WO2022225254A1 - L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산 방법 - Google Patents

L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산 방법 Download PDF

Info

Publication number
WO2022225254A1
WO2022225254A1 PCT/KR2022/005385 KR2022005385W WO2022225254A1 WO 2022225254 A1 WO2022225254 A1 WO 2022225254A1 KR 2022005385 W KR2022005385 W KR 2022005385W WO 2022225254 A1 WO2022225254 A1 WO 2022225254A1
Authority
WO
WIPO (PCT)
Prior art keywords
microorganism
protein
amino acid
corynebacterium
present application
Prior art date
Application number
PCT/KR2022/005385
Other languages
English (en)
French (fr)
Inventor
최우성
장재원
백미나
이광우
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Priority to AU2022260752A priority Critical patent/AU2022260752A1/en
Priority to JP2023558681A priority patent/JP2024510838A/ja
Priority to EP22791954.5A priority patent/EP4306645A1/en
Priority to BR112023019851A priority patent/BR112023019851A2/pt
Priority to MX2023012155A priority patent/MX2023012155A/es
Priority to CN202280029877.6A priority patent/CN117813386A/zh
Publication of WO2022225254A1 publication Critical patent/WO2022225254A1/ko

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/14—Glutamic acid; Glutamine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/15—Corynebacterium

Definitions

  • the present application relates to a microorganism of the genus Corynebacterium that produces L-amino acids and a method for producing L-amino acids using the same.
  • L-amino acids are used in animal feed, pharmaceuticals, and cosmetics industries, and are mainly produced by fermentation using strains of the spp. Corynebacterium or Escherichia. For the production of L-amino acids, various studies such as the development of high-efficiency production strains and fermentation process technology are being conducted.
  • a target substance-specific approach such as increasing the expression of a gene encoding an enzyme involved in L-amino acid biosynthesis or removing a gene unnecessary for biosynthesis is mainly used (US 8048650 B2, etc.).
  • the present applicants have completed the invention by confirming that the L- amino acid production capacity of the microorganism of the genus Corynebacterium with weakened activity of the protein comprising the amino acid sequence of SEQ ID NO: 1 is increased.
  • One object of the present application is to provide a microorganism of the genus Corynebacterium in which the activity of a protein comprising the amino acid sequence of SEQ ID NO: 1 is weakened.
  • Another object of the present application is to provide a method for preparing L-amino acids comprising the step of culturing the microorganism in a medium.
  • Another object of the present application is the microorganism; the culture medium; Or to provide a composition for preparing L- amino acids comprising a combination thereof.
  • Another object of the present application is to provide a method for producing a microorganism of the genus Corynebacterium for producing L-amino acids, comprising the step of weakening the activity of a protein comprising the amino acid sequence of SEQ ID NO: 1.
  • Another object of the present application is to provide a use of L- amino acid production of a microorganism of the genus Corynebacterium, in which the activity of a protein comprising the amino acid sequence of SEQ ID NO: 1 is weakened.
  • L-amino acids can be produced with high efficiency.
  • One aspect of the present application provides a microorganism of the genus of Corynebacterium in which the activity of a protein comprising the amino acid sequence of SEQ ID NO: 1 is weakened.
  • the protein of the present application may have, include, or essentially consist of the amino acid sequence set forth in SEQ ID NO: 1.
  • protein comprising the amino acid sequence of SEQ ID NO: 1 refers to a protein having ABC-Transporter permease component activity, and the NCBI number may be named NCgl1917.
  • the protein comprising the amino acid sequence of SEQ ID NO: 1 may be an endogenous protein of the strain, but is not limited thereto.
  • the amino acid sequence of the NCgl1917 protein can be obtained from a known database, National Institutes of Health (NIH GenBank).
  • NIH GenBank National Institutes of Health
  • the amino acid sequence information of NCgl1917 can be confirmed in NCBI Reference Sequence WP_006284211, but is not limited thereto.
  • the NCgl1917 protein may refer to a protein having an ABC transporter permease activity derived from the genus Corynebacterium, but is not limited thereto.
  • the amino acid sequence of the NCgl1917 protein is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99 %, 99.5%, 99.7%, or 99.9% or more homology or identity to an amino acid sequence.
  • a protein having an amino acid sequence in which some sequence is deleted, modified, substituted, conservatively substituted or added is also included within the scope of the present application. is self-evident
  • amino acid sequence N-terminus, C-terminus and/or sequence additions or deletions that do not alter the function of the protein of the present application, naturally occurring mutations, silent mutations or conservation It is a case of having an enemy substitution.
  • conservative substitution means substituting one amino acid with another amino acid having similar structural and/or chemical properties.
  • the protein may have, for example, one or more conservative substitutions while still retaining one or more biological activities.
  • Such amino acid substitutions may generally occur based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues.
  • positively charged (basic) amino acids are arginine, lysine, and histidine
  • negatively charged (acidic) amino acids are glutamic acid and arpartate.
  • nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan and proline
  • polar or hydrophilic ( hydrophilic) amino acids include serine, threonine, cysteine, tyrosine, asparagine and glutamine
  • aromatic amino acids among the amino acids include phenylalanine, tryptophan and tyrosine.
  • the term 'homology' or 'identity' refers to the degree of similarity between two given amino acid sequences or nucleotide sequences and may be expressed as a percentage.
  • the terms homology and identity can often be used interchangeably.
  • Sequence homology or identity of a conserved polynucleotide or protein is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially homologous or identical sequences are generally capable of hybridizing with all or part of a sequence under moderate or high stringent conditions. It is apparent that hybridization also includes hybridization with polynucleotides containing common codons or codons taking codon degeneracy into account in the polynucleotide.
  • a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids).
  • Default parameters for the GAP program are: (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap open penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps.
  • polynucleotide encoding the protein comprising the amino acid sequence of SEQ ID NO: 1 may be named Ncgl1917 gene.
  • polynucleotide refers to a DNA or RNA strand of a certain length or more as a polymer of nucleotides in which nucleotide monomers are connected in a long chain form by covalent bonds. Specifically, it may be a polynucleotide fragment encoding the protein.
  • the polynucleotide encoding the protein of the present application may include a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 1.
  • the polynucleotide of the present application may have or include the sequence of SEQ ID NO: 2.
  • the polynucleotide of the present application may consist of, or consist essentially of, the sequence of SEQ ID NO: 2.
  • the polynucleotide of the present application is various in the coding region within the range that does not change the amino acid sequence of the protein of the present application. Deformation can be made.
  • the polynucleotide of the present application has 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% homology or identity to the sequence of SEQ ID NO: 2 Having or including a nucleotide sequence that is more than, 98% or more, and less than 100%, or homology or identity with the sequence of SEQ ID NO: 2 is 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% of the nucleotide sequence may consist of or consist essentially of, but is not limited thereto.
  • the polynucleotide of the present application is a probe that can be prepared from a known gene sequence, for example, a sequence that can hybridize under stringent conditions with a sequence complementary to all or part of the polynucleotide sequence of the present application, without limitation. may be included.
  • the "stringent condition” means a condition that enables specific hybridization between polynucleotides. These conditions are described in J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8).
  • polynucleotides with high homology or identity 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or a condition in which polynucleotides having 99% or more homology or identity hybridize with each other and polynucleotides with lower homology or identity do not hybridize, or a washing condition of conventional Southern hybridization at 60°C, 1 ⁇ SSC, 0.1% SDS, specifically 60° C., 0.1 ⁇ SSC, 0.1% SDS, more specifically 68° C., 0.1 ⁇ SSC, 0.1% SDS at a salt concentration and temperature equivalent to one wash, specifically two to three times conditions can be enumerated.
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization.
  • complementary is used to describe the relationship between nucleotide bases capable of hybridizing to each other.
  • adenine is complementary to thymine
  • cytosine is complementary to guanine.
  • the polynucleotides of the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments complementary to the overall sequence.
  • a polynucleotide having homology or identity to the polynucleotide of the present application can be detected using the hybridization conditions including a hybridization step at a Tm value of 55°C and using the above-described conditions.
  • the Tm value may be 60 °C, 63 °C, or 65 °C, but is not limited thereto and may be appropriately adjusted by those skilled in the art according to the purpose.
  • the appropriate stringency for hybridizing the polynucleotides depends on the length of the polynucleotides and the degree of complementarity, and the parameters are well known in the art (eg, J. Sambrook et al., supra).
  • microorganism or strain
  • microorganism includes both wild-type microorganisms and microorganisms in which genetic modification has occurred naturally or artificially, and causes such as insertion of an external gene or enhanced or inactivated activity of an intrinsic gene
  • a specific mechanism is weakened or enhanced as a microorganism, and may be a microorganism including genetic modification for the production of a desired protein, protein or product.
  • the microorganism of the present application the activity of the protein comprising the amino acid sequence of SEQ ID NO: 1 of the present application is weakened microorganism; Microorganisms with weakened expression of a polynucleotide encoding a protein comprising the amino acid sequence of SEQ ID NO: 1 of the present application; Or it may be a microorganism (eg, a recombinant microorganism) genetically modified through a vector to weaken the activity of the protein comprising the amino acid sequence of SEQ ID NO: 1 of the present application, but is not limited thereto.
  • the attenuation of the activity of the protein comprising the amino acid sequence of SEQ ID NO: 1 may be attenuated expression of the polynucleotide encoding the amino acid sequence of SEQ ID NO: 1 or the polynucleotide of SEQ ID NO: 2.
  • the attenuation of the activity of the protein comprising the amino acid sequence of SEQ ID NO: 1 may be due to modification of the polynucleotide sequence, for example, insertion, deletion or substitution of nucleotides. However, it is not limited thereto.
  • the microorganism of the present application may be a microorganism having the ability to produce L-amino acids.
  • the activity of the protein containing the amino acid sequence of SEQ ID NO: 1 of the present application is weakened in the microorganism or the parent strain without L-amino acid production ability naturally having L-amino acid production ability, so that the L-amino acid production ability is It may be a given microorganism, but is not limited thereto.
  • the microorganism of the present application is transformed through a vector so that the activity of the protein comprising the amino acid sequence of SEQ ID NO: 1 of the present application is weakened, and the activity of the protein comprising the amino acid sequence of SEQ ID NO: 1 is weakened strain or a microorganism.
  • the microorganism is a natural wild-type microorganism or a microorganism that produces L-amino acids, the protein activity comprising the amino acid sequence of SEQ ID NO: 1 of the present application is weakened, It may be a microorganism having an increased ability to produce L-amino acids compared to a microorganism, or a microorganism in which the activity of a protein comprising the amino acid sequence of SEQ ID NO: 1 is not altered), but is not limited thereto.
  • the non-modified microorganism which is the target strain for comparing the increase in L-amino acid production ability, is Corynebacterium glutamicum KCCM12502P (KR 10-2126951 B1), KCCM11222P (US 10590446 B2) or KCCM11248P (KR 10- 1335789 B1), but is not limited thereto.
  • the strain with increased production capacity is about 1% or more, specifically about 1% or more, about 2.5% or more, about 5% or more, about 6 compared to the L-amino acid production capacity of the parent strain or unmodified microorganism before mutation.
  • the recombinant strain with increased production capacity has an L-amino acid production capacity of about 1.1 times or more, about 1.12 times or more, about 1.13 times or more, 1.15 times or more, 1.16 times or more, compared to the parent strain or unmodified microorganism before mutation. , 1.17 times or more, 1.18 times or more, 1.19 times or more, 1.2 times or more, 1.25 times or more, 1.3 times or more, or 1.35 times or more, but is not limited thereto.
  • the term "about” is a range including all of ⁇ 0.5, ⁇ 0.4, ⁇ 0.3, ⁇ 0.2, ⁇ 0.1, etc., including all numerical values in a range equal to or similar to the numerical value following the term about, but not limited
  • the microorganism with increased L-amino acid production capacity of the present application has less than 100% activity of the protein comprising the amino acid sequence of SEQ ID NO: 1, for example, about 99.9 compared to the parent strain or unmodified microorganism before mutation. % or less, about 99% or less, about 98% or less, about 97% or less, about 96% or less, about 95% or less, about 90% or less, about 80% or less, about 70% or less, about 60% or less, about 50 % or less, about 40% or less, about 30% or less, about 20% or less, about 10% or less, about 5% or less, or about 0% or less.
  • the term "unmodified microorganism” does not exclude a strain containing a mutation that can occur naturally in a microorganism, it is a wild-type strain or a natural-type strain itself, or a genetic variation caused by natural or artificial factors. It may mean the strain before being changed.
  • the unmodified microorganism may refer to a microorganism before the activity of the protein comprising the amino acid sequence of SEQ ID NO: 1 described herein is weakened.
  • the "unmodified microorganism” may be used interchangeably with "strain before modification", “microbe before modification”, “unmodified strain”, “unmodified strain”, "unmodified microorganism” or "reference microorganism”.
  • the microorganism of the genus Corynebacterium of the present application is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium crudilactis ), Corynebacterium deserti ( Corynebacterium deserti ), Corynebacterium efficiens ( Corynebacterium efficiens ), Corynebacterium callunae ( Corynebacterium callunae ), Corynebacterium stationis ( Corynebacterium stationis ), Corynebacterium singulare ( Corynebacterium singulare ) Corynebacterium halotolerans ( Corynebacterium halotolerans ), Corynebacterium striatum ( Corynebacterium striatum ), Corynebacterium ammoniagenes ( Corynebacterium ammoniagenes ), Corynebacterium pollutisoli ( Coryne
  • the term "weakening" of a protein is a concept that includes both reduced or no activity compared to intrinsic activity.
  • the attenuation may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, attenuation, and the like.
  • the attenuation is when the activity of the protein itself is reduced or eliminated compared to the activity of the protein possessed by the original microorganism due to mutation of the polynucleotide encoding the protein, etc. )
  • the overall protein activity level and/or concentration (expression amount) in the cell is lower than that of the native strain due to inhibition, etc., when the polynucleotide is not expressed at all, and/or even if the polynucleotide is expressed, the protein It can also be included when there is no activity of.
  • the "intrinsic activity” refers to the activity of a specific protein originally possessed by the parent strain, wild-type or unmodified microorganism before transformation when the trait is changed due to genetic mutation caused by natural or artificial factors.
  • the attenuation of the protein activity may be performed by any method known in the art, but is not limited thereto, and may be achieved by application of various methods well known in the art (eg, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).
  • the attenuation of the protein of the present application is
  • modification of the gene sequence encoding the protein to remove or attenuate the activity of the protein eg, one or more nucleotides on the nucleotide sequence of the protein gene to encode the modified protein to remove or attenuate the activity of the protein) deletion/replacement/addition of);
  • an antisense oligonucleotide eg, antisense RNA
  • an antisense oligonucleotide that complementarily binds to the transcript of the gene encoding the protein
  • deletion of a part or all of the gene encoding the protein may be the removal of the entire polynucleotide encoding the endogenous target protein in the chromosome, replacement with a polynucleotide in which some nucleotides are deleted, or replacement with a marker gene.
  • the expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.
  • the base sequence modification encoding the start codon or 5'-UTR region of the gene transcript encoding the protein for example, encodes another start codon having a lower protein expression rate than the intrinsic start codon. It may be substituted with a nucleotide sequence, but is not limited thereto.
  • the modification of the amino acid sequence or polynucleotide sequence of 4) and 5) above deletes, inserts, non-conservative or conservative substitution of the amino acid sequence of the protein or the polynucleotide sequence encoding the protein to weaken the activity of the protein. Or a combination thereof may result in a mutation in sequence, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity or an amino acid sequence or polynucleotide sequence improved to have no activity, but is not limited thereto.
  • the expression of a gene can be inhibited or attenuated.
  • a transposon may be inserted into the polynucleotide sequence, thereby weakening the expression of the polynucleotide or weakening the activity of a protein encoded by the polynucleotide sequence.
  • a transposon may be inserted into the polynucleotide sequence, thereby weakening the expression of the polynucleotide or weakening the activity of a protein encoded by the polynucleotide sequence.
  • antisense oligonucleotide eg, antisense RNA
  • antisense RNA an antisense oligonucleotide that complementarily binds to the transcript of the gene encoding the protein
  • RTE reverse transcription engineering
  • the term "vector” refers to a DNA comprising a nucleotide sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so that the target polypeptide can be expressed in a suitable host. preparations may be included.
  • the expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After transformation into an appropriate host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
  • the vector used in the present application is not particularly limited, and any vector known in the art may be used.
  • Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in a natural or recombinant state.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors may be used.
  • pBluescript II-based pGEM-based, pTZ-based, pCL-based, pET-based and the like
  • pDZ pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like
  • pC1BAC vectors and the like can be used.
  • a polynucleotide encoding a target polypeptide may be inserted into a chromosome through a vector for intracellular chromosome insertion.
  • the insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • It may further include a selection marker (selection marker) for confirming whether the chromosome is inserted.
  • the selection marker is used to select cells transformed with the vector, that is, to determine whether a target nucleic acid molecule is inserted, and selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or surface polypeptide expression. Markers to be given can be used. In an environment treated with a selective agent, only the cells expressing the selectable marker survive or exhibit other expression traits, so that the transformed cells can be selected.
  • the term "transformation” refers to introducing a vector including a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell.
  • the transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located outside the chromosome, as long as they can be expressed in the host cell.
  • the polynucleotide includes DNA and/or RNA encoding a target polypeptide.
  • the polynucleotide may be introduced in any form as long as it can be introduced and expressed into a host cell.
  • the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression.
  • the expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding a target protein and the polynucleotide sequence are functionally linked.
  • Part or all of the polynucleotide in the microorganism of the present application is modified by (a) homologous recombination using a vector for chromosome insertion in the microorganism or genome editing using engineered nuclease (e.g., CRISPR-Cas9) and/or (b) It may be induced by light and/or chemical treatments such as, but not limited to, ultraviolet and radiation.
  • the method for modifying part or all of the gene may include a method by DNA recombination technology.
  • a part or all of the gene may be deleted.
  • the injected nucleotide sequence or vector may include a dominant selection marker, but is not limited thereto.
  • Another aspect of the present application provides a method for producing L- amino acids, comprising culturing a recombinant microorganism of the genus Corynebacterium in which the activity of a protein comprising the amino acid sequence of SEQ ID NO: 1 is weakened in a medium.
  • Proteins, attenuated microorganisms, and the like comprising the amino acid sequence of SEQ ID NO: 1 are the same as those described in the other embodiments.
  • the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum, but is not limited thereto, and this is the same as described in other embodiments.
  • the L-amino acid may be one or more amino acids selected from L-threonine and L-isoleucine, but is not limited thereto.
  • the term "cultivation” means growing the microorganisms of the genus Corynebacterium of the present application in appropriately controlled environmental conditions.
  • the culture process of the present application may be performed according to a suitable medium and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art according to the selected strain.
  • the culture may be a batch, continuous and/or fed-batch, but is not limited thereto.
  • the term "medium” refers to a material in which nutrients required for culturing the microorganism of the genus Corynebacterium of the present application are mixed as a main component, and includes water essential for survival and development, as well as nutrients and development supplies, etc.
  • any medium and other culture conditions used for culturing the microorganisms of the genus Corynebacterium of the present application may be used without particular limitation as long as they are media used for culturing conventional microorganisms, but the genus Corynebacterium of the present application
  • the microorganisms can be cultured in a conventional medium containing an appropriate carbon source, nitrogen source, phosphorus, inorganic compound, amino acid and/or vitamin, etc. under aerobic conditions while controlling temperature, pH, and the like.
  • the culture medium for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology” by the American Society for Bacteriology (Washington D.C., USA, 1981)].
  • the carbon source includes carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, and the like; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; amino acids such as glutamic acid, methionine, lysine, and the like may be included.
  • natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice winter, cassava, sugar cane offal and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e., converted to reducing sugar). molasses) may be used, and other appropriate amounts of carbon sources may be variously used without limitation. These carbon sources may be used alone or in combination of two or more, but is not limited thereto.
  • nitrogen source examples include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or degradation products thereof, defatted soybean cake or degradation products thereof, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but is not limited thereto.
  • inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate
  • Amino acids such as glutamic acid, methionine, glutamine
  • organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract
  • the phosphorus may include potassium first potassium phosphate, second potassium phosphate, or a sodium-containing salt corresponding thereto.
  • potassium first potassium phosphate potassium phosphate
  • second potassium phosphate or a sodium-containing salt corresponding thereto.
  • sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and in addition, amino acids, vitamins and/or suitable precursors may be included. These components or precursors may be added to the medium either batchwise or continuously. However, the present invention is not limited thereto.
  • compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium.
  • an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation.
  • oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen or carbon dioxide gas may be injected without or without gas to maintain anaerobic and microaerobic conditions, it is not
  • the culture temperature may be maintained at 20 to 45° C., specifically, 25 to 40° C., and may be cultured for about 10 to 160 hours, but is not limited thereto.
  • the L-amino acid prepared by the culture of the present application may be secreted into the medium or may remain in the cell.
  • the L-amino acid production method of the present application includes the steps of preparing the microorganism of the genus Corynebacterium of the present application, preparing a medium for culturing the microorganism, or a combination thereof (regardless of the order, in any order) , for example, prior to the culturing step, may further include.
  • the method for producing L-amino acids of the present application may further include recovering L-amino acids from the culture medium (the culture medium) or the microorganisms of the genus Corynebacterium.
  • the recovering step may be further included after the culturing step.
  • the recovery may be to collect the desired L-amino acid using a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method, etc. .
  • a suitable method known in the art according to the culture method of the microorganism of the present application, for example, a batch, continuous or fed-batch culture method, etc. .
  • chromatography such as island chromatography, HPLC, or a combination thereof may be used, and a desired L-amino acid may be recovered from a medium or a microorganism using a suitable method known in the art.
  • the L-amino acid production method of the present application may include an additional purification step.
  • the purification may be performed using a suitable method known in the art.
  • the recovery step and the purification step are performed continuously or discontinuously, regardless of the order, or integrated into one step may be performed, but is not limited thereto.
  • Another aspect of the present application is a microorganism of the genus Corynebacterium with weakened activity of a protein comprising the amino acid sequence of SEQ ID NO: 1 of the present application; the culture medium; Or to provide a composition for preparing L- amino acids comprising a combination thereof.
  • the protein comprising the amino acid sequence of SEQ ID NO: 1, attenuated, microbial medium, and L-amino acid are the same as those described in the other embodiments.
  • composition of the present application may further include any suitable excipients commonly used in compositions for the production of amino acids, and these excipients may be, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents, etc.
  • excipients commonly used in compositions for the production of amino acids
  • these excipients may be, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizing agents or isotonic agents, etc.
  • the present invention is not limited thereto.
  • the protein, attenuation, microorganism, medium and L-amino acid including the amino acid sequence of SEQ ID NO: 1 are the same as those described in the other aspects above.
  • Another aspect of the present application provides a method for producing a microorganism of the genus Corynebacterium for producing L-amino acids, comprising the step of weakening the activity of a protein comprising the amino acid sequence of SEQ ID NO: 1.
  • the preparation method may include modifying the microorganism to weaken the activity of the protein comprising the amino acid sequence of SEQ ID NO: 1.
  • Another aspect of the present application provides a use of L- amino acid production of a microorganism of the genus Corynebacterium, wherein the activity of a protein comprising the amino acid sequence of SEQ ID NO: 1 is weakened.
  • Proteins, attenuated microorganisms and L-amino acids including the amino acid sequence of SEQ ID NO: 1 are the same as those described in the other embodiments.
  • a random mutant library was prepared by the following method.
  • the plasmid obtained using the EZ-Tn5TM ⁇ R6K ⁇ ori/KAN-2> TnP TransposomeTM Kit (Epicentre) was electrophoresed using the Corynebacterium glutamicum KCCM12502P strain (Korea Patent No. 10-2126951) as the parent strain.
  • About 20,000 colonies were obtained by transformation by the pulse method (Appl. Microbiol. Biotecenol. (1999) 52:541-545) and plated on a complex plate medium containing kanamycin (25 mg/l).
  • Glucose 10 g Peptone 10 g, Beef extract 5 g, yeast extract 5 g, Brain Heart Infusion 18.5 g, NaCl 2.5 g, urea 2 g, Sorbitiol 91 g, agar 20 g (based on 1 liter of distilled water)
  • Example 1 About 20,000 colonies obtained in Example 1 were inoculated into the following selection medium containing 300 uL of kanamycin (25 mg/l), respectively, and in a 96-deep well plate at 32 ° C. at 200 rpm. Incubated for 24 hours.
  • Glucose 10 g (NH4)2SO4 5.5 g, MgSO4 7H2O 1.2 g, KH2PO4 0.8 g, K2HPO4 16.4 g, biotin 100 ug, thiamine HCL 1000 ug, calcium-pantothenic acid 2000 ug, nicotinamide 2000 ug (based on 1 liter of distilled water)
  • the ninhydrin method was used (Moore, S., Stein, W. H., Photometric ninhydrin method for use in the chromatography of amino acids. J. Biol. Chem. 1948, 176, 367-388). After the culture was completed, 10 ul of the culture supernatant and 190 ul of the ninhydrin reaction solution were reacted for 30 minutes at 65° C. About 60 colonies were selected as mutant strains showing high absorbance compared to the Coomb KCCM12502P strain. Other colonies showed absorbance similar to or reduced with the Corynebacterium glutamicum KCCM12502P strain used as a control.
  • the selected about 60 strains were cultured again in the same way as above, and then the ninhydrin reaction was repeated.
  • L-threonine production ability was improved compared to the parent strain, Corynebacterium glutamicum KCCM12502P strain
  • the top 10 mutants were selected and divided into 12502P-m1, 12502P-m2, 12502P-m3, 12502P-m4, 12502P-m5, 12502P-m6, 12502P-m7, 12502P-m8, 12502P-m9, 12502P-m10, respectively. named.
  • flask culture was performed using the following medium.
  • the production of L-threonine was measured by culturing in the following manner. First, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a species medium containing kanamycin (25 mg/l), and cultured with shaking at 30° C. for 20 hours at 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of a production medium containing kanamycin (25 mg/l) and cultured with shaking at 32° C. for 72 hours at 200 rpm.
  • the composition of the species medium and the production medium is as follows, respectively, and the culture results are shown in Table 1.
  • 12502P-m6 was finally selected as a strain with significantly improved L-threonine production capacity among the 10 selected mutants.
  • Genomic DNA of 12502P-m6 was extracted, cut, ligated, transformed into E. coli DH5 ⁇ , and plated on LB solid medium containing kanamycin (25 mg/l). After selecting 20 transformed colonies, a plasmid containing a part of an unknown gene was obtained, and primer SEQ ID NO: 3 and primer SEQ ID NO: 4 of the EZ-Tn5TM ⁇ R6K ⁇ ori/KAN-2> TnP TransposomeTM Kit were used.
  • the gene including the nucleotide sequence of SEQ ID NO: 2 was inactivated based on the nucleotide sequence reported to the National Institutes of Health (NIH Geneback), and the amino acid sequence of SEQ ID NO: 1 was inactivated. It was found that the activity of the containing protein was weakened.
  • Example 5 Construction of a recombinant vector and strain for attenuating protein activity comprising the amino acid sequence of SEQ ID NO: 1
  • a recombinant vector capable of deleting the gene including the nucleotide sequence of SEQ ID NO: 2 identified in Example 4 on the chromosome of the Corynebacterium sp. strain was prepared by the following method. First, using the genomic DNA extracted from the WT strain as a template, primers of SEQ ID NOs: 5 and 6 were synthesized in which a restriction enzyme SmaI recognition site was inserted into the 5' fragment at a position 249 bp away from the front of the Ncgl1917 gene.
  • primers SEQ ID NOs: 7 and 8 in which a restriction enzyme SmaI recognition site was inserted into the 3' fragment at a position 410 bp away from the rear of the Ncgl1917 gene were synthesized (Table 3).
  • primer sequence (5' -> 3') SEQ ID NO: 5 ACGGCCAGTGAATTCGAGCTCGGTACCCATGCCTAATAATGAATTCCA SEQ ID NO: 6 TGGTCCAGCCGAAAAGCCCAAGCACCACCGCAGAGACCCAGAACAGT SEQ ID NO: 7 GTGGTGCTTGGGCTTTTCGG SEQ ID NO: 8 TGCAGGTCGACTCTAGAGGATCCCCTCATCGCTTCCTCGACTTAG
  • PCR (Sambrook et al, Molecular Cloning, a Laboratory Manual (1989), Cold Spring Harbor Laboratories] was performed using the chromosomal DNA of wild-type Corynebacterium glutamicum ATCC 13032 as a template. From this, a DNA fragment of 249 bp at the top and 410 bp at the bottom of the portion encoding the protein encoded by the nucleotide sequence of SEQ ID NO: 2 was obtained. At this time, PCR conditions were denatured at 94°C for 2 minutes, denatured at 94°C for 1 minute, annealed at 56°C for 1 minute, and polymerization was repeated 30 times at 72°C for 40 seconds, followed by polymerization at 72°C for 10 minutes.
  • the pDCM2 vector (KR 10-2020-0136813 A), which was treated with restriction enzyme SmaI and heat-treated at 65° C. for 20 minutes, and the inserted DNA fragment amplified through the PCR were ligated using the Infusion Cloning Kit, and then transformed into E. coli DH5 ⁇ . switched.
  • the strain was plated on LB solid medium containing kanamycin (25 mg/l). After selecting colonies transformed with the vector into which the desired gene was inserted through PCR using primers SEQ ID NOs: 5 and 8, plasmids were obtained using a commonly known plasmid extraction method. This plasmid was named pDCM2- ⁇ Ncgl1917.
  • the constructed vector was transformed into a Corynebacterium glutamicum KCCM12502P strain producing threonine by an electric pulse method.
  • the strain in which the Ncgl1917 gene was inactivated in the KCCM12502P strain was named KCCM12502P:: ⁇ 1917.
  • Example 6 Corynebacterium glutamicum KCCM12502P-derived, L-threonine production capacity evaluation of a strain with weakened activity of a protein comprising the amino acid sequence of SEQ ID NO: 1
  • the L-threonine-producing strain is effective in increasing the L-threonine-producing ability by inactivating the protein comprising the amino acid sequence of SEQ ID NO: 1 in the L-threonine-producing strain
  • the strain KCCM12502P:: ⁇ 1917 was named CA09-0907 and made an international deposit to the Korea Center for Microorganisms Conservation (KCCM) on February 1, 2021, and was given an accession number as KCCM12946P.
  • Example 7 Corynebacterium glutamicum KCCM11222P-derived, production of a strain with weakened activity of a protein comprising the amino acid sequence of SEQ ID NO: 1 and evaluation of L-threonine production ability
  • Example 8 Corynebacterium glutamicum KCCM11248P-derived, production of a strain with weakened activity of a protein comprising the amino acid sequence of SEQ ID NO: 1 and evaluation of L-isoleucine production ability
  • the L-isoleucine-producing strain Coryne in the same manner as in Example 5.
  • Bacterium glutamicum KCCM11248P (Republic of Korea Patent No. 10-1335789) to prepare a strain in which the gene containing the nucleotide sequence of SEQ ID NO: 2 is deleted and named as KCCM11248P:: ⁇ 1917.
  • flask culture was performed using the following medium.
  • each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium, and cultured with shaking at 30° C. for 20 hours at 200 rpm. Then, a 250 ml corner-baffle flask containing 24 ml of production medium was inoculated with 1 ml of the seed culture and cultured with shaking at 32° C. for 72 hours at 200 rpm.
  • the composition of the species medium and the production medium is as follows, respectively, and the culture results are shown in Table 6.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 출원은 L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 L-아미노산의 생산 방법에 관한 것이다.

Description

L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 L-아미노산의 생산 방법
본 출원은 L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 L-아미노산의 생산 방법에 관한 것이다.
L- 아미노산은 동물사료, 의약품 및 화장품 산업 등에 사용되고 있으며, 주로 코리네박테리움 속 균주나 에세케리키아 속 균주를 이용한 발효에 의해 생산되고 있다. L-아미노산의 생산을 위하여, 고효율 생산균주 및 발효공정기술 개발과 같은 다양한 연구들이 수행되고 있다.
구체적으로, L-아미노산 생합성에 관여하는 효소를 코딩하는 유전자의 발현을 증가시키거나 또는 생합성에 불필요한 유전자를 제거하는 것과 같은 목적 물질 특이적 접근 방법이 주로 이용되고 있다 (US 8048650 B2 등).
본 출원인들은 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된 코리네박테리움 속 미생물의 L-아미노산 생산능이 증가한 것을 확인하여 발명을 완성하였다.
본 출원의 하나의 목적은 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된 코리네박테리움 속 미생물을 제공하는 것이다.
본 출원의 다른 하나의 목적은 상기 미생물을 배지에서 배양하는 단계를 포함하는 L-아미노산 제조방법을 제공하는 것이다.
본 출원의 다른 하나의 목적은 상기 미생물; 이를 배양한 배지; 또는 이들의 조합을 포함하는 L-아미노산 제조용 조성물을 제공하는 것이다.
본 출원의 다른 하나의 목적은 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성을 약화하는 단계를 포함하는, L-아미노산을 생산하는 코리네박테리움 속 미생물의 제조방법을 제공하는 것이다.
본 출원의 다른 하나의 목적은 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된, 코리네박테리움 속 미생물의 L-아미노산 생산 용도를 제공하는 것이다.
본 출원의 미생물을 이용하여, L-아미노산을 고효율로 생산할 수 있다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 출원에 기재된 본 출원의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 출원에 포함되는 것으로 의도된다.
본 출원의 하나의 양태는 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된 코리네박테리움 속 (the genus of Corynebacterium) 미생물을 제공한다.
본 출원의 단백질은 서열번호 1로 기재된 아미노산 서열을 가지거나, 포함하거나, 상기 아미노산 서열로 필수적으로 이루어질(essentially consisting of) 수 있다.
본 출원에서 용어, "서열번호 1의 아미노산 서열을 포함하는 단백질"은 ABC-Transporter permease component 활성을 갖는 단백질로, NCBI number가 NCgl1917 로 명명될 수 있다.
본 출원에 있어서, 상기 서열번호 1의 아미노산 서열을 포함하는 단백질은 균주의 내재적 단백질일 수 있으나, 이에 제한되지 않는다.
상기 NCgl1917 단백질의 아미노산 서열은 공지의 데이터 베이스인 미국국립보건원 진뱅크(NIH GenBank)에서 얻을 수 있다. 예를 들어 상기 NCgl1917의 아미노산 서열 정보는 NCBI Reference Sequence WP_006284211 등에서 확인할 수 있으나 이에 제한되지는 않는다. 일 예로, 상기 NCgl1917 단백질은 코리네박테리움 속 유래의 ABC transporter permease 활성을 가지는 단백질을 지칭할 수 있으나, 이에 제한되지는 않는다.
본 출원에 있어서, 상기 NCgl1917 단백질의 아미노산 서열은 상기 서열번호 1로 기재된 아미노산 서열과 적어도 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% 또는 99.9% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다. 또한, 이러한 상동성 또는 동일성을 가지며 본 출원의 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원의 범위 내에 포함됨은 자명하다.
예를 들어, 상기 아미노산 서열 N-말단, C-말단 그리고/또는 내부에 본 출원의 단백질의 기능을 변경하지 않는 서열 추가 또는 결실, 자연적으로 발생할 수 있는 돌연변이, 잠재성 돌연변이 (silent mutation) 또는 보존적 치환을 가지는 경우이다.
본 출원에서 용어 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 상기 단백질은 하나 이상의 생물학적 활성을 여전히 보유하면서, 예를 들어 하나 이상의 보존적 치환을 가질 수 있다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 예를 들면, 전하를 띠는 곁사슬(electrically charged amino acid)을 갖는 아미노산 중 양으로 하전된(염기성) 아미노산은 알지닌, 리신, 및 히스티딘을, 음으로 하전된(산성) 아미노산은 글루탐산 및 아르파르트산을 포함하고; 전하를 띠지 않는 곁사슬(uncharged amino acid)을 갖는 아미노산 중 비극성 아미노산(nonpolar amino acid)은 글리신, 알라닌, 발린, 류신, 이소류신, 메티오닌, 페닐알라닌, 트립토판 및 프롤린을 포함하고, 극성(polar) 또는 친수성(hydrophilic) 아미노산은 세린, 트레오닌, 시스테인, 티로신, 아스파라긴 및 글루타민을 포함하고, 상기 아미노산 중 방향족 아미노산은 페닐알라닌, 트립토판 및 티로신을 포함한다.
본 출원에서 용어, '상동성 (homology)' 또는 '동일성 (identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열 상호간 유사한 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 단백질의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 일부분과 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드와의 하이브리드화 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 또는 단백질 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 단백질의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
본 출원에 있어서, 상기 서열번호 1의 아미노산 서열을 포함하는 단백질을 코딩하는 폴리뉴클레오티드는 Ncgl1917 유전자로 명명될 수 있다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 또는 RNA 가닥을 의미한다. 구체적으로는 상기 단백질을 코딩하는 폴리뉴클레오티드 단편일 수 있다.
본 출원의 단백질을 코딩하는 폴리뉴클레오티드는 서열번호 1로 기재된 아미노산 서열을 코딩하는 염기서열을 포함할 수 있다. 본 출원의 일 예로, 본 출원의 폴리뉴클레오티드는 서열번호 2의 서열을 가지거나 포함할 수 있다. 또한, 본 출원의 폴리뉴클레오티드는 서열번호 2의 서열로 이루어지거나, 필수적으로 구성될 수 있다.
본 출원의 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy) 또는 본 출원의 단백질을 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 본 출원의 단백질의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다.
구체적으로, 본 출원의 폴리뉴클레오티드는 서열번호 2의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열을 가지거나 포함하거나, 또는 서열번호 2의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열로 이루어지거나 필수적으로 이루어질 수 있으나, 이에 제한되지 않는다.
또한, 본 출원의 폴리뉴클레오티드는 공지의 유전자 서열로부터 제조될 수 있는 프로브, 예를 들면, 본 출원의 폴리뉴클레오티드 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화할 수 있는 서열이라면 제한없이 포함될 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(J. Sambrook et al.,Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al.,Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8 참조)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 폴리뉴클레오티드끼리, 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 상동성 또는 동일성을 갖는 폴리뉴클레오티드끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 폴리뉴클레오티드끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1ХSSC, 0.1% SDS, 구체적으로 60℃, 0.1ХSSC, 0.1% SDS, 보다 구체적으로 68℃, 0.1ХSSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데닌은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원의 폴리뉴클레오티드는 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 본 출원의 폴리뉴클레오티드와 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55 ℃의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60 ℃, 63 ℃ 또는 65 ℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
상기 폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(예컨대, J. Sambrook et al., 상동).
본 출원에서 용어, "미생물(또는, 균주)"는 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거나 불활성화되는 등의 원인으로 인해서 특정 기작이 약화되거나 강화된 미생물로서, 목적하는 단백질, 단백질 또는 산물의 생산을 위하여 유전적 변형(modification)을 포함하는 미생물일 수 있다.
본 출원의 미생물은, 본 출원의 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된 미생물; 본 출원의 서열번호 1의 아미노산 서열을 포함하는 단백질을 코딩하는 폴리뉴클레오티드의 발현이 약화된 미생물; 또는 본 출원의 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화되도록 벡터를 통해 유전적으로 변형된 미생물 (예컨대, 재조합 미생물)일 수 있으나, 이에 제한되지 않는다.
일 예로, 상기 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성 약화는 서열번호 1의 아미노산 서열을 코딩하는 폴리뉴클레오티드 또는 서열번호 2의 폴리뉴클레오티드의 발현 약화일 수 있다. 일 예로, 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성 약화는 상기 폴리뉴클레오티드 서열의 변형, 예를 들어 뉴클레오티드의 삽입, 결실 또는 치환에 의한 것일 수 있다. 그러나, 이에 제한되지 않는다.
본 출원의 미생물은 L-아미노산 생산능을 가진 미생물일 수 있다.
본 출원의 미생물은 자연적으로 L-아미노산 생산능을 가지고 있는 미생물 또는 L-아미노산 생산능이 없는 모균주에 본 출원의 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화되어, L-아미노산 생산능이 부여된 미생물일 수 있으나 이에 제한되지 않는다.
일 예로, 본 출원의 미생물은, 본 출원의 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화되도록 벡터를 통해 형질 전환되어, 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된 균주 또는 미생물일 수 있다. 상기 미생물은 본 출원의 목적상, 천연의 야생형 미생물 또는 L-아미노산을 생산하는 미생물에 본 출원의 서열번호 1의 아미노산 서열을 포함하는 단백질 활성이 약화되어, 비변형 미생물(예를 들어 천연의 야생형 미생물, 또는 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 변경되지 않은 미생물)에 비하여 L-아미노산 생산능이 증가된 미생물일 수 있으나, 이에 제한되는 것은 아니다.
그 예로, 상기 L-아미노산 생산능의 증가여부를 비교하는 대상 균주인 비변형 미생물은 코리네박테리움 글루타미쿰 KCCM12502P(KR 10-2126951 B1), KCCM11222P(US 10590446 B2) 또는 KCCM11248P(KR 10-1335789 B1)일 수 있으나, 이에 제한되지 않는다.
일 예로, 상기 생산능이 증가된 균주는 변이 전 모균주 또는 비변형 미생물의 L-아미노산 생산능에 비하여 약 1% 이상, 구체적으로는 약 1% 이상, 약 2.5% 이상, 약 5% 이상, 약 6% 이상, 약 7% 이상, 약 8% 이상, 약 9% 이상, 약 10% 이상, 약 10.5% 이상, 약 11% 이상, 약 11.5%이상, 약 12% 이상, 약 12.5% 이상, 약 13% 이상, 약 13.5% 이상, 약 14% 이상, 약 14.5% 이상, 약 15% 이상, 약 15.5% 이상, 약 16% 이상, 약 16.5% 이상, 약 17% 이상, 약 17.5% 이상, 약 18% 이상, 약 18.5% 이상, 약 19% 이상, 약 19.5% 이상, 약 20% 이상, 약 20.5% 이상, 약 21% 이상, 약 21.5% 이상, 약 22% 이상, 약 22.5% 이상, 약 23% 이상, 약 23.5% 이상, 약 24% 이상, 약 24.5% 이상, 약 25% 이상, 약 25.5% 이상, 약 26% 이상, 약 26.5% 이상, 약 27% 이상, 약 27. 5% 이상, 약 28% 이상, 약 28.5% 이상, 약 29% 이상, 약 29.5% 이상, 약 30% 이상, 약 30.5% 이상, 약 31% 이상, 약 31.5% 이상, 약 32% 이상, 약 32.5% 이상, 약 33% 이상, 약 33.5% 이상, 약 34% 이상, 약 34.5% 이상, 약 35% 이상 증가된 것일 수 있으나, 변이 전 모균주 또는 비변형 미생물의 생산능에 비해 +값의 증가량을 갖는 한, 이에 제한되지 않는다. 다른 예에서, 상기 생산능이 증가된 재조합 균주는 변이 전 모균주 또는 비변형 미생물에 비하여, L-아미노산 생산능이 약 1.1배 이상, 약 1.12배 이상, 약 1.13배 이상, 1.15배 이상, 1.16배 이상, 1.17배 이상, 1.18배 이상, 1.19배 이상, 1.2배 이상, 1.25배 이상, 1.3배 이상 또는 1.35배 이상 증가된 것일 수 있으나, 이에 제한되지 않는다. 상기 용어 "약(about)"은 ±0.5, ±0.4, ±0.3, ±0.2, ±0.1 등을 모두 포함하는 범위로, 약 이란 용어 뒤에 나오는 수치와 동등하거나 유사한 범위의 수치를 모두 포함하나, 이에 제한되지 않는다.
일 예로, 본 출원의 L-아미노산 생산능이 증가된 미생물은, 변이 전 전 모균주 또는 비변형 미생물에 비하여, 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 100% 미만, 예를 들어 약 99.9% 이하, 약 99% 이하, 약 98% 이하, 약 97% 이하, 약 96% 이하, 약 95% 이하, 약 90% 이하, 약 80% 이하, 약 70% 이하, 약 60% 이하, 약 50% 이하, 약 40% 이하, 약 30% 이하, 약 20% 이하, 약 10% 이하, 약 5% 이하, 또는 약 0%일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "비변형 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 야생형 균주 또는 천연형 균주 자체이거나, 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화되기 전 균주를 의미할 수 있다. 예를 들어, 상기 비변형 미생물은 본 명세서에 기재된 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화 되기 전의 미생물을 의미할 수 있다. 상기 "비변형 미생물"은 "변형 전 균주", "변형 전 미생물", "비변이 균주", "비변형 균주", "비변이 미생물" 또는 "기준 미생물"과 혼용될 수 있다.
본 출원의 또 다른 일 예로, 본 출원의 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum), 코리네박테리움 크루디락티스(Corynebacterium crudilactis), 코리네박테리움 데세르티(Corynebacterium deserti), 코리네박테리움 이피시엔스(Corynebacterium efficiens), 코리네박테리움 칼루내(Corynebacterium callunae), 코리네박테리움 스테셔니스(Corynebacterium stationis), 코리네박테리움 싱굴라레(Corynebacterium singulare), 코리네박테리움 할로톨레란스(Corynebacterium halotolerans), 코리네박테리움 스트리아툼(Corynebacterium striatum), 코리네박테리움 암모니아게네스(Corynebacterium ammoniagenes), 코리네박테리움 폴루티솔리(Corynebacterium pollutisoli), 코리네박테리움 이미탄스(Corynebacterium imitans), 코리네박테리움 테스투디노리스(Corynebacterium testudinoris) 또는 코리네박테리움 플라베스센스(Corynebacterium flavescens)일 수 있다.
본 출원에서 용어, 단백질의 "약화"는 내재적 활성에 비하여 활성이 감소되거나 또는 활성이 없는 것을 모두 포함하는 개념이다. 상기 약화는 불활성화(inactivation), 결핍(deficiency), 하향조절(down-regulation), 감소(decrease), 저하(reduce), 감쇠(attenuation) 등의 용어와 혼용될 수 있다.
상기 약화는 상기 단백질을 코딩하는 폴리뉴클레오티드의 변이 등으로 단백질 자체의 활성이 본래 미생물이 가지고 있는 단백질의 활성에 비해 감소 또는 제거된 경우, 이를 코딩하는 폴리뉴클레오티드의 발현 저해 또는 단백질로의 번역(translation) 저해 등으로 세포 내에서 전체적인 단백질 활성 정도 및/또는 농도(발현량)가 천연형 균주에 비하여 낮은 경우, 상기 폴리뉴클레오티드의 발현이 전혀 이루어지지 않은 경우, 및/또는 폴리뉴클레오티드의 발현이 되더라도 단백질의 활성이 없는 경우 역시 포함할 수 있다. 상기 "내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주, 야생형 또는 비변형 미생물이 본래 가지고 있던 특정 단백질의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 단백질의 활성이 내재적 활성에 비하여 "불활성화, 결핍, 감소, 하향조절, 저하, 감쇠"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 단백질의 활성에 비하여 낮아진 것을 의미한다.
이러한 단백질의 활성의 약화는, 당업계에 알려진 임의의 방법에 의하여 수행될 수 있으나 이로 제한되는 것은 아니며, 당해 분야에 잘 알려진 다양한 방법의 적용으로 달성될 수 있다(예컨대, Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 단백질의 약화는
1) 단백질을 코딩하는 유전자 전체 또는 일부의 결손;
2) 단백질을 코딩하는 유전자의 발현이 감소하도록 발현조절영역(또는 발현조절서열)의 변형;
3) 단백질의 활성이 제거 또는 약화되도록 상기 단백질을 구성하는 아미노산 서열의 변형(예컨대, 아미노산 서열 상의 1 이상의 아미노산의 삭제/치환/부가);
4) 단백질의 활성이 제거 또는 약화되도록 상기 단백질을 코딩하는 유전자 서열의 변형 (예를 들어, 단백질의 활성이 제거 또는 약화되도록 변형된 단백질을 코딩하도록 상기 단백질 유전자의 핵산염기 서열 상의 1 이상의 핵산염기의 삭제/치환/부가);
5) 단백질을 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
6) 단백질을 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입;
7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 단백질을 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가;
8) 단백질을 코딩하는 유전자 서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE); 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
예컨대,
상기 1) 단백질을 코딩하는 상기 유전자 일부 또는 전체의 결손은, 염색체 내 내재적 목적 단백질을 코딩하는 폴리뉴클레오티드 전체의 제거, 일부 뉴클레오티드가 결실된 폴리뉴클레오티드로의 교체 또는 마커 유전자로 교체일 수 있다.
또한, 상기 2) 발현조절영역(또는 발현조절서열)의 변형은, 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 발현조절영역(또는 발현조절서열) 상의 변이 발생, 또는 더욱 약한 활성을 갖는 서열로의 교체일 수 있다. 상기 발현조절영역에는 프로모터, 오퍼레이터 서열, 리보좀 결합부위를 코딩하는 서열, 및 전사와 해독의 종결을 조절하는 서열을 포함하나, 이에 한정되는 것은 아니다.
또한, 상기 3) 단백질을 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 단백질의 발현율이 더 낮은 다른 개시코돈을 코딩하는 염기서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
또한, 상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은 단백질의 활성을 약화하도록 상기 단백질의 아미노산 서열 또는 상기 단백질을 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 약한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 없도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 예를 들면, 폴리뉴클레오티드 서열 내 변이를 도입하여 종결 코돈을 형성시킴으로써, 유전자의 발현을 저해하거나 약화시킬 수 있다. 폴리뉴클레오티드 서열의 변형의 다른 예로, 폴리뉴클레오티드 서열 내에 트랜스포존이 삽입되어, 상기 폴리뉴클레오티드의 발현이 약화되거나, 폴리뉴클레오티드 서열이 코딩하는 단백질의 활성이 약화될 수 있다. 그러나, 이에 제한되지 않는다.
상기 6) 단백질을 코딩하는 상기 유전자의 전사체에 상보적으로 결합하는 안티센스 올리고뉴클레오티드(예컨대, 안티센스 RNA)의 도입은 예를 들어 문헌 [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986]을 참고할 수 있다.
상기 7) 리보솜(ribosome)의 부착이 불가능한 2차 구조물을 형성시키기 위하여 단백질을 코딩하는 유전자의 사인-달가르노(Shine-Dalgarno) 서열 앞단에 사인-달가르노 서열과 상보적인 서열의 부가는 mRNA 번역을 불가능하게 하거나 속도를 저하시키는 것일 수 있다.
상기 8) 단백질을 코딩하는 유전자서열의 ORF(open reading frame)의 3' 말단에 반대 방향으로 전사되는 프로모터의 부가(Reverse transcription engineering, RTE)는 상기 단백질을 코딩하는 유전자의 전사체에 상보적인 안티센스 뉴클레오티드를 만들어 활성을 약화하는 것일 수 있다.
본 출원에서 용어, "벡터"는 적합한 숙주 내에서 목적 폴리펩티드를 발현시킬 수 있도록 적합한 발현조절영역(또는 발현조절서열)에 작동 가능하게 연결된 상기 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 염기서열을 포함하는 DNA 제조물을 포함할 수 있다. 상기 발현조절영역은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pDZ계, pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC 벡터 등을 사용할 수 있다.
일례로 세포 내 염색체 삽입용 벡터를 통해 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 염색체 내로 삽입할 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 폴리펩티드의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원에서 용어 "형질전환"은 표적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 혹은 미생물 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 폴리펩티드가 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 목적 폴리펩티드를 코딩하는 DNA 및/또는 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로도 도입될 수 있다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 목적 단백질을 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 출원의 미생물에서 폴리뉴클레오티드의 일부 또는 전체의 변형은 (a) 미생물 내 염색체 삽입용 벡터를 이용한 상동 재조합 또는 유전자가위 (engineered nuclease, e.g., CRISPR-Cas9)을 이용한 유전체 교정 및/또는 (b) 자외선 및 방사선 등과 같은 빛 및/또는 화학물질 처리에 의해 유도될 수 있으나 이에 제한되지 않는다. 상기 유전자 일부 또는 전체의 변형 방법에는 DNA 재조합 기술에 의한 방법이 포함될 수 있다. 예를 들면, 목적 유전자와 상동성이 있는 뉴클레오티드 서열을 포함하는 뉴클레오티드 서열 또는 벡터를 상기 미생물에 주입하여 상동 재조합(homologous recombination)이 일어나게 함으로써 유전자 일부 또는 전체의 결손이 이루어질 수 있다. 상기 주입되는 뉴클레오티드 서열 또는 벡터는 우성 선별 마커를 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 또 다른 하나의 양태는 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된 코리네박테리움 속 재조합 미생물을 배지에서 배양하는 단계를 포함하는, L-아미노산 제조방법을 제공한다.
상기 서열번호 1의 아미노산 서열을 포함하는 단백질, 약화 및 미생물 등은 상기 다른 양태에서 기재한 바와 같다.
상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰일 수 있으나, 이에 제한되지 않으며, 이에 대해서는 다른 양태에서 기재한 바와 같다.
상기 L-아미노산은 L-쓰레오닌 및 L-이소류신 중에서 선택되는 1 이상의 아미노산일 수 있으나, 이에 제한되지 않는다.
본 출원에서, 용어 "배양"은 본 출원의 코리네박테리움 속 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원의 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및/또는 유가식일 수 있으나, 이에 제한되는 것은 아니다.
본 출원에서 용어, "배지"는 본 출원의 코리네박테리움 속 미생물을 배양하기 위해 필요로 하는 영양물질을 주성분으로 혼합한 물질을 의미하며, 생존 및 발육에 불가결한 물을 비롯하여 영양물질 및 발육인자 등을 공급한다. 구체적으로, 본 출원의 코리네박테리움 속 미생물의 배양에 사용되는 배지 및 기타 배양 조건은 통상의 미생물의 배양에 사용되는 배지라면 특별한 제한 없이 어느 것이나 사용할 수 있으나, 본 출원의 코리네박테리움 속 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
구체적으로, 코리네박테리움 속 미생물에 대한 배양 배지는 문헌["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.C., USA, 1981)]에서 찾아 볼 수 있다.
본 출원에서 상기 탄소원으로는 글루코오스, 사카로오스, 락토오스, 프룩토오스, 수크로오스, 말토오스 등과 같은 탄수화물; 만니톨, 소르비톨 등과 같은 당 알코올, 피루브산, 락트산, 시트르산 등과 같은 유기산; 글루탐산, 메티오닌, 리신 등과 같은 아미노산 등이 포함될 수 있다. 또한, 전분 가수분해물, 당밀, 블랙스트랩 당밀, 쌀겨울, 카사버, 사탕수수 찌꺼기 및 옥수수 침지액 같은 천연의 유기 영양원을 사용할 수 있으며, 구체적으로는 글루코오스 및 살균된 전처리 당밀(즉, 환원당으로 전환된 당밀) 등과 같은 탄수화물이 사용될 수 있으며, 그 외의 적정량의 탄소원을 제한 없이 다양하게 이용할 수 있다. 이들 탄소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 질산암모늄 등과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민 등과 같은 아미노산, 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해 생성물 등과 같은 유기 질소원이 사용될 수 있다. 이들 질소원은 단독으로 사용되거나 2 종 이상이 조합되어 사용될 수 있으며, 이에 한정되는 것은 아니다.
상기 인원으로는 인산 제1칼륨, 인산 제2칼륨, 또는 이에 대응되는 소디움-함유 염 등이 포함될 수 있다. 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간, 탄산칼슘 등이 사용될 수 있으며, 그 외에 아미노산, 비타민 및/또는 적절한 전구체 등이 포함될 수 있다. 이들 구성성분 또는 전구체는 배지에 회분식 또는 연속식으로 첨가될 수 있다. 그러나, 이에 한정되는 것은 아니다.
또한, 본 출원의 코리네박테리움 속 미생물의 배양 중에 수산화암모늄, 수산화칼륨, 암모니아, 인산, 황산 등과 같은 화합물을 배지에 적절한 방식으로 첨가하여, 배지의 pH를 조정할 수 있다. 또한, 배양 중에는 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 또한, 배지의 호기 상태를 유지하기 위하여, 배지 내로 산소 또는 산소 함유 기체를 주입하거나 혐기 및 미호기 상태를 유지하기 위해 기체의 주입 없이 혹은 질소, 수소 또는 이산화탄소 가스를 주입할 수 있으며, 이에 한정되는 것은 아니다.
본 출원의 배양에서 배양온도는 20 내지 45℃, 구체적으로는 25 내지 40℃ 를 유지할 수 있고, 약 10 내지 160 시간 동안 배양할 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 배양에 의하여 제조된 L-아미노산은 배지 중으로 분비되거나 세포 내에 잔류할 수 있다.
본 출원의 L-아미노산 제조방법은, 본 출원의 코리네박테리움 속 미생물을 준비하는 단계, 상기 미생물을 배양하기 위한 배지를 준비하는 단계, 또는 이들의 조합(순서에 무관, in any order)을, 예를 들어, 상기 배양하는 단계 이전에, 추가로 포함할 수 있다.
본 출원의 L-아미노산 생산방법은, 상기 배양에 따른 배지(배양이 수행된 배지) 또는 코리네박테리움 속 미생물로부터 L-아미노산을 회수하는 단계를 추가로 포함할 수 있다. 상기 회수하는 단계는 상기 배양하는 단계 이후에 추가로 포함될 수 있다.
상기 회수는 본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 목적하는 L-아미노산을 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 결정화 단백질 침전제에 의한 처리(염석법), 추출, 초음파 파쇄, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피 등의 각종 크로마토그래피, HPLC 또는 이들의 방법을 조합하여 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 L-아미노산을 회수할 수 있다.
또한, 본 출원의 L-아미노산 생산방법은, 추가적으로 정제 단계를 포함할 수 있다. 상기 정제는 당해 기술분야에 공지된 적합한 방법을 이용하여, 수행할 수 있다. 일 예에서, 본 출원의 L-아미노산 생산방법이 회수 단계와 정제 단계를 모두 포함하는 경우, 상기 회수 단계와 정제 단계는 순서에 상관없이 연속적 또는 비연속적으로 수행되거나, 동시에 또는 하나의 단계로 통합되어 수행될 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 또 다른 하나의 양태는 본 출원의 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된 코리네박테리움 속 미생물; 이를 배양한 배지; 또는 이들의 조합을 포함하는 L-아미노산 제조용 조성물을 제공하는 것이다.
상기 서열번호 1의 아미노산 서열을 포함하는 단백질, 약화, 미생물 배지, 및 L-아미노산 등은 상기 다른 양태에서 기재한 바와 같다.
본 출원의 조성물은 아미노산 생산용 조성물에 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있으며, 이러한 부형제는, 예를 들어 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 조성물에서, 서열번호 1의 아미노산 서열을 포함하는 단백질, 약화, 미생물, 배지 및 L-아미노산 등은 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 다른 하나의 양태는 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성을 약화하는 단계를 포함하는, L-아미노산을 생산하는 코리네박테리움 속 미생물의 제조방법을 제공한다.
상기 제조방법은 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성을 약화하도록 미생물을 변형하는 단계를 포함할 수 있다.
단백질의 활성 약화, L-아미노산 및 미생물 등에 대해서는 상기 다른 양태에서 기재한 바와 같다.
본 출원의 또 다른 하나의 양태는 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된, 코리네박테리움 속 미생물의 L-아미노산 생산 용도를 제공한다.
상기 서열번호 1의 아미노산 서열을 포함하는 단백질, 약화, 미생물 및 L-아미노산 등은 상기 다른 양태에서 기재한 바와 같다.
이하 본 출원을 실시예 및 실험예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예 및 실험예는 본 출원을 예시적으로 설명하기 위한 것으로 본 출원의 범위가 이들 실시예 및 실험예에 한정되는 것은 아니다.
실시예 1. 트랜스포존을 이용한 무작위적 돌연변이 라이브러리 제작
L-쓰레오닌 생산능이 증가된 균주를 얻기 위하여, 아래의 방법으로 무작위 돌연변이 라이브러리를 제작하였다. 먼저 EZ-Tn5™ <R6Kγori/KAN-2>TnP Transposome™ Kit(Epicentre)를 사용하여 얻은 플라스미드를 코리네박테리움 글루타미쿰 KCCM12502P 균주(대한민국 등록특허 제10-2126951호)를 모균주로 하여 전기펄스법(Appl. Microbiol. Biotecenol.(1999) 52:541-545)으로 형질전환하고 카나마이신 (25mg/l)이 포함된 복합평판배지에 도말하여 약 20,000개의 콜로니를 확보하였다.
<복합평판배지 (pH 7.0)>
포도당 10 g, 펩톤 10 g, Beef extract 5 g, 효모추출물 5 g, Brain Heart Infusion 18.5 g, NaCl 2.5 g, 요소 2 g, Sorbitiol 91 g, 한천 20 g (증류수 1 리터 기준)
실시예 2. 트랜스포존을 이용한 무작위적 돌연변이 라이브러리 스크리닝
상기 실시예 1에서 확보된 약 20,000개의 콜로니를 각각 300 uL의 카나마이신 (25mg/l)이 포함된 하기의 선별배지에 접종하여 96 딥 웰 플레이트(96-deep well plate) 에서 32℃ 200 rpm으로 약 24시간 동안 배양하였다.
<선별배지 (pH 8.0)>
포도당 10 g, (NH4)2SO4 5.5 g, MgSO4·7H2O 1.2 g, KH2PO4 0.8 g, K2HPO4 16.4 g, 바이오틴 100 ug, 티아민 HCL 1000 ug, 칼슘-판토텐산 2000 ug, 니코틴아미드 2000 ug (증류수 1 리터 기준)
배양액에 생산된 L-쓰레오닌의 생산량을 분석하기 위하여 닌하이드린 방법을 이용하였다(Moore, S., Stein, W. H., Photometric ninhydrin method for use in the chromatography of amino acids. J. Biol. Chem.1948, 176, 367-388). 배양이 완료된 후 배양 상층액 10 ul 와 닌하이드린 반응용액 190 ul을 65℃에서 30분간 반응시킨 후, 파장 570 nm에서 분광 광도계(spectrophotometer)로 흡광도를 측정하고, 대조군인 코리네박테리움 글루타미쿰 KCCM12502P 균주와 비교하여 높은 흡광도를 보이는 변이균주들로서 약 60여 종의 콜로니를 선별하였다. 그 외 콜로니들은 대조군으로 이용된 코리네박테리움 글루타미쿰 KCCM12502P 균주와 유사하거나 감소한 흡광도를 보였다.
상기 선별된 60여 종의 균주들은 상기와 동일한 방법으로 다시 배양 한 후 닌하이드린 반응을 반복 수행하여, 결과적으로 모균주인 코리네박테리움 글루타미쿰 KCCM12502P 균주 대비 L-쓰레오닌 생산능이 향상된 상위 10종의 돌연변이주를 선별하여 각 12502P-m1, 12502P-m2, 12502P-m3, 12502P-m4, 12502P-m5, 12502P-m6, 12502P-m7, 12502P-m8, 12502P-m9, 12502P-m10으로 명명하였다.
실시예 3. 선별된 무작위적 돌연변이주들의 L-쓰레오닌 생산능 분석
실시예 2에서 선별된 10 종의 돌연변이주들을 대상으로 L-쓰레오닌 생산능이 재현성 있게 증가된 균주들을 최종 선별하기 위하여, 하기의 배지를 이용한 플라스크 배양을 실시하였다. 아래와 같은 방법으로 배양하여 L-쓰레오닌 생산량을 측정하였다. 먼저, 카나마이신 (25mg/l)이 포함된 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주들을 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음, 카나마이신 (25mg/l)이 포함된 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 32℃에서 72 시간 동안, 200 rpm에서 진탕 배양하였다. 상기 종 배지와 생산 배지의 조성은 각각 하기와 같으며, 배양 결과는 표 1와 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 22 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 63 g, (NH4)2SO4 28 g, 대두 단백질 20 g, 당밀 14 g, KH2PO4 1.1 g, MgSO4·7H2O 1.2 g, 바이오틴 1.8 mg, 티아민 염산염 9 mg, 칼슘-판토텐산 9 mg, MnSO4 180 mg, FeSO4 200 mg, ZnSO4 1 mg, CuSO4 1 mg, CaCO3 30 g (증류수 1리터 기준).
선별된 무작위 돌연변이주 10종의 L-쓰레오닌 생산농도
균주 L-쓰레오닌(g/L)
배치 1 배치 2 배치 3 평균
대조군 KCCM12502P 3.42 3.48 3.32 3.40
1 12502P-m1 3.38 3.58 3.44 3.46
2 12502P-m2 3.76 3.86 3.82 3.82
3 12502P-m3 3.66 3.62 3.65 3.65
4 12502P-m4 3.18 3.31 3.2 3.23
5 12502P-m5 3.28 3.34 3.35 3.33
6 12502P-m6 4.42 4.28 4.33 4.34
7 12502P-m7 3.72 3.72 3.62 3.68
8 12502P-m8 3.91 4.01 3.84 3.92
9 12502P-m9 3.81 3.72 3.79 3.78
10 12502P-m10 4.08 3.99 3.98 4.01
선발된 10종의 변이주들 중 L-쓰레오닌 생산능이 의미있게 향상된 균주로서 12502P-m6 이 최종 선별되었다.
실시예 4. 최종 선별주들에서의 L-쓰레오닌 생산능 증가 원인 규명
본 실시예에서는 상기 실시예 3으로부터 최종 선별된 돌연변이주를 대상으로 트랜스포존의 무작위적인 삽입에 의해 결손된 유전자를 동정하고자 하였다. 12502P-m6 의 Genomic DNA를 추출하여 절단한 후 연결하여 대장균 DH5α에 형질전환하고, 카나마이신 (25 mg/l)이 포함된 LB 고체배지에 도말하였다. 형질전환된 콜로니 20종을 선별한 후, 미지의 유전자 일부가 포함된 플라스미드를 획득하였고, EZ-Tn5™ <R6Kγori/KAN-2>TnP Transposome™ Kit의 프라이머 서열번호 3 및 프라이머 서열번호 4를 사용하여 염기서열을 분석한 결과 미국국립보건원의 유전자은행(NIH Geneback)에 보고된 염기서열에 근거하여 서열번호 2(Ncgl1917)의 뉴클레오티드 서열을 포함하는 유전자가 불활성화되어, 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화 된 것을 알게 되었다.
프라이머 서열 (5' -> 3')
서열번호 3 ACCTACAACAAAGCTCTCATCAACC
서열번호 4 CTACCCTGTGGAACACCTACATCT
실시예 5. 서열번호 1의 아미노산 서열을 포함하는 단백질 활성 약화를 위한 재조합 벡터 및 균주 제작
코리네박테리움 속 균주의 염색체 상에서 상기 실시예 4에서 확인된 서열번호 2의 뉴클레오티드 서열을 포함하는 유전자를 결손시킬 수 있는 재조합 벡터를 아래와 같은 방법으로 제작하였다. 먼저, WT 균주로부터 추출한 게놈 DNA를 주형으로 Ncgl1917 유전자의 앞쪽 249bp 떨어진 위치의 5' 단편에 제한효소 SmaI 인식 부위를 삽입한 서열번호 5 및 6의 프라이머를 합성하였다. 또한 Ncgl1917 유전자의 뒤쪽 410bp 떨어진 위치의 3' 단편에 제한효소 SmaI 인식 부위를 삽입한 프라이머 서열번호 7 및 8을 합성하였다 (표3).
프라이머 서열 (5' -> 3')
서열번호 5 ACGGCCAGTGAATTCGAGCTCGGTACCCATGCCTAATAATGAATTCCA
서열번호 6 TGGTCCAGCCGAAAAGCCCAAGCACCACCGCAGAGACCCAGAACAGT
서열번호 7 GTGGTGCTTGGGCTTTTCGG
서열번호 8 TGCAGGTCGACTCTAGAGGATCCCCTCATCGCTTCCTCGACTTAG
구체적으로, 야생형 코리네박테리움 글루타미쿰 ATCC 13032의 염색체 DNA를 주형으로 PCR[Sambrook et al, Molecular Cloning, a Laboratory Manual (1989), Cold Spring Harbor Laboratories]을 수행하였다. 이로부터 서열번호 2의 뉴클레오티드 서열로 코딩되는 단백질을 암호화하는 부분의 상단 249bp와 하단 410bp의 DNA 단편을 획득하였다. 이때, PCR 조건은 94℃ 에서 2분간 변성 후, 94℃ 1분 변성, 56℃ 1분 어닐링, 72℃ 40초 중합을 30회 반복한 후, 72℃에서 10분간 중합반응을 수행하였다. 한편 제한효소 SmaI으로 처리한 후 65℃에서 20분간 열처리한 pDCM2 벡터(KR 10-2020-0136813 A)와 상기 PCR을 통하여 증폭한 삽입 DNA 단편을 Infusion Cloning Kit를 사용하여 연결한 후 대장균 DH5α에 형질전환하였다. 상기 균주를 카나마이신 (25 mg/l)이 포합된 LB 고체배지에 도말하였다. 프라이머 서열번호 5 및 8 이용한 PCR을 통해 목적한 유전자가 삽입된 벡터로 형질전환된 콜로니를 선별한 후 통상적으로 알려진 플라스미드 추출법을 이용하여 플라스미드를 획득하였다. 상기 플라스미드는 pDCM2-ΔNcgl1917로 명명하였다. 제작된 벡터를 쓰레오닌을 생산하는 코리네박테리움 글루타미쿰 KCCM12502P 균주에 전기펄스법으로 형질전환하였다. 이와 같이 KCCM12502P 균주에 Ncgl1917 유전자가 불활성화된 균주를 KCCM12502P::Δ1917으로 명명하였다.
실시예 6. 코리네박테리움 글루타미쿰 KCCM12502P 유래의, 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된 균주의 L-쓰레오닌 생산능 평가
상기 제작된 코리네박테리움 글루타미쿰 KCCM12502P::Δ1917균주의 L-쓰레오닌 생산능을 분석하기 위해 하기의 배지를 이용한 플라스크 배양을 실시하였다. 대조군으로는 모균주인 코리네박테리움 글루타미쿰 KCCM12502P 균주를 사용하였으며, 아래와 같은 방법으로 배양하여 L-쓰레오닌 생산량을 측정하였다. 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주들을 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음, 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 32℃에서 72 시간 동안, 200 rpm에서 진탕 배양하였다. 상기 종 배지와 생산 배지의 조성은 각각 하기와 같으며, 배양 결과는 표 4와 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 22 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.0)>
포도당 63 g, (NH4)2SO4 28 g, 대두 단백질 20 g, 당밀 14 g, KH2PO4 1.1 g, MgSO4·7H2O 1.2 g, 바이오틴 1.8 mg, 티아민 염산염 9 mg, 칼슘-판토텐산 9 mg, MnSO4 180 mg, FeSO4 200 mg, ZnSO4 1 mg, CuSO4 1 mg, CaCO3 30 g (증류수 1리터 기준).
모균주 및 Ncgl1917이 결실된 균주의 L-쓰레오닌 생산농도
균주 L-쓰레오닌(g/L)
배치 1 배치 2 배치 3 평균
대조군 KCCM12502P 3.33 3.28 3.31 3.31
1 KCCM12502P::Δ1917 4.46 4.38 4.41 4.42
상기 결과와 같이, L-쓰레오닌 생산균주인 코리네박테리움 글루타미쿰 KCCM12502P로부터 서열번호 2의 뉴클레오티드 서열을 포함하는 유전자를 결손시켰을 경우, 모균주 대비 L-쓰레오닌 생산능이 평균 35% 증가함을 확인하였다.
따라서, 코리네박테리움 속 미생물에서 서열번호 2의 뉴클레오티드 서열을 포함하는 유전자를 결손시킴으로써 L-쓰레오닌 생산능을 향상시킬 수 있음을 확인하였다.
상기의 결과들로부터, L-쓰레오닌 생산균주에서 서열번호 1의 아미노산 서열을 포함하는 단백질을 불활성화 시킴으로써 L-쓰레오닌 생산능을 증가시키는데 효과가 있음을 확인하였고, 상기 균주 KCCM12502P::Δ1917를 CA09-0907로 명명하고 2021년 2월 1일자로 한국미생물보존센터(KCCM)에 국제기탁하여 KCCM12946P로 기탁번호를 부여받았다.
실시예 7. 코리네박테리움 글루타미쿰 KCCM11222P유래의, 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화 된 균주의 제작 및 L-쓰레오닌 생산능 평가
L-쓰레오닌을 생산하는 다른 코리네박테리움 글루타미쿰에 속하는 균주에서도 상기와 동일한 효과가 있는지를 확인하기 위하여, 상기 실시예 5와 같은 방법으로 L-쓰레오닌 생산균주인 코리네박테리움 글루타미쿰 KCCM11222P (US 10590446 B2)를 대상으로 서열번호 2의 뉴클레오티드 서열을 포함하는 유전자가 결손된 균주를 제작하고 KCCM11222P::Δ1917로 명명하였다. 제작된 코리네박테리움 글루타미쿰 KCCM11222P::Δ1917균주의 L-쓰레오닌 생산능을 분석하기 위해 실시예 6과 같은 방법으로 배양하였다. 대조군으로는 모균주인 코리네박테리움 글루타미쿰 KCCM11222P 균주를 사용하였다. 배양 결과는 표 5와 같다.
모균주 및 Ncgl1917이 결실된 균주의 L-쓰레오닌 생산농도
균주 L-쓰레오닌(g/L)
배치 1 배치 2 배치 3 평균
대조군 KCCM11222P 7.10 7.14 7.12 7.12
1 KCCM11222P::Δ1917 8.08 8.01 8.03 8.04
상기 결과와 같이, L-쓰레오닌 생산균주인 코리네박테리움 글루타미쿰 KCCM11222P를 대상으로 서열번호 2의 뉴클레오티드 서열을 포함하는 유전자를 결손 시켰을 경우, L-쓰레오닌 생산능이 평균 12%증가함을 확인하였다. 실시예 5 내지 7의 결과를 종합하면, 코리네박테리움 속 미생물에서 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성을 약화시킴으로써 L-쓰레오닌 생산능을 향상시킬 수 있음을 확인하였다.
실시예 8. 코리네박테리움 글루타미쿰 KCCM11248P 유래의, 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된 균주의 제작 및 L-이소류신 생산능 평가
L-이소류신을 생산하는 코리네박테리움 글루타미쿰에 속하는 균주에서도 상기와 동일하게 L-아미노산 생산 증가 효과가 있는지를 확인하기 위하여, 상기 실시예 5와 같은 방법으로 L-이소류신 생산균주인 코리네박테리움 글루타미쿰 KCCM11248P (대한민국 등록 특허 제10-1335789호)를 대상으로 서열번호 2의 뉴클레오티드 서열을 포함하는 유전자가 결손된 균주를 제작하고 KCCM11248P::Δ1917로 명명하였다. 제작된 코리네박테리움 글루타미쿰 KCCM11248P::Δ1917균주의 L-이소류신 생산능을 분석하기 위해 하기의 배지를 이용한 플라스크 배양을 실시하였다. 대조군으로는 모균주인 코리네박테리움 글루타미쿰 KCCM11248P 균주를 사용하였으며, 아래와 같은 방법으로 배양하여 L-이소류신 생산량을 측정하였다. 먼저, 종 배지 25 ml을 함유하는 250 ml 코너-바플 플라스크에 각 균주들을 접종하고, 30℃에서 20시간 동안, 200 rpm으로 진탕 배양하였다. 그런 다음 생산 배지 24 ml을 함유하는 250 ml 코너-바플 플라스크에 1 ml의 종 배양액을 접종하고 32℃에서 72 시간 동안, 200 rpm에서 진탕 배양하였다. 상기 종 배지와 생산 배지의 조성은 각각 하기와 같으며, 배양 결과는 표 6와 같다.
<종배지 (pH 7.0)>
포도당 20 g, 펩톤 10 g, 효모추출물 5 g, 요소 1.5 g, KH2PO4 4 g, K2HPO4 8g, MgSO4·7H2O 0.5 g, 바이오틴 0.1 mg, 티아민 HCl 1 mg, 칼슘-판토텐산 22 mg, 니코틴아미드 2 mg (증류수 1 리터 기준)
<생산배지 (pH 7.2)>
포도당 100 g, 효모추출물 5 g, (NH4)2SO4 16 g, KH2PO4 1 g, MgSO4·7H2O 1 g, FeSO4·7H2O 10mg, MnSO4·H2O 10 mg, 바이오틴 200 ㎍ (증류수 1리터 기준)
모균주 및 Ncgl1917이 결실된 균주의 L-이소류신 생산농도
균주 L-이소류신(g/L)
배치 1 배치 2 배치 3 평균
대조군 KCCM11248P 3.26 3.18 3.21 3.21
1 KCCM11248P::Δ1917 4.07 4.07 4.11 4.08
상기 결과와 같이, L-이소류신 생산균주인 코리네박테리움 글루타미쿰 KCCM11248P를 대상으로 서열번호 2의 뉴클레오티드 서열을 포함하는 유전자를 결손 시켰을 경우, L-이소류신 생산능이 평균 27%증가함을 확인하였다. 따라서, 코리네박테리움 속 미생물에서 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성을 약화시킴으로써 L-이소류신 생산능을 향상시킬 수 있음을 확인하였다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
Figure PCTKR2022005385-appb-img-000001

Claims (11)

  1. 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화된, 코리네박테리움 속 미생물.
  2. 제 1항에 있어서, 상기 코리네박테리움 속 미생물은 L-아미노산을 생산하는 것인, 코리네박테리움 속 미생물.
  3. 제1항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰(Corynebacterium glutamicum)인 것인, 코리네박테리움 속 미생물.
  4. 제2항에 있어서, 상기 L-아미노산은 L-쓰레오닌 및 L-이소류신 중에서 선택되는 1 이상인 것인, 코리네박테리움 속 미생물.
  5. 제1항에 있어서, 상기 미생물은 서열번호 1의 아미노산 서열을 포함하는 단백질의 활성이 약화되지 않은 미생물에 비해 L-아미노산 생산능이 증가된 것인, 코리네박테리움 속 미생물.
  6. 제1항 내지 제5항 중 어느 한 항의 코리네박테리움 속 미생물을 배지에서 배양하는 단계를 포함하는, L-아미노산 제조방법.
  7. 제6항에 있어서, 상기 코리네박테리움 속 미생물은 코리네박테리움 글루타미쿰인 것인, 제조방법.
  8. 제6항에 있어서, 상기 L-아미노산은 L-쓰레오닌 및 L-이소류신 중에서 선택되는 1 이상인 것인, 제조방법.
  9. 제6항에 있어서, 상기 제조방법은 상기 미생물 또는 배지로부터 L-아미노산을 회수하는 단계를 추가적으로 포함하는 것인, 제조방법.
  10. 제1항 내지 제5항 중 어느 한 항의 미생물; 이를 배양한 배지; 또는 이들의 조합을 포함하는, L-아미노산 생산용 조성물.
  11. 제10항에 있어서, 상기 L-아미노산은 L-쓰레오닌 및 L-이소류신 중에서 선택되는 1 이상인 것인, L-아미노산 생산용 조성물.
PCT/KR2022/005385 2021-04-20 2022-04-14 L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산 방법 WO2022225254A1 (ko)

Priority Applications (6)

Application Number Priority Date Filing Date Title
AU2022260752A AU2022260752A1 (en) 2021-04-20 2022-04-14 L-amino-acid-producing corynebacterium sp. microorganism, and method for producing l-amino acids by using same
JP2023558681A JP2024510838A (ja) 2021-04-20 2022-04-14 Ｌ－アミノ酸を生産するコリネバクテリウム属微生物及びそれを用いたｌ－アミノ酸の生産方法
EP22791954.5A EP4306645A1 (en) 2021-04-20 2022-04-14 L-amino-acid-producing corynebacterium sp. microorganism, and method for producing l-amino acids by using same
BR112023019851A BR112023019851A2 (pt) 2021-04-20 2022-04-14 Microrganismo de corynebacterium sp. produtor de l-aminoácido e método para produzir l-aminoácidos usando o mesmo
MX2023012155A MX2023012155A (es) 2021-04-20 2022-04-14 Microorganismo de la especie corynebacterium que produce l-aminoacidos y procedimiento de produccion de l-aminoacidos mediante el uso del mismo.
CN202280029877.6A CN117813386A (zh) 2021-04-20 2022-04-14 产l-氨基酸棒状杆菌属微生物及使用其生产l-氨基酸的方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210051233A KR102635860B1 (ko) 2021-04-20 2021-04-20 L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산 방법
KR10-2021-0051233 2021-04-20

Publications (1)

Publication Number Publication Date
WO2022225254A1 true WO2022225254A1 (ko) 2022-10-27

Family

ID=83722507

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/005385 WO2022225254A1 (ko) 2021-04-20 2022-04-14 L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산 방법

Country Status (9)

Country Link
EP (1) EP4306645A1 (ko)
JP (1) JP2024510838A (ko)
KR (1) KR102635860B1 (ko)
CN (1) CN117813386A (ko)
AR (1) AR125387A1 (ko)
AU (1) AU2022260752A1 (ko)
BR (1) BR112023019851A2 (ko)
MX (1) MX2023012155A (ko)
WO (1) WO2022225254A1 (ko)

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100816472B1 (ko) * 2006-12-21 2008-03-26 씨제이제일제당 (주) 글루타메이트 에이비씨-타입 트랜스포터 활성이 결실된코리네박테리아 및 이를 이용한 엘-라이신 생산방법
KR20090069572A (ko) * 2007-12-26 2009-07-01 씨제이제일제당 (주) Ａｂｃ-트랜스포터를 코딩하는 유전자가 불활성화된코리네박테리움 속 미생물 및 이를 이용한 5'-이노신산의제조방법
US8048650B2 (en) 2006-12-29 2011-11-01 Cj Cheiljedang Corporation Microorganism of Corynebacterium genus having enhanced L-lysine productivity and a method of producing L-lysine using the same
KR101335789B1 (ko) 2012-01-13 2013-12-02 씨제이제일제당 (주) Ｌ-이소루신을 생산하는 미생물 및 이를 이용한 ｌ-이소루신 제조방법
US20180100168A1 (en) * 2015-04-21 2018-04-12 Nutech Ventures Mutant microorganisms and methods of making and using
US10590446B2 (en) 2011-12-01 2020-03-17 Cj Cheiljedang Corporation Microorganism for simultaneously producing L-amino acid and riboflavin, and method for producing L-amino acid and riboflavin using same
KR102126951B1 (ko) 2019-09-26 2020-06-26 씨제이제일제당 주식회사 디하이드로디피콜린산 리덕타제 변이형 폴리펩티드 및 이를 이용한 l-쓰레오닌 생산방법
KR20200136813A (ko) 2020-03-17 2020-12-08 씨제이제일제당 (주) 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100816472B1 (ko) * 2006-12-21 2008-03-26 씨제이제일제당 (주) 글루타메이트 에이비씨-타입 트랜스포터 활성이 결실된코리네박테리아 및 이를 이용한 엘-라이신 생산방법
US8048650B2 (en) 2006-12-29 2011-11-01 Cj Cheiljedang Corporation Microorganism of Corynebacterium genus having enhanced L-lysine productivity and a method of producing L-lysine using the same
KR20090069572A (ko) * 2007-12-26 2009-07-01 씨제이제일제당 (주) Ａｂｃ-트랜스포터를 코딩하는 유전자가 불활성화된코리네박테리움 속 미생물 및 이를 이용한 5'-이노신산의제조방법
US10590446B2 (en) 2011-12-01 2020-03-17 Cj Cheiljedang Corporation Microorganism for simultaneously producing L-amino acid and riboflavin, and method for producing L-amino acid and riboflavin using same
KR101335789B1 (ko) 2012-01-13 2013-12-02 씨제이제일제당 (주) Ｌ-이소루신을 생산하는 미생물 및 이를 이용한 ｌ-이소루신 제조방법
US20180100168A1 (en) * 2015-04-21 2018-04-12 Nutech Ventures Mutant microorganisms and methods of making and using
KR102126951B1 (ko) 2019-09-26 2020-06-26 씨제이제일제당 주식회사 디하이드로디피콜린산 리덕타제 변이형 폴리펩티드 및 이를 이용한 l-쓰레오닌 생산방법
KR20200136813A (ko) 2020-03-17 2020-12-08 씨제이제일제당 (주) 프리페네이트 디하이드라타아제 활성 강화를 통한 l-트립토판을 생산하는 방법

Non-Patent Citations (21)

* Cited by examiner, † Cited by third party
Title
"Atlas Of Protein Sequence and Structure", 1979, NATIONAL BIOMEDICAL RESEARCH FOUNDATION, pages: 353 - 358
"Guide to Huge Computers", 1994, ACADEMIC PRESS
"Manual of Methods for General Bacteriology", 1981, AMERICAN SOCIETY FOR BACTERIOLOGY
"NCBI", Database accession no. WP_00628421 1
APPL. MICROBIOL. BIOTECHNOL, vol. 52, 1999, pages 541 - 545
ATSCHUL, S. F ET AL., J MOLEC BIOL, vol. 215, 1990, pages 403
CARILLO ET AL., SIAM J APPLIED MATH, vol. 48, 1988, pages 1073
DATABASE PROTEIN 17 April 2020 (2020-04-17), ANONYMOUS : "MULTISPECIES: ABC transporter permease [Corynebacterium]", XP055978289, retrieved from NCBI Database accession no. WP_006284211.1 *
DEVEREUX, J ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, 1984, pages 387
GRIBSKOV ET AL., NUCL. ACIDS RES, vol. 14, 1986, pages 6745
J. BIOL. CHEM., vol. 176, 1948, pages 367 - 388
J. SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS, article "Molecular Cloning"
NAKASHIMA N ET AL.: "Bacterial cellular engineering by genome editing and gene silencing", INT J MOL SCI, vol. 15, no. 2, 2014, pages 2773 - 2793, XP055376889, DOI: 10.3390/ijms15022773
NEEDLEMAN ET AL., J MOL BIOL, vol. 48, 1970, pages 443
NEEDLEMANWUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 - 453
PEARSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
RICE ET AL.: "EMBOSS: The European Molecular Biology Open Software Suite", TRENDS GENET, vol. 16, 2000, pages 276 - 277, XP004200114, DOI: 10.1016/S0168-9525(00)02024-2
SAMBROOK ET AL., MOLECULAR CLONING, 2012
WANG SHUAIWEN, FANG YU, WANG ZHEN, ZHANG SHUYAN, WANG LIANGJIA, GUO YONG, WANG XIAOYUAN: "Improving l-threonine production in Escherichia coli by elimination of transporters ProP and ProVWX", MICROBIAL CELL FACTORIES, vol. 20, no. 1, 1 December 2021 (2021-12-01), pages 58, XP055978286, DOI: 10.1186/s12934-021-01546-x *
WATERMAN, ADV. APPL. MATH, vol. 2, 1981, pages 482
WEINTRAUB, H ET AL.: "Antisense-RNA as a molecular tool for genetic analysis", REVIEWS - TRENDS IN GENETICS, vol. 1, no. 1, 1986

Also Published As

Publication number Publication date
KR20220144650A (ko) 2022-10-27
MX2023012155A (es) 2023-10-26
AR125387A1 (es) 2023-07-12
CN117813386A (zh) 2024-04-02
JP2024510838A (ja) 2024-03-11
EP4306645A1 (en) 2024-01-17
BR112023019851A2 (pt) 2023-11-07
AU2022260752A1 (en) 2023-10-05
KR102635860B1 (ko) 2024-02-13

Similar Documents

Publication Publication Date Title
WO2022163934A1 (ko) 신규한 d-알라닌-d-알라닌 리가아제 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163933A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163917A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022216088A1 (ko) L-아르기닌을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아르기닌 생산방법
WO2022163922A1 (ko) 신규한 아스파라긴 신타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163923A1 (ko) 신규한 atp 포스포리보실트랜스퍼라제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163920A1 (ko) 신규한 시스테인 설피네이트 디설피나제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163935A1 (ko) 신규한 글루코사민-6-포스페이트 디아미나제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022154191A1 (ko) 신규한 2,5-다이케토-d-글루콘산 리덕타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163939A1 (ko) 신규한 mfs 트랜스포터 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022191630A1 (ko) 신규한 시트레이트 신타아제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022215796A1 (ko) 신규한 전사 조절자 변이체 및 이를 이용한 l-발린 생산 방법
WO2022215800A1 (ko) 신규한 분지쇄아미노산 투과효소 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163913A1 (ko) 신규한 막단백질 TerC 변이체 및 이를 이용한 L-라이신 생산 방법
WO2022225254A1 (ko) L-아미노산을 생산하는 코리네박테리움 속 미생물 및 이를 이용한 l-아미노산의 생산 방법
WO2022163919A1 (ko) 신규한 우레아제 부속 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163925A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163921A1 (ko) 신규한 스퍼미딘 신타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163924A1 (ko) 신규한 5,10-메틸렌테트라하이드로폴레이트 리덕타제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163909A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2022154173A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2022163926A1 (ko) 신규한 프롤린 탈수소효소 변이체 및 이를 이용한 l-발린 생산 방법
WO2022163911A1 (ko) 신규한 프리모솜 조립 단백질 변이체 및 이를 이용한 l-라이신 생산 방법
WO2022163936A1 (ko) 신규한 엑시뉴클레아제 abc 서브유닛 a 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022154188A1 (ko) 신규한 폴리케타이드 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22791954

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2022260752

Country of ref document: AU

Ref document number: AU2022260752

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 12023552608

Country of ref document: PH

WWE Wipo information: entry into national phase

Ref document number: 2023558681

Country of ref document: JP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023019851

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2022260752

Country of ref document: AU

Date of ref document: 20220414

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2022791954

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: MX/A/2023/012155

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2022791954

Country of ref document: EP

Effective date: 20231012

WWE Wipo information: entry into national phase

Ref document number: 202317070922

Country of ref document: IN

Ref document number: 2301006820

Country of ref document: TH

WWE Wipo information: entry into national phase

Ref document number: 202280029877.6

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 112023019851

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230926

WWE Wipo information: entry into national phase

Ref document number: 2023124686

Country of ref document: RU

NENP Non-entry into the national phase

Ref country code: DE