WO2022229817A1 - Vaccins comprenant des particules pseudo-virales présentant des antigènes du sars-cov-2 et leurs méthodes d'utilisation - Google Patents

Vaccins comprenant des particules pseudo-virales présentant des antigènes du sars-cov-2 et leurs méthodes d'utilisation Download PDF

Info

Publication number
WO2022229817A1
WO2022229817A1 PCT/IB2022/053821 IB2022053821W WO2022229817A1 WO 2022229817 A1 WO2022229817 A1 WO 2022229817A1 IB 2022053821 W IB2022053821 W IB 2022053821W WO 2022229817 A1 WO2022229817 A1 WO 2022229817A1
Authority
WO
WIPO (PCT)
Prior art keywords
cov
sars
seq
vlp
antigen
Prior art date
Application number
PCT/IB2022/053821
Other languages
English (en)
Inventor
Ariane Volkmann
Adam Frederik Sander Bertelsen
Original Assignee
Bavarian Nordic A/S
Adaptvac Aps
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bavarian Nordic A/S, Adaptvac Aps filed Critical Bavarian Nordic A/S
Publication of WO2022229817A1 publication Critical patent/WO2022229817A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5258—Virus-like particles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55555—Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
    • A61K2039/6031—Proteins
    • A61K2039/6075—Viral proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/64—Medicinal preparations containing antigens or antibodies characterised by the architecture of the carrier-antigen complex, e.g. repetition of carrier-antigen units
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02—Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/735—Fusion polypeptide containing domain for protein-protein interaction containing a domain for self-assembly, e.g. a viral coat protein (includes phage display)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20071—Demonstrated in vivo effect
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00—Bacteriophages
    • C12N2795/00011—Details
    • C12N2795/18011—Details ssRNA Bacteriophages positive-sense
    • C12N2795/18023—Virus like particles [VLP]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00—Bacteriophages
    • C12N2795/00011—Details
    • C12N2795/18011—Details ssRNA Bacteriophages positive-sense
    • C12N2795/18041—Use of virus, viral particle or viral elements as a vector
    • C12N2795/18042—Use of virus, viral particle or viral elements as a vector virus or viral particle as vehicle, e.g. encapsulating small organic molecule

Definitions

  • the present invention relates to vaccines comprising virus-like particles displaying at least one SARS-CoV-2 antigen, such as the receptor-binding domain (RBD) of the SARS- CoV-2 spike protein.
  • Antigens are displayed on virus-like particles (VLPs) comprising AP205 using a peptide tag and binding partner.
  • VLPs virus-like particles
  • the invention also relates to methods of treatment using the VLPs to treat and/or prevent infection with the SARS-CoV-2 virus and variants thereof.
  • the invention further relates to medical uses of the recombinant VLPs in the prevention of COVID-19.
  • SARS-CoV-2 was described soon after a series of unidentified pneumonia diseases had occurred in Wuhan, China, at the end of 2019 (Zhou et al. (2020) Nature 579: 270-3). Typical clinical symptoms were reported to be fever, dry cough, dyspnea, headache, and pneumonia, and the infection occasionally resulted in progressive respiratory failure due to alveolar damage and even death (Zhou et al. (2020) Nature 579: 270-3). Moreover, olfactory and gustatory disorders are regarded as strong specific symptoms (Lechien et al. (2020) Eur. Arch. Otorhinolaryngol. 6: 1-11).
  • COVID-19 similar to the diseases caused by SARS-CoV-1 and MERS-CoV, is considered to have its origin in a zoonotic transfer of the causative virus from its natural reservoir host, most likely bats, to humans, possibly via an intermediate mammalian host.
  • SARS-CoV-2 Due to the fact that COVID-19 appeared only recently, the knowledge and understanding of the disease and its causative virus, SARS-CoV-2, is limited.
  • SARS-CoV-2 belongs to the Coronaviridae family, a family of positive-sense, single- stranded RNA viruses. Like other coronaviruses, SARS-CoV-2 is characterized by a crown like (“corona”) appearance when viewed by electron microscopy which is produced by the spikes extruding from the virus surface. Such spike (S) proteins are essential for attachment and entry of the virus into host cells.
  • the SARS-CoV-2 S protein is a large type I transmembrane protein composed of two subunits, SI and S2.
  • the SI subunit contains a receptor-binding domain (RBD) that mediates virus attachment to the host cell receptor.
  • the S2 subunit (ectodomain) mediates fusion between the viral and host cell membranes.
  • SARS-CoV-2 plays a key role in the induction of neutralizing antibodies, T cell responses and protective immunity.
  • the entry of SARS-CoV-2 into host cells involves a series of conformational changes upon binding to the cellular receptor angiotensin-converting enzyme 2 (ACE), and eventually the S protein undergoes a substantial structural rearrangement from the prefusion to the postfusion conformation (Wrapp et al. (2020) Science 367: 1260-3).
  • ACE angiotensin-converting enzyme 2
  • antibodies against the prefusion form of S are considered to be much more effective than those against the postfusion form, which renders the prefusion form of SARS-CoV-2 S the preferred antigenic conformation of S for a vaccine.
  • RBD within the S protein forms the main target for the induction of neutralizing antibody responses, which correlate with disease outcome in macaques (Mercado et al. (2020) Nature 586: 583- 88).
  • peptide tags and binding partners for linking or attaching proteins to each other and other entities is a useful tool of molecular biology and can be used, inter alia , for generating capsid-like particles or virus-like particles (VLPs) covered with proteins, for example, as described in WO 2016/112921.
  • Peptide tags and binding partners can be used to display molecules such as antigens on the surface of VLPs, including for use in vaccines.
  • Some peptide tag and binding partner pairs interact via an isopeptide bond that can form spontaneously and provide a stable or irreversible bond between the peptide tag and its binding partner.
  • Isopeptide bonds are amide bonds formed between carboxyl/carboxamide and amino groups, where at least one of the carboxyl or amino groups is outside of the main chain of the protein that forms the “backbone” of the protein. These bonds are resistant to most proteases and chemically irreversible under normal biological conditions.
  • peptide tags and binding partners that form isopeptide bonds
  • other peptides or molecules that are attached to the peptide tag and/or the binding partner are also linked to each other via the interaction between the peptide tag and binding partner.
  • peptide tags and binding partners can be used to attach molecules such as antigens to VLPs, for example, for use in vaccines.
  • VLPs decorated with the SARS-CoV-2 RBD have been described by Fougeroux et al. (2021) Nat. Commun. 12: 324.
  • the invention provides vaccines comprising virus-like particles displaying at least one SARS-CoV-2 antigen.
  • a SARS-CoV-2 antigen is any antigen that produces an immune response to SARS-CoV-2, such as, for example, the receptor-binding domain (RBD) of the SARS-CoV-2 spike protein or a portion thereof.
  • Antigens are displayed on virus-like particles (VLPs) comprising the RNA bacteriophage AP205 coat protein (“AP205”) using a peptide tag and binding partner.
  • the peptide tag and binding partner comprise the amino acid sequences set forth in SEQ ID NO: 4 and SEQ ID NO: 6, respectively.
  • the invention also provides methods of treatment using the VLPs of the invention and use of the VLPs to treat and/or prevent infection with the SARS-CoV-2 virus and variants thereof.
  • the invention further provides medical uses of the VLPs in the prevention and/or amelioration of COVID-19 symptoms.
  • the invention provides a virus-like particle (VLP) comprising an AP205 protein fused to a peptide tag and comprising a SARS-CoV-2 antigen fused to a peptide binding partner, whereby the SARS-CoV-2 antigen is displayed on the surface of said VLP.
  • VLP virus-like particle
  • the invention provides a virus-like particle (VLP) comprising: (a) an AP205 protein fused to a peptide tag having the amino acid sequence set forth in SEQ ID NO:4, or a derivative thereof; and (b) a SARS-CoV-2 antigen fused to a peptide binding partner having the amino acid sequence set forth in SEQ ID NO: 6, or a derivative thereof, whereby the SARS-CoV-2 antigen is displayed on the surface of said VLP, that when administered to a subject as a vaccine stimulates a response that prevents or alleviates symptoms of coronavirus infection caused by SARS-CoV-2 variants B.1.1.7 and/or B.1.351.
  • VLP virus-like particle
  • VLP virus-like particle
  • an AP205 protein fused to a peptide tag (i) an AP205 protein fused to a peptide tag; and (ii) a SARS-CoV-2 antigen comprising the wild-type (Wuhan) spike protein Receptor Binding Domain (RBD), whereby the SARS-CoV- 2 antigen is displayed on the surface of said VLP; and that when administered to a subject as a vaccine stimulates an immune response that prevents or alleviates symptoms of coronavirus infection caused by SARS-CoV-2 variants such as B.1.1.7, B.1.351, and/or B 1.617.2.
  • SARS-CoV-2 variants such as B.1.1.7, B.1.351, and/or B 1.617.2.
  • the invention provides a vaccine comprising the VLP according to the invention in an aqueous solution that contains no squalene (i.e., that does not contain any squalene).
  • the invention provides a method of treating a subject to prevent or ameliorate symptoms of a coronavirus infection, preferably coronavirus disease 19 (COVID-19), comprising the step of administering the vaccine according to the invention to a subject.
  • a coronavirus infection preferably coronavirus disease 19 (COVID-19)
  • COVID-19 coronavirus disease 19
  • the invention provides a VLP according to the invention, or a vaccine according to the invention, for use in the prevention or treatment of a coronavirus infection, preferably coronavirus disease 19 (COVID-19).
  • a coronavirus infection preferably coronavirus disease 19 (COVID-19).
  • FIG. 1 diagrams the construction of VLPs; in this example, the VLP comprises AP205 coat protein fused to a peptide tag; the VLP is coated with SARS-CoV-2 RBD antigen genetically fused to a binding partner (“catcher”).
  • the components were produced by recombinant expression; the Spike Receptor Binding Domain (“RBD”) antigen was produced in Drosophila S2 cells, and the virus-like particle was produced in E. coli.
  • the components were then mixed, and the peptide tag and binding partner fused together in a spontaneous reaction that resulted in an isopeptide bond. This spontaneous covalent irreversible binding between the peptide tag and binding partner produces the VLP display, which provides high density, ordered, directional display of antigens and is highly immunogenic.
  • FIG. 2 shows results from experiments described in Example 2, in which non human primates were vaccinated with VLPs according to the invention. Subjects were then monitored for production of RBD-binding antibodies and CoV-2 neutralizing antibodies pre vaccination (“pre”) and at intervals thereafter (shown on the x-axis as number of weeks). Treatment groups are as described in Example 2; groups A (high dose/MF59® adjuvant), B (high dose), C (low dose/MF59® adjuvant), and D (low dose) are shown from left to right on the x-axis in each panel.
  • Figure 3 shows upon challenge with SARS-CoV-2 a reduction of viral load in lung lavage (bronchoalveolar lavage, or “BAL”) in subjects treated with VLP vaccines.
  • virus copies/mL are shown for treatment groups A, B, C, and D from Example 2; groups are shown from left to right on days 2, 4, and 6, followed by the control group.
  • the right hand panel shows measurements of virus RNA for each treatment group and the control.
  • Figure 4 shows the amount of SARS-CoV-2 neutralizing antibodies measured in serum from rhesus macaques that had been vaccinated with the VLP vaccine described in Example 1.
  • the SARS-CoV-2 variants or strains against which the antibodies were tested were the wild-type strain from China (“Wuhan”) and two variants (“B.1.1.7”, “B.1.351”) thereof.
  • Figure 5 further shows that neutralizing antibodies in serum from these non-human primates were induced at comparable levels following vaccination with the VLP vaccine described in Example 1 (ABNCoV2) in different doses.
  • the SARS-CoV-2 variants or strains against which the antibodies were tested included the Wuhan wild-type strain or variant as well as the variants designated B.l.1.7 (“Alpha”), B.1.351 (“Beta”), and Bl.617.2 (“Delta”).
  • Cross-neutralization of variants by NHP serum was observed following immunization with ABNCoV2 at both the high dose (100 pg, data points and bars on left side of graph) and low dose (15pg, data points and bars on right side of graph).
  • Figure 6 shows that high-level neutralizing antibodies were induced in human patients in the Phase 1 clinical trial, at 14 days after the second dose of ABNCoV2 (non-adjuvanted dose groups). An increase in neutralizing antibody titer was seen with increasing doses of ABNCoV2 up to 25pg, when a plateau was reached. These antibody levels were up to 12- fold higher than titers in human convalescent sera samples (HCS).
  • Figure 7 shows the induction of high levels of neutralizing antibodies against SARS- CoV-2 in human subjects in the Phase I trial. Geometric mean titers with geometric standard deviations are shown 14 days after the second ABNCoV2 dose was administered for patients in the clinical trial (data points on left side of graph) in comparison to human convalescent samples (HCS, data points on right side of graph).
  • Figure 8 shows neutralizing antibodies in human patients in the Phase 2 trial. These patients were in the 100 pg dose group and were initially seropositive subjects.
  • Figure 8 shows neutralizing antibody titers at baseline (“week 0”), week 1, and week 2 for the overall population (left) and for patients stratified by baseline antibody level (left to right) for the SARS-CoV-2 Wuhan strain/variant.
  • NT neutralization titer
  • LLOQ lower limit of quantitation
  • Figure 9 shows the neutralizing antibody response from human patients in the Phase 2 trial.
  • Neutralizing antibody response is shown for seropositive subjects at week 2 for SARS-CoV-2 variants Alpha, Beta, and Wuhan.
  • the three bars shown for each variant indicate the percentage of subjects with at least 2-fold (left-most bar), at least 4-fold (middle bar), and at least 6-fold increase (right-most bar) for each variant tested.
  • Upper left quadrant shows overall results, while the other three quadrants show results grouped by relationship of baseline NT (neutralization titer) to LLOQ (lower limit of quantitation).
  • the invention provides vaccines comprising virus-like particles displaying at least one SARS-CoV-2 antigen.
  • a SARS-CoV-2 antigen is any antigen that produces an immune response to SARS-CoV-2, such as, for example, the receptor-binding domain (RBD) of the SARS-CoV-2 spike protein or a portion thereof.
  • Antigens are displayed on virus-like particles (VLPs).
  • the VLPs comprise the RNA bacteriophage AP205 coat protein (also referred to herein as “AP205”) linked to a SARS-CoV-2 antigen via a peptide tag and binding partner.
  • the peptide tag and binding partner comprise the sequences set forth in SEQ ID NO:4 and SEQ ID NO:6, respectively.
  • the invention also provides methods of treatment using the VLPs of the invention and use of the VLPs to treat and/or prevent infection with the SARS-CoV-2 virus and variants thereof.
  • the invention further provides medical uses of the VLPs in the prevention and/or amelioration of COVID-19 symptoms.
  • VLPs of the invention were immunogenic and provided protection against SARS-CoV-2 infection without using a squalene adjuvant.
  • the effect was particularly prominent in a non-adjuvanted prime-boost regime.
  • squalene adjuvants are prepared from shark liver oil. The omittance of those adjuvants helps avoid killing of and exploiting live sharks and thus has a desirable environmental implication.
  • the source material of the squalene adjuvants is limited. This aspect may become relevant for example in case of a high demand for those adjuvants as during a pandemic such as the COVID-19 pandemic.
  • VLPs of the invention induced neutralizing antibodies not only against the wild-type strain of SARS-CoV-2 (“Wuhan”) but also against variants (“mutants”) that developed and emerged during the COVID-19 pandemic.
  • Wuhan wild-type strain
  • mutant variants
  • some publications in the art refer to the originally-identified (“Wuhan”) strain of SARS-CoV- 2 as “wild-type,” while others refer to it as another “variant,”; under the circumstances, both terms can be considered correct and are used interchangeably herein, along with the term “strain.” Because so many SARS-CoV-2 variants have arisen during the pandemic, the induction of broadly neutralizing antibodies by the VLPs of the invention is a very beneficial property because it helps avoid re-adapting the vaccine to each new SARS-CoV-2 variant and minimizes the numbers of vaccination every individual needs to receive for continued protection, particularly in circumstances where multiple variants and/or new variants may be present in a population.
  • VLPs of the invention display or are linked to a peptide of interest that is a SARS- CoV-2 antigen, as further discussed elsewhere herein.
  • VLP z.e., Virus-Like Particle
  • CLPs Capsid-Like Particles
  • VLPs are structures that resemble virions but do not contain viral genetic material necessary for infection of and replication in host cells. VLPs can be naturally occurring or can be synthesized via the expression or production of viral structural proteins, which can then self- assemble into the virus-like structure (also referred to in the art as capsid proteins and capsids or CLPs, respectively).
  • a fusion protein comprising AP205 and the peptide tag of SEQ ID NO:4 is provided by expressing the fusion protein from an expression vector comprising a nucleotide sequence encoding the fusion protein. This fusion protein can then be mixed together with a binding partner linked to a SARS-CoV-2 antigen under conditions allowing self-assembly of the VLP to produce VLPs of the invention.
  • the structure of the VLP is provided by self-assembly of particle-forming proteins, such as, for example, the AP205 protein, as described in U.S. Pat. No. 7,138,252, herein incorporated by reference in its entirety.
  • a particle-forming protein is fused to a peptide tag and a peptide of interest is fused to a binding partner to produce two components that are capable of spontaneously binding to each other by forming an isopeptide bond (see diagram in Figure 1), while not interfering with the ability of the particle-forming protein to form particles.
  • an isopeptide bond forms spontaneously between the peptide tag and binding partner, resulting in the peptide of interest being displayed on the surface of the particle.
  • Figure 1 shows a diagram of the general idea of such an embodiment in which a particle-forming protein is fused to a peptide tag and the peptide to be displayed (here, a SARS-CoV-2 antigen) is fused to the peptide binding partner.
  • a SARS-CoV-2 antigen a SARS-CoV-2 antigen
  • This strategy has been used to generate VLPs displaying antigenic peptides, as described in detail in WO 2016/112921, hereby incorporated by reference in its entirety (see, e.g., section entitled “The AP205 VLP” and the working Examples).
  • Bacteriophage capsid proteins are examples of suitable particle-forming proteins that can be used to generate these VLPs and include, for example, AP205, QB, MS2, and HBc; other suitable proteins are known in the art. Derivatives and/or fragments of known particle-forming proteins may also be used in the compositions and/or methods of the invention, so long as they retain the property of being capable of self-assembling into particles.
  • particle-forming proteins that are derivatives of bacteriophage capsid proteins can be used in the compositions and methods of the invention, and can have sequences that differ from those of a known sequence such as, for example, SEQ ID NO: 1 and/or SEQ ID NO:2 by up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 20 or more amino acids so long as the protein is capable of forming a capsid on which antigens can be displayed.
  • particle-forming proteins can have sequences that share sequence identity with SEQ ID NO:l and/or SEQ ID NO:2 of 80% or more, or at least 85%, 90%, 95%, or 99% or more sequence identity with SEQ ID NO: 1 and/or SEQ ID NO:2.
  • a particle-forming protein can have a sequence that is a fragment or portion of SEQ ID NO: 1 or SEQ ID NO:2, so long as the protein is still capable of forming a capsid on which antigens can be displayed.
  • a protein capable of self-assembling into particles such as VLPs can be genetically modified by fusion with a peptide tag.
  • the assembled particles will display the peptide tag on their surface and can then be coupled to a peptide binding partner that will react with the peptide tag to form an isopeptide bond.
  • An antigen coupled to the peptide binding partner will then be displayed on the particles.
  • the components are rearranged so that the protein capable of self-assembling into particles such as VLPs is coupled to a peptide binding partner, and the antigen to be displayed on the surface of the VLP is coupled to a peptide tag.
  • peptide binding partner and “peptide tag” are interchangeable so long as the objects of the invention are met.
  • a fusion protein can be obtained by constructing a polynucleotide encoding the protein capable of self-assembling into particles fused to the peptide tag, and/or by constructing a polynucleotide encoding the peptide binding partner fused to the antigen that is to be displayed on the VLP, and expressing these in an expression vector in a suitable host cell.
  • a spacer or linker may be included between the different portions of each fusion protein in this construct, for example, to enhance binding properties of the fusion proteins or assembly of the final VLP product.
  • the compounds of interest may be fused to the peptide tag or binding partner via an N- terminal fusion or a C-terminal fusion or via an internal fusion, for example, in a loop.
  • VLPs of the invention display or are linked to a peptide of interest that is a SARS- CoV-2 antigen.
  • SARS-CoV-2 antigen is intended that the peptide is capable of stimulating an immune response to SARS-CoV-2 in a subject.
  • a peptide that is a SARS-CoV-2 antigen is a portion of a spike protein of SARS-CoV-2.
  • a peptide that is a SARS-CoV-2 antigen comprises all or a portion of the receptor-binding domain (“RBD”) of the SARS-CoV-2 spike protein.
  • the SARS-CoV-2 antigen has an amino acid sequence of a SARS-CoV-2 spike (S) protein or a part thereof, wherein the amino acid sequence is the sequence of a SARS-CoV-2 S full-length protein; or the amino acid sequence is the sequence of a part of a SARS-CoV-2 S protein SI domain that comprises or consists of a SARS-CoV-2 S receptor binding domain (RBD).
  • the entire RBD is included (e.g ., corresponding to amino acids 319-591 or 330-583 of the protein reference sequence GenBank QIA20044.1, or other fragments of the full-length S receptor protein that comprise all or part of the RBD, for example, as set forth in SEQ ID NO: 13).
  • SARS-CoV-2 S full- length protein from the Wuhan strain (YP 009724390.1, SARS-CoV-2 isolate Wuhan-Hu-1, NC_045512.2) has the amino acid sequence set forth in SEQ ID NO:7.
  • a SARS-CoV-2 antigen that is a derivative or fragment of a known SARS-CoV-2 antigen from any strain or variant may also be useful in the compositions and/or methods of the invention, for example, so long as it is capable of producing an immune response when used as a component of a VLP, or so long as it shares immunogenic properties with another known SARS-CoV-2 antigen so that an antibody that binds to one also binds to the other.
  • the SARS-CoV-2 antigen has an amino acid sequence that is all or a portion of a SARS-CoV-2 S protein SI domain that comprises or consists of a SARS- CoV-2 S RBD (Receptor Binding Domain).
  • the SARS-CoV-2 antigen is a fusion protein comprising two or more portions of one or more SARS-CoV-2 proteins. In such fusion proteins, at least one portion can be from a part of the native full-length SARS- CoV-2 protein that is not normally exposed on the surface of a SARS-CoV-2 virion.
  • the SARS-CoV-2 protein comprises two consecutive non-native proline residues and/or has been otherwise modified to prevent proteolytic cleavage by furin-like proteases.
  • the SARS-CoV-2 antigen is from a “variant” strain of SARS- CoV-2 that is known to differ from the first-discovered strain, sometimes referred to as the “Wuhan” strain.
  • Wuhan strain of SARS- CoV-2 that is known to differ from the first-discovered strain.
  • variant strains have been identified to date and, based on the rate of their appearance, additional variants are expected to arise in the future (see, e.g ., Guruprasad (2021) Proteins doi: 10.1002/prot.26042).
  • the spike proteins, RBD domains, and other domains of proteins from these variant strains and nucleotide sequences encoding them are readily obtained by one of skill in the art and adapted for use in the VLPs of the invention.
  • known SARS-CoV-2 antigens and proteins that are derivatives of known SARS-CoV-2 antigens can be used in the compositions and methods of the invention, and can have sequences that differ from those of a known sequence such as, for example, SEQ ID NO:7 and/or SEQ ID NO: 13 by up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 20 or more amino acids so long as the protein is capable of stimulating an immune response in a subject, for example, when administered as a vaccine either by itself or displayed on a VLP.
  • antigens can have sequences that share sequence identity with SEQ ID NO: 7 or SEQ ID NO: 13 of 80% or more, or at least 85%, 90%, 95%, or 99% or more sequence identity with SEQ ID NO: 7 or SEQ ID NO: 13.
  • a protein can have a sequence that is a fragment or portion of SEQ ID NO:7 or SEQ ID NO: 13, so long as the protein is still capable of acting as an antigen (that is, of stimulating an immune response in a subject).
  • the antigenic peptide is capable of eliciting an immune response in an animal such as a mammal; for example, a subject that can be vaccinated and/or immunized can be a cow, pig, horse, sheep, goat, llama, mouse, rat, monkey, dog, cat, bird, fish, or human patient.
  • An immune response in a subject that has been vaccinated using a vaccine comprising VLPs may comprise the production of or an increase in neutralizing antibodies and/or T cell responses.
  • the peptide tag and binding partner comprise the sequences set forth in SEQ ID NO:4 and SEQ ID NO:6.
  • Other peptide tags and binding partners may also be used in the compositions and methods of the invention so long as they are capable of spontaneous isopeptide bond formation so as to link the SARS-CoV-2 antigen to the VLP; for example, the binding partner may comprise the sequence set forth in SEQ ID NO: 10.
  • peptide tag and binding partners may have sequences that differ from those set forth in SEQ ID NO:4 and SEQ ID NO:6 (that is, may be derivatives of SEQ ID NO:4 and SEQ ID NO:6) so long as they are capable of forming an isopeptide bond between the tag and partner.
  • a “derivative” of a particular protein or sequence can share at least a particular percentage of sequence identity, or can differ at one or more amino acid or nucleotide residues from another protein or sequence.
  • peptide tags and binding partners that are derivatives of SEQ ID NO:4 and/or SEQ ID NO:6 can be used in the compositions and methods of the invention, and can have sequences that differ from those of SEQ ID NO:4 and/or SEQ ID NO:6 by up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 20 or more amino acids so long as the peptide tag and binding partner can be linked to each other by an isopeptide bond.
  • peptide tags and binding partners can have sequences that share sequence identity with SEQ ID NO: 4 and/or SEQ ID NO:6 of 80% or more, or at least 85%, 90%, 95%, or 99% or more sequence identity with SEQ ID NO:4 or SEQ ID NO:6.
  • a peptide tags and/or binding partners can have a sequence that is a fragment or portion of SEQ ID NO:4 or SEQ ID NO:6, respectively; for example, the binding partner may comprise the sequence set forth in SEQ ID NO: 10.
  • the binding partner is attached at its N-terminus or C- terminus to the peptide of interest at the N-terminus or at the C-terminus, or alternatively is attached to the particle-forming protein at its N-terminus or C-terminus.
  • the peptide tag is attached at its N-terminus or C-terminus to the peptide of interest at the N-terminus or at C-terminus, or alternatively is attached to the particle-forming protein at its N-terminus or the C-terminus.
  • any configuration or combination of the components can be used in the compositions and methods of the invention so long as the VLPs of the invention can be formed so that the peptide of interest is displayed on the surface of VLPs, and is linked to the VLP particle-forming protein via a peptide tag and binding partner pair that are connected via an isopeptide bond.
  • the assembly of the components can be assessed by in vivo assays of immunogenicity or by in vitro assays showing that the components have bound to each other.
  • compositions comprising a particle-forming protein linked or fused to a peptide tag and an antigen linked or fused to a binding partner, wherein the peptide tag and binding partner are capable of interacting by the spontaneous formation of an isopeptide bond and wherein the particle-forming protein and the antigen are linked via an isopeptide bond between the peptide tag and binding partner.
  • compositions comprising a particle-forming protein fused to a binding partner and an antigen fused to a peptide tag, wherein the binding partner and peptide are capable of interacting by the spontaneous formation of an isopeptide bond, wherein the particle-forming protein and antigen are linked via an isopeptide bond between the binding partner and the peptide tag, and wherein the particle-forming protein and antigen form a particle displaying said antigen; in some embodiments, the particle is a virus-like particle (VLP).
  • VLP virus-like particle
  • the particle-forming protein is a VLP-subunit monomer that is an AP205 subunit monomer, for example, an AP205 subunit monomer comprising the sequence set forth in SEQ ID NO: 1 or SEQ ID NO:2.
  • the VLP- subunit monomer may have a sequence that is a subsequence of SEQ ID NO: 1 or SEQ ID NO:2, such as, for example, a sequence that is missing the initial methionine of SEQ ID NO: 1 or SEQ ID NO:2.
  • the binding partner can have the sequence set forth in SEQ ID NO:6, or it can have a truncated sequence such as the sequence set forth in SEQ ID NO: 10.
  • protein linkers or tags are used to connect parts of constructs together; for example, a linker can be used to genetically connect an AP205 protein to a peptide tag, so that a VLP-subunit monomer can comprise a peptide tag having the sequence set forth in SEQ ID NO:4, a linker having the sequence set forth in SEQ ID NO:8, and an AP205 protein having the sequence set forth in SEQ ID NO:l.
  • a VLP subunit monomer can have the sequence set forth in SEQ ID NO: 9.
  • an RBD-catcher component (also sometimes referred to herein as an RBD- antigen component or “RBD-binding tag”) comprises a catcher or binding partner having the sequence of SEQ ID NO: 10, a linker having the sequence of SEQ ID NO:l 1, an RBD antigen having the sequence set forth in SEQ ID NO: 13, a linker having the sequence set forth in SEQ ID NO: 11, and a C-tag having the sequence set forth in SEQ ID NO: 12 (e.g ., ABNCoV2).
  • an RBD-catcher component has the sequence set forth in SEQ ID NO: 14.
  • a C-tag can be used to aid in purification of the protein to which it is attached, and a secretion signal sequence may also be genetically linked to this protein to facilitate production and later cleaved off prior to assembly of the VLP vaccine.
  • a “derivative” of a particular protein or nucleotide sequence can share at least a particular percentage of sequence identity, or can differ at one or more amino acid or nucleotide residues from a reference protein or sequence.
  • derivatives of proteins that comprise a subunit monomer of a VLP linked to an RBD-antigen component can be used in the compositions and methods of the invention, and can have sequences that differ from those of known sequences by up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 20 or more amino acids.
  • derivatives can have sequences that share sequence identity with a reference sequence of 80% or more, or at least 85%, 90%, 95%, or 99% or more sequence identity with a particular reference sequence or protein.
  • a protein can be a fragment or portion of another known protein that includes less than the full length of the known protein. That is, for example, a protein that is a fragment or portion of another known protein may be missing amino acids from the N- or C- terminus of the known protein, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 or more amino acids, or 20, 50, or 100 amino acids, so long as a characteristic of the protein is retained, such as, for example, immunogenicity or binding to a particular antibody.
  • a particle-forming protein that is a VLP subunit is produced by expression in E. coli and can be recovered following cell lysis, while the RBD or other SARS-CoV-2 antigen is expressed in Drosophila S2 cells and is secreted into the medium.
  • each of the RBD or other antigen and the particle-forming protein is separated from the medium and/or cell debris and purified by suitable techniques, for example, chromatography, ultrafiltration, and/or diafiltration.
  • the particle-forming protein and the RBD or other antigen can then be coupled by mixing the components together and incubating for a suitable period of time (e.g., overnight) to produce VLPs displaying the antigen, followed by filtration such as ultrafiltration using tangential flow filtration or other suitable filtration to separate assembled VLPs displaying antigens from non-coupled particle forming protein and antigen components.
  • the assembled VLPs can be frozen in solution and stored, then later diluted with formulation buffer to the required concentration for administration as a vaccine.
  • Suitable formulation buffers are known in the art, for example, a formulation buffer can comprise or consist of PBS, Tris buffer, and sucrose.
  • VLPs of the invention can be used in prophylactic treatment of any animal or subject in which they produce an immune response.
  • VLPs of the invention can be used to vaccinate any animal, including, for example, a human subject or patient.
  • Vaccines may be administered to a subject in a single dose or in more than one dose. If more than one dose of the vaccine is administered, the doses can be given several days or several weeks apart, or may be given several months apart.
  • each dose can contain the same vaccine (“homologous prime-boost regime” as used herein) or alternatively, the first dose can contain or comprise a first VLP with a first SARS-CoV-2 antigen and the second or subsequent dose can contain or comprise a second VLP with a second SARS-CoV-2 antigen that can be from a different SARS-CoV-2 strain or variant than the antigen in the first dose.
  • compositions of the inventions thus may be vaccine compositions with prophylactic applications and useful for prophylaxis or treatment of a disease or disorder caused by SARS-CoV-2, including symptoms referred to as COVID-19.
  • the compositions may also be useful for inducing an immune response in a subject by administering said compositions at least once to the subject.
  • Vaccination with compositions of the invention can be effective to reduce or prevent symptoms of infection by SARS-CoV-2 and/or related viruses, including MERS.
  • a dose of a vaccine may be administered to a subject before or after doses of the same vaccine or a different vaccine, and a dose of vaccine that is administered to a subject who has previously been treated with the same vaccine or a different vaccine may be referred to as a “booster.”
  • VLPs of the invention are said to elicit an immune response, for example, if they elicit neutralizing antibodies in a subject following administration.
  • the effectiveness of a vaccine of the invention can be assessed by measurement of neutralizing antibodies in a subject following administration, wherein the presence of neutralizing antibodies indicates that an immune response has been produced in the subject.
  • the virus neutralization titers exceed those produced following natural infection with SARS-CoV-2 or a variant thereof.
  • An immune response in a subject that has been vaccinated using a vaccine comprising VLPs of the invention may also, or alternatively, comprise the production of or an increase in T cell responses.
  • Methods of measuring neutralizing antibodies and T cell responses are known in the art. For example, antigen-specific IgG titers can be measured by ELISA, and the levels of antigen-specific T cells can be assessed using FACS analysis.
  • compositions and methods of the invention prevent, alleviate, or ameliorate at least one symptom of infection with SARS-CoV-2.
  • symptoms include, for example, fever; high viral load in tissues such as lung, nose, and/or throat; chills; muscle or body aches; congestion; need for hospitalization; death; and other symptoms that have been reported.
  • by “alleviates symptoms of COVID-19” or “alleviates symptoms of infection with SARS-CoV-2” is intended that hospitalization and death are avoided when a composition or method of the invention is used to treat a subject.
  • a symptom of COVID-19 or infection with SARS-CoV-2 is intended that that symptom is less severe than in a patient that was not treated with the same composition or method, or is less severe than would be expected for a patient that was not treated, for example, by statistical analysis of treated and untreated patient populations, wherein a symptom is ameliorated if it is increased if favorable or decreased if unfavorable by at least 10%, 20%, 25%, 30%, or more in a treated versus an untreated subject populations using appropriate statistical analysis.
  • a patient that was previously infected with SARS-CoV-2 can be vaccinated with a VLP of the invention and lingering symptoms of the earlier infection are reduced or diminished; for example, fatigue may be decreased.
  • Doses of active agent (i.e ., VLPs) to be administered are in the range of from 5 to 200 pg, preferably from 10 to 150 pg, more preferably from 15 to 100 pg. In some embodiments, doses of VLPs to be administered are in the range from 10 to 20 pg, preferably 15 pg or about 15 pg (“low dose”), or in the range from 80 to 120 pg, preferably 100 pg or about 100 pg (“high dose”).
  • VLPs active agent
  • serum titers of neutralizing antibodies in a patient will increase following administration of VLPs, but in patients with measurable pre-existing levels of antibodies and/or neutralizing antibodies (that is, patients who have a high baseline antibody titer), the increase in antibodies and/or neutralizing antibodies following administration of VLPs may appear to be lower than the increase observed in patients who were previously seronegative or who had serum antibody titers that were below a level that can be accurately measured.
  • an increase in serum antibody titers above the pre immunization baseline can be measured to confirm stimulation of the immune response by VLPs, even if the increase is as little as 2-fold (see, e.g., Example 4 and Figure 8).
  • the invention provides methods of increasing antibodies and/or neutralizing antibodies against SARS-CoV-2 antigens such as RBD by at least 2-fold, at least 4-fold, at least 6-fold, or at least 10-fold or more in a patient comprising administering VLPs to the patient, and VLPs can be administered to patients regardless of their previous serum antibody titer levels to induce a broad immune response against SARS-CoV-2 variants.
  • the serum antibody titers are measured at least or about one week after administration of the VLPs or at least or about two weeks after administration of the VLPs.
  • the invention provides compositions and methods for boosting an immune response in a subject.
  • the VLPs of the invention are formulated in an aqueous solution for administration as a vaccine.
  • the aqueous solution can be formulated for use as a vaccine and can further comprise a pharmaceutically acceptable carrier, adjuvant, or excipient.
  • the aqueous solution does not include an adjuvant, such as, for example, squalene and/or MF59® adjuvant, but only includes components such as buffers, salts, and the like that are not expected to additionally boost the immune response.
  • squalene is excluded from the aqueous solution comprising the VLPs of the invention and is not a component of the vaccine.
  • an adjuvant such as, for example, MF59® adjuvant and/or AddaVaxTM adjuvant is excluded from the aqueous solution comprising the VLPs of the invention and is not a component of the vaccine.
  • the method of producing a VLP comprises the steps of: (i) obtaining a first polypeptide comprising or consisting of a peptide binding partner fused to a particle-forming protein; and obtaining a second polypeptide comprising or consisting of a peptide tag fused to an antigen of interest; or obtaining a first polypeptide comprising or consisting of a peptide tag fused to a particle-forming protein and obtaining a second polypeptide comprising or consisting of a binding partner fused to an antigen of interest; (ii) subjecting the first and second polypeptides to conditions which enable formation of an isopeptide bond between the peptide tag and binding partner portions of the polypeptides, whereby particles are produced in which the antigen of interest is displayed on the surface of the particles; and (iii) generating a pharmaceutical composition comprising said particles.
  • the particle-forming protein may be any of those listed herein, including, for example, a capsid protein that is AP205.
  • Exemplary AP205 amino acid sequences are set forth in SEQ ID NO:l and SEQ ID NO:2.
  • the SARS-CoV-2 antigens can be produced in cell culture such as, for example, Schneider-2 insect cells (also referred to as S2 cells) (see, e.g., Moraes etal. (2012) Biotech. Adv. 30: 613-28).
  • the AP205 component can be expressed in and prepared from E. coli cultures (see, e.g., Thrane el al. (2016) J. Nanobiotechnology 14: 30). These components can then be mixed together under suitable conditions, resulting in the formation of an isopeptide bond between the peptide tag and binding partner, which can be confirmed by SDS-PAGE analysis and other techniques such as affinity for binding, densitometry, and/or electron microscopy.
  • nucleic acid includes one or more nucleic acid sequences
  • method includes reference to equivalent steps and methods known to those of ordinary skill in the art that could be modified or substituted for the methods described herein.
  • the conjunctive term “and/or” between multiple recited elements is understood as encompassing both individual and combined options. For instance, where two elements are conjoined by “and/or,” a first option refers to the applicability of the first element without the second. A second option refers to the applicability of the second element without the first. A third option refers to the applicability of the first and second elements together. Any one of these options is understood to fall within the meaning, and therefore satisfy the requirement of the term “and/or” as used herein. Concurrent applicability of more than one of the options is also understood to fall within the meaning, and therefore satisfy the requirement of the term “and/or.”
  • any of the aforementioned terms can be amended and thus replaced with the term “containing” or “including” or when used herein with the term “having.”
  • any of the aforementioned terms (comprising, containing, including, having), whenever used in the context of an aspect or embodiment in the description of the present invention also include, the terms “consisting of’ or “consisting essentially of,” each of which denotes a specific legal meaning depending on jurisdiction.
  • nucleic acid refers to RNA or DNA that is linear or branched, single or double stranded, or a hybrid thereof.
  • the polynucleotides can be obtained by chemical synthesis or derived from a microorganism.
  • exogenous nucleic acid sequences when used in connection with a recombinant virus means a foreign nucleic acid sequence, a nucleic acid sequence not contained in the non-recombinant virus used for generating the recombinant virus, or a nucleic acid sequence inserted into the virus genome while generating the recombinant virus.
  • a “derivative” of a particular protein or nucleotide sequence can share at least a particular percentage of sequence identity, or can differ at one or more amino acid or nucleotide residues from a reference protein or sequence.
  • proteins that are derivatives of AP205 can be used in the compositions and methods of the invention, and can have sequences that differ from those of known AP205 sequences by up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 20 or more amino acids so long as the derivatives are capable of self-assembly into a particle.
  • derivatives can have sequences that share sequence identity with a reference sequence of 80% or more, or at least 85%, 90%, 95%, or 99% or more sequence identity with a particular reference sequence or protein.
  • a protein can be a fragment or portion of another known protein that includes less than the full length of the known protein. That is, for example, a protein that is a fragment or portion of another known protein may be missing amino acids from the N- or C- terminus of the known protein, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 or more amino acids, or 20, 50, or 100 amino acids, so long as a characteristic of the protein is retained, such as, for example, immunogenicity or binding to a particular antibody.
  • a protein that is a fragment of the binding partner of SEQ ID NO:6 can be missing the first 3 amino acids of that sequence and so has the sequence set forth in SEQ ID NO: 10.
  • “Pharmaceutically acceptable” means that the carrier, additive, antibiotic, preservative, adjuvant, diluent, stabilizer or excipient, at the dosages and concentrations employed, will substantially not cause an unwanted or harmful effect(s) in the subject(s) to which they are administered. While the instant vaccine was shown to be effective even in the absence of adjuvant, in some embodiments, the vaccine is formulated with an adjuvant such as, for example, MF59® adjuvant (Novartis, Cambridge, MA, USA) or AddaVaxTM adjuvant (InvivoGen, San Diego, CA, USA).
  • an adjuvant such as, for example, MF59® adjuvant (Novartis, Cambridge, MA, USA) or AddaVaxTM adjuvant (InvivoGen, San Diego, CA, USA).
  • a “pharmaceutically acceptable” excipient is any inert substance that is combined with an active molecule such as a virus for preparing an agreeable or convenient dosage form.
  • the "pharmaceutically acceptable” excipient is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation comprising the viral preparation.
  • excipients are cryoprotectants, non-ionic detergents, buffers, salts and inhibitors of free radical oxidation.
  • “Pharmaceutically acceptable carriers” are for example described in Remington's Pharmaceutical Sciences, 18th edition, A. R. Gennaro, Ed., Mack Publishing Company (1990); Pharmaceutical Formulation Development of Peptides and Proteins, S. Frokjaer and L. Hovgaard, eds., Taylor & Francis (2000); and Handbook of Pharmaceutical Excipients,
  • a subject is typically a mammal, such as a non-primate (e.g ., cows, pigs, horses, cats, dogs, rats, etc.) or a primate (e.g., monkey and human), and in some preferred embodiments is a human.
  • a non-primate e.g ., cows, pigs, horses, cats, dogs, rats, etc.
  • a primate e.g., monkey and human
  • prime-boost regime means that the active agent, i.e. VLPs, are administered in a first vaccination and later after a certain period of time in a second vaccination or still further vaccinations.
  • a patient may be administered one or more different vaccines over time.
  • the term “homologous” prime-boost regime as referred to herein means that the active agent (i.e., VLPs) used in the first vaccination are the same as those used in the second or further vaccinations, and “heterologous” prime-boost means that the vaccine that is first administered to a patient is different from the vaccine that is subsequently administered to a patient.
  • the VLPs of the invention provide broad protection against SARS-CoV-2 variants (see, e.g., Figures 5 and 7), they are suitable for administration as either a priming vaccine or as a booster in homologous or heterologous prime-boost regimes, or for administration to any patient for whom an increase in neutralizing antibody titer is desirable regardless of vaccination or infection history. Further, this broad protection against SARS-CoV-2 variants necessarily means that an immune response in a subject is induced against multiple SARS- CoV-2 variants as a result of immunization with the VLPs of the invention.
  • Item l is a virus-like particle (VLP) comprising an AP205 protein fused to a peptide tag and comprising a SARS-CoV-2 antigen fused to a peptide binding partner, whereby the SARS-CoV-2 antigen is displayed on the surface of said VLP.
  • VLP virus-like particle
  • Item 2 is the VLP of item 1, wherein said peptide tag has the sequence set forth in SEQ ID NO:4 and/or is encoded by the sequence set forth in SEQ ID NO:3.
  • Item 3 is the VLP of item 1 or 2, wherein said peptide binding partner has the sequence set forth in SEQ ID NO:6 or SEQ ID NO: 10 and/or is encoded by the sequence set forth in SEQ ID NO:5.
  • Item 4 is the VLP of any one of items 1 to 3, wherein said AP205 has the sequence set forth in SEQ ID NO:l or SEQ ID NO:2, or is missing the initial methionine from SEQ ID NO:l or SEQ ID NO:2.
  • Item 5 is the VLP of any one of items 1 to 4, wherein said antigen has the sequence set forth in SEQ ID NO:7 or SEQ ID NO: 13, or is a fragment thereof.
  • Item 6 is the VLP of item 5, wherein said antigen comprises amino acids 319-591 of SEQ ID NO:7 or is set forth in SEQ ID NO: 13.
  • Item 7 is the VLP of any one of items 1 to 6 that comprises an isopeptide bond between said binding partner and said peptide tag.
  • Item 8 is a virus-like particle (VLP) comprising: (i) an AP205 protein fused to a peptide tag; and (ii) a SARS-CoV-2 antigen comprising the wild-type (Wuhan) spike protein Receptor Binding Domain (RBD), whereby the SARS-CoV-2 antigen is displayed on the surface of said VLP; and that when administered to a subject as a vaccine stimulates an immune response that prevents or alleviates symptoms of coronavirus infection caused by any one of SARS-CoV-2 variants B.1.1.7, B.1.351, B 1.617.2, and/or another variant.
  • this immune response is a measurable increase in anti-SARS-CoV-2 antibodies and/or neutralizing antibodies in the patient following immunization, for example one or two weeks following immunization.
  • Item 9 is the VLP of item 8, wherein said peptide tag has the sequence set forth in SEQ ID NO:4 or is encoded by the sequence set forth in SEQ ID NO:3.
  • Item 10 is the VLP of items 8 or 9, wherein said AP205 has the sequence set forth in SEQ ID NO: 1 or SEQ ID NO:2, or has the sequence set forth in SEQ ID NO: 1 or SEQ ID NO:2 but without the initial methionine.
  • Item 11 is the VLP of any one of items 8 to 10, wherein said antigen has the sequence set forth in SEQ ID NO:7 or SEQ ID NO: 13, or is a fragment thereof.
  • Item 12 is the VLP of item 11, wherein said antigen comprises amino acids 319-591 of SEQ ID NO:7 or is as set forth in SEQ ID NO: 13.
  • Item 13 is a virus-like particle (VLP) comprising: (a) an AP205 protein fused to a peptide tag having the amino acid sequence set forth in SEQ ID NO:4, or a derivative thereof; and (b) a SARS-CoV-2 antigen fused to a peptide binding partner having the amino acid sequence set forth in SEQ ID NO:6, or a derivative thereof, whereby the SARS-CoV-2 antigen is displayed on the surface of said VLP; that when administered to a subject as a vaccine stimulates a response that prevents or alleviates symptoms of coronavirus infection caused by any one of SARS-CoV-2 variants B.l.1.7, B.1.351, B 1.617.2, and/or another variant.
  • this immune response is a measurable increase in anti-SARS- CoV-2 antibodies and/or neutralizing antibodies in the patient following immunization, for example one or two weeks following immunization.
  • Item 14 is the VLP of item 13, wherein said AP205 has the sequence set forth in SEQ ID NO: 1 or SEQ ID NO:2, or has the sequence set forth in SEQ ID NO: 1 or SEQ ID NO:2 without the initial methionine.
  • Item 15 is the VLP of items 13 or 14, wherein said antigen has the sequence set forth in SEQ ID NO:7 or SEQ ID NO: 13, or is a fragment thereof.
  • Item 16 is the VLP of item 15, wherein said antigen comprises the sequence set forth in SEQ ID NO: 13, or amino acids 319-591 of SEQ ID NO:7.
  • Item 17 is the VLP of any one of items 13 to 16 that comprises an isopeptide bond between said binding partner and said peptide tag.
  • Item 18 is a pharmaceutical composition, or a vaccine, comprising the VLP of anyone of items 1 to 17, optionally further comprising a pharmaceutically acceptable carrier or excipient.
  • Item 19 is the pharmaceutical composition of item 18, or the vaccine of item 18, that does not contain an immunologic adjuvant.
  • Item 20 is the pharmaceutical composition of item 18, or the vaccine of item 18, comprising the VLP in an aqueous solution that does not contain shark liver oil.
  • Item 21 is the pharmaceutical composition of item 18, or the vaccine of item 18, comprising the VLP in an aqueous solution that contains no squalene.
  • Item 22 is the pharmaceutical composition of item 18, or the vaccine of item 18, comprising the VLP in an aqueous solution that does not contain a squalene-based oil-in water nano-emulsion.
  • Item 23 is the pharmaceutical composition of item 18, or the vaccine of item 18, comprising the VLP in an aqueous solution that does not contain MF59® adjuvant or AddaVaxTM adjuvant.
  • Item 24 is a method of preparation of the pharmaceutical composition or the vaccine of any of items 18 to 23, which method does not contain a step of including a squalene in the composition or vaccine.
  • Item 25 is a method of treating a subject to prevent or ameliorate symptoms of a coronavirus infection, preferably coronavirus disease 19 (COVID-19), comprising the step of administering the vaccine of any of items 18 to 23 or a vaccine comprising the VLP of any of items 1 to 17 to a subject.
  • COVID-19 coronavirus disease 19
  • Item 26 is the method of item 25, wherein the step of administering the vaccine produces an immune response in said subject that prevents or ameliorates symptoms of infection with SARS-CoV-2, preferably SARS-CoV-2 wild-type strain (Wuhan) or a variant thereof.
  • this immune response is a measurable increase in anti-SARS- CoV-2 antibodies and/or neutralizing antibodies in the patient following immunization, for example one or two weeks following immunization.
  • the invention also provides a method of stimulating the immune response in a subject by administering said vaccine of Item 25 to said subject.
  • Item 27 is the method of item 26, wherein the SARS-CoV-2 variant is B.1.1.7,
  • Item 28 is the method of item 25, wherein the step of administering the vaccine produces an immune response in said subject that prevents or ameliorates symptoms of infection with a strain of SARS-CoV-2 that is not the SARS-CoV-2 wild-type strain (Wuhan).
  • Item 29 is a VLP of any one of items 1 to 17, or a pharmaceutical composition or a vaccine of any one of items 18 to 23, for use in the prevention or treatment of a coronavirus infection, preferably coronavirus disease 19 (COVID-19).
  • a coronavirus infection preferably coronavirus disease 19 (COVID-19).
  • Item 30 is the VLP or the pharmaceutical composition or the vaccine for use of item
  • coronavirus infection is caused by SARS-CoV-2, preferably SARS-CoV-2 wild-type strain (Wuhan) or a variant thereof.
  • SARS-CoV-2 preferably SARS-CoV-2 wild-type strain (Wuhan) or a variant thereof.
  • Item 31 is the VLP or the pharmaceutical composition or the vaccine for use of item
  • SARS-CoV-2 variant is B.1.1.7, B.1.351, B 1.617.2, or another variant.
  • Item 32 is the VLP or the pharmaceutical composition or the vaccine for use of item 29, wherein the coronavirus infection is not caused by the SARS-CoV-2 wild-type strain (Wuhan).
  • Item 33 is the VLP or the pharmaceutical composition or the vaccine for use of anyone of items 29 to 32 that is used or administered in a prime-boost regime, for example a homologous prime-boost regime or a heterologous prime-boost regime.
  • Item 34 is the use of a VLP of anyone of items 1 to 17 for the preparation of a pharmaceutical composition or a vaccine for use in the prevention or treatment of a coronavirus infection, preferably coronavirus disease 19 (COVID-19).
  • a coronavirus infection preferably coronavirus disease 19 (COVID-19).
  • Item 35 is the use of item 34, wherein the coronavirus infection is caused by SARS- CoV-2, preferably SARS-CoV-2 wild-type strain (Wuhan) or a variant thereof.
  • SARS-CoV-2 preferably SARS-CoV-2 wild-type strain (Wuhan) or a variant thereof.
  • Item 36 is the use of item 35, wherein the SARS-CoV-2 variant is B.1.1.7, B.1.351, or Bl.617.2.
  • Item 37 is the use of item 34, wherein the coronavirus infection is not caused by the SARS-CoV-2 wild-type strain (Wuhan).
  • Item 38 is the use of any one of items 34 to 37, wherein the pharmaceutical composition or vaccine is used or administered in a prime-boost regime, for example a homologous prime-boost regime or a heterologous prime-boost regime.
  • Item 39 is a VLP of any one of items 1 to 17, for use in the prevention or treatment of a coronavirus infection, preferably coronavirus disease 19 (COVID-19), wherein the VLP is used or administered without simultaneously using or administering an immunologic adjuvant selected from the group consisting of shark liver oil, squalene, a squalene-based oil- in-water nano-emulsion, MF59 ® adjuvant and AddaVaxTM adjuvant.
  • an immunologic adjuvant selected from the group consisting of shark liver oil, squalene, a squalene-based oil- in-water nano-emulsion, MF59 ® adjuvant and AddaVaxTM adjuvant.
  • Item 40 is the VLP of item 39, wherein the VLP is used or administered in a prime- boost regime, for example a homologous prime-boost regime or a heterologous prime-boost regime.
  • VLP virus-like particle
  • an AP205 protein comprising the sequence set forth in SEQ ID NO: 1 or SEQ ID NO:2, or comprising the sequence set forth in SEQ ID NO:l or SEQ ID NO:2 without the initial methionine
  • a linker having the sequence set forth in SEQ ID NO: 8 fused to a peptide tag having the amino acid sequence set forth in SEQ ID NO:4, or a derivative thereof
  • a SARS-CoV-2 antigen having the sequence set forth in SEQ ID NO: 13 or amino acids 319-591 of SEQ ID NO:7 fused to a peptide binding partner having the amino acid sequence set forth in SEQ ID NO: 6 or SEQ ID NO: 10, or a derivative thereof, whereby the SARS-CoV-2 antigen is displayed on the surface of said VLP; that when administered to a subject as a vaccine stimulates a response that prevents or alleviates symptoms of coronavirus infection caused by SARS-
  • Item 42 is a subunit monomer of a virus-like particle (VLP) comprising: a peptide tag having the sequence set forth in SEQ ID NO:4, a linker having the sequence set forth in SEQ ID NO:8, and an AP205 protein comprising the sequence set forth in SEQ ID NO: 1 but missing the initial methionine.
  • VLP virus-like particle
  • Item 43 is the subunit monomer of a VLP of item 42 that has the sequence set forth in SEQ ID NO:9.
  • Item 44 is an RBD-antigen component comprising: a binding partner having the sequence set forth in SEQ ID NO: 6 or SEQ ID NO: 10, a linker having the sequence set forth in SEQ ID NO: 11, the SARS-CoV-2 antigen sequence set forth in SEQ ID NO: 13, a linker having the sequence set forth in SEQ ID NO: 11, and a C-tag having the sequence set forth in SEQ ID NO: 12.
  • Item 45 is the RBD-antigen component of item 44 that has the sequence set forth in SEQ ID NO: 14.
  • Item 46 is a VLP comprising a subunit monomer of item 42 or 43 and an RBD- antigen component of item 44 or 45.
  • the subunit monomer and RBD- antigen component are linked at their N-termini.
  • Item 47 is a pharmaceutical composition, or a vaccine, comprising the VLP of item 46, optionally further comprising a pharmaceutically acceptable carrier or excipient.
  • Item 48 is the use of a subunit monomer of a VLP of item 42 or item 43 or an RBD- antigen component of item 44 or 45 or a VLP of item 46 for the preparation of a pharmaceutical composition or a vaccine for use in the prevention or treatment of a coronavirus infection, preferably coronavirus disease 19 (COVID-19).
  • a coronavirus infection preferably coronavirus disease 19 (COVID-19).
  • Item 49 is a method of treating a subject to prevent or ameliorate symptoms of a coronavirus infection, preferably coronavirus disease 19 (COVID-19), comprising the step of administering the pharmaceutical composition or vaccine of item 47 to a subject.
  • a coronavirus infection preferably coronavirus disease 19 (COVID-19)
  • COVID-19 coronavirus disease 19
  • RBD antigens were designed with boundaries aa 319-591 of the SARS-CoV-2 sequence (Sequence ID: QIA20044.1).
  • the RBD antigens were genetically fused with the split-protein Catcher (or “binding partner”) at the N-terminus.
  • the antigen constructs had an N-terminal BiP secretion signal and a C-terminal C-tag (N-RBD-EPEA-C) used for purification.
  • a GSGS linker was inserted between the RBD and the Catcher.
  • the final gene sequences were codon optimized for expression in Drosophila melanogaster.
  • the ExpreS2 platform was used to produce all proteins by transient transfection.
  • Schneider-2 (ExpreS2) cells were transiently transfected using transfection reagent (ExpreS2 Insect TRx5, ExpreS2ion Biotechnologies) according to manufacturer’s protocol.
  • Cells were grown at 25 °C in shake flasks for 3 days before harvest of the supernatant containing the secreted protein of interest.
  • Cells and debris were pelleted by centrifugation (5000 rpm for 10 min at 4 °C) in a Beckman Avanti JXN-26 centrifuge equipped with a JLA 8.1000 swing-out rotor. The supernatant was decanted and passed through a 0.22 pm vacuum filter (PES) before further processing.
  • PES 0.22 pm vacuum filter
  • the supernatant was passed over a Centramate tangential flow filtration (TFF) membrane (0. Im2, 10 kDa MWCO, PALL) mounted in a SIUS-LS filter holder atop a SIUS- LS filter plate insert (Repligen/TangenX).
  • the retentate was concentrated ten-fold by recirculation through a concentration vessel of 1 liter volume without stirring. Buffer exchange was performed by diafiltration until achieving a tum-over-volume of 10.
  • the crude protein was loaded onto a Capture Select C tag resin (Thermo Fisher) affinity column and washed with capture buffer (25 mM Tris-HCl, 100 mM NaCl, pH7.5).
  • the captured protein was step-eluted in 25 mM Tris-HCl (pH7.5) containing increasing concentrations of MgC12 (0.25 M, 0.5 M, 1 M and 2 M). Data were collected on Unicorn software (Cytivalifesciences, Marlborough, USA, version 5.11) and fractions containing the protein of interest were pooled and concentrated (Amicon 15 ml, 10 kDa or 30 kDa MWCO). Concentrated protein was loaded onto a preparative Superdex-200pg 26/600 (Cytiva) SEC column equilibrated in lx PBS (Gibco) and eluted in the same buffer. Fractions containing the monomeric RBD protein were pooled and concentrated as above.
  • the peptide binding Tag and a linker was added to the N- terminus of the Acinetobacter phage AP205 coat protein (Gene ID: 956335).
  • the gene sequence was inserted into the pET28a(+) vector (Novagen) using Ncol (New England Biolabs) and Notl (New England Biolabs) restriction sites.
  • the Tag-VLP was expressed in BL21 (DE3) competent A. coli cells (New England Biolabas) according to manufacturer’s protocols, and purified as described below for the VLP vaccines. Formulation and purification of the RBD-VLP vaccines.
  • Tag-VLP and RBD antigen were mixed in a 1:1 molar ratio in lxPBS, 5% glycerol and incubated overnight at room temperature.
  • PBS buffer, pH 7.4, supplemented by 400 mM xylitol was chosen for quality assessment of the RBD vaccine.
  • the mixture of RBD and VLP was subjected to a spin test to assess stability. Specifically, a fraction of the sample was spun at 16000 g for 2 min, and equal amounts of pre- and post-spin samples were subsequently loaded on a reduced SDS-PAGE to assess potential loss in the post-spin sample due to precipitation of aggregated RBD-VLP complexes.
  • the conjugated RBD-VLP was purified by dialysis (cutoff 1000 kDa) in a lxPBS with 5% (v/v) glycerol for immunization studies or 400 mM xylitol for quality assessment.
  • RBD-VLP Purified RBD-VLP were both quality checked by negative stain Transmission electron microscopy (TEM) (detailed description 10.1038/s41598-019-41522-5) as well as by Dynamic Light Scattering (DLS) analysis (DynaPro Nanostar, Wyatt technology).
  • TEM negative stain Transmission electron microscopy
  • DLS Dynamic Light Scattering
  • the RBD-VLP sample was first spun at 21,000 g for 2.5 min and then loaded into a disposable cuvette. The sample was then run with 20 acquisitions of 7 sec each. The estimated diameter of the RBD-VLP particle population and the percent polydispersity (%Pd) was calculated by Wyatt DYNAMICS software (v7.10.0.21, US).
  • a vaccine comprising a VLP as described above was evaluated for its ability to induce an immune response in non-human primates (NHPs) (here, rhesus macaques) and for its ability to protect vaccinated NHPs from infection with and/or symptoms produced by SARS-CoV-2.
  • NHPs non-human primates
  • VLPs used in these experiments comprised: (1) the RBD of the SARS-CoV-2 spike protein (amino acids 319-591 of Sequence ID QIA220044.1) genetically fused at the N-terminus to a binding partner comprising the amino acid sequence set forth in SEQ ID NO: 6; and (2) a peptide tag having the amino acid sequence set forth in SEQ ID NO:4 genetically fused to the AP205 coat protein, wherein these components were linked by an isopeptide bond between the binding partner and the peptide tag (diagrammed in Figure 1; also referred to herein as “ABNCoV2”).
  • Subjects were challenged with virus at week 20 and monitored for antibody, cytokine, and chemokine responses.
  • All subjects were exposed via combined intranasal and intratracheal route to 10 5 TCID50 SARS-CoV-2 (CoV isolate BetaCoV/ German/ BavPatl/ 2020 p.4, European Virus Archive, Berlin, Germany).
  • the p4 low passage stock was prepared on Vero E6 cells; supernatant was collected and stored at -80 C, and titer determined using a 50% tissue culture infective dose assay (TCID50 assay) on Vero E6 cells, at 1 x 10 5 TCIDso/mL.
  • virus was diluted to 2 x 10 4 TCID50 per mL, and each animal received 0.25 mL in each nostril and 4.5 mL intratracheally, for a total calculated dose of 1 x 10 5 TCID50.
  • antibodies were highest in Day 16 samples from the high dose group without MF59® adjuvant, followed by the low dose group without MF59® adjuvant, followed by the low dose group with MF59® adjuvant, followed by the high dose group with MF59® adjuvant.
  • Neutralization assays were performed as follows. Human plasma from SeraCare and NHP serum samples from week 4 were heat inactivated by incubating at 56°C for 30 minutes. Two-fold serial dilutions were prepared in media (DMEM + 2% FCS + 1% Pen/Strep + L- Glutamine). Sera were mixed with SARS-CoV-2 at a final titer of 200 TCID50/90pL and incubated at 4°C overnight. Control samples included one including SARS-CoV-2 but lacking serum and another control lacking both serum and virus.
  • Virus/serum mixtures were then added to 2 x 10 4 VeroE6-hTMPRSS2 cells seeded in flat-bottom 96-well plates 24 hours earlier, and these mixtures were then incubated for 72 hours in an incubator at 37°C in the presence of 5% C02 and humidification. Cells were then fixed in 5% formalin and stained with crystal violet; cytopathic effect (CPE) was evaluated using a light microscope. Based on dilution curves obtained, Plaque Reduction Neutralization Titer 50 values (PRNT50 titers) were approximated using commercially available software (GraphPad) ( Figure 2, right panel).
  • Non-human Primate (“NHP”) study showed that the VLP vaccine was immunogenic and protected the subjects against SARS-CoV-2.
  • Antibodies were induced at levels comparable to those in human convalescent subjects by either a single intramuscular administration of adjuvanted VLP vaccine or the higher dose of vaccine tested without adjuvant; however, a second administration of non-adjuvanted VLP vaccine produced titers more than 50-fold higher.
  • Antibodies were durable for at least three to four months. Immune responses were not boosted by the challenge with SARS-CoV-2 virus.
  • SARS-CoV-2 virus load in lung was significantly reduced in all vaccinated groups compared to non-vaccinated controls, but was reduced most effectively in the group that received 2 administrations of the high dose vaccine (100 pg).
  • EXAMPLE 3 Neutralization of SARS-CoV-2 variants by serum from VLP vaccinated non-human primates
  • VLP vaccine described above (ABNCoV2) was evaluated for its ability to induce SARS-CoV-2 wild-type strain (Wuhan) specific as well as SARS-CoV-2 variant-specific neutralizing antibodies in vaccinated NHPs.
  • antibodies in the NHPs were durable within the monitored 3 -month timeframe and levels of neutralizing antibodies were >50-fold higher than those measured in human convalescent samples.
  • These high-level neutralizing antibodies translated into efficacy against challenge, with no viral load detected by PCR in the majority of animals vaccinated with the human dose of 100 pg ABNCoV2 and a significant reduction even in the 15 pg ABNCoV2 vaccination group, compared to non-vaccinated controls that all harbored a high number of viral copies in their lungs.
  • EXAMPLE 4 Human clinical trials showed that a VLP vaccine displaying RBD antigen is highly immunogenic
  • Phase 1 human clinical trial In a Phase 1 human clinical trial investigating a dose response of the ABNCoV2 vaccine in seronegative individuals, the vaccine was well tolerated across all dose groups. Neutralization titers against the SARS-CoV-2 “Wuhan” strain were up to 12-fold higher than the titers in Human Convalescent Sera (HCS), and were comparable for all SARS-CoV-2 Variants Of Concern (VOCs), including the “Delta” variant (Bl.617.2).
  • the Phase 1 trial (“COUGH- 1”) assessed five different dose levels of the ABNCoV2 vaccine.
  • Doses of ABNCoV2 from 6 pg to 70 pg were administered to human patients in a two-dose schedule. These human patients were previously unvaccinated and were seronegative.
  • At ABNCoV2 dose levels from 6 pg to 25 pg administration with and without the MF59® adjuvant (Novartis, Cambridge, MA, USA) was tested.
  • Humoral and cellular responses (B cells and T cells) were measured along with other indicators of safety and immunogenicity for all 45 enrolled patients.
  • PRNT50 is the concentration of serum needed in a Plaque Reduction Neutralization Test to reduce the number of plaques by 50% compared to the serum free virus and is a measurement of the titer of virus-neutralizing antibody in serum; methods for determining this value are well known in the art.
  • Phase 2 human clinical trial In a Phase 2 trial investigating ABNCoV2 dose response in a single administration of vaccine to seropositive individuals, initial results showed that a 100pg dose of ABNCoV2 promoted a strong immunostimulatory effect, increasing the existing levels of SARS-CoV-2 neutralizing antibodies against the Wuhan variant by 2-40-fold, depending on the initial levels of antibodies. Similar fold increases were also observed for all SARS-CoV-2 VOCs (Wuhan, Alpha, Beta, and Delta). No related serious adverse events were reported.
  • the Phase 2 trial involved healthy adult human patients in three groups:
  • Group 1 28 patients who were seronegative for SARS-CoV-2 antibodies at screening and were vaccinated with two doses of 100 pg ABNCoV2
  • Group 2 103 patients who were seropositive for SARS-CoV-2 antibodies at screening (with a prior SARS-CoV-2 vaccination or previously infected with SARS-CoV-2) and were vaccinated with one dose of 100 pg ABNCoV2
  • Group 3 66 patients who were seropositive for SARS-CoV-2 antibodies at screening (with a prior SARS-CoV-2 vaccination or previously infected) and were vaccinated with one dose of 50 pg ABNCoV2
  • This Phase 2 trial was designed to evaluate the safety, tolerability, and immunogenicity of the vaccine in adult human patients, and particularly its effectiveness when administered to patients who had previously been vaccinated with another SARS-CoV- 2 vaccine (i.e., to evaluate ABNCoV2 when administered as a “booster”).
  • results for the Group 2 seropositive patients showed that ABNCoV2 (lOOpg) provided a strong boosting effect, increasing the existing levels of SARS-CoV-2 neutralizing antibodies against the Wuhan strain by 2-40-fold depending on the initial levels of antibodies.
  • a similar fold increase was observed for all SARS-CoV-2 variants tested (Wuhan, Alpha, Beta and Delta) following the booster vaccination with ABNCoV2. No related serious adverse events were reported in the trial.
  • Figure 8 shows neutralizing antibody titer increases in patients in the Phase 2 trial who were initially seropositive.
  • Figure 9 shows neutralizing antibody responses from human patients in the Phase 2 trial. Neutralizing antibody response is shown for seropositive subjects at week 2 for SARS- CoV-2 strains Alpha, Beta, and Wuhan.
  • the three bars shown in Figure 9 for each strain indicate the percentage of subjects with at least a 2-fold increase (left-most bar), at least a 4- fold increase (middle bar), and at least a 6-fold increase (right-most bar).
  • the upper left quadrant of Figure 9 shows overall results, while the other three quadrants show results for patients grouped by relationship of baseline NT (neutralization titer) to LLOQ (lower limit of quantitation).
  • EXAMPLE 5 Phase III trial will be conducted using a non-inferiority design comparing ABNCoV2 immunogenicitv to a licensed boost vaccine
  • a Phase 3 trial is to demonstrate non-inferiority of the ABNCoV2-mediated boost response in terms of GMT of neutralizing antibodies to the SARS-CoV-2 Wuhan strain, as compared to a licensed mRNA-based boost vaccine, in a cohort with a homologous previous vaccination regimen at least six months before.
  • Secondary objectives include analysis of neutralizing antibodies against Variants of Concern (those relevant at the time of analysis) and extent of boost response in various cohorts based on other primary vaccination regimens than the primary endpoint cohort.
  • Exploratory objectives include T cell responses (IFNY and IL-4), analysis of RBD-binding antibodies, and duration of humoral boost responses.
  • Each subject will receive one dose of ABNCoV2 vaccine (active treatment groups) or 1 dose of a comparator vaccine (control groups); subjects will include a wide age-range including older adults.
  • the trial will include various cohorts defined by the previously administered number and type of SARS-CoV-2 vaccine administrations, such as, for example, subjects with a previous homologous 2-dose regimen at least 6 months before screening, subjects with heterologous (or “mix & match”) regimens at least 3 months before screening, or subjects who already had a first boost administration at least 3 months ago and are eligible for a further boost at time of screening.
  • SEQ ID NO:l AP205 amino acid sequence (wt, UniProt Q9AZ42)
  • SEQ ID NO:2 AP205 amino acid sequence (containing Pro5Thr mutation; see US Pat. No. 7138252)
  • SEQ ID NO:3 peptide tag DNA sequence ggtaatccgctgattgtgatggtgaatgataccaccaaagtgaaa
  • SEQ ID NO:4 peptide tag amino acid sequence
  • SEQ ID NO:5 peptide binding partner DNA sequence attgataccatgagcggtctgagcggtgaaaccggtcagagcggtaataccaccattgaagaggatagcaccacacatgtgaaattca gcaaacgcgatagcaacggcaaagaactggcaggcgcaatgattgaactgcgtaatctgagtggtcagaccattcagagctgggtta gtgatggcaccgttaaagatttttatctgatgcctggcacctatcagtttgtgaaaccgcagcaccggaaggttatgagctggcagcac cgattaccttaccgttcaggataacggcgaagttattattcagggccgctgacacgtggcgatgttcatattt
  • SEQ ID NO:6 peptide binding partner amino acid sequence
  • SEQ ID NO:7 amino acid sequence of SARS-CoV-2 full-length S protein (YP_009724390.1, SARS-CoV-2 isolate Wuhan-Hu-1, NC_045512.2)
  • SEQ ID NO: 8 linker (amino acid sequence) GSGTAGGGSGS
  • SEQ ID NO: 9 cVLP-AP205 subunit monomer
  • SEQ ID NO: 10 peptide binding partner amino acid sequence
  • SEQ ID NO: 11 linker sequence GSGS
  • SEQ ID NO: 12 C-tag sequence EPEA
  • SEQ ID NO: 13 RBD antigen sequence
  • SEQ ID NO: 14 Catcher-RBD antigen sequence

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne des vaccins comprenant des particules pseudo-virales présentant au moins un antigène du SARS-CoV-2. L'invention concerne également des particules pseudo-virales (PPV) comprenant des antigènes présentant une protéine AP205, comme le domaine de liaison au récepteur (DLR) de la protéine de spicule du SARS-CoV-2, utilisant une connexion comprenant une étiquette peptidique et un partenaire de liaison. L'invention concerne en outre des méthodes de traitement faisant appel aux PPV de l'invention et l'utilisation des PPV pour traiter et/ou prévenir une infection par le virus du SARS-CoV-2 et des variants de celui-ci. L'invention concerne enfin des utilisations médicales des PPV dans la prévention et/ou l'atténuation des symptômes de la COVID-19.
PCT/IB2022/053821 2021-04-28 2022-04-25 Vaccins comprenant des particules pseudo-virales présentant des antigènes du sars-cov-2 et leurs méthodes d'utilisation WO2022229817A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202163181117P 2021-04-28 2021-04-28
US63/181,117 2021-04-28
US202163246274P 2021-09-20 2021-09-20
US63/246,274 2021-09-20

Publications (1)

Publication Number Publication Date
WO2022229817A1 true WO2022229817A1 (fr) 2022-11-03

Family

ID=81585415

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2022/053821 WO2022229817A1 (fr) 2021-04-28 2022-04-25 Vaccins comprenant des particules pseudo-virales présentant des antigènes du sars-cov-2 et leurs méthodes d'utilisation

Country Status (1)

Country Link
WO (1) WO2022229817A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024068265A2 (fr) 2022-09-30 2024-04-04 Bavarian Nordic A/S Particules de type virus présentant des antigènes du sars-cov-2 utilisées en tant que vaccins de rappel et leurs utilisations

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7138252B2 (en) 2002-07-17 2006-11-21 Cytos Biotechnology Ag Molecular antigen arrays
WO2016112921A1 (fr) 2015-01-15 2016-07-21 University Of Copenhagen Pseudo-particule virale à présentation efficace des épitopes
WO2021224451A1 (fr) * 2020-05-07 2021-11-11 Adaptvac Aps Marqueurs peptidiques et partenaires de liaison

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7138252B2 (en) 2002-07-17 2006-11-21 Cytos Biotechnology Ag Molecular antigen arrays
WO2016112921A1 (fr) 2015-01-15 2016-07-21 University Of Copenhagen Pseudo-particule virale à présentation efficace des épitopes
WO2021224451A1 (fr) * 2020-05-07 2021-11-11 Adaptvac Aps Marqueurs peptidiques et partenaires de liaison

Non-Patent Citations (24)

* Cited by examiner, † Cited by third party
Title
"Antibodies: A Laboratory Manual", 1988
"Current Protocols in Molecular Biology", 1987
"GenBank", Database accession no. QIA20044.1
"Gene", Database accession no. 956335
"PCR2: A Practical Approach", 1995, ACADEMIC PRESS
"Pharmaceutical Formulation Development of Peptides and Proteins", vol. 3rd, 2000, PHARMACEUTICAL PRESS
"Remington's Pharmaceutical Sciences", 1990, MACK PUBLISHING COMPANY
"UniProt", Database accession no. Q9AZ42
COHEN ALEXANDER A ET AL: "Mosaic nanoparticles elicit cross-reactive immune responses to zoonotic coronaviruses in mice", SCIENCE, vol. 371, no. 6530, 12 February 2021 (2021-02-12), US, pages 735 - 741, XP055846840, ISSN: 0036-8075, Retrieved from the Internet <URL:https://www.science.org/doi/pdf/10.1126/science.abf6840?casa_token=vd9M10Lk_G4AAAAA:2E7uCpfuPVVO9F4xlb-yiA-Wxo4k3jZYJs-ZPyk0r06PEHDmaleZgIMoRaGS2S3YduFwwcGTVGoPgw> DOI: 10.1126/science.abf6840 *
FOUGEROUX CYRIELLE ET AL: "Capsid-like particles decorated with the SARS-CoV-2 receptor-binding domain elicit strong virus neutralization activity", NATURE COMMUNICATIONS, vol. 12, no. 1, 12 January 2021 (2021-01-12), XP055938298, Retrieved from the Internet <URL:http://www.nature.com/articles/s41467-020-20251-8> DOI: 10.1038/s41467-020-20251-8 *
FOUGEROUX ET AL., NAT. COMMUN, vol. 12, 2021, pages 324
KARL D. BRUNE ET AL: "Plug-and-Display: decoration of Virus-Like Particles via isopeptide bonds for modular immunization", SCIENTIFIC REPORTS, vol. 6, 19 January 2016 (2016-01-19), pages 19234, XP055258597, DOI: 10.1038/srep19234 *
LECHIEN ET AL., EUR. ARCH. OTORHINOLARYNGOL., vol. 6, 2020, pages 1 - 11
LIU XUELAN ET AL: "AP205 VLPs Based on Dimerized Capsid Proteins Accommodate RBM Domain of SARS-CoV-2 and Serve as an Attractive Vaccine Candidate", VACCINES, vol. 9, no. 4, 19 April 2021 (2021-04-19), pages 403, XP055938291, Retrieved from the Internet <URL:https://www.mdpi.com/2076-393X/9/4/403> DOI: 10.3390/vaccines9040403 *
LUSTIG ET AL., EURO SURVEILL., vol. 26, July 2021 (2021-07-01), pages 2100557
MERCADO ET AL., NATURE, vol. 586, 2020, pages 583 - 88
MORAES ET AL., BIOTECH. ADV., vol. 30, 2012, pages 613 - 28
PLANAS ET AL., NATURE, vol. 596, July 2021 (2021-07-01), pages 276 - 280
SAMBROOKFRITSCHMANIATIS: "Molecular Cloning: A Laboratory Manual", vol. 2nd, 1989
THRANE ET AL., J. NANOBIOTECHNOLOGY, vol. 14, 2016, pages 30
TIONG KIT TAN ET AL: "A COVID-19 vaccine candidate using SpyCatcher multimerization of the SARS-CoV-2 spike protein receptor-binding domain induces potent neutralising antibody responses", NATURE COMMUNICATIONS, vol. 12, no. 1, 22 January 2021 (2021-01-22), pages 1 - 16, XP055771837, DOI: 10.1038/s41467-020-20654-7 *
VAN OOSTEN LINDA ET AL: "Two-Component Nanoparticle Vaccine Displaying Glycosylated Spike S1 Domain Induces Neutralizing Antibody Response against SARS-CoV-2 Variants", MBIO, 12 October 2021 (2021-10-12), XP055938296, Retrieved from the Internet <URL:https://journals.asm.org/doi/10.1128/mBio.01813-21> [retrieved on 20220704], DOI: 10.1128/mBio.01813-21 *
WRAPP ET AL., SCIENCE, vol. 367, 2020, pages 1260 - 3
ZHANG FAN ET AL: "Encrypting Chemical Reactivity in Protein Sequences toward Information-Coded Reactions", CHINESE JOURNAL OF CHEMISTRY, vol. 38, no. 8, 25 May 2020 (2020-05-25), CN, pages 864 - 878, XP055938884, ISSN: 1001-604X, Retrieved from the Internet <URL:https://onlinelibrary.wiley.com/doi/full-xml/10.1002/cjoc.202000083> DOI: 10.1002/cjoc.202000083 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024068265A2 (fr) 2022-09-30 2024-04-04 Bavarian Nordic A/S Particules de type virus présentant des antigènes du sars-cov-2 utilisées en tant que vaccins de rappel et leurs utilisations

Similar Documents

Publication Publication Date Title
US11938221B2 (en) Multivalent nanoparticle-based vaccines
US11969467B2 (en) Nucleic acid vaccine against the SARS-CoV-2 coronavirus
ES2858315T3 (es) Proteína F de prefusión de VRS soluble estabilizada para uso en la profilaxis de la infección por VRS
JP2023513693A (ja) ＳＡＲＳ－ＣｏＶ－２ワクチン
KR20230049084A (ko) Sars-cov-2 및 인플루엔자 조합 백신
JP2018520159A (ja) Ｒｓｖに対するワクチン
US10059747B2 (en) Crimean-congo haemorrhagic fever virus antigenic composition
JP2012510449A (ja) ワクチン
EP4114986A2 (fr) Expression de protéines de sras-cov, constructions d&#39;acides nucléiques, protéines de type viral (vlp) et procédés associés
EP4384604A1 (fr) Antigène vaccinal
US20230174588A1 (en) A vaccine against sars-cov-2 and preparation thereof
WO2022229817A1 (fr) Vaccins comprenant des particules pseudo-virales présentant des antigènes du sars-cov-2 et leurs méthodes d&#39;utilisation
WO2023062515A1 (fr) Plateforme de vaccin à nanoparticules auto-assemblées à épitopes multiples (plateforme msn-vaccin) et ses utilisations
JP2023519837A (ja) コロナウイルスを処置するためのワクチン組成物
CN113801206A (zh) 利用受体识别域诱导抗新冠病毒中和抗体的方法
WO2024068265A2 (fr) Particules de type virus présentant des antigènes du sars-cov-2 utilisées en tant que vaccins de rappel et leurs utilisations
WO2023236822A1 (fr) Développement et utilisation d&#39;un vaccin à large spectre contre la grippe aviaire de type h5n6
JP2024503482A (ja) 複製可能アデノウイルス４型ｓａｒｓ－ｃｏｖ－２ワクチンおよびそれらの使用
AU2022320680A1 (en) Recombinant antigen for inducing an immune response against the zika virus

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22721856

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22721856

Country of ref document: EP

Kind code of ref document: A1