In some embodiments of the kit of the disclosure, wherein the infection is an influenza A infection, the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of GTCTTGTCTTTAGCCA (SEQ ID NO: 29), a sixth primer comprising a nucleic acid sequence of CMAGTGAGCGAGGACTG (SEQ ID NO: 30). [000228] In some embodiments of the kit of the disclosure, wherein the infection is an influenza A infection, the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GACTGGAAAGTGTCTTTGC (SEQ ID NO: 31), an eighth primer comprising a nucleic acid sequence of TRTTGTTTGGGTCCCCATT (SEQ ID NO: 32). [000229] In some embodiments of the kit of the disclosure, wherein the infection is an influenza A infection, the test primer mix further comprises: a first primer comprising a nucleic acid sequence of GACTTGAAGATGTCTTTGC (SEQ ID NO: 25), a second primer comprising a nucleic acid sequence of TRTTATTTGGGTCTCCATT (SEQ ID NO: 26), a third primer comprising a nucleic acid sequence of

[000230] In some embodiments of the kit of the disclosure, wherein the infection is an influenza A infection, the test primer mix further comprises: a ninth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); a tenth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); an eleventh primer comprising a nucleic acid sequence of

[000231] In some embodiments of the kit of the disclosure, wherein the infection is an influenza A infection, the test primer mix further comprises: (i) a first primer comprising a nucleic acid sequence of GACTTGAAGATGTCTTTGC (SEQ ID NO: 25), a second primer comprising a nucleic acid sequence of TRTTATTTGGGTCTCCATT (SEQ ID NO: 26), a third primer comprising a nucleic acid sequence of

TTGTKTTCACGCTCACCGTGTTTGGACAAAGCGTCTACG (SEQ ID NO: 28), a fifth primer comprising a nucleic acid sequence of GTCTTGTCTTTAGCCA (SEQ ID NO: 29), a sixth primer comprising a nucleic acid sequence of CMAGTGAGCGAGGACTG (SEQ ID NO: 30), a seventh primer comprising a nucleic acid sequence of GACTGGAAAGTGTCTTTGC (SEQ ID NO: 31), an eighth primer comprising a nucleic acid sequence of TRTTGTTTGGGTCCCCATT (SEQ ID NO: 32), a ninth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), a tenth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), an eleventh primer comprising a nucleic acid sequence of

TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21), a twelfth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), a thirteenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), and a fourteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000232] In some embodiments of the kit of the disclosure, wherein the infection is an influenza B infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of GCAACCAATGCCACCATA (SEQ ID NO: 33), a second primer comprising a nucleic acid sequence of TTCTCTCTTCAAGRGACATC (SEQ ID NO: 34), a third primer comprising a nucleic acid sequence of

CAAGACCGCCTAAACAGACTAAACTTTTACTTTCAGGCTCACTT TGAAAGYCTTTCATAGCAC (SEQ ID NO: 36). [000233] In some embodiments of the kit of the disclosure, wherein the infection is an influenza B infection, the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of TGAAAGYCTTTCATAGCAC (SEQ ID NO: 37), a sixth primer comprising a nucleic acid sequence of CAAGAATAAAGACTCACAAC (SEQ ID NO: 38).

[000234] In some embodiments of the kit of the disclosure, wherein the infection is an influenza B infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of GCAACCAATGCCACCATA (SEQ ID NO: 33), a second primer comprising a nucleic acid sequence of TTCTCTCTTCAAGRGACATC (SEQ ID NO: 34), a third primer comprising a nucleic acid sequence of

[000235] In some embodiments of the kit of the disclosure, wherein the infection is an influenza B infection, the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000236] In some embodiments of the kit of the disclosure, wherein the infection is an influenza B infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of GCAACCAATGCCACCATA (SEQ ID NO: 33), a second primer comprising a nucleic acid sequence of TTCTCTCTTCAAGRGACATC (SEQ ID NO: 34), a third primer comprising a nucleic acid sequence of

CAAGACCGCCTAAACAGACTAAACTTTTACTTTCAGGCTCACTT TGAAAGYCTTTCATAGCAC (SEQ ID NO: 36), a fifth primer comprising a nucleic acid sequence of TGAAAGYCTTTCATAGCAC (SEQ ID NO: 37), a sixth primer comprising a nucleic acid sequence of CAAGAATAAAGACTCACAAC (SEQ ID NO: 38), a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), and an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000237] In some embodiments of the kit of the disclosure, wherein the infection is an respiratory syncytial virus A infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of GAGTTGAAGGGATTTTTGCA (SEQ ID NO: 39), a second primer comprising a nucleic acid sequence of TGGGTTGTTCAATATATGGTAGA (SEQ ID NO: 40), a third primer comprising a nucleic acid sequence of

C A AGC AGA A AT GGA AC A AGTT GT GC T GC TTC TC C ACC C A ATT (SEQ ID NO: 42). [000238] In some embodiments of the kit of the disclosure, wherein the infection is an respiratory syncytial virus A infection, the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of GAGGTGTATGAGTATGCTCAGA (SEQ ID NO: 43), a sixth primer comprising a nucleic acid sequence of CACCGTAACATCACTTG (SEQ ID NO: 44). [000239] In some embodiments of the kit of the disclosure, wherein the infection is an respiratory syncytial virus A infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of GAGTTGAAGGGATTTTTGCA (SEQ ID NO: 39), a second primer comprising a nucleic acid sequence of TGGGTTGTTCAATATATGGTAGA (SEQ ID NO: 40), a third primer comprising a nucleic acid sequence of

[000240] In some embodiments of the kit of the disclosure, wherein the infection is an respiratory syncytial virus A infection, the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000241] In some embodiments of the kit of the disclosure, wherein the infection is an respiratory syncytial virus A infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of GAGTTGAAGGGATTTTTGCA (SEQ ID NO: 39), a second primer comprising a nucleic acid sequence of TGGGTTGTTCAATATATGGTAGA (SEQ ID NO: 40), a third primer comprising a nucleic acid sequence of

CAAGCAGAAATGGAACAAGTTGTGCTGCTTCTCCACCCAATT (SEQ ID NO: 42), a fifth primer comprising a nucleic acid sequence of GAGGTGTATGAGTATGCTCAGA (SEQ ID NO: 43), a sixth primer comprising a nucleic acid sequence of CACCGTAACATCACTTG (SEQ ID NO: 44), a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000242] In some embodiments of the kit of the disclosure, wherein the infection is an respiratory syncytial virus B infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of TGACATCAGAAATACAAGTCAAT (SEQ ID NO: 45), a second primer comprising a nucleic acid sequence of CGTTTTTTAAGACATTGTTTGCC (SEQ ID NO: 46), a third primer comprising a nucleic acid sequence of

GCTGCCCTTGTAATAACCAAATTAGCTCCTAATTACTGCAGTAAGACC (SEQ ID NO: 48).

[000243] In some embodiments of the kit of the disclosure, wherein the infection is an respiratory syncytial virus B infection, the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of CAGCAGGAGATAGATCA (SEQ ID NO: 49), a sixth primer comprising a nucleic acid sequence of GAGCCACTTCTCCCATC (SEQ ID NO: 50). [000244] In some embodiments of the kit of the disclosure, wherein the infection is an respiratory syncytial virus B infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of TGACATCAGAAATACAAGTCAAT (SEQ ID NO: 45), a second primer comprising a nucleic acid sequence of CGTTTTTTAAGACATTGTTTGCC (SEQ ID NO: 46), a third primer comprising a nucleic acid sequence of

GCTGCCCTTGTAATAACCAAATTAGCTCCTAATTACTGCAGTAAGACC (SEQ ID NO: 48), a fifth primer comprising a nucleic acid sequence of CAGCAGGAGATAGATCA (SEQ ID NO: 49), a sixth primer comprising a nucleic acid sequence of GAGCCACTTCTCCCATC (SEQ ID NO: 50).

[000245] In some embodiments of the kit of the disclosure, wherein the infection is an respiratory syncytial virus B infection, the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000246] In some embodiments of the kit of the disclosure, wherein the infection is an respiratory syncytial virus B infection, the test primer mix further comprises: a first primer comprising a nucleic acid sequence of TGACATCAGAAATACAAGTCAAT (SEQ ID NO: 45), a second primer comprising a nucleic acid sequence of CGTTTTTTAAGACATTGTTTGCC (SEQ ID NO: 46), a third primer comprising a nucleic acid sequence of C ATCC C AC AGT C T GGAGA AT C A AGA A AGTCCT AC A A A A A A AT GC (SEQ ID NO: 47), a fourth primer comprising a nucleic acid sequence of

GCTGCCCTTGTAATAACCAAATTAGCTCCTAATTACTGCAGTAAGACC (SEQ ID NO: 48), a fifth primer comprising a nucleic acid sequence of CAGCAGGAGATAGATCA (SEQ ID NO: 49), a sixth primer comprising a nucleic acid sequence of GAGCCACTTCTCCCATC (SEQ ID NO: 50), a seventh primer comprising a nucleic acid sequence of

GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), and an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), and a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000247] In some embodiments of the kit of the disclosure, wherein the infection is gonorrhoeae infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of CCATTGATCCTTGGGACAG (SEQ ID NO: 51), a second primer comprising a nucleic acid sequence of CAGACCGGCATAATACACAT (SEQ ID NO: 52), a third primer comprising a nucleic acid sequence of

AGCGGCAGCATTCAATTTGTTCCTGATTACTTTCCAGCGTGA (SEQ ID NO: 54). [000248] In some embodiments of the kit of the disclosure, wherein the infection is gonorrhoeae infection, the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of ATACCGTCGTGGCGTTTG (SEQ ID NO: 55), a sixth primer comprising a nucleic acid sequence of CGCCTATACGCCTGCTAC (SEQ ID NO: 56).

[000249] In some embodiments of the kit of the disclosure, wherein the infection is gonorrhoeae infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of CCATTGATCCTTGGGACAG (SEQ ID NO: 51), a second primer comprising a nucleic acid sequence of CAGACCGGCATAATACACAT (SEQ ID NO: 52), a third primer comprising a nucleic acid sequence of

[000250] In some embodiments of the kit of the disclosure, wherein the infection is gonorrhoeae infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of CCATTGATCCTTGGGACAG (SEQ ID NO: 51), a second primer comprising a nucleic acid sequence of CAGACCGGCATAATACACAT (SEQ ID NO: 52), a third primer comprising a nucleic acid sequence of

[000251] In some embodiments of the kit of the disclosure, wherein the infection is gonorrhoeae infection, the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000252] In some embodiments of the kit of the disclosure, wherein the infection is gonorrhoeae infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of CCATTGATCCTTGGGACAG (SEQ ID NO: 51), a second primer comprising a nucleic acid sequence of CAGACCGGCATAATACACAT (SEQ ID NO: 52), a third primer comprising a nucleic acid sequence of

AGCGGCAGCATTCAATTTGTTCCTGATTACTTTCCAGCGTGA (SEQ ID NO: 54), a fifth primer comprising a nucleic acid sequence of ATACCGTCGTGGCGTTTG (SEQ ID NO: 55), a sixth primer comprising a nucleic acid sequence of CGCCTATACGCCTGCTAC (SEQ ID NO: 56), a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), and a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000253] In some embodiments of the kit of the disclosure, wherein the infection is chlamydia infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of AATATCATCTTTGCGGTTGC (SEQ ID NO: 57), a second primer comprising a nucleic acid sequence of TCTACAAGAGTACATCGGTCA (SEQ ID NO: 58), a third primer comprising a nucleic acid sequence of TCGAGCAACCGCTGTGACGACCTTCATTATGTCGGAGTC (SEQ ID NO: 59), a fourth primer comprising a nucleic acid sequence of GC AGC TT GT AGT C C TGC TT G AGGG AGC G AGT T AC G A AG A (SEQ ID NO: 60).

[000254] In some embodiments of the kit of the disclosure, wherein the infection is chlamydia infection, the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of TACAAACGCCTAGGGTGC (SEQ ID NO: 61), a sixth primer comprising a nucleic acid sequence of GTTAAGGCAAATCGCCCG (SEQ ID NO: 62).

[000255] In some embodiments of the kit of the disclosure, wherein the infection is chlamydia infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of AATATCATCTTTGCGGTTGC (SEQ ID NO: 57), a second primer comprising a nucleic acid sequence of TCTACAAGAGTACATCGGTCA (SEQ ID NO: 58), a third primer comprising a nucleic acid sequence of TCGAGCAACCGCTGTGACGACCTTCATTATGTCGGAGTC (SEQ ID NO: 59), a fourth primer comprising a nucleic acid sequence of GC AGC TT GT AGTCC T GCTT GAGGGAGC GAGTT AC GA AGA (SEQ ID NO: 60), a fifth primer comprising a nucleic acid sequence of TACAAACGCCTAGGGTGC (SEQ ID NO: 61), a sixth primer comprising a nucleic acid sequence of GTTAAGGCAAATCGCCCG (SEQ ID NO: 62). [000256] In some embodiments of the kit of the disclosure, wherein the infection is chlamydia infection, the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000257] In some embodiments of the kit of the disclosure, wherein the infection is chlamydia infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of AATATCATCTTTGCGGTTGC (SEQ ID NO: 57), a second primer comprising a nucleic acid sequence of TCTACAAGAGTACATCGGTCA (SEQ ID NO: 58), a third primer comprising a nucleic acid sequence of TCGAGCAACCGCTGTGACGACCTTCATTATGTCGGAGTC (SEQ ID NO: 59), a fourth primer comprising a nucleic acid sequence of GC AGC TT GT AGTCC T GCTT GAGGGAGC GAGTT AC GA AGA (SEQ ID NO: 60), a fifth primer comprising a nucleic acid sequence of TACAAACGCCTAGGGTGC (SEQ ID NO: 61), a sixth primer comprising a nucleic acid sequence of GTTAAGGCAAATCGCCCG (SEQ ID NO: 62), a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24). [000258] In some embodiments of the kit of the disclosure, wherein the infection is trichomoniasis infection, the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of CTTGATGTCACGAACGATTTCCTTT (SEQ ID NO: 67), a sixth primer comprising a nucleic acid sequence of TACAGACTCCTCCATCAACGT (SEQ ID NO: 68).

[000259] In some embodiments of the kit of the disclosure, wherein the infection is trichomoniasis infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of GCTTCTCACAGAGCGTGG (SEQ ID NO: 63), a second primer comprising a nucleic acid sequence of GCTCATTGCCGATTGTGATG (SEQ ID NO: 64), a third primer comprising a nucleic acid sequence of

[000260] In some embodiments of the kit of the disclosure, wherein the infection is trichomoniasis infection, the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000261] In some embodiments of the kit of the disclosure, wherein the infection is trichomoniasis infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of GCTTCTCACAGAGCGTGG (SEQ ID NO: 63), a second primer comprising a nucleic acid sequence of GCTCATTGCCGATTGTGATG (SEQ ID NO: 64), a third primer comprising a nucleic acid sequence of

TACAGACTCCTCCATCAACGT (SEQ ID NO: 68), a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000262] In some embodiments of the kit of the disclosure, wherein the infection is herpes simplex 1 infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of GCCGTTGTTCCCATTATCCC (SEQ ID NO: 69), a second primer comprising a nucleic acid sequence of TACTTGGCATGGGGGGTG (SEQ ID NO: 70), a third primer comprising a nucleic acid sequence of

GGTCGTCCCTCGCATGAAGCGGCGTGGTAAGGCTGATG (SEQ ID NO: 72).

[000263] In some embodiments of the kit of the disclosure, wherein the infection is herpes simplex 1 infection, the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of TTGGTGGGAACCCCCGATAC (SEQ ID NO:73), a sixth primer comprising a nucleic acid sequence of AACATGACCCAGACCGGCAC (SEQ ID NO: 74). [000264] In some embodiments of the kit of the disclosure, wherein the infection is herpes simplex 1 infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of GCCGTTGTTCCCATTATCCC (SEQ ID NO: 69), a second primer comprising a nucleic acid sequence of TACTTGGCATGGGGGGTG (SEQ ID NO: 70), a third primer comprising a nucleic acid sequence of

[000265] In some embodiments of the kit of the disclosure, wherein the infection is herpes simplex 1 infection, the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000266] In some embodiments of the kit of the disclosure, wherein the infection is herpes simplex 1 infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of GCCGTTGTTCCCATTATCCC (SEQ ID NO: 69), a second primer comprising a nucleic acid sequence of TACTTGGCATGGGGGGTG (SEQ ID NO: 70), a third primer comprising a nucleic acid sequence of

GGT C GT C C C TC GC AT G A AGC GGC GT GGT A AGGC T GAT G (SEQ ID NO: 72), a fifth primer comprising a nucleic acid sequence of TTGGTGGGAACCCCCGATAC (SEQ ID NO:73), a sixth primer comprising a nucleic acid sequence of AACATGACCCAGACCGGCAC (SEQ ID NO: 74), a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), and a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000267] In some embodiments of the kit of the disclosure, wherein the infection is herpes simplex 2 infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of TCAGCCCATCCTCCTTCG (SEQ ID NO: 75), a second primer comprising a nucleic acid sequence of CCCACCTCTACCCACAAC (SEQ ID NO: 76), a third primer comprising a nucleic acid sequence of

AAATGCTTCCCTGCTGGTGCCCGCCGAGTTCGATCTGGT (SEQ ID NO: 78).

[000268] In some embodiments of the kit of the disclosure, wherein the infection is herpes simplex 2 infection, the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of CACGTCTTTGGGGACGGCGGC (SEQ ID NO: 79), a sixth primer comprising a nucleic acid sequence of ATCTGGGACCGCGCCGCGGAGAC (SEQ ID NO:

80).

[000269] In some embodiments of the kit of the disclosure, wherein the infection is herpes simplex 2 infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of TCAGCCCATCCTCCTTCG (SEQ ID NO: 75), a second primer comprising a nucleic acid sequence of CCCACCTCTACCCACAAC (SEQ ID NO: 76), a third primer comprising a nucleic acid sequence of

[000270] In some embodiments of the kit of the disclosure, wherein the infection is herpes simplex 2 infection, the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000271] In some embodiments of the kit of the disclosure, wherein the infection is herpes simplex 2 infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of TCAGCCCATCCTCCTTCG (SEQ ID NO: 75), a second primer comprising a nucleic acid sequence of CCCACCTCTACCCACAAC (SEQ ID NO: 76), a third primer comprising a nucleic acid sequence of

ATCTGGGACCGCGCCGCGGAGAC (SEQ ID NO: 80), a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of

[000272] In some embodiments of the kit of the disclosure, wherein the infection is syphilis infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of TGCAGTCTTTTTTTGTGCGG (SEQ ID NO: 81), a second primer comprising a nucleic acid sequence of TCAAATCATTGGTGGTGCGA (SEQ ID NO: 82), a third primer comprising a nucleic acid sequence of CTGCGGGGC A ATGCCT AGCTGCTCCCGGGGTTT GG (SEQ ID NO: 83), a fourth primer comprising a nucleic acid sequence of GTAACTGGTCACGCCCAGCTGCCCGTGCGTGTACTCGTTC (SEQ ID NO: 84).

[000273] In some embodiments of the kit of the disclosure, wherein the infection is syphilis infection, the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of AGAAAAAACGGGCAGTGCG (SEQ ID NO: 85), a sixth primer comprising a nucleic acid sequence of GGGGCATTAAGTTTAAAAAGAACCC (SEQ ID NO: 86).

[000274] In some embodiments of the kit of the disclosure, wherein the infection is syphilis infection, the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of TCCCTCGAGACTCGATTCC (SEQ ID NO: 87), an eighth primer comprising a nucleic acid sequence of GTACGCATCTGTCGGTAGC (SEQ ID NO: 88).

[000275] In some embodiments of the kit of the disclosure, wherein the infection is syphilis infection, the test primer mix further comprises: a ninth primer comprising a nucleic acid sequence of CCACCCCCCTTCTGTGCAACCATCCTTCTGATGCGTCAGC (SEQ ID NO:

89), a tenth primer comprising a nucleic acid sequence of

GTGCTTTTCGGGAGGATTCCCGAGTGCACTGCGCTCATCT (SEQ ID NO: 90).

[000276] In some embodiments of the kit of the disclosure, wherein the infection is syphilis infection, the test primer mix further comprises: a eleventh primer comprising a nucleic acid sequence of TTCCGCGTTCGGTGCTC (SEQ ID NO: 91), a twelfth primer comprising a nucleic acid sequence of CTTTCGGGACGATGAGATAATGC (SEQ ID NO: 92). [000277] In some embodiments of the kit of the disclosure, wherein the infection is syphilis infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of TGCAGTCTTTTTTTGTGCGG (SEQ ID NO: 81), a second primer comprising a nucleic acid sequence of TCAAATCATTGGTGGTGCGA (SEQ ID NO: 82), a third primer comprising a nucleic acid sequence of CTGCGGGGC A ATGCCT AGCTGCTCCCGGGGTTT GG (SEQ ID NO: 83), a fourth primer comprising a nucleic acid sequence of

GTGCTTTTCGGGAGGATTCCCGAGTGCACTGCGCTCATCT (SEQ ID NO: 90), a eleventh primer comprising a nucleic acid sequence of TTCCGCGTTCGGTGCTC (SEQ ID NO: 91), and a twelfth primer comprising a nucleic acid sequence of CTTTCGGGACGATGAGATAATGC (SEQ ID NO: 92).

[000278] In some embodiments of the kit of the disclosure, wherein the infection is syphilis infection, the test primer mix further comprises: a thirteenth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an fourteenth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a fifteenth primer comprising a nucleic acid sequence of

AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), and a eighteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24) [000279] In some embodiments of the kit of the disclosure, wherein the infection is syphilis infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of TGCAGTCTTTTTTTGTGCGG (SEQ ID NO: 81), a second primer comprising a nucleic acid sequence of TCAAATCATTGGTGGTGCGA (SEQ ID NO: 82), a third primer comprising a nucleic acid sequence of CTGCGGGGC A ATGCCT AGCTGCTCCCGGGGTTT GG (SEQ ID NO: 83), a fourth primer comprising a nucleic acid sequence of

GTGCTTTTCGGGAGGATTCCCGAGTGCACTGCGCTCATCT (SEQ ID NO: 90), a eleventh primer comprising a nucleic acid sequence of TTCCGCGTTCGGTGCTC (SEQ ID NO: 91), and a twelfth primer comprising a nucleic acid sequence of CTTTCGGGACGATGAGATAATGC (SEQ ID NO: 92), a thirteenth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an fourteenth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a fifteenth primer comprising a nucleic acid sequence of

AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), and an eighteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000280] In some embodiments of the kit of the disclosure, wherein the infection is Gardnerella vaginalis, the test primer mix comprises: a first primer comprising a nucleic acid sequence of CGGGTTGATATTCCCGTACC (SEQ ID NO: 93), a second primer comprising a nucleic acid sequence of ACATCCCCCGGATTTACCT (SEQ ID NO: 94), a third primer comprising a nucleic acid sequence of

[000281] In some embodiments of the kit of the disclosure, wherein the infection is

Gardnerella vaginalis , the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of ATGAAGGTTAGTACTCTCAGATT (SEQ ID NO: 99), an eighth primer comprising a nucleic acid sequence of ACGAAGGTTAGTACTCTCAGATT (SEQ ID NO: 100), a ninth primer comprising a nucleic acid sequence of

ATCAAGGTTAGTACTCTCAGATT (SEQ ID NO: 101), a tenth primer comprising a nucleic acid sequence of CGGCTGCGGAGGTGGTTTT (SEQ ID NO: 102).

[000282] In some embodiments of the kit of the disclosure, wherein the infection is

Gardnerella vaginalis , the test primer mix comprises: a first primer comprising a nucleic acid sequence of CGGGTTGATATTCCCGTACC (SEQ ID NO: 93), a second primer comprising a nucleic acid sequence of ACATCCCCCGGATTTACCT (SEQ ID NO: 94), a third primer comprising a nucleic acid sequence of

[000283] In some embodiments of the kit of the disclosure, wherein the infection is

Gardnerella vaginalis , the test primer mix further comprises: an eleventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an twelfth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a thirteenth primer comprising a nucleic acid sequence of

TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a fourteenth primer comprising a nucleic acid sequence of

[000284] In some embodiments of the kit of the disclosure, wherein the infection is

ATGAAGGTTAGTACTCTCAGATT (SEQ ID NO: 99), an eighth primer comprising a nucleic acid sequence of ACGAAGGTTAGTACTCTCAGATT (SEQ ID NO: 100), a ninth primer comprising a nucleic acid sequence of ATCAAGGTTAGTACTCTCAGATT (SEQ ID NO: 101), a tenth primer comprising a nucleic acid sequence of CGGCTGCGGAGGTGGTTTT (SEQ ID NO: 102), an eleventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an twelfth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a thirteenth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a fourteenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), a fifteenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a sixteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000285] In some embodiments of the kit of the disclosure, wherein the infection is Candida albicans the test primer mix comprises: a first primer comprising a nucleic acid sequence of CAATGGAAAGACCCTTCTCAA (SEQ ID NO: 103), a second primer comprising a nucleic acid sequence of GTGGGACTAAGATATAAATTGACTT (SEQ ID NO: 104), a third primer AGGTT T C GT C GT AT G A AGT GGT ATT C T GAT G A AG AT AC A A AT GC T (SEQ ID NO: 105), a fourth primer comprising a nucleic acid sequence of

C AACGAAGT C AATCTGGAACC AAAATTGCTGAA ATTTTCGT G (SEQ ID NO: 106). [000286] In some embodiments of the kit of the disclosure, wherein the infection is Candida albicans the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of GGTGTTGGTGGAACTGA (SEQ ID NO: 107), a sixth primer comprising a nucleic acid sequence of GAGGCATTGACAGATATGAA (SEQ ID NO: 108).

[000287] In some embodiments of the kit of the disclosure, wherein the infection is Candida albicans the test primer mix comprises: a first primer comprising a nucleic acid sequence of CAATGGAAAGACCCTTCTCAA (SEQ ID NO: 103), a second primer comprising a nucleic acid sequence of GTGGGACTAAGATATAAATTGACTT (SEQ ID NO: 104), a third primer AGGTT T C GT C GT AT G A AGT GGT ATT C T GAT G A AG AT AC A A AT GC T (SEQ ID NO: 105), a fourth primer comprising a nucleic acid sequence of

[000288] In some embodiments of the kit of the disclosure, wherein the infection is

Candida albicans the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000289] In some embodiments of the kit of the disclosure, wherein the infection is

Candida albicans the test primer mix comprises: a first primer comprising a nucleic acid sequence of CAATGGAAAGACCCTTCTCAA (SEQ ID NO: 103), a second primer comprising a nucleic acid sequence of GTGGGACTAAGATATAAATTGACTT (SEQ ID NO: 104), a third primer AGGTT T C GT C GT AT G A AGT GGT ATT C T GAT G A AG AT AC A A AT GC T (SEQ ID NO: 105), a fourth primer comprising a nucleic acid sequence of

C AACGAAGT C AATCTGGAACC AAAATTGCTGAA ATTTTCGT G (SEQ ID NO: 106), a fifth primer comprising a nucleic acid sequence of GGTGTTGGTGGAACTGA (SEQ ID NO: 107), a sixth primer comprising a nucleic acid sequence of GAGGCATTGACAGATATGAA (SEQ ID NO: 108), a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000290] In some embodiments of the kit of the disclosure, wherein the infection is Mycoplasma genitalia the test primer mix comprises: a first primer comprising a nucleic acid sequence of TGGTCACTTCACTCCCTAA (SEQ ID NO: 109), a second primer comprising a nucleic acid sequence of ACAACACAACTTACACCACTA (SEQ ID NO: 110), a third primer comprising a nucleic acid sequence of

CATTGACTCAACCCAAGCTTTGGACTCAACCCCAATCACAC (SEQ ID NO: 111), a fourth primer comprising a nucleic acid sequence of

GTGCTTTTTCAAACCCTGGTAAAGTACAACATTATTGTTGCAACCG (SEQ ID NO:

112).

[000291] In some embodiments of the kit of the disclosure, wherein the infection is Mycoplasma genitalia the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of GAAGTTTGTTGTAGTTGGGGGA (SEQ ID NO: 113), a sixth primer comprising a nucleic acid sequence of AGTATCTTGGTCTTG (SEQ ID NO: 114).

[000292] In some embodiments of the kit of the disclosure, wherein the infection is Mycoplasma genitalia the test primer mix comprises: TGGTCACTTCACTCCCTAA (SEQ ID NO: 109), a second primer comprising a nucleic acid sequence of

ACAACACAACTTACACCACTA (SEQ ID NO: 110), a third primer comprising a nucleic acid sequence of CATTGACTCAACCCAAGCTTTGGACTCAACCCCAATCACAC (SEQ ID NO:

111), a fourth primer comprising a nucleic acid sequence of

GTGCTTTTTCAAACCCTGGTAAAGTACAACATTATTGTTGCAACCG (SEQ ID NO:

[000293] In some embodiments of the kit of the disclosure, wherein the infection is Mycoplasma genitalia the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of

[000294] In some embodiments of the kit of the disclosure, wherein the infection is

Mycoplasma genitalia the test primer mix comprises: : a first primer comprising a nucleic acid sequence of TGGTCACTTCACTCCCTAA (SEQ ID NO: 109), a second primer comprising a nucleic acid sequence of ACAACACAACTTACACCACTA (SEQ ID NO: 110), a third primer comprising a nucleic acid sequence of

GTGCTTTTTCAAACCCTGGTAAAGTACAACATTATTGTTGCAACCG (SEQ ID NO:

[000295] In some embodiments of the kit of the disclosure, wherein the infection is a

Mycobacterium tuberculosis infection, the test primer mix comprises: : a first primer comprising a nucleic acid sequence of GGGCTTGCCGGGTTTGA (SEQ ID NO: 115), a second primer comprising a nucleic acid sequence of TGGACCCGCCAACAAGAA (SEQ ID NO: 116), a third primer comprising a nucleic acid sequence of

CTCGCTGAACCGGATCGATGTGGCGTACTCGACCTGAAAG (SEQ ID NO: 118).

[000296] In some embodiments of the kit of the disclosure, wherein the infection is a Mycobacterium tuberculosis infection, the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of CCTATCCGTATGGTGGATAACG (SEQ ID NO: 119), a sixth primer comprising a nucleic acid sequence of GTCGGAAGCTCCTATGACAAT (SEQ ID NO: 120).

[000297] In some embodiments of the kit of the disclosure, wherein the infection is a Mycobacterium tuberculosis infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of GGGCTTGCCGGGTTTGA (SEQ ID NO: 115), a second primer comprising a nucleic acid sequence of TGGACCCGCCAACAAGAA (SEQ ID NO: 116), a third primer comprising a nucleic acid sequence of

[000298] In some embodiments of the kit of the disclosure, wherein the infection is a Mycobacterium tuberculosis infection, the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000299] In some embodiments of the kit of the disclosure, wherein the infection is a

Mycobacterium tuberculosis infection, the test primer mix comprises: a first primer comprising a nucleic acid sequence of GGGCTTGCCGGGTTTGA (SEQ ID NO: 115), a second primer comprising a nucleic acid sequence of TGGACCCGCCAACAAGAA (SEQ ID NO: 116), a third primer comprising a nucleic acid sequence of

[000300] In some embodiments of the kit of the disclosure, wherein the infection is

Ureaplasma parvum infection the test primer mix comprises: a first primer comprising a nucleic acid sequence of TCAAGTCAATTTAGTCCAGGTA (SEQ ID NO: 121), a second primer comprising a nucleic acid sequence of GGAATATCGAAACGTCGTCC (SEQ ID NO: 122), a third primer comprising a nucleic acid sequence of

GACGGTCCCCAGTATTTTTAATACTGCAATTAATTTCGCTAGTGGTG (SEQ ID NO: 123), a fourth primer comprising a nucleic acid sequence of CAAGTTGGATCACATTTTCACTTGTGCGTTCTTTATCTTCATTTCCTT (SEQ ID NO: 124).

[000301] In some embodiments of the kit of the disclosure, wherein the infection is Ureaplasma parvum infection the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of AATTACTTTTGCCTCTCTACC (SEQ ID NO: 125), a sixth primer comprising a nucleic acid sequence of TGAAGTGAATAGTGCATTAG (SEQ ID NO: 126). [000302] In some embodiments of the kit of the disclosure, wherein the infection is Ureaplasma parvum infection the test primer mix comprises: a first primer comprising a nucleic acid sequence of TCAAGTCAATTTAGTCCAGGTA (SEQ ID NO: 121), a second primer comprising a nucleic acid sequence of GGAATATCGAAACGTCGTCC (SEQ ID NO: 122), a third primer comprising a nucleic acid sequence of

GACGGTCCCCAGTATTTTTAATACTGCAATTAATTTCGCTAGTGGTG (SEQ ID NO:

123), a fourth primer comprising a nucleic acid sequence of

CAAGTTGGATCACATTTTCACTTGTGCGTTCTTTATCTTCATTTCCTT (SEQ ID NO:

124), a fifth primer comprising a nucleic acid sequence of AATTACTTTTGCCTCTCTACC (SEQ ID NO: 125), a sixth primer comprising a nucleic acid sequence of TGAAGTGAATAGTGCATTAG (SEQ ID NO: 126).

[000303] In some embodiments of the kit of the disclosure, wherein the infection is Ureaplasma parvum infection the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000304] In some embodiments of the kit of the disclosure, wherein the infection is Ureaplasma parvum infection the test primer mix comprises: a first primer comprising a nucleic acid sequence of TCAAGTCAATTTAGTCCAGGTA (SEQ ID NO: 121), a second primer comprising a nucleic acid sequence of GGAATATCGAAACGTCGTCC (SEQ ID NO: 122), a third primer comprising a nucleic acid sequence of

GACGGTCCCCAGTATTTTTAATACTGCAATTAATTTCGCTAGTGGTG (SEQ ID NO:

123), a fourth primer comprising a nucleic acid sequence of

CAAGTTGGATCACATTTTCACTTGTGCGTTCTTTATCTTCATTTCCTT (SEQ ID NO:

124), a fifth primer comprising a nucleic acid sequence of AATTACTTTTGCCTCTCTACC (SEQ ID NO: 125), a sixth primer comprising a nucleic acid sequence of TGAAGTGAATAGTGCATTAG (SEQ ID NO: 126), a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000305] In some embodiments of the kit of the disclosure, wherein the infection is Ureaplasma urealyticum infection the test primer mix comprises: a first primer comprising a nucleic acid sequence of GGTAAATTAGTACCAGGAGCA (SEQ ID NO: 127), a second primer comprising a nucleic acid sequence of AACGACGTCCATAAGCAA (SEQ ID NO: 128), a third primer comprising a nucleic acid sequence of

CCAAGTTGGATCACATTTCCACTTCGTTCTTTGTCTTCGTTTCC (SEQ ID NO: 130). [000306] In some embodiments of the kit of the disclosure, wherein the infection is Ureaplasma urealyticum infection the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of GCTTCTCTACCTTCGTTCAT (SEQ ID NO: 131), a sixth primer comprising a nucleic acid sequence of AGTGCATTAGTATTCTTTGATGA (SEQ ID NO: 132).

[000307] In some embodiments of the kit of the disclosure, wherein the infection is Ureaplasma urealyticum infection the test primer mix comprises: a first primer comprising a nucleic acid sequence of GGTAAATTAGTACCAGGAGCA (SEQ ID NO: 127), a second primer comprising a nucleic acid sequence of AACGACGTCCATAAGCAA (SEQ ID NO: 128), a third primer comprising a nucleic acid sequence of

CCAAGTTGGATCACATTTCCACTTCGTTCTTTGTCTTCGTTTCC (SEQ ID NO: 130), : a fifth primer comprising a nucleic acid sequence of GCTTCTCTACCTTCGTTCAT (SEQ ID NO: 131), a sixth primer comprising a nucleic acid sequence of AGTGCATTAGTATTCTTTGATGA (SEQ ID NO: 132).

[000308] In some embodiments of the kit of the disclosure, wherein the infection is Ureaplasma urealyticum infection the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000309] In some embodiments of the kit of the disclosure, wherein the infection is Ureaplasma urealyticum infection the test primer mix comprises: a first primer comprising a nucleic acid sequence of GGTAAATTAGTACCAGGAGCA (SEQ ID NO: 127), a second primer comprising a nucleic acid sequence of AACGACGTCCATAAGCAA (SEQ ID NO: 128), a third primer comprising a nucleic acid sequence of

CCAAGTTGGATCACATTTCCACTTCGTTCTTTGTCTTCGTTTCC (SEQ ID NO: 130), : a fifth primer comprising a nucleic acid sequence of GCTTCTCTACCTTCGTTCAT (SEQ ID NO: 131), a sixth primer comprising a nucleic acid sequence of

AGTGCATTAGTATTCTTTGATGA (SEQ ID NO: 132); a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000310] In some embodiments of the kit of the disclosure, wherein the infection is Human Tdymphotropic virus 1 infection the test primer mix comprises: a first primer comprising a nucleic acid sequence of CAGGGGCCCTAATAATTCTACC (SEQ ID NO: 133), a second primer comprising a nucleic acid sequence of AGGGCCCGGAAATCATAGG (SEQ ID NO: 134), a third primer comprising a nucleic acid sequence of AAGGCCCGGAAATCATGGG (SEQ ID NO: 135), a fourth primer comprising a nucleic acid sequence of TGCCAGGCTGTTAGCGTGACGAAGACTGTTTGCCCACCA (SEQ ID NO: 136), a fifth primer comprising a nucleic acid sequence of

AACGGCCTCCTTCCGTTCCACGTGCCATCGGTAAATGTCC (SEQ ID NO: 138).

[000311] In some embodiments of the kit of the disclosure, wherein the infection is Human T-lymphotropic virus 1 infection the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of CCTAGCAGGCTGGAAAAGGG (SEQ ID NO: 139), an eighth primer comprising a nucleic acid sequence of CCTAACAGGCTGAAAAAGGG (SEQ ID NO: 140), a ninth primer comprising a nucleic acid sequence of CTCAACCCTCACCACTCCA (SEQ ID NO: 141).

[000312] In some embodiments of the kit of the disclosure, wherein the infection is Human

Tdymphotropic virus 1 infectiom the test primer mix comprises: a first primer comprising a nucleic acid sequence of CAGGGGCCCTAATAATTCTACC (SEQ ID NO: 133), a second primer comprising a nucleic acid sequence of AGGGCCCGGAAATCATAGG (SEQ ID NO: 134), a third primer comprising a nucleic acid sequence of AAGGCCCGGAAATCATGGG (SEQ ID NO: 135), a fourth primer comprising a nucleic acid sequence of TGCCAGGCTGTTAGCGTGACGAAGACTGTTTGCCCACCA (SEQ ID NO: 136), a fifth primer comprising a nucleic acid sequence of

[000313] In some embodiments of the kit of the disclosure, wherein the infection is Human

T-lymphotropic virus 1 infection the test primer mix further comprises: a tenth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eleventh primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a twelfth primer comprising a nucleic acid sequence of

[000314] In some embodiments of the kit of the disclosure, wherein the infection is Human

Tdymphotropic virus 1 infection the test primer mix comprises: a first primer comprising a nucleic acid sequence of CAGGGGCCCTAATAATTCTACC (SEQ ID NO: 133), a second primer comprising a nucleic acid sequence of AGGGCCCGGAAATCATAGG (SEQ ID NO: 134), a third primer comprising a nucleic acid sequence of AAGGCCCGGAAATCATGGG (SEQ ID NO: 135), a fourth primer comprising a nucleic acid sequence of TGCCAGGCTGTTAGCGTGACGAAGACTGTTTGCCCACCA (SEQ ID NO: 136), a fifth primer comprising a nucleic acid sequence of

CCTAACAGGCTGAAAAAGGG (SEQ ID NO: 140), a ninth primer comprising a nucleic acid sequence of CTCAACCCTCACCACTCCA (SEQ ID NO: 141); a tenth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eleventh primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a twelfth primer comprising a nucleic acid sequence of

[000315] In some embodiments of the kit of the disclosure, wherein the infection is Human Tdymphotropic virus 2 infection the test primer mix comprises: a first primer comprising a nucleic acid sequence of TCACCAAGGTGCCTCTAA (SEQ ID NO: 142), an second primer comprising a nucleic acid sequence of GCAAGGGCCGGAAATCAT (SEQ ID NO: 143), a third primer comprising a nucleic acid sequence of

GCCTGGTGTACAGGACTTCTCCCATCGTTGAAGGTCCAT (SEQ ID NO: 147).

[000316] In some embodiments of the kit of the disclosure, wherein the infection is Human T-lymphotropic virus 2 infection the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GGTTGGAACATTGTGGTGG (SEQ ID NO: 148), an eighth primer comprising a nucleic acid sequence of TCCATCTTAACAACCCCAGG (SEQ ID NO: 149).

[000317] In some embodiments of the kit of the disclosure, wherein the infection is Human T-lymphotropic virus 2 infection the test primer mix comprises: a first primer comprising a nucleic acid sequence of TCACCAAGGTGCCTCTAA (SEQ ID NO: 142), an second primer comprising a nucleic acid sequence of GCAAGGGCCGGAAATCAT (SEQ ID NO: 143), a third primer comprising a nucleic acid sequence of

[000318] In some embodiments of the kit of the disclosure, wherein the infection is Human T-lymphotropic virus 2 infection the test primer mix further comprises: a ninth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an tenth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); an eleventh primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a twelfth primer comprising a nucleic acid sequence of

[000319] In some embodiments of the kit of the disclosure, wherein the infection is Human T-lymphotropic virus 2 infection the test primer mix further comprises: a first primer comprising a nucleic acid sequence of TCACCAAGGTGCCTCTAA (SEQ ID NO: 142), an second primer comprising a nucleic acid sequence of GCAAGGGCCGGAAATCAT (SEQ ID NO: 143), a third primer comprising a nucleic acid sequence of

148), an eighth primer comprising a nucleic acid sequence of TCCATCTTAACAACCCCAGG (SEQ ID NO: 149); and the step of determining the expression level of at least one gene associated with the Human T-lymphotropic virus 2 infection in a biological sample from the subject using a LAMP assay comprises using: the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a ninth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an tenth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); an eleventh primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a twelfth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), a thirteenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a fourteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000320] In some embodiments of the kit of the disclosure, wherein the infection is Hepatitis A the test primer mix comprise: a first primer comprising a nucleic acid sequence of TGGATTTCTGACACTCCTTAC (SEQ ID NO: 150), a second primer comprising a nucleic acid sequence of TGTAGTAACATCCATAGCATGA (SEQ ID NO: 151), a third primer comprising a nucleic acid sequence of

TTGACCTCTCCTTCTAACGTTGCACATTCCAAGTTAATTGCTGAA (SEQ ID NO: 153). [000321] In some embodiments of the kit of the disclosure, wherein the infection is Hepatitis A the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of ACCTTTCTGATGTGC (SEQ ID NO: 154), a sixth primer comprising a nucleic acid sequence of TTCCC ATGTCAGAGT (SEQ ID NO: 155).

[000322] In some embodiments of the kit of the disclosure, wherein the infection is Hepatitis A the test primer mix comprises: a first primer comprising a nucleic acid sequence of TGGATTTCTGACACTCCTTAC (SEQ ID NO: 150), a second primer comprising a nucleic acid sequence of TGTAGTAACATCCATAGCATGA (SEQ ID NO: 151), a third primer comprising a nucleic acid sequence of

TTGACCTCTCCTTCTAACGTTGCACATTCCAAGTTAATTGCTGAA (SEQ ID NO: 153), : a fifth primer comprising a nucleic acid sequence of ACCTTTCTGATGTGC (SEQ ID NO: 154), a sixth primer comprising a nucleic acid sequence of TTCCCATGTCAGAGT (SEQ ID NO: 155).

[000323] In some embodiments of the kit of the disclosure, wherein the infection is Hepatitis A the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of

[000324] In some embodiments of the kit of the disclosure, wherein the infection is Hepatitis A the test primer mix comprises: a first primer comprising a nucleic acid sequence of TGGATTTCTGACACTCCTTAC (SEQ ID NO: 150), a second primer comprising a nucleic acid sequence of TGTAGTAACATCCATAGCATGA (SEQ ID NO: 151), a third primer comprising a nucleic acid sequence of

[000325] In some embodiments of the kit of the disclosure, wherein the infection is Hepatitis B the test primer mix comprises: a first primer comprising a nucleic acid sequence of CTAGACTCGTGGTGGACTTC (SEQ ID NO: 156), a second primer comprising a nucleic acid sequence of ACAAGAAGATGAGGCATAGCA (SEQ ID NO: 157), a third primer comprising a nucleic acid sequence of ACTGGAGATTTGGGACTGCCTCAATTTTCTAGGGGGAAC (SEQ ID NO: 158), a fourth primer comprising a nucleic acid sequence of TGTTGTCCTCCGATTTGTCGCAGGATGCAGAGGAAGA (SEQ ID NO: 159).

[000326] In some embodiments of the kit of the disclosure, wherein the infection is Hepatitis B the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of GAATTTTGGCCAAGACACAC (SEQ ID NO: 160), a sixth primer comprising a nucleic acid sequence of TGTGTCTGCGGCGTT (SEQ ID NO: 161).

[000327] In some embodiments of the kit of the disclosure, wherein the infection is Hepatitis B the test primer mix comprises: a first primer comprising a nucleic acid sequence of CTAGACTCGTGGTGGACTTC (SEQ ID NO: 156), a second primer comprising a nucleic acid sequence of ACAAGAAGATGAGGCATAGCA (SEQ ID NO: 157), a third primer comprising a nucleic acid sequence of ACTGGAGATTTGGGACTGCCTCAATTTTCTAGGGGGAAC (SEQ ID NO: 158), a fourth primer comprising a nucleic acid sequence of TGTTGTCCTCCGATTTGTCGCAGGATGCAGAGGAAGA (SEQ ID NO: 159), a fifth primer comprising a nucleic acid sequence of GAATTTTGGCCAAGACACAC (SEQ ID NO: 160), a sixth primer comprising a nucleic acid sequence of TGTGTCTGCGGCGTT (SEQ ID NO: 161). [000328] In some embodiments of the kit of the disclosure, wherein the infection is Hepatitis B the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000329] In some embodiments of the kit of the disclosure, wherein the infection is Hepatitis B the test primer mix comprises: a first primer comprising a nucleic acid sequence of CTAGACTCGTGGTGGACTTC (SEQ ID NO: 156), a second primer comprising a nucleic acid sequence of ACAAGAAGATGAGGCATAGCA (SEQ ID NO: 157), a third primer comprising a nucleic acid sequence of ACTGGAGATTTGGGACTGCCTCAATTTTCTAGGGGGAAC (SEQ ID NO: 158), a fourth primer comprising a nucleic acid sequence of TGTTGTCCTCCGATTTGTCGCAGGATGCAGAGGAAGA (SEQ ID NO: 159), a fifth primer comprising a nucleic acid sequence of GAATTTTGGCCAAGACACAC (SEQ ID NO: 160), a sixth primer comprising a nucleic acid sequence of TGTGTCTGCGGCGTT (SEQ ID NO: 161); and the step of determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of

[000330] In some embodiments of the kit of the disclosure, wherein the infection is Hepatitis C the test primer mix comprises: a first primer comprising a nucleic acid sequence of TGGTCTGCGGAACCGG (SEQ ID NO: 162), a second primer comprising a nucleic acid sequence of GGGGCACTCGCAAGCA (SEQ ID NO: 163), a third primer comprising a nucleic acid sequence of ACGCCCAAATCTCCAGGCATTGTTTTCATTGCCAGGACGACCGG (SEQ ID NO: 164), a fourth primer comprising a nucleic acid sequence of CCGCGAGACTGCTAGCCGATTTTCCCTATCAGGCAGTA (SEQ ID NO: 165).

[000331] In some embodiments of the kit of the disclosure, wherein the infection is Hepatitis C the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of AGCGGGTTGATCCAAGAAAGGAC (SEQ ID NO: 166), a sixth primer comprising a nucleic acid sequence of TGTTGGGTCGCGAAAGGCC (SEQ ID NO: 167). [000332] In some embodiments of the kit of the disclosure, wherein the infection is Hepatitis C the test primer mix comprises: a first primer comprising a nucleic acid sequence of TGGTCTGCGGAACCGG (SEQ ID NO: 162), a second primer comprising a nucleic acid sequence of GGGGCACTCGCAAGCA (SEQ ID NO: 163), a third primer comprising a nucleic acid sequence of ACGCCCAAATCTCCAGGCATTGTTTTCATTGCCAGGACGACCGG (SEQ ID NO: 164), a fourth primer comprising a nucleic acid sequence of CCGCGAGACTGCTAGCCGATTTTCCCTATCAGGCAGTA (SEQ ID NO: 165), a fifth primer comprising a nucleic acid sequence of AGCGGGTTGATCCAAGAAAGGAC (SEQ ID NO: 166), a sixth primer comprising a nucleic acid sequence of TGTTGGGTCGCGAAAGGCC (SEQ ID NO: 167).

[000333] In some embodiments of the kit of the disclosure, wherein the infection is Hepatitis C the test primer mix further comprises a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000334] In some embodiments of the kit of the disclosure, wherein the infection is Hepatitis C the test primer mix comprises: a first primer comprising a nucleic acid sequence of TGGTCTGCGGAACCGG (SEQ ID NO: 162), a second primer comprising a nucleic acid sequence of GGGGCACTCGCAAGCA (SEQ ID NO: 163), a third primer comprising a nucleic acid sequence of ACGCCCAAATCTCCAGGCATTGTTTTCATTGCCAGGACGACCGG (SEQ ID NO: 164), a fourth primer comprising a nucleic acid sequence of CCGCGAGACTGCTAGCCGATTTTCCCTATCAGGCAGTA (SEQ ID NO: 165), a fifth primer comprising a nucleic acid sequence of AGCGGGTTGATCCAAGAAAGGAC (SEQ ID NO: 166), a sixth primer comprising a nucleic acid sequence of TGTTGGGTCGCGAAAGGCC (SEQ ID NO: 167), a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24)

[000335] In some embodiments of the kit of the disclosure, wherein the infection is Human Papilloma Virus type 16 the test primer mix comprises: a first primer comprising a nucleic acid sequence of TTACATAATAGATTGGTGGTGTT (SEQ ID NO: 168), a second primer comprising a nucleic acid sequence of GGTCACGTAGGTCTGTACT (SEQ ID NO: 169), a third primer comprising a nucleic acid sequence of

GTCCTTGAGAAAAAGGATTTCCAGTTTCCTAATGAGTTTCCATTTGA (SEQ ID NO: 170), a fourth primer comprising a nucleic acid sequence of

TTAAGTTTGCACGAGGACGAGAGTATTTTGTCCTGACACACA (SEQ ID NO: 171).

[000336] In some embodiments of the kit of the disclosure, wherein the infection is Human Papilloma Virus type 16 the test primer mix comprises: a fifth primer comprising a nucleic acid sequence of TCATTAAGCTCATACACTGG (SEQ ID NO: 172), a sixth primer comprising a nucleic acid sequence of ATGGAGACTCTTTGCCA (SEQ ID NO: 173).

[000337] In some embodiments of the kit of the disclosure, wherein the infection is Human Papilloma Virus type 16 the test primer mix comprises: a first primer comprising a nucleic acid sequence of TTACATAATAGATTGGTGGTGTT (SEQ ID NO: 168), a second primer comprising a nucleic acid sequence of GGTCACGTAGGTCTGTACT (SEQ ID NO: 169), a third primer comprising a nucleic acid sequence of

TTAAGTTTGCACGAGGACGAGAGTATTTTGTCCTGACACACA (SEQ ID NO: 171), a fifth primer comprising a nucleic acid sequence of TCATTAAGCTCATACACTGG (SEQ ID NO: 172), a sixth primer comprising a nucleic acid sequence of ATGGAGACTCTTTGCCA (SEQ ID NO: 173). [000338] In some embodiments of the kit of the disclosure, wherein the infection is Human Papilloma Virus type 16 the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000339] In some embodiments of the kit of the disclosure, wherein the infection is Human Papilloma Virus type 16 the test primer mix comprises: a first primer comprising a nucleic acid sequence of TTACATAATAGATTGGTGGTGTT (SEQ ID NO: 168), a second primer comprising a nucleic acid sequence of GGTCACGTAGGTCTGTACT (SEQ ID NO: 169), a third primer comprising a nucleic acid sequence of

TTAAGTTTGCACGAGGACGAGAGTATTTTGTCCTGACACACA (SEQ ID NO: 171), a fifth primer comprising a nucleic acid sequence of TCATTAAGCTCATACACTGG (SEQ ID NO: 172), a sixth primer comprising a nucleic acid sequence of ATGGAGACTCTTTGCCA (SEQ ID NO: 173): a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24) [000340] In some embodiments of the kit of the disclosure, wherein the infection is Human Papilloma Virus type 18 the test primer mix comprises: a first primer comprising a nucleic acid sequence of TACTGGC AGTGGTAC AGG (SEQ ID NO: 174), a second primer comprising a nucleic acid sequence of GTGCCAGTAAACGTAGGC (SEQ ID NO: 175), a third primer comprising a nucleic acid sequence of

ACACGTCCCCCAGTGGTTATCCACACTGGAGTCCTCTA (SEQ ID NO: 177),

[000341] In some embodiments of the kit of the disclosure, wherein the infection is Human Papilloma Virus type 18 the test primer mix further comprises: a fifth primer comprising a nucleic acid sequence of TACATTCCATTGGGTGGGC (SEQ ID NO: 178), a sixth primer comprising a nucleic acid sequence of TGTTACATTAATAGAGGA (SEQ ID NO: 179). [000342] In some embodiments of the kit of the disclosure, wherein the infection is Human Papilloma Virus type 18 the test primer mix comprises: a first primer comprising a nucleic acid sequence of TACTGGC AGTGGTAC AGG (SEQ ID NO: 174), an second primer comprising a nucleic acid sequence of GTGCCAGTAAACGTAGGC (SEQ ID NO: 175), a third primer comprising a nucleic acid sequence of

AGGACC AAC ATCC ACC ACTGGGTCGT AC AGGGT AC ATTC (SEQ ID NO: 176), a fourth primer comprising a nucleic acid sequence of

ACACGTCCCCCAGTGGTTATCCACACTGGAGTCCTCTA (SEQ ID NO: 177), an fifth primer comprising a nucleic acid sequence of TACATTCCATTGGGTGGGC (SEQ ID NO: 178), a sixth primer comprising a nucleic acid sequence of TGTTACATTAATAGAGGA (SEQ ID NO: 179).

[000343] In some embodiments of the kit of the disclosure, wherein the infection is Human Papilloma Virus type 18 the test primer mix further comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

[000344] In some embodiments of the kit of the disclosure, wherein the infection is Human Papilloma Virus type 18 the test primer mix comprises: a first primer comprising a nucleic acid sequence of TACTGGC AGTGGTAC AGG (SEQ ID NO: 174), an second primer comprising a nucleic acid sequence of GTGCCAGTAAACGTAGGC (SEQ ID NO: 175), a third primer comprising a nucleic acid sequence of

178), a sixth primer comprising a nucleic acid sequence of TGTTACATTAATAGAGGA (SEQ ID NO: 179); a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

[000345] In some embodiments of the kit of the disclosure, the intercalating DNA dye is a fluorescent intercalating DNA dye. In some embodiments of the kit of the disclosure, the fluorescent intercalating DNA dye is any one of SYTO-9, SYTO-13, SYTO-82, SYBR green, SYBR-Gold, LC-Green and Eva-Green.

[000346] In some embodiment of the kit of the disclosure, the sample comprises about 0.25 to about 0.5 copies of DNA per pi. In some embodiment of the kit of the disclosure, the sample comprises about 0.5 copies of DNA per mΐ. In some embodiment of the kit of the disclosure, the sample comprises 0.5 copies of DNA per pi. In some embodiment of the kit of the disclosure, the sample comprises at least 0.5 copies of DNA per mΐ. In some embodiment of the kit of the disclosure, the sample comprises between 0.5-80 copies of DNA per mΐ.

[000347] In some embodiments of the kit of the disclosure, the sample is any one of an upper respiratory specimen including oropharyngeal and nasopharyngeal swabs, anterior nasal and mid-turbinate nasal swabs, nasopharyngeal washes/aspirates or nasal aspirates as well as bronchoalveolar lavage (BAL).

[000348] All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. The references cited herein are not admitted to be prior art to the claimed invention. In the case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be limiting.

[000349] Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. The references cited herein are not admitted to be prior art to the claimed invention. In the case of conflict, the present Specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be limiting.

[000350] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs and as commonly used in the art to which this application belongs; such art is incorporated by reference in its entirety.

[000351] Any of the above aspects and embodiments can be combined with any other aspect or embodiment as disclosed in the Summary, and/or in the Detailed Description section.

EXAMPLES

[000352] Provided herein is a study describing the method of the disclosure for detecting the presence or absence of a pathogenic infection in a subject by determining the level of expression of one or more genes associated with the infection in a sample from the subject. The method of the disclosure, comprises determining the expression level of the one or more genes associated with the infection using a LAMP assay, including RT-LAMP assay if the pathogenic infection is an RNA virus infection. The RT-LAMP assay described herein is easy to run, requires very little instrumentation and technical skills, and can provide rapid output within 30-50 minutes. The RT- LAMP assay described herein can be adapted and called to meet testing needs. The assay described herein can be used to detect the presence or absence of pathogenic infection including SARS-CoV-2 in various sample matrices like saliva, nasopharyngeal and oropharyngeal swabs. The assay described herein is advantageous over methods known in the art due to no requirement of RNA extraction, being cost effective and not being dependent on reagents in short supply. As a result, the method described herein is very sensitive, cost effective and easy to scale, and well suited to use for management of epidemics and pandemics including the SARS-CoV-2 pandemic.

Example 1: Description of assay used in method and kit for detection of SARS-CoV-2 infection in subjects

[000353] Provided herein is a study that describes and evaluates the specificity and efficacy of the method and kit of the disclosure for detecting the presence or absence of a SARS-CoV-2 infection in a subject by detecting the combined expression levels of three SARS-COV-2 specific genes, SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 A in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay, described herein. A stepwise execution of the method described herein is described in FIG. 1.

[000354] Assay Overview: The RT-LAMP assay used in the method and performed using the kit described herein, uses three SARS-CoV-2 specific primer sets to uniquely identify SARS- CoV-2 viral RNA. The first primer set targets the SARS-CoV-2 nucleocapsid gene (N) (SARS- CoV-2 E), the second primer set targets the envelope gene (E) ( SARS-CoV-2 E), and a third primer set that targets the ORF1 gene (al) ( SARS-CoV-2 ORF1). The nucleic acid sequences of the three sets of primers described herein are provided in Table 1. The assay was designed for rapid and high throughput processing of samples in 96 or 384 well formats. The assay described herein uses a provided green, fluorescent dye, to be used for each reaction together with the reaction mix. Each sample was run in duplicates to ensure accuracy and reproducibility. The end- point visualization was achieved using any instalment with the following wavelength capacity: excitation 470 ±10 nm, emission 520 ±10 nm.

[000355] Both reverse transcription and LAMP reactions for the assay described herein were done at 65 °C using the enzyme mixture of reverse transcriptase and Bst (Bacillus Stearothermophilus) DNA polymerase. The LAMP primers were target specific oligonucleotides, and the intercalating fluorescent dye emits fluorescence detectable in the FAM channel (emission at 520 ±10 nm). The emission signals were detected by fluorescence readers in RT-PCR systems or plate readers. The disclosed set of six LAMP primers per gene (total twenty four primers) were target specific and annealed to complementary sequences in the viral (Sars-CoV-2) and endogenous (18S RNA) genes and were amplified by the mechanism of Reverse Transcription Loop Amplification (RT-LAMP) to form long double strands of DNA which were monitored in a real-time fashion by the intercalating dye emission of fluorescence. [000356] In the assay described herein, the fluorescence was detected without manipulation of the product or opening the reaction tube and can be monitored by the fluorescence reader on the Applied Biosystems real-time PCR platform or measuring end-point fluorescence in plate readers like Tecan Infinite 200. In addition, the kit described herein utilized two external positive (PC) controls and one negative template control (NC).The SARS-CoV-2 PC was a plasmid that contains the Sars-CoV-2 N-gene (GenBank: MN908947.3) extensively used for LAMP and RT- qPCR assay validation. The 18S RNA PC was DNA purified from human HeLa (cervix adenocarcinoma) cells grown in DMEM plus 10% FBS. The NC contains nuclease-free water. [000357] Assay Step Description

[000358] Specimens/samples including oropharyngeal and nasopharyngeal swabs, anterior nasal and mid-turbinate nasal swabs were collected in Mawi’s iSwab-EL collection tubes. The sample required no extraction because lysis and viral RNA release was achieved in the tube after collection. Nucleic acids were reverse transcribed using the enzyme mix from the Prime COVID- 19 Extraction less High Throughput Kit. 5pl of the sample were added to 5m1 of the RT-LAMP reaction mix as described in Table 3 below, resulting in the RNA conversion to cDNA which was then subsequently loop amplified. During the amplification, double-stranded DNA was created which is bound by the intercalating dye (See FIG. 1).

Table 3: COVID-19 Extraction less High Throughput reaction set-up.

Reactions were set-up at a recommended temperature of 65°C (30 seconds cycles), and were run for at least 100 cycles (approximately 50 minutes run).

[000359] The controls included in the assay described herein were as follows: a) A “no template” (negative) control (NC) containing nuclease-free water to assure there was no cross contamination and to establish a no reaction baseline for the control and the target and was made once per plate; b) The internal control (18S RNA) to verify the presence of nucleic acid material, test accuracy, performance of the assay, and included in each replicate; c) Two positive controls; d) The two positive controls (PC) to verify that the assay run was performing as intended and are used once per plate to confirm the proper reaction mix performance and therefore, the successful detection of both target gene (N) and control gene (18S RNA).

[000360] The method described herein can be used to detect the expression levels of SARS- CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in upper respiratory specimens including oropharyngeal and nasopharyngeal swabs, anterior nasal and mid-turbinate nasal swabs, nasopharyngeal washes/aspirates or nasal aspirates as well as bronchoalveolar lavage (BAL) from individuals suspected of COVID-19. SARS-CoV-2 RNA. SARS-CoV-2 RNA is generally detectable in upper respiratory specimens including oropharyngeal and nasopharyngeal swabs, anterior nasal and mid turbinate nasal swabs, nasopharyngeal washes/aspirates or nasal aspirates as well as bronchoalveolar lavage (BAL) during the acute phase of infection. Positive results are indicative of the presence of SARS-CoV-2 RNA. The Positive results described herein did not rule out bacterial infection or co-infection with other viruses.

[000361] Data Interpretation Strategy [000362] The assay described herein was validated using the baseline threshold setting which is automatically adjusted by the Applied Biosystems QuantStudio 3, QuantStudio 5, QuantStudio 6 real-time PCR instruments or with background Endpoint fluorescence measurements using a plate reader like Tecan Infinite 200 Pro. All positive, negative and internal controls were examined prior to interpretation of patient results. If the controls were not valid, the patient results were not interpretable. Negative control (NC): NC reactions did exhibit any fluorescence growth curves (Ct) that crossed the threshold line < cycle 80. Similarly, if assessed on a plate reader like the Tecan Infinite 200, the NC reactions did not exhibit a signal greater than a 2-fold increase in fluorescence compared to the background fluorescence (e.g., empty well). If any NC reaction showed amplification of ORF1/N/E or 18sRNA genes, the run was invalidated, and testing was repeated using the same NC and residual nucleic acid from clinical samples. Positive control (PC): PC reactions for both Target (Sars-CoV-2) and endogenous control (18s RNA) genes yielded a fluorescence signal above the background within the fluorescence channel used. If the PC reactions did not exhibit positive amplification for the target genes, indicating LAMP inhibition, or thermocycler/kit malfunction. The run was invalidated, and the assay was repeated using the same PC and residual nucleic acid from clinical samples. Internal Control (IC): Failure to detect 18sRNA in any clinical specimen indicated any one or more of: Improper/inefficient extraction of nucleic acid from clinical materials; Loss of nucleic acids and/or degradation; Absence of sufficient human cellular material due to poor collection or loss of specimen integrity; Improper assay set up and execution; and Reagents or equipment malfunction. The data interpretation for control validation is described in Table 4 below.

Table 4: Data interpretation for quality control validation

[000363] Result interpretation: Assessment of clinical specimen test results was performed after the positive and negative controls were examined and determined to be valid and acceptable. If the controls were not valid, the patient results were determined to be uninterpretable. A specimen was determined as positive for Sars-CoV-2 if detection occurred for both target (ORF1/E/N) and endogenous (18S RNA) genes. The details of the process of results interpretation is described in Table 5 below.

Table 5: Interpretation of Patient Results Using the LAMP Assay

[000364] Performance evaluation of assay: Described herein is a performance evaluation of the LAMP-assay used in the method and kit described herein.

[000365] Analytical Sensitivity

[000366] Limit of Detection (LoD): The limit of detection (LoD) was defined as the lowest concentration at which approximately 95% of true positive replicates were detected. The LoD was established using the heat inactivated Sars-CoV-2 Virus (Cat# VR-1986 ATCC) spiked into pooled negative anterior nasopharyngeal swabs (n=10 swabs collected from healthy donors tested negative for Sars-CoV-2) collected in Mawi iSwab extraction less buffer (cat# ISM-T- NEL Mawi). 5ul of Input material was used in a final reaction volume of 10 ul. 24 replicates were analyzed, and samples were called negative if no amplification was detected before cycle 80 of the LAMP reaction. The LoD determination of the assay used in the method and Kit described herein was 80 copies/pL, which was the lowest concentration of SARS-CoV-2 at which > 95% of replicates were detected.

[000367] Inclusivity (analytical sensitivity): A homology analysis was conducted for the ORF1, E, and N, primer sets against all complete, high coverage SARS-CoV-2 sequences deposited at GISAID as of April 2, 2020. A total of 2,702 sequences were considered, of which 493, for the N gene and ORF1 region, and 495, for the E gene, were discarded for lack of coverage in their respective regions. Each primer set matched at 100% similarity against the SARS-CoV-2 Ref Seq reference genome (Wuhan-Hu-1; NC 045512.1). In addition, an in-silico inclusivity analysis determined that all three primer sets differed by one or fewer mutations for 100% of GISAID sequences, indicating nominal primer hybridization for all SARS-CoV-2 variants under consideration. The results of the study described herein are provided in Table 6 below.

Table 6: In silico Inclusivity Analysis.

[000368] Cross-reactivity (Analytical Specificity): In silico cross-reactivity analysis was performed by aligning the LAMP primer sequences against sequences of common viruses as well as those coronaviruses most closely related to SARS-CoV-2. The organisms assessed in silico for potential cross-reactivity to the Prime COVID-19 N-gene, E-gene and ORFl region by High Throughput Assay were: COVID-19 (MN908947.3), Human Coronavirus 229E (NC 002645.1), Human Coronavirus OC43 (NC 006213.1), Human Coronavirus HKU1 (NC_006577.2), Human Coronavirus NL63 (NC_005831.2), SARS CoV (NC_004718.3), MERS V (NC_019843.3), Adenovirus, strain ad71 9 (X67709.1), Human Metapneumovirus (NC_039199.1), Parainfluenza virus 1, strain Washington/ 1964 (AF457102.1), Parainfluenza virus 2, strain GREER (AF533012.1), Parainfluenza virus 3, strain HPIV3/MEX/1526/2005 (KF530234.1), Parainfluenza virus 4, strain M-25 (NC_021928.1), Influenza A (H1N1) (FJ966079.1), Influenza A (H3N2) 9 (KT002533.1), Influenza B (Victoria) (MN230203.1), Influenza B (Yamagata) (MK715533.1), Enterovirus D68 (EV-D68) 9 (KP745766.1),

Respiratory syncytial virus (U39661.1) and Human rhinovirus 14(NC_001490.1).

[000369] With the exception of SARS CoV, none of the above viruses contain a match against the total sequence length of the SARS-CoV-2 primer sets greater than the recommended threshold of 80%. A threshold of < 80% was considered sufficient to rule out the possibility of a cross pathogen hybridizing event. All pathogens, with the exception of SARS CoV, scored below the 80% threshold. For SARS CoV, the N primer set returned a similarity score of 82.2%, while the E primer set scored 96.4%. The likelihood of a false positive is thus expected to be low, given that SARS CoV is a rare pathogen and there are no known circulating strains of SARS CoV in the human population.

[000370] Cross-Reactivity Wet Testing: In addition to the in-silico analysis for cross reactivity, wet testing was also performed to test cross-reach vity/exclusivity with other organisms: Adenovirus 11 stain Slobitski, Adenovirus , strain: Adenoid 75, Bordetella pertussis strain 18323 [NCTC10739], Candida albicans strain NIH 3172, Chlamydophila Pneumonia strain TWAR strain 2023, Candida albicans strain NIH 3172, Chlamydophila Pneumonia, strain TWAR strain 2023, Enterovirus 70 strain J670/71, Haemophilus influenzae strain NCTC 8143, Human parainfluenza virus 4b strain CH 19503, Human respiratory syncytial virus strain A2, Human rhinovirus 61 strain 6669-CV39 [V-152- 002-021], Mycobacterium Tuberculosis strain H37Ra, Mycoplasma Pneumonia strain Somerson et al. FH strain of Eaton Agent [NCTC 10119], Pseudomonas Aeruginosa strain (Schroeter) Migula (ATCC® 10145™)- [CCEB 481, MDB strain BU 277, NCIB 8295, NCPPB 1965, NCTC 10332, NRRL B-771, R. Hugh 815], Staphylococcus Epidermidis strain AmMS 205, Streptococcus Pneumonia strain Mu50 [NRSl], Streptococcus pyogenes strain Rosenbach (ATCC® 49399™ - QC A62, Streptococcus salivarius strain B2, Human coronavirus, Human coronavirus, Middle East Respiratory Syndrome Coronavirus (MERS-CoV), strain EMC/2012, SARS Coronavirus, SARS-Related Coronavirus 2, A. baumannii strain 307-0294, Adenovirus Type 3, Adenovirus Type 3, Adenovirus Type 31, C. pneumonia strain CWL-029, Coronavirus strain 229E, Coronavirus strain NL63, Coronavirus strain OC43, Coronavirus strain SARS, E. cloacae strain Z101, E. coli strain Z297, Enterovirus, H. influenzae strain MinnA, Human Metapneumovirus, Influenza A strains HI, H1N1 (2009),

H3, H3 A/Brisbane/10/07, Influenza B, Influenza B strain B/Florida/02/06, K. aerogenes strain Z052, K. oxytoca strain Z115, K. pneumoniae strains KPC2, Z138; OXA-48, Z460; NDM-1, L. pneumophila strain Philadelphia, M. catarrhalis strain Ne 11, M. pneumonia strain M129, Metapneumovirus strain 8 PERU6-2003, P. aeruginosa strain Z139, VIM-1, P. mirabilis strain Z050, Parainfluenza virus Types 1, 2, 3, Respiratory Syncytial Virus A, Respiratory Syncytial Virus B, Rhinovirus, RSV A2, S. agalactiae strain Z019, COL, S. marcescens strain Z053, S. pneumoniae strain Z022 and S. pyogenes strain Z018.

[000371] Samples were prepared by spiking (inactivated) purified, intact viral particles, cultured RNA, or bacterial cells using those panel s/organi sms mentioned above, into a negative clinical matrix and processed in triplicate with the assay. Because no quantification information was available for the individual organisms that were wet tested, 50 pL of each stock was spiked into a negative clinical matrix and tested. All results of wet bench testing were negative, indicating that the Prime COVID-19 High Throughput Assay is designed for the specific detection of SARS-CoV-2, with no expected cross-reactivity to other coronaviruses, or human microflora that would predict potential false positive LAMP results.

[000372] Endogenous Interference Substances Studies: Interfering substances which could be found in respiratory samples endogenously or exogenously were tested to evaluate the extent, if any, of potential assay inhibition. Baseline anterior nasal swabs were collected in triplicate from study volunteers as negative control samples (without potential interfering substance). The study volunteers then used the interfering substances as recommended by the manufacturer of the substance which should represent the relevant dose. Immediately after the substances were used, anterior nasal swabs were collected in triplicate and spiked with Sars-CoV-2 heat inactivated virus (Cat# VR-1986 ATCC ) at 5X LoD. 100 pL of whole blood and mucin were separately added into the negative clinical matrix in triplicate and then spiked with heat inactivated virus at 5X LoD. The negative swabs that did not contain potentially interfering substances were also spiked with synthetic RNA at 5X LoD. Interfering substances tested were: Tobacco (active ingredient: Nicotine, Tar, Carbon Monoxide, Formaldehyde, Ammonia, Hydrogen Cyanide, Arsenic, and DDT), Marijuana (active ingredient: Cannabinoids, THC, CBD), Alcohol (active ingredient; Ethanol), Vaseline (active ingredient: Petroleum Jelly), Nasal allergy spray (active ingredient: Triamcinolone Acetonide), Nasal congestion spray (active ingredient: Oxymetazoline HC1), Nyquil (Active ingredient: Acetminophen, Doxylamine Succinate, Dextromethorphan HBr), Flonase (active ingredient: Futicasone propionate), Emergen-C (active ingredient: Zinc, Magnesium, Riboflavin, Vitamin C), Saline nasal Spray (active ingredient: NaCL, Phenylcarbinol, Nemalkonium Chloride), Act dry mouth Lozenges (active ingredient: Isomalt, Xylitol, Glycerin), Listerine Mouthwash (active ingredient: Eucalyptol, Menthol, Methyl Salicylate, Thymol), Sore throat and cough lozenges (active ingredient: Benzocaine, Dextromethorphan HBr), Zinc (active ingredient: Zinc) and Chloraseptic Spray (active ingredient: Phenol, Glycerin).

[000373] None of the tested substances inhibited or interfered with the performance of the Prime COVID-19 High Throughput Assay. Swabs both with and without the interfering substance yielded expected results. Based on the results of the study described herein, the assay used in the method and kit of the present disclosure, was shown to be specific for detection of SARS-CoV-2 genes in samples from subjects, without any significant cross-reactivity to other pathogens and/or external interfering substances. Based on the results of the study described herein, the assay used in the method and kit of the present disclosure, is sufficiently standardized and characterized for use in validation of clinical samples.

Example 2: Efficacy and Sensitivity of detection method using RT-LAMP assay for detection of SARS-CoV-2 infection in subjects

[000374] Clinical Validation of RT-LAMP assay: Described herein is a study done to validate the method and kit described herein were validated for determining positive (presence of) and negative (absence of) for infection with SARS-CoV-2 in a total of 238 clinical samples (nasopharyngeal swabs) from subjects from Source 1 and Source 2 that were previously diagnosed as positive and negative for COVID-19. The study described herein validated 53 total positive and 88 negative from source 1, and 52 total positive and 45 negative from source 2. The samples from source 1, were previously diagnosed as positive or negative for SARS-CoV-2 using CDC 2019-nCoV Real Time PCR Test. The results described herein show that method and kit described herein was able to correctly detect the positive and negative clinical samples with 100%. The results described herein show that 105 out of 105 total positive diagnosed samples were correctly identified as positive, and 133 out of 133 of the negative diagnosed samples were correctly identified as negative, for infection with SARS-CoV-2 (FIG. 2). All results generated by using the method and kit described herein were concordant with the RT- qPCR results done (See FIG. 3).

[000375] Positive percent agreement (PPA) and negative percent agreement (NPA) were determined by comparing observed results generated by the method and kit described herein, with the assay results performed at Sources 1 and 2 (Table 7).

Table 7:

[000376] Sensitivity determination of RT-LAMP assay and comparison with RT-PCR:

Next the limit of detection (LoD) of the assay described herein was compared with that of standard 1 RT-PCR based assay. The LoD was established using genomic RNA (from positive reference material that contain synthetic RNA of the SARS-CoV-2 genome at the following concentration 1,000 copies/ml) spiked into pooled negative anterior nasopharyngeal swabs collected in Universal Transport Medium (cat# 117, Puritan Medical Products). Each spiked replicate was RNA extracted and processed using the kit disclosed herein. Twenty-four replicates were analyzed, and samples were called negative if no amplification was detected before cycle 80 of the LAMP reaction. The result described herein showed that the sensitivity of the assay described herein was 0.5 copy/mΐ, which is higher than the sensitivity of 1.0 copy/mΐ for standard RT-PCR based assay. The sensitivity of an assay is inversely proportional to the amount or copies of DNA in a volume of the reaction that is required to produce a detectable signal in all samples tested. The result described herein showed that the assay used in the method and kit of the present disclosure demonstrated better sensitivity than the standard RT-PCR based assay. [000377] Next the limit of detection was assessed without RNA extraction. The LoD was established using genomic RNA (from positive reference material that contain synthetic RNA of the SARS-CoV-2 genome at the following concentration 1,000 copies/ml) spiked into pooled negative anterior nasopharyngeal swabs collected in Mawi’s Buffer (cat# ISM-T-NEL-XL Mawi ). Each sample was analyzed in replicates of 24. The result described herein showed that the assay used in the method and kit of the present disclosure demonstrated a LoD of 80 copies/pl (See FIG. 5).

[000378] Based on the study described herein, the method and kit disclosed herein, provide a cost-effective, efficient and accurate alternative to conventional diagnostic methods like RT- PCR, for determination of presence or absence of SARS-CoV-2 infection in subjects by detecting in samples of the subjects, the combined expression level of the three SARS-CoV-2 genes described herein.

EXAMPLE 3: Efficacy and Sensitivity of method using RT-LAMP assay for detection of Influenza A virus in samples.

[000379] Described herein is a study done to validate the method and kit described herein for determining presence or absence of infection with Influenza A virus in samples. Samples were received from BEI Resources as Genomic RNA of several strains of Influenza A. RNA was reverse transcribed to cDNA using the High-Capacity cDNA synthesis KIT (cat # 4368814 Thermo Fisher Scientific). Samples were then used for the LAMP reaction. Samples were analyzed in replicates of 3. Negative controls included water only. Reactions were set-up using primers specific for Influenza A gene and Green Fluorescent Dye (Lucigen), and assessed on the FAM channel. The results disclosed herein show that the assay using the Influenza A primers of the disclosure detected presence of Influenza A cDNA in all 9 replicates (See FIG. 6A).

[000380] Samples received from BEI Resources as Genomic RNA of several strains of Influenza A were evaluated in replicates of two, with either primers for Influenza A virus or Influenza B virus, in order to determine specificity of the Influenza A primers used in the assay. The results described herein show that the assay and the disclosed herein detected the Influenza A in both replicates of the tested samples when Influenza A primers were used. None of the replicates of any Influenza A samples were detected with Influenza B primers (See FIGs. 6C and 6D).

Example 4: Efficacy and Sensitivity of method using RT-LAMP assay for detection of Influenza B virus in samples.

[000381] Described herein is a study done to validate the method and kit described herein for determining presence or absence of infection with Influenza B virus in samples. Samples were received from BEI Resources as Genomic RNA of several strains of Influenza B. Samples received from BEI Resources as Genomic RNA of several strains of Influenza B were evaluated in replicates of two, with either primers for Influenza A virus or Influenza B virus, in order to determine specificity of the Influenza B primers used in the assay. The results described herein show that the assay and the disclosed herein detected the Influenza B in both replicates of the tested samples when Influenza B primers were used. None of the replicates of any Influenza B samples were detected with Influenza A primers (See FIG 7A). The results disclosed herein show that the assay using the Influenza A primers of the disclosure detected presence of Influenza A cDNA in all 9 replicates (See FIG. 7B).

Example 5: Efficacy and Sensitivity of method using RT-LAMP assay for detection of respiratory syncytial virus (RSV) A and B in samples.

[000382] Described herein is a study done to validate the method and kit described herein for determining presence or absence of infection with respiratory syncytial virus (RSV) A and B virus in samples. Samples were received from ATCC (RSVA cat# VR-1540 P ATCC - Human respiratory syncytial virus A, purified; and RSVB cat# VR-2579 ATCC - Human respiratory syncytial virus B, Purified) were used for RNA extraction with the Qiagen QIAamp mini Viral RNA extraction (cat# 52906 Qiagen) kit following the manufacturer's recommendation. RNA was used for cDNA synthesis using the High-Capacity DNA reverse transcription kit (cat# 4368814 Life Technologies) according to the manufacturer’s instruction. cDNA was used for the LAMP reaction after being tested for quality by a Nanodrop. A random cDNA from a sample in the lab was used to test non-specific amplification of the assessed primers. Every test was performed in replicates of 3 and using Primers and Green Fluorescent Dye (Lucigen) detected on the FAM channel. The results described herein show that the assay done using primers for RSV A detected both replicates of the sample from the purified RSV A but none the replicates of the sample from the purified RSV B. Similarly, assay done using primers for RSV B detected both replicates of the sample from the purified RSV B but none the replicates of the sample from the purified RSV A. The results described herein show that the assay for detecting RSV in samples from subjects for use in the method and kit of the present disclosure, is specific and sensitive for the RSV A or B virus.

Example 6: Detecting sexually transmitted pathogens.

[000383] Described herein is a study done to validate the method and kit described herein for determining presence or absence of infection by sexually transmitted pathogens in samples. Positive controls were obtained from ATCC. When the samples were provided as inactivated viral material, 140 ul were used for RNA extraction using the QIAamp Viral RNA Mini Kit Qiagen cat# 52906 and eluted in 60 ul of AVE buffer as instructed by the manufacturer. If a sample was already provided as RNA or DNA no extraction was performed. RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit Life Technologies cat # 4368814. Reverse transcribed cDNA, or genomic DNA was used for the LAMP assay. Negative control was RNAse/DNAse free water and/or when present (cDNA from a non-STIs).

[000384] Detection of N. gonorrhoeae. Genomic DNA of Neisseria gonorrhoeae (ATCC cat# 700825D-5) was used as positive control with 3 replicates tested. All 3 Replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 9A).

[000385] Detection of Chlamydia. cDNA (from extracted RNA) of Chlamydia VR885 (ATCC cat# 700825D-5) was used as positive control with 3 replicates tested. All 3 Replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 9B).

[000386] Detection of Trichomoniasis. Genomic DNA of Trichomonas vaginalis G3 (ATCC cat# PRA-98D) was used as positive control with 3 replicates tested. All 3 Replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 9C).

[000387] Detection of Herpes Simplex Virus 1 and 2. cDNA from Human herpesvirus 1 (HSV-1) Strain MacIntyre (ATCC® VR-539D™) and HSV-2 strain G (ATCC® VR- 734D™), was used as positive control with 3 replicates tested. For the HSV-1 sample, all 3 Replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 9D). None of the HSV-2 replicates was detected using the assay primers used for the HSV-1 assay (two replicates detected after cycle 50 = exclusion criteria). For the HSV-2 sample, all 3 replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 9E). None of the HSV-1 replicates was detected using the assay primers used for the HSV-1 assay (three replicates detected after cycle 50 = exclusion criteria).

[000388] Detection of Syphilis. Genomic DNA of Treponema Pallidum from ATCC was detected in 2 replicates. All 2 Replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 9F). [000389] Detection of Gardnerella vaginalis. Genomic DNA of Gardnerella vaginalis was used as positive control with 3 replicates tested. All 3 Replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 9G).

[000390] Detection of Candida albicans. Genomic DNA of Candida albicans was used as positive control with 3 replicates tested. All 3 Replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 9H).

[000391] Detection of Mycoplasma genitalium. Genomic DNA of Mycoplasma genitalium was used as positive control with 3 replicates tested. All 3 Replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 91).

[000392] Detection of Mycobacterium tuberculosis. Genomic DNA of Mycobacterium tuberculosis was used as positive control with 3 replicates tested. All 3 Replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 9J).

[000393] Detection of Ureaplasma parvum. Genomic DNA of Ureaplasma parvum was used as positive control with 3 replicates tested. All 3 Replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 9K). [000394] Detection of Ureaplasma urealyticum. Genomic DNA of Ureaplasma urealyticum was used as positive control with 3 replicates tested. All 3 Replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 9L).

[000395] Detection of Human T-lymphocytic virus 1. Genomic DNA of Human T- lymphocytic virus 1 was used as positive control with 3 replicates tested. All 3 Replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 9M).

[000396] Detection of Human T-lymphocytic virus 2. Genomic DNA of Human T- lymphocytic virus 2 was used as positive control with 3 replicates tested. All 3 Replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 9N).

[000397] Detection of Hepatitis A virus. Genomic DNA of hepatitis A virus was used as positive control with 3 replicates tested. All 3 Replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 90).

[000398] Detection of Hepatitis B virus. Genomic DNA of hepatitis B virus was used as positive control with 3 replicates tested. All 3 Replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 9P).

[000399] Detection of Hepatitis C virus. Genomic DNA of hepatitis C virus was used as positive control with 3 replicates tested. All 3 Replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 9Q).

[000400] Detection of Human Papilloma Virus type 16. Genomic DNA of Human Papilloma Virus type 16 was used as positive control with 3 replicates tested. All 3 Replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 9R).

[000401] Detection of Human Papilloma Virus type 18. Genomic DNA of Human Papilloma Virus type 18 was used as positive control with 3 replicates tested. All 3 Replicates were detected. None of the negative control (non-STI cDNA) replicates and none of the water only control replicates, were detected (See FIG. 9S).

[000402] The results described herein show the efficacy of the assay used in the method and kit of the disclosure, in detecting presence or absence of infection caused by various pathogenic viruses and bacteria in samples of subjects.

OTHER EMBODIMENTS

While the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

What is claimed is:

1. A method of detecting the presence or absence of a SARS-CoV-2 infection in a subject, the method comprising: a) determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay; b) determining the expression level of 18s RNA in the biological sample using a LAMP assay; c) comparing the combined expression level of SARS-CoV-2 ORF1 , SARS-CoV-2 N and SARS-CoV-2 E , to a first predetermined expression cutoff value; d) comparing the expression level of 18s RNA to a second predetermined expression cutoff value; e) determining i) the presence of a SARS-CoV-2 infection in the subject when the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E is greater than the first predetermined expression cutoff value and the expression level of 18s RNA is greater than the second predetermined expression cutoff value; or ii) the absence of a SARS-CoV-2 in the subject when the when the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E is less than the first predetermined expression cutoff value and the expression level of 18S RNA is greater than the second predetermined expression cutoff value, wherein determining the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of ACCAGGAACTAATCAGACAAG (SEQ ID NO: 1), a second primer comprising a nucleic acid sequence of GACTTGATCTTTGAAATTTGGATCT (SEQ ID NO: 2), a third primer comprising a nucleic acid sequence of

TTCCGAAGAACGCTGAAGCGGAACTGATTACAAACATTGGCC (SEQ ID NO: 3), a fourth primer comprising a nucleic acid sequence of

CGC ATT GGC ATGGAAGTC AC AATTT GAT GGC ACCTGTGT A (SEQ ID NO: 4); and/or a fifth primer comprising a nucleic acid sequence of GGGGGCAAATTGTGCAATTTG (SEQ ID NO: 5), a sixth primer comprising a nucleic acid sequence of CTTCGGGAACGTGGTTGACC (SEQ ID NO: 6). a seventh primer comprising a nucleic acid sequence of TGAGTACGAACTTATGTACTCAT (SEQ ID NO: 7), an eighth primer comprising a nucleic acid sequence of TTCAGATTTTTAACACGAGAGT (SEQ ID NO: 8), a ninth primer comprising a nucleic acid sequence of

ACC ACGAAAGC AAGAAAAAGAAGTTCGTTTCGGAAGAGAC AG (SEQ ID NO:

9), a tenth primer comprising a nucleic acid sequence of

TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT (SEQ ID NO:

10), and/or, an eleventh primer comprising a nucleic acid sequence of CGCTATTAACTATTAACG (SEQ ID NO: 11), a twelfth primer comprising a nucleic acid sequence of CGCGCTTCGATTGTGTGCGT (SEQ ID NO: 12); and/or a thirteenth primer comprising a nucleic acid sequence of CGGTGGACAAATTGTCAC (SEQ ID NO: 13), a fourteenth primer comprising a nucleic acid sequence of CTTCTCTGGATTTAACACACTT (SEQ ID NO: 14), a fifteenth primer comprising a nucleic acid sequence of

TCAGCACACAAAGCCAAAAATTTATTTTTCTGTGCAAAGGAAATTAAGGAG (SEQ ID NO: 15), a sixteenth primer comprising a nucleic acid sequence of

TATTGGTGGAGCTAAACTTAAAGCCTTTTCTGTACAATCCCTTTGAGTG (SEQ ID NO: 16), and/or a seventeenth primer comprising a nucleic acid sequence of TTACAAGCTTAAAGAATGTCTGAACACT (SEQ ID NO: 17), an eighteenth primer comprising a nucleic acid sequence of TTGAATTT AGGT GAAAC ATTT GT C ACG (SEQ ID NO: 18).

2. The method of claim 1, wherein determining the expression level of 18S RNA using a LAMP assay comprises using: a nineteenth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), a twentieth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a twenty-first primer comprising a nucleic acid sequence of

TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21), a twenty-second primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22).

3. The method of claim 2, wherein determining the expression level of 18S RNA using a LAMP assay further comprises using: a twenty-third primer comprising a nucleic acid sequence of

AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23) and a twenty-fourth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24). 4 The method of claim 1, wherein determining the combined expression level of SARS- CoV-2 ORFlrfl, SARS-CoV-2 N, and SARS-CoV-2 E using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of ACCAGGAACTAATCAGACAAG (SEQ ID NO: 1), a second primer comprising a nucleic acid sequence of GACTTGATCTTTGAAATTTGGATCT (SEQ ID NO: 2), a third primer comprising a nucleic acid sequence of

CGC ATT GGC ATGGAAGTC AC AATTT GAT GGC ACCTGTGT A (SEQ ID NO: 4), a fifth primer comprising a nucleic acid sequence of GGGGGCAAATTGTGCAATTTG (SEQ ID NO: 5), a sixth primer comprising a nucleic acid sequence of CTTCGGGAACGTGGTTGACC (SEQ ID NO: 6), a seventh primer comprising a nucleic acid sequence of TGAGTACGAACTTATGTACTCAT (SEQ ID NO: 7), an eighth primer comprising a nucleic acid sequence of TTCAGATTTTTAACACGAGAGT (SEQ ID NO: 8), a ninth primer comprising a nucleic acid sequence of

ACC ACGAAAGC AAGAAAAAGAAGTTCGTTTCGGAAGAGAC AG (SEQ ID NO:

9), a tenth primer comprising a nucleic acid sequence of

TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT (SEQ ID NO:

10), an eleventh primer comprising a nucleic acid sequence of CGCTATTAACTATTAACG (SEQ ID NO: 11), a twelfth primer comprising a nucleic acid sequence of CGCGCTTCGATTGTGTGCGT (SEQ ID NO: 12), a thirteenth primer comprising a nucleic acid sequence of CGGTGGACAAATTGTCAC (SEQ ID NO: 13), a fourteenth primer comprising a nucleic acid sequence of CTTCTCTGGATTTAACACACTT (SEQ ID NO: 14), a fifteenth primer comprising a nucleic acid sequence of

TATTGGTGGAGCTAAACTTAAAGCCTTTTCTGTACAATCCCTTTGAGTG (SEQ ID NO: 16), a seventeenth primer comprising a nucleic acid sequence of TTACAAGCTTAAAGAATGTCTGAACACT (SEQ ID NO: 17), and an eighteenth primer comprising a nucleic acid sequence of TTGAATTT AGGT GAAAC ATTT GT C ACG (SEQ ID NO: 18).

5. The method of claim 1, wherein determining the combined expression level of SARS- CoV-2 ORFlrfl, SARS-CoV-2 N, and SARS-CoV-2 E using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of ACCAGGAACTAATCAGACAAG (SEQ ID NO: 1), a second primer comprising a nucleic acid sequence of GACTTGATCTTTGAAATTTGGATCT (SEQ ID NO: 2), a third primer comprising a nucleic acid sequence of

ACC ACGAAAGC AAGAAAAAGAAGTTCGTTTCGGAAGAGAC AG (SEQ ID NO:

9), a tenth primer comprising a nucleic acid sequence of

TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT (SEQ ID NO:

TATTGGTGGAGCTAAACTTAAAGCCTTTTCTGTACAATCCCTTTGAGTG (SEQ ID NO: 16), a seventeenth primer comprising a nucleic acid sequence of TTACAAGCTTAAAGAATGTCTGAACACT (SEQ ID NO: 17), and an eighteenth primer comprising a nucleic acid sequence of TTGAATTT AGGT GAAAC ATTT GT C ACG (SEQ ID NO: 18), and wherein determining the expression level of 18S RNA using a LAMP assay comprises using: a nineteenth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), a twentieth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a twenty-first primer comprising a nucleic acid sequence of

TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21), a twenty-second primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), and a twenty-third primer comprising a nucleic acid sequence of

AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23); and a twenty-fourth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

6. The method of any one of claims 1-5, wherein step (e) further comprises determining that the method is erroneous in step (b), when the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E is less than the first predetermined expression cutoff value and the expression level of 18s RNA is less than the second predetermined expression cutoff value.

7. The method of claim 6, further comprising repeating steps (a)-(e) using a different biological sample from the subject.

8. The method of any claims 1-7, wherein the method is performed in two replicates.

9. The method of claim 6, wherein step (e) comprises determining i) the presence of a SARS-CoV-2 infection in the subject when the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E is greater than the first predetermined expression cutoff value in both replicates and the expression level of 18S RNA is greater than the second predetermined expression cutoff value in both replicates; or ii) the absence of a SARS-CoV-2 in the subject when the when the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E is less than the first predetermined expression cutoff value in both replicates and the expression level of 18s RNA is greater than the second predetermined expression cutoff value in both replicates, further wherein the method of step (b) is:

1) erroneous when the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E is less than the first predetermined expression cutoff value in both replicates and the expression level of 18s RNA is less than the second predetermined expression cutoff value in both replicates; or

2) inconclusive as to the presence or absence of a SARS-CoV-2 infection in the subject when: i) the combined expression level of SARS-CoV-2 ORF1, SARS- CoV-2 N and SARS-CoV-2 E is greater than the first predetermined expression cutoff value in one replicate and less than the predetermined expression cutoff value in the other replicate; and/or ii) the expression level of 18S RNA is greater than the second predetermined expression cutoff value in one replicate and less than the predetermined expression cutoff value in a second replicate.

10. The method of any one of claims 1-9, wherein the LAMP assay is a reverse transcriptase LAMP (RT-LAMP) assay comprising the use of Bacillus Stearothermophilus ( Bst ) DNA Polymerase and an intercalating DNA dye.

11. The method of any one claims 1-10, further comprising performing: i) at least one positive control reaction, wherein the positive control reactions comprise: a) determining the combined expression level of SARS-CoV-2 ORF1 , SARS-CoV-2 N, and SARS-CoV-2 E in a positive control sample using a LAMP assay, wherein the positive control sample comprises a known amount of SARS- CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E and/or 18S RNA in a positive control sample using a LAMP assay, wherein the positive control sample comprises a known amount of 18S RNA; b) comparing the combined expression level of SARS-CoV-2 ORF1, SARS- CoV-2 N and SARS-CoV-2 E and/or the combined expression level of 18S RNA to a positive control expression cutoff value; c) determining that the positive control was successful when the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS-CoV-2 E is greater than the positive control expression cutoff value, and/or the expression level of 18S RNA is greater than the positive control expression cutoff value; and/or ii) at least one negative control reaction, wherein the negative control reactions comprise: a) determining the combined expression level of SARS-CoV-2 ORF1 , SARS-CoV-2 N, and SARS-CoV-2 E in a negative control sample using a LAMP assay, wherein the negative control sample does not comprise SARS-CoV-2 ORF1, SARS-CoV-2 N, and SARS-CoV-2 E and/or 18S RNA in a negative control sample using a LAMP assay, wherein the negative control sample does not comprise 18S RNA; b) comparing the combined expression level of SARS-CoV-2 ORF1, SARS- CoV-2 N and SARS-CoV-2 E to a negative control expression cutoff value and/or combined expression level of 18S RNA to a negative control expression cutoff value; c) determining that the negative control was successful when the combined expression level of SARS-CoV-2 ORF1, SARS-CoV-2 N and SARS- CoV-2 E is less than the negative control expression cutoff value and/or the expression level of 18S RNA is less than the negative control expression cutoff value.

12. The method of any one of claims 1-11, further comprising a step of administering an effective treatment to the subject in which the presence of a SARS-CoV-2 infection is detected, wherein the effective treatment is an antiviral drug, an antibody or fragment thereof, a steroid medication, convalescent plasma, or a combination thereof.

13. A method of detecting the presence or absence of an infection in a subject, the method comprising: a) determining the expression level of at least one gene associated with the infection and/or 18S RNA in a biological sample from the subject using a loop-mediated isothermal amplification (LAMP) assay; b) comparing the expression level of the at least one gene associated with the infection to a corresponding predetermined expression cutoff value and/or 18s RNA to a predetermined control expression cutoff value; c) determining i) the presence of the infection in the subject when the expression level of the at least one gene associated with the infection is greater than the first predetermined expression cutoff value and/or the expression level of 18s RNA is greater than the predetermined control expression cutoff value; or ii) the absence of the infection in the subject when the expression level of the at least one gene associated with the infection is less than the first predetermined expression cutoff value and/or the expression level of 18s RNA is greater than the predetermined control expression cutoff value, wherein if the infection is: i) an influenza A infection, then determining the expression level of at least one gene associated with the influenza A infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GACTTGAAGATGTCTTTGC (SEQ ID NO: 25), a second primer comprising a nucleic acid sequence of TRTTATTTGGGTCTCCATT (SEQ ID NO: 26), a third primer comprising a nucleic acid sequence of

TT AGT C AGAGGTGAC ARRATTGC AGATCTT GAGGCTCTC (SEQ ID NO: 27), a fourth primer comprising a nucleic acid sequence of

TTGTKTTCACGCTCACCGTGTTTGGACAAAGCGTCTACG (SEQ ID NO: 28), a fifth primer comprising a nucleic acid sequence of GTCTTGTCTTTAGCCA (SEQ ID NO: 29), a sixth primer comprising a nucleic acid sequence of CMAGTGAGCGAGGACTG (SEQ ID NO: 30), a seventh primer comprising a nucleic acid sequence of GACTGGAAAGTGTCTTTGC (SEQ ID NO: 31), an eighth primer comprising a nucleic acid sequence of TRTTGTTTGGGTCCCCATT (SEQ ID NO: 32); ii) an influenza B infection, then determining the expression level of at least one gene associated with the influenza B infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GCAACCAATGCCACCATA (SEQ ID NO: 33), a second primer comprising a nucleic acid sequence of TTCTCTCTTCAAGRGACATC (SEQ ID NO: 34), a third primer comprising a nucleic acid sequence of

T AGTC A AGGGC Y C TTTGC C AC TTTGA AGC AGGA ATTC T GGA (SEQ ID NO: 35), a fourth primer comprising a nucleic acid sequence of CAAGACCGCCTAAACAGACTAAACTTTTACTTTCAGGCTCACTT TGAAAGYCTTTCATAGCAC (SEQ ID NO: 36), a fifth primer comprising a nucleic acid sequence of TGAAAGYCTTTCATAGCAC (SEQ ID NO: 37), a sixth primer comprising a nucleic acid sequence of CAAGAATAAAGACTCACAAC (SEQ ID NO: 38); iii) a respiratory syncytial virus A infection, then determining the expression level of at least one gene associated with the respiratory syncytial virus A infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GAGTTGAAGGGATTTTTGCA (SEQ ID NO: 39), a second primer comprising a nucleic acid sequence of T GGGTT GTT C A AT AT AT GGT AG A (SEQ ID NO: 40), a third primer comprising a nucleic acid sequence of

CAAGCAGAAATGGAACAAGTTGTGCTGCTTCTCCACCCAATT (SEQ ID NO: 42), a fifth primer comprising a nucleic acid sequence of GAGGT GT ATGAGT AT GCTC AGA (SEQ ID NO: 43), a sixth primer comprising a nucleic acid sequence of CACCGTAACATCACTTG (SEQ ID NO: 44); iv) a respiratory syncytial virus B infection, then determining the expression level of at least one gene associated with the respiratory syncytial virus B infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of T GAC AT C AGA A AT AC A AGT C A AT (SEQ ID NO: 45), a second primer comprising a nucleic acid sequence of CGTTTTTTAAGACATTGTTTGCC (SEQ ID NO: 46), a third primer comprising a nucleic acid sequence of

CATCCCACAGTCTGGAGAATCAAGAAAGTCCTACAAAAAAATGC (SEQ ID NO: 47), a fourth primer comprising a nucleic acid sequence of

GCTGCCCTTGTAATAACCAAATTAGCTCCTAATTACTGCAGTAAGACC (SEQ ID NO: 48), a fifth primer comprising a nucleic acid sequence of CAGCAGGAGATAGATCA (SEQ ID NO: 49), a sixth primer comprising a nucleic acid sequence of GAGCCACTTCTCCCATC (SEQ ID NO: 50): v) a gonorrhea infection, then determining the expression level of at least one gene associated with the gonorrhoeae infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of CCATTGATCCTTGGGACAG (SEQ ID NO: 51), a second primer comprising a nucleic acid sequence of CAGACCGGCATAATACACAT (SEQ ID NO: 52), a third primer comprising a nucleic acid sequence of

GGGA AT C GT A AC GC AC GGA A AT A AT GT GGCTTCGC A ATT G ( SEQ ID NO: 53), a fourth primer comprising a nucleic acid sequence of

AGCGGCAGCATTCAATTTGTTCCTGATTACTTTCCAGCGTGA (SEQ ID NO: 54), a fifth primer comprising a nucleic acid sequence of ATACCGTCGTGGCGTTTG (SEQ ID NO: 55), and a sixth primer comprising a nucleic acid sequence of CGCCTATACGCCTGCTAC (SEQ ID NO: 56); vi) a chlamydia infection, then determining the expression level of at least one gene associated with the chlamydia infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of AATATCATCTTTGCGGTTGC (SEQ ID NO: 57), a second primer comprising a nucleic acid sequence of TCTACAAGAGTACATCGGTCA (SEQ ID NO: 58), a third primer comprising a nucleic acid sequence of

GC AGC TT GT AGT C C TGC TT G AGGG AGC G AGT T AC G A AG A (SEQ ID NO: 60), a fifth primer comprising a nucleic acid sequence of TAC AAACGCCTAGGGTGC (SEQ ID NO: 61), and a sixth primer comprising a nucleic acid sequence of GTTAAGGCAAATCGCCCG (SEQ ID NO: 62); vii) a trichomoniasis infection, then determining the expression level of at least one gene associated with the trichomoniasis infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GCTTCTCACAGAGCGTGG (SEQ ID NO: 63), a second primer comprising a nucleic acid sequence of GCTCATTGCCGATTGTGATG (SEQ ID NO: 64), a third primer comprising a nucleic acid sequence of

T GCTGAAATGGAGAAGGCCGCCGTTGCC ATCTGGA AGTGT G (SEQ ID NO: 66), a fifth primer comprising a nucleic acid sequence of CTTGATGTCACGAACGATTTCCTTT (SEQ ID NO: 67), a sixth primer comprising a nucleic acid sequence of TACAGACTCCTCCATCAACGT (SEQ ID NO: 68); viii) a herpes simplex 1 infection, then determining the expression level of at least one gene associated with the herpes simplex 1 infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GCCGTTGTTCCCATTATCCC (SEQ ID NO: 69), a second primer comprising a nucleic acid sequence of TACTTGGCATGGGGGGTG (SEQ ID NO: 70), a third primer comprising a nucleic acid sequence of

GTTGGGT GGT GGAGGAGACGTCCTTTTGGTTCTTGTCGGT (SEQ ID NO: 71), a fourth primer comprising a nucleic acid sequence of

GGTCGTCCCTCGCATGAAGCGGCGTGGTAAGGCTGATG (SEQ ID NO: 72), a fifth primer comprising a nucleic acid sequence of TTGGTGGGAACCCCCGATAC (SEQ ID NO:73), and a sixth primer comprising a nucleic acid sequence of AACATGACCCAGACCGGCAC (SEQ ID NO: 74); ix) a herpes simplex 2 infection, then determining the expression level of at least one gene associated with the herpes simplex 2 infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TCAGCCCATCCTCCTTCG (SEQ ID NO: 75), a second primer comprising a nucleic acid sequence of CCCACCTCTACCCACAAC (SEQ ID NO: 76), a third primer comprising a nucleic acid sequence of

AAATGCTTCCCTGCTGGTGCCCGCCGAGTTCGATCTGGT (SEQ ID NO: 78), a fifth primer comprising a nucleic acid sequence of CACGTCTTTGGGGACGGCGGC (SEQ ID NO: 79), and a sixth primer comprising a nucleic acid sequence of ATCTGGGACCGCGCCGCGGAGAC (SEQ ID NO: 80); x) a syphilis infection, then determining the expression level of at least one gene associated with the syphilis infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TGCAGTCTTTTTTTGTGCGG (SEQ ID NO: 81), a second primer comprising a nucleic acid sequence of TCAAATCATTGGTGGTGCGA (SEQ ID NO: 82), a third primer comprising a nucleic acid sequence of CTGCGGGGCAATGCCTAGCTGCTCCCGGGGTTTGG (SEQ ID NO: 83), a fourth primer comprising a nucleic acid sequence of

GTAACTGGTCACGCCCAGCTGCCCGTGCGTGTACTCGTTC (SEQ ID NO: 84), a fifth primer comprising a nucleic acid sequence of AGAAAAAACGGGCAGTGCG (SEQ ID NO: 85), a sixth primer comprising a nucleic acid sequence of GGGGCATTAAGTTTAAAAAGAACCC (SEQ ID NO: 86), a seventh primer comprising a nucleic acid sequence of TCCCTCGAGACTCGATTCC (SEQ ID NO: 87), an eighth primer comprising a nucleic acid sequence of GTACGCATCTGTCGGTAGC (SEQ ID NO: 88), a ninth primer comprising a nucleic acid sequence of

GTGCTTTTCGGGAGGATTCCCGAGTGCACTGCGCTCATCT (SEQ ID NO: 90), an eleventh primer comprising a nucleic acid sequence of TTCCGCGTTCGGTGCTC (SEQ ID NO: 91), and a twelfth primer comprising a nucleic acid sequence of CTTTCGGGACGAT GAG AT AAT GC (SEQ ID NO: 92); xi) is a Gardnerella vaginalis infection, then determining the expression level of at least one gene associated with the Gardnerella vaginalis infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of CGGGTTGATATTCCCGTACC (SEQ ID NO: 93), a second primer comprising a nucleic acid sequence of ACATCCCCCGGATTTACCT (SEQ ID NO: 94), a third primer comprising a nucleic acid sequence of

AACCCCGAAAGATAATCAACCAGGGTGTTACACCGTTCGAACTG (SEQ ID NO:

95), a fourth primer comprising a nucleic acid sequence of

AACCCCGAAAGGAAGCCAGCCTAGGTGTTACACCGTTCGAACTG (SEQ ID NO: 97), a sixth primer comprising a nucleic acid sequence of

TCGGT AGT AGGTT AGCGT GGGAGGAC AGCCC AC ACGCTT AG (SEQ ID NO: 98), a seventh primer comprising a nucleic acid sequence of

AT GA AGGTT AGT AC TCTC AGATT (SEQ ID NO: 99), an eighth primer comprising a nucleic acid sequence of

ACGAAGGTTAGTACTCTC AGATT (SEQ ID NO: 100), a ninth primer comprising a nucleic acid sequence of

AT C A AGGTT AGT AC TCTC AGATT (SEQ ID NO: 101), and a tenth primer comprising a nucleic acid sequence of CGGCTGCGGAGGTGGTTTT

(SEQ ID NO: 102); xii) a Candida albicans infection, then determining the expression level of at least one gene associated with the Candida albicans infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of CAATGGAAAGACCCTTCTCAA (SEQ ID NO: 103), a second primer comprising a nucleic acid sequence of GT GGGACT AAGAT AT AAATTGACTT (SEQ ID NO: 104), a third primer

AGGTTTCGTCGTATGAAGTGGTATTCTGATGAAGATACAAATGCT (SEQ ID NO: 105), a fourth primer comprising a nucleic acid sequence of

CAACGAAGTCAATCTGGAACCAAAATTGCTGAAATTTTCGTG (SEQ ID NO: 106), a fifth primer comprising a nucleic acid sequence of GGTGTTGGTGGAACTGA (SEQ ID NO: 107), a sixth primer comprising a nucleic acid sequence of GAGGCATTGACAGATATGAA (SEQ ID NO: 108); xiii) a Mycoplasma genitalium infection, then determining the expression level of at least one gene associated with the Mycoplasma genitalium infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TGGTCACTTCACTCCCTAA (SEQ ID NO: 109), a second primer comprising a nucleic acid sequence of AC A AC AC A ACTT AC AC C AC T A (SEQ ID NO: 110), a third primer comprising a nucleic acid sequence of

GTGCTTTTTCAAACCCTGGTAAAGTACAACATTATTGTTGCAACCG (SEQ ID NO: 112), a fifth primer comprising a nucleic acid sequence of GAAGTTT GTTGT AGTT GGGGGA (SEQ ID NO: 113), a sixth primer comprising a nucleic acid sequence of AGTATCTTGGTCTTG (SEQ ID NO: 114); xiv) a Mycobacterium tuberculosis infection, then determining the expression level of at least one gene associated with the Mycobacterium tuberculosis infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GGGCTTGCCGGGTTTGA (SEQ ID NO: 115), a second primer comprising a nucleic acid sequence of TGGACCCGCCAACAAGAA (SEQ ID NO: 116), a third primer comprising a nucleic acid sequence of

CTCGCTGAACCGGATCGATGTGGCGTACTCGACCTGAAAG (SEQ ID NO: 118), a fifth primer comprising a nucleic acid sequence of CCTATCCGTATGGTGGATAACG (SEQ ID NO: 119), a sixth primer comprising a nucleic acid sequence of GTCGGAAGCTCCTATGACAAT (SEQ ID NO: 120) xv) a Ureaplasma parvum infection, then determining the expression level of at least one gene associated with the Ureaplasma parvum infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TCAAGTCAATTTAGTCCAGGTA (SEQ ID NO: 121), a second primer comprising a nucleic acid sequence of GGAATATCGAAACGTCGTCC (SEQ ID NO: 122), a third primer comprising a nucleic acid sequence of

GACGGTCCCCAGTATTTTTAATACTGCAATTAATTTCGCTAGTGGTG (SEQ ID NO: 123), a fourth primer comprising a nucleic acid sequence of

CAAGTTGGATCACATTTTCACTTGTGCGTTCTTTATCTTCATTTCCTT (SEQ ID NO: 124); a fifth primer comprising a nucleic acid sequence of AATTACTTTTGCCTCTCTACC (SEQ ID NO: 125), a sixth primer comprising a nucleic acid sequence of TGAAGTGAATAGTGCATTAG (SEQ ID NO: 126); xvi) a Ureaplasma urealyticum infection, then determining the expression level of at least one gene associated with the Ureaplasma urealyticum infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of GGTAAATTAGTACCAGGAGCA (SEQ ID NO: 127), a second primer comprising a nucleic acid sequence of AACGACGTCCATAAGCAA (SEQ ID NO: 128), a third primer comprising a nucleic acid sequence of

AGGACGGTCACCAGTATTTTTAATATTAACTTCGCTGAAGGCG (SEQ ID NO:

129), a fourth primer comprising a nucleic acid sequence of

CCAAGTTGGATCACATTTCCACTTCGTTCTTTGTCTTCGTTTCC (SEQ ID NO:

130), a fifth primer comprising a nucleic acid sequence of GCTTCTCTACCTTCGTTCAT (SEQ ID NO: 131), a sixth primer comprising a nucleic acid sequence of AGTGCATTAGTATTCTTTGATGA (SEQ ID NO: 132); xvii) a Human T-lymphotropic virus 1 infection, then determining the expression level of at least one gene associated with the Human T-lymphotropic virus 1 infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of CAGGGGCCCTAATAATTCTACC (SEQ ID NO: 133), a second primer comprising a nucleic acid sequence of AGGGCCCGGAAATCATAGG (SEQ ID NO: 134), a third primer comprising a nucleic acid sequence of AAGGCCCGGAAATCATGGG (SEQ ID NO: 135), a fourth primer comprising a nucleic acid sequence of

TGCCAGGCTGTTAGCGTGACGAAGACTGTTTGCCCACCA (SEQ ID NO: 136), a fifth primer comprising a nucleic acid sequence of

AACGGCCTCCTTCCGTTCCACGTGCCATCGGTAAATGTCC (SEQ ID NO: 138), a seventh primer comprising a nucleic acid sequence of CCTAGCAGGCTGGAAAAGGG (SEQ ID NO: 139), an eighth primer comprising a nucleic acid sequence of CCTAACAGGCTGAAAAAGGG (SEQ ID NO: 140), a ninth primer comprising a nucleic acid sequence of CTCAACCCTCACCACTCCA (SEQ ID NO: 141); xviii) a Human T-lymphotropic virus 2 infection, then determining the expression level of at least one gene associated with the Human T-lymphotropic virus 2 infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TCACCAAGGTGCCTCTAA (SEQ ID NO: 142), a second primer comprising a nucleic acid sequence of GCAAGGGCCGGAAATCAT (SEQ ID NO: 143), a third primer comprising a nucleic acid sequence of

GCCTGGTGTACAGGACTTCTCCCATCGTTGAAGGTCCAT (SEQ ID NO: 147), a seventh primer comprising a nucleic acid sequence of GGTTGGAACATTGTGGTGG (SEQ ID NO: 148), an eighth primer comprising a nucleic acid sequence of TCCATCTTAACAACCCCAGG (SEQ ID NO: 149); xix) a Hepatitis A virus infection, then determining the expression level of at least one gene associated with the Hepatitis A virus infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TGGATTTCTGACACTCCTTAC (SEQ ID NO: 150), a second primer comprising a nucleic acid sequence of T GT AGT A AC ATCC AT AGC AT GA (SEQ ID NO: 151), a third primer comprising a nucleic acid sequence of

TTGACCTCTCCTTCTAACGTTGCACATTCCAAGTTAATTGCTGAA (SEQ ID NO: 153), a fifth primer comprising a nucleic acid sequence of ACCTTTCTGATGTGC (SEQ ID NO: 154), a sixth primer comprising a nucleic acid sequence of TTCCCATGTCAGAGT (SEQ ID NO: 155); xx) a Hepatitis B virus infection, then determining the expression level of at least one gene associated with the Hepatitis B virus infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of CTAGACTCGTGGTGGACTTC (SEQ ID NO: 156), a second primer comprising a nucleic acid sequence of AC A AG A AG AT GAGGC AT AGC A (SEQ ID NO: 157), a third primer comprising a nucleic acid sequence of

T GTT GT C C TC C G AT TT GT C GC AGG AT GC AG AGG A AG A (SEQ ID NO: 159), a fifth primer comprising a nucleic acid sequence of GAATTTTGGCCAAGACACAC (SEQ ID NO: 160), a sixth primer comprising a nucleic acid sequence of TGTGTCTGCGGCGTT (SEQ ID NO: 161); xxi) a Hepatitis C virus infection, then determining the expression level of at least one gene associated with the Hepatitis C virus infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TGGTCTGCGGAACCGG (SEQ ID NO: 162), a second primer comprising a nucleic acid sequence of GGGGCACTCGCAAGCA (SEQ ID NO: 163), a third primer comprising a nucleic acid sequence of

CCGCGAGACTGCTAGCCGATTTTCCCTATCAGGCAGTA (SEQ ID NO: 165), a fifth primer comprising a nucleic acid sequence of AGCGGGTT GAT C C A AGA A AGGAC (SEQ ID NO: 166), a sixth primer comprising a nucleic acid sequence of TGTTGGGTCGCGAAAGGCC (SEQ ID NO: 167) xxii) a Human Papilloma Virus type 16 virus infection, then determining the expression level of at least one gene associated with the Human Papilloma Virus type 16 virus infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of

TT AC AT A AT AGATTGGT GGT GTT (SEQ ID NO: 168), a second primer comprising a nucleic acid sequence of GGTCACGTAGGTCTGTACT (SEQ ID NO: 169), a third primer comprising a nucleic acid sequence of

TTAAGTTTGCACGAGGACGAGAGTATTTTGTCCTGACACACA (SEQ ID NO: 171), a fifth primer comprising a nucleic acid sequence of TCATTAAGCTCATACACTGG (SEQ ID NO: 172), a sixth primer comprising a nucleic acid sequence of ATGGAGACTCTTTGCCA (SEQ ID NO: 173); and xxiii) a Human Papilloma Virus type 18 virus infection, then determining the expression level of at least one gene associated with the Human Papilloma Virus type 16 virus infection in a biological sample from the subject using a LAMP assay comprises using: a first primer comprising a nucleic acid sequence of TACTGGCAGTGGTACAGG (SEQ ID NO: 174), an second primer comprising a nucleic acid sequence of GTGCCAGTAAACGTAGGC (SEQ ID NO: 175), a third primer comprising a nucleic acid sequence of

AGGAC C A AC AT C C AC C ACTGGGTCGT AC AGGGT AC ATT C (SEQ ID NO: 176), a fourth primer comprising a nucleic acid sequence of

14. The method of claim 13, wherein if the infection is: (a) an influenza A infection, then determining the expression level of 18S RNA using a LAMP assay comprises using: a ninth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); a tenth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); an eleventh primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), a thirteenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), and a fourteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24);

(b) an influenza B infection, then determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a ninth primer comprising a nucleic acid sequence of

TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21), a tenth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), and a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24);

(c) a respiratory syncytial virus A infection, then determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

(d) a respiratory syncytial virus B infection, then determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), and an eleventh primer comprising a nucleic acid sequence of

AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24);

(e) a gonorrhea infection, then determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

(f) a chlamydia infection, then determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

(g) a trichomoniasis infection, then determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24);

(h) a herpes simplex 1 infection, then determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a ninth primer comprising a nucleic acid sequence of

(i) a herpes simplex 2 infection, then determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a ninth primer comprising a nucleic acid sequence of

(j) a syphilis infection, then determining the expression level of 18S RNA using a LAMP assay comprises using: a thirteenth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), an fourteenth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a fifteenth primer comprising a nucleic acid sequence of

TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21), a sixteenth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an seventeenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), and an eighteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24);

(k) a Gardnerella vaginalis, then determining the expression level of 18S RNA using a LAMP assay comprises using: an eleventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an twelfth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a thirteenth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), a fifteenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a sixteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24); l) a Candida albicans, then determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of

AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24); m) a Mycoplasma genitalium, then determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24); n) a Mycobacterium tuberculosis, then determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24); o) . a Ureaplasma parvum, then determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24); p) a Ureaplasma urealyticum, then determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24); q) a Human T-lymphotropic virus 1, then determining the expression level of 18S RNA using a LAMP assay comprises using: a tenth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eleventh primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a twelfth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), a fourteenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), an fifteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24); r) a Human T-lymphotropic virus 2, then determining the expression level of 18S RNA using a LAMP assay comprises using: a ninth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an tenth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); an eleventh primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), a thirteenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a fourteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24); s) a Hepatitis A, then determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24); t) a Hepatitis B, then determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21); a tenth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24); u) a Hepatitis C, then determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24); v) a Human Papilloma Virus type 16, then determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24); and w) a Human Papilloma Virus type 18, then determining the expression level of 18S RNA using a LAMP assay comprises using: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

15. The method of any one of the claims 1-14, wherein the LAMP assay is a reverse transcriptase LAMP (RT-LAMP) assay, wherein the RT-LAMP assay comprises the use of Bacillus Stearothermophilus (Bst) DNA Polymerase and an intercalating DNA dye

16. The method of claim 13, further comprising a step of administering an effective treatment to the subject in which the presence of the infection is detected, wherein the effective treatment is an antiviral drug, an antibiotic, an antibody or a fragment thereof, a steroid medication, convalescent plasma or a combination thereof.

17. The method of claim 15, wherein the LAMP assay is a multiplexed LAMP assay, wherein the multiplexed LAMP assay comprises use of: a) a plurality of locked nucleotide beacon probes; or b) a plurality of quenched fluorophore probes.

18. A kit for detecting the presence or absence of a SARS-CoV-2 infection in a sample from a subject, wherein the kit comprises: a) a test primer mix, wherein the primer mix comprises (i) a set of at least six primers that bind to a SARS-CoV-2 ORF1 gene, a SARS-CoV-2 N gene, or a SARS-CoV-2 E gene or a combination thereof, in the SARS-Cov-2 single strand RNA genome and (ii) a set of at least six primers that bind to 18S RNA; b) enzyme mixture of a reverse transcriptase and a Bst (Bacillus Stearothermophilus) DNA polymerase; c) an DNA intercalating dye; and d) a nucleotide mixture, wherein the primer mix comprises: a first primer comprising a nucleic acid sequence of ACCAGGAACTAATCAGACAAG (SEQ ID NO: 1), a second primer comprising a nucleic acid sequence of GACTTGATCTTTGAAATTTGGATCT (SEQ ID NO: 2), a third primer comprising a nucleic acid sequence of

CGC ATT GGC ATGGAAGTC AC AATTT GAT GGC ACCTGTGT A (SEQ ID NO: 4), and/or a fifth primer comprising a nucleic acid sequence of GGGGGCAAATTGTGCAATTTG (SEQ ID NO: 5), a sixth primer comprising a nucleic acid sequence of CTTCGGGAACGTGGTTGACC

(SEQ ID NO: 6), and/or a seventh primer comprising a nucleic acid sequence of

TGAGTACGAACTTATGTACTCAT (SEQ ID NO: 7), an eighth primer comprising a nucleic acid sequence of TTCAGATTTTTAACACGAGAGT (SEQ ID NO: 8), a ninth primer comprising a nucleic acid sequence of

ACC ACGAAAGC AAGAAAAAGAAGTTCGTTTCGGAAGAGAC AG (SEQ ID NO:

9), a tenth primer comprising a nucleic acid sequence of

TTGCTAGTTACACTAGCCATCCTTAGGTTTTACAAGACTCACGT (SEQ ID NO:

10), and/or an eleventh primer comprising a nucleic acid sequence of CGCTATTAACTATTAACG (SEQ ID NO: 11), a twelfth primer comprising a nucleic acid sequence of CGCGCTTCGATTGTGTGCGT (SEQ ID NO: 12), and/or a thirteenth primer comprising a nucleic acid sequence of CGGTGGACAAATTGTCAC (SEQ ID NO: 13), a fourteenth primer comprising a nucleic acid sequence of CTTCTCTGGATTTAACACACTT (SEQ ID NO: 14), a fifteenth primer comprising a nucleic acid sequence of

TATTGGTGGAGCTAAACTTAAAGCCTTTTCTGTACAATCCCTTTGAGTG (SEQ ID NO: 16), and/or a seventeenth primer comprises a seventeenth nucleic acid sequence of TTACAAGCTTAAAGAATGTCTGAACACT (SEQ ID NO: 17), an eighteenth primer comprising a nucleic acid sequence of TTGAATTT AGGT GAAAC ATTT GT C ACG (SEQ ID NO: 18).

19. The kit of claim 18, wherein the primer mix comprises: a nineteenth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), a twentieth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a twenty-first primer comprising a nucleic acid sequence of

TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21), a twenty-second primer comprising a nucleic acid sequence of GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22); and/or a twenty-third primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23); and a twenty-fourth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24).

20. A kit for detecting the presence or absence of an infection in a sample from a subject, wherein the kit comprises: a) a test primer mix, wherein the primer mix comprises (i) a set of at least six primers that bind to at least one gene, in the genome of a biological agent causing the infection, and (ii) a set of at least six primers, wherein the primers bind to 18S RNA; b) enzyme mixture of a reverse transcriptase and a Bst (Bacillus Stearothermophilus) DNA polymerase; c) an intercalating DNA dye; and d) a nucleotide mixture, wherein if the infection is any one of: i) an influenza A infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of GACTTGAAGATGTCTTTGC (SEQ ID NO: 25), a second primer comprising a nucleic acid sequence of TRTTATTTGGGTCTCCATT (SEQ ID NO: 26), a third primer comprising a nucleic acid sequence of

TTGTKTTCACGCTCACCGTGTTTGGACAAAGCGTCTACG (SEQ ID NO: 28), and/or a fifth primer comprising a nucleic acid sequence of GTCTTGTCTTTAGCCA (SEQ ID NO: 29), a sixth primer comprising a nucleic acid sequence of CMAGTGAGCGAGGACTG (SEQ ID NO: 30), and/or a seventh primer comprising a nucleic acid sequence of GACTGGAAAGTGTCTTTGC (SEQ ID NO: 31), an eighth primer comprising a nucleic acid sequence of TRTTGTTTGGGTCCCCATT (SEQ ID NO: 32); ii) an influenza B infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of GCAACCAATGCCACCATA (SEQ ID NO: 33), a second primer comprising a nucleic acid sequence of TTCTCTCTTCAAGRGACATC (SEQ ID NO: 34), a third primer comprising a nucleic acid sequence of

T AGTC A AGGGC Y C TTTGC C AC TTTGA AGC AGGA ATTC T GGA (SEQ ID NO: 35), a fourth primer comprising a nucleic acid sequence of CAAGACCGCCTAAACAGACTAAACTTTTACTTTCAGGCTCACTT TGAAAGYCTTTCATAGCAC (SEQ ID NO: 36), a fifth primer comprising a nucleic acid sequence of TGAAAGYCTTTCATAGCAC (SEQ ID NO: 37), a sixth primer comprising a nucleic acid sequence of CAAGAATAAAGACTCACAAC (SEQ ID NO: 38); iii) a respiratory syncytial virus A infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of GAGTTGAAGGGATTTTTGCA (SEQ ID NO: 39), a second primer comprising a nucleic acid sequence of T GGGTT GTT C A AT AT AT GGT AG A (SEQ ID NO: 40), and/or a third primer comprising a nucleic acid sequence of

TAACTGATTTTGCTAAGACCCCCGGATTGTTTATGAATGCCTATGG (SEQ ID NO: 41), a fifth primer comprising a nucleic acid sequence of GAGGT GT ATGAGT AT GCTC AGA (SEQ ID NO: 43), a sixth primer comprising a nucleic acid sequence of CACCGTAACATCACTTG (SEQ ID NO: 44) a fourth primer comprising a nucleic acid sequence of

CAAGCAGAAATGGAACAAGTTGTGCTGCTTCTCCACCCAATT (SEQ ID NO: 42); iv) a respiratory syncytial virus B infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of

T GAC AT C AG A A AT AC A AGT C A AT (SEQ ID NO: 45), a second primer comprising a nucleic acid sequence of CGTTTTTTAAGACATTGTTTGCC (SEQ ID NO: 46), a third primer comprising a nucleic acid sequence of

GCTGCCCTTGTAATAACCAAATTAGCTCCTAATTACTGCAGTAAGACC (SEQ ID NO: 48), and/or a fifth primer comprising a nucleic acid sequence of CAGCAGGAGATAGATCA (SEQ ID NO: 49), a sixth primer comprising a nucleic acid sequence of GAGCCACTTCTCCCATC (SEQ ID NO: 50); v) a gonorrhea infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of CCATTGATCCTTGGGACAG (SEQ ID NO: 51), a second primer comprising a nucleic acid sequence of CAGACCGGCATAATACACAT (SEQ ID NO: 52), a third primer comprising a nucleic acid sequence of

AGCGGCAGCATTCAATTTGTTCCTGATTACTTTCCAGCGTGA (SEQ ID NO: 54), and/or a fifth primer comprising a nucleic acid sequence of ATACCGTCGTGGCGTTTG (SEQ ID NO: 55), a sixth primer comprising a nucleic acid sequence of CGCCTATACGCCTGCTAC (SEQ ID NO: 56); vi) a chlamydia infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of AATATCATCTTTGCGGTTGC (SEQ ID NO: 57), a second primer comprising a nucleic acid sequence of TCTACAAGAGTACATCGGTCA (SEQ ID NO: 58), a third primer comprising a nucleic acid sequence of

GC AGC TT GT AGT C C TGC TT G AGGG AGC G AGT T AC G A AG A (SEQ ID NO: 60), and/or a fifth primer comprising a nucleic acid sequence of TAC AAACGCCTAGGGTGC (SEQ ID NO: 61), a sixth primer comprising a nucleic acid sequence of GTTAAGGCAAATCGCCCG (SEQ ID NO: 62); vii) a trichomoniasis infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of GCTTCTCACAGAGCGTGG (SEQ ID NO: 63), a second primer comprising a nucleic acid sequence of GCTCATTGCCGATTGTGATG (SEQ ID NO: 64), a third primer comprising a nucleic acid sequence of

T GCTGAAATGGAGAAGGCCGCCGTTGCC ATCTGGAAGTGT G (SEQ ID NO: 66), and/or a fifth primer comprising a nucleic acid sequence of CTTGATGTCACGAACGATTTCCTTT (SEQ ID NO: 67), a sixth primer comprising a nucleic acid sequence of TACAGACTCCTCCATCAACGT (SEQ ID NO: 68); viii) a herpes simplex 1 infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of GCCGTTGTTCCCATTATCCC (SEQ ID NO: 69), a second primer comprising a nucleic acid sequence of TACTTGGCATGGGGGGTG (SEQ ID NO: 70), a third primer comprising a nucleic acid sequence of

GGTCGTCCCTCGCATGAAGCGGCGTGGTAAGGCTGATG (SEQ ID NO: 72), and/or a fifth primer comprising a nucleic acid sequence of TTGGTGGGAACCCCCGATAC (SEQ ID NO:73), a sixth primer comprising a nucleic acid sequence of AACATGACCCAGACCGGCAC (SEQ ID NO: 74); ix) a herpes simplex 2 infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of TCAGCCCATCCTCCTTCG (SEQ ID NO: 75), a second primer comprising a nucleic acid sequence of CCCACCTCTACCCACAAC (SEQ ID NO: 76), a third primer comprising a nucleic acid sequence of

AAATGCTTCCCTGCTGGTGCCCGCCGAGTTCGATCTGGT (SEQ ID NO: 78), and/or a fifth primer comprising a nucleic acid sequence of CACGTCTTTGGGGACGGCGGC (SEQ ID NO: 79), a sixth primer comprising a nucleic acid sequence of ATCTGGGACCGCGCCGCGGAGAC (SEQ ID NO: 80); x) a syphilis infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of TGCAGTCTTTTTTTGTGCGG (SEQ ID NO: 81), a second primer comprising a nucleic acid sequence of TCAAATCATTGGTGGTGCGA (SEQ ID NO: 82), a third primer comprising a nucleic acid sequence of CTGCGGGGCAATGCCTAGCTGCTCCCGGGGTTTGG (SEQ ID NO: 83), a fourth primer comprising a nucleic acid sequence of

GTAACTGGTCACGCCCAGCTGCCCGTGCGTGTACTCGTTC (SEQ ID NO: 84), and/or a fifth primer comprising a nucleic acid sequence of AGAAAAAACGGGCAGTGCG (SEQ ID NO: 85), a sixth primer comprising a nucleic acid sequence of GGGGCATTAAGTTTAAAAAGAACCC (SEQ ID NO: 86), and/or a seventh primer comprising a nucleic acid sequence of TCCCTCGAGACTCGATTCC (SEQ ID NO: 87), an eighth primer comprising a nucleic acid sequence of GTACGCATCTGTCGGTAGC (SEQ ID NO: 88), and/or a ninth primer comprising a nucleic acid sequence of

GTGCTTTTCGGGAGGATTCCCGAGTGCACTGCGCTCATCT (SEQ ID NO: 90), and/or an eleventh primer comprising a nucleic acid sequence of TTCCGCGTTCGGTGCTC (SEQ ID NO: 91), a twelfth primer comprising a nucleic acid sequence of CTTTCGGGACGAT GAG AT AAT GC (SEQ ID NO: 92); xi) a Gardnerella vaginalis infection, then the test primer mix comprises:

.a first primer comprising a nucleic acid sequence of CGGGTTGATATTCCCGTACC (SEQ ID NO: 93), a second primer comprising a nucleic acid sequence of ACATCCCCCGGATTTACCT (SEQ ID NO: 94), a third primer comprising a nucleic acid sequence of

AACCCCGAAAGATAATCAACCAGGGTGTTACACCGTTCGAACTG (SEQ ID NO:

95), a fourth primer comprising a nucleic acid sequence of

TCGGT AGT AGGTT AGCGT GGGAGGAC AGCCC AC ACGCTT AG (SEQ ID NO: 98), and/or a seventh primer comprising a nucleic acid sequence of AT GA AGGTT AGT AC TCTC AGATT (SEQ ID NO: 99), an eighth primer comprising a nucleic acid sequence of ACGAAGGTTAGTACTCTC AGATT (SEQ ID NO: 100), a ninth primer comprising a nucleic acid sequence of AT C A AGGTT AGT AC TCTC AGATT (SEQ ID NO: 101), a tenth primer comprising a nucleic acid sequence of CGGCTGCGGAGGTGGTTTT (SEQ ID NO: 102); xii) a Candida albicans infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of CAATGGAAAGACCCTTCTCAA (SEQ ID NO: 103), a second primer comprising a nucleic acid sequence of GT GGGACT AAGAT AT AAATTGACTT (SEQ ID NO: 104), a third primer

CAACGAAGTCAATCTGGAACCAAAATTGCTGAAATTTTCGTG (SEQ ID NO: 106); and/or a fifth primer comprising a nucleic acid sequence of GGTGTTGGTGGAACTGA (SEQ ID NO: 107), a sixth primer comprising a nucleic acid sequence of GAGGCATTGACAGATATGAA (SEQ ID NO: 108); xiii) a Mycoplasma genitalium infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of TGGTCACTTCACTCCCTAA (SEQ ID NO: 109), a second primer comprising a nucleic acid sequence of AC A AC AC A ACTT AC AC C AC T A (SEQ ID NO: 110), a third primer comprising a nucleic acid sequence of

GTGCTTTTTCAAACCCTGGTAAAGTACAACATTATTGTTGCAACCG (SEQ ID NO: 112), and/or a fifth primer comprising a nucleic acid sequence of GAAGTTT GTTGT AGTT GGGGGA (SEQ ID NO: 113), a sixth primer comprising a nucleic acid sequence of AGTATCTTGGTCTTG (SEQ ID NO: 114); xiv) a Mycobacterium tuberculosis infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of GGGCTTGCCGGGTTTGA (SEQ ID NO: 115), a second primer comprising a nucleic acid sequence of TGGACCCGCCAACAAGAA (SEQ ID NO: 116), a third primer comprising a nucleic acid sequence of TCCAACCGTCGGTCGGAGCATAGGCCGTTGATCGTCTCG (SEQ ID NO: 117), a fourth primer comprising a nucleic acid sequence of

CTCGCTGAACCGGATCGATGTGGCGTACTCGACCTGAAAG (SEQ ID NO: 118), and/or a fifth primer comprising a nucleic acid sequence of

CCTATCCGTATGGTGGATAACG (SEQ ID NO: 119), a sixth primer comprising a nucleic acid sequence of GTCGGAAGCTCCTATGACAAT (SEQ ID NO: 120); xv) a Ureaplasma parvum infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of TCAAGTCAATTTAGTCCAGGTA (SEQ ID NO: 121), a second primer comprising a nucleic acid sequence of GGAATATCGAAACGTCGTCC (SEQ ID NO: 122), a third primer comprising a nucleic acid sequence of

CAAGTTGGATCACATTTTCACTTGTGCGTTCTTTATCTTCATTTCCTT (SEQ ID NO: 124), and/or a fifth primer comprising a nucleic acid sequence of AATTACTTTTGCCTCTCTACC (SEQ ID NO: 125), a sixth primer comprising a nucleic acid sequence of TGAAGTGAATAGTGCATTAG (SEQ ID NO: 126); xvi) a Ureaplasma urealyticum infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of GGTAAATTAGTACCAGGAGCA (SEQ ID NO: 127), a second primer comprising a nucleic acid sequence of AACGACGTCCATAAGCAA (SEQ ID NO: 128), a third primer comprising a nucleic acid sequence of

AGGACGGTCACCAGTATTTTTAATATTAACTTCGCTGAAGGCG (SEQ ID NO:

129), a fourth primer comprising a nucleic acid sequence of

CCAAGTTGGATCACATTTCCACTTCGTTCTTTGTCTTCGTTTCC (SEQ ID NO:

130), a fifth primer comprising a nucleic acid sequence of GCTTCTCTACCTTCGTTCAT (SEQ ID NO: 131), a sixth primer comprising a nucleic acid sequence of AGTGCATTAGTATTCTTTGATGA (SEQ ID NO: 132); xvii) a Human T-lymphotropic virus 1 infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of CAGGGGCCCTAATAATTCTACC (SEQ ID NO: 133), a second primer comprising a nucleic acid sequence of AGGGCCCGGAAATCATAGG (SEQ ID NO: 134), a third primer comprising a nucleic acid sequence of AAGGCCCGGAAATCATGGG (SEQ ID NO: 135), a fourth primer comprising a nucleic acid sequence of

AACGGCCTCCTTCCGTTCCACGTGCCATCGGTAAATGTCC (SEQ ID NO: 138), and/or a seventh primer comprising a nucleic acid sequence of CCTAGCAGGCTGGAAAAGGG (SEQ ID NO: 139), an eighth primer comprising a nucleic acid sequence of CCTAACAGGCTGAAAAAGGG (SEQ ID NO: 140), a ninth primer comprising a nucleic acid sequence of CTCAACCCTCACCACTCCA (SEQ ID NO: 141); xviii) a Human T-lymphotropic virus 2 infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of TCACCAAGGTGCCTCTAA (SEQ ID NO: 142), an second primer comprising a nucleic acid sequence of GCAAGGGCCGGAAATCAT (SEQ ID NO: 143), a third primer comprising a nucleic acid sequence of

GCCTGGTGTACAGGACTTCTCCCATCGTTGAAGGTCCAT (SEQ ID NO: 147), and/or a seventh primer comprising a nucleic acid sequence of GGTTGGAACATTGTGGTGG (SEQ ID NO: 148), an eighth primer comprising a nucleic acid sequence of TCCATCTTAACAACCCCAGG (SEQ ID NO: 149); xix) a Hepatitis A virus infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of TGGATTTCTGACACTCCTTAC (SEQ ID NO: 150), a second primer comprising a nucleic acid sequence of T GT AGT A AC ATCC AT AGC AT GA (SEQ ID NO: 151), a third primer comprising a nucleic acid sequence of

TTGACCTCTCCTTCTAACGTTGCACATTCCAAGTTAATTGCTGAA (SEQ ID NO: 153), and/or a fifth primer comprising a nucleic acid sequence of ACCTTTCTGATGTGC (SEQ ID NO: 154), a sixth primer comprising a nucleic acid sequence of TTCCCATGTCAGAGT (SEQ ID NO: 155); xx) a Hepatitis B virus infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of CTAGACTCGTGGTGGACTTC (SEQ ID NO: 156), a second primer comprising a nucleic acid sequence of AC A AG A AG AT GAGGC AT AGC A (SEQ ID NO: 157), a third primer comprising a nucleic acid sequence of

TGTTGTCCTCCGATTTGTCGCAGGATGCAGAGGAAGA (SEQ ID NO: 159), and/or a fifth primer comprising a nucleic acid sequence of GAATTTTGGCCAAGACACAC (SEQ ID NO: 160), a sixth primer comprising a nucleic acid sequence of TGTGTCTGCGGCGTT (SEQ ID NO: 161); xxi) a Hepatitis C virus infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of TGGTCTGCGGAACCGG (SEQ ID NO: 162), a second primer comprising a nucleic acid sequence of GGGGCACTCGCAAGCA (SEQ ID NO: 163), a third primer comprising a nucleic acid sequence of

CCGCGAGACTGCTAGCCGATTTTCCCTATCAGGCAGTA (SEQ ID NO: 165), and/or a fifth primer comprising a nucleic acid sequence of AGCGGGTT GAT C C A AGA A AGGAC (SEQ ID NO: 166), a sixth primer comprising a nucleic acid sequence of TGTTGGGTCGCGAAAGGCC (SEQ ID NO: 167); xxii) a Human Papilloma Virus type 16 infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of TT AC AT A AT AGATTGGT GGT GTT (SEQ ID NO: 168), a second primer comprising a nucleic acid sequence of GGTCACGTAGGTCTGTACT (SEQ ID NO: 169), a third primer comprising a nucleic acid sequence of

TTAAGTTTGCACGAGGACGAGAGTATTTTGTCCTGACACACA (SEQ ID NO: 171); and/or a fifth primer comprising a nucleic acid sequence of TCATTAAGCTCATACACTGG (SEQ ID NO: 172), a sixth primer comprising a nucleic acid sequence of ATGGAGACTCTTTGCCA (SEQ ID NO: 173); and xxiii) a Human Papilloma Virus type 18 infection, then the test primer mix comprises: a first primer comprising a nucleic acid sequence of TACTGGCAGTGGTACAGG (SEQ ID NO: 174), a second primer comprising a nucleic acid sequence of GTGCCAGTAAACGTAGGC (SEQ ID NO: 175), a third primer comprising a nucleic acid sequence of

ACACGTCCCCCAGTGGTTATCCACACTGGAGTCCTCTA (SEQ ID NO: 177), and/or a fifth primer comprising a nucleic acid sequence of TACATTCCATTGGGTGGGC (SEQ ID NO: 178), a sixth primer comprising a nucleic acid sequence of TGTTACATTAATAGAGGA (SEQ ID NO: 179).

21. The kit of claim 20, wherein the infection is:

(a) an influenza A infection, then the test primer mix comprises: a ninth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); a tenth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); an eleventh primer comprising a nucleic acid sequence of

TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21) a twelfth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), a thirteenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a fourteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24);

(b) an influenza B infection, then the test primer mix comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a ninth primer comprising a nucleic acid sequence of

(c) a respiratory syncytial virus A infection, then the test primer mix comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a ninth primer comprising a nucleic acid sequence of

(d) a respiratory syncytial virus B infection, then the test primer mix comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

(e) a gonorrhea infection, then the test primer mix comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a ninth primer comprising a nucleic acid sequence of

(f) a chlamydia infection, then the test primer mix comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

(g) a trichomoniasis infection, then the test primer mix comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a ninth primer comprising a nucleic acid sequence of

(h) a herpes simplex 1 infection, then the test primer mix comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a ninth primer comprising a nucleic acid sequence of

(i) a herpes simplex 2 infection, then the test primer mix comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a ninth primer comprising a nucleic acid sequence of

(j) a syphilis infection, then the test primer mix comprises: a thirteenth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), a fourteenth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a fifteenth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), a seventeenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), an eighteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24);

(k) a Gardnerella vaginalis infection, then the test primer mix comprises: an eleventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), an twelfth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a thirteenth primer comprising a nucleic acid sequence of

TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG (SEQ ID NO: 21), a fourteenth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), a fifteenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), and a sixteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24);

(l) a Candida albicans infection, then the test primer mix comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

(m) a Mycoplasma genitalium infection, then the test primer mix comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

(n) a Mycobacterium tuberculosis infection, then the test primer mix comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a ninth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24); (o) a Ureaplasma parvum infection, then the test primer mix comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a ninth primer comprising a nucleic acid sequence of

(p) a Ureaplasma urealyticum infection, then the test primer mix comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a ninth primer comprising a nucleic acid sequence of

(q) a Human Tdymphotropic virus 1 infection, then the test primer mix comprises: a tenth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19); an eleventh primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20); a twelfth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), a fourteenth primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), an fifteenth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24);

(r) a Human T-lymphotropic virus 2 infection, then the test primer mix comprises: a ninth primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), a tenth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), an eleventh primer comprising a nucleic acid sequence of

(r) a Hepatitis A virus infection, then the test primer mix comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a ninth primer comprising a nucleic acid sequence of

(s) a Hepatitis B virus infection, then the test primer mix comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a ninth primer comprising a nucleic acid sequence of

(t) a Hepatitis C virus infection, then the test primer mix comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a ninth primer comprising a nucleic acid sequence of

(u) a Human Papilloma Virus type 16 infection, then the test primer mix comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a ninth primer comprising a nucleic acid sequence of

GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG (SEQ ID NO: 22), an eleventh primer comprising a nucleic acid sequence of AGAACCGCGGTCCTATTCCATTATT (SEQ ID NO: 23), and a twelfth primer comprising a nucleic acid sequence of ATTCCTTGGACCGGCGCAAG (SEQ ID NO: 24); and

(v) a Human Papilloma Virus type 18 infection, then the test primer mix comprises: a seventh primer comprising a nucleic acid sequence of GTTCAAAGCAGGCCCGAG (SEQ ID NO: 19), an eighth primer comprising a nucleic acid sequence of CCTCCGACTTTCGTTCTTGA (SEQ ID NO: 20), a ninth primer comprising a nucleic acid sequence of