Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
  • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7088—Compounds having three or more nucleosides or nucleotides
  • A61K31/713—Double-stranded nucleic acids or oligonucleotides
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
  • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/86—Viral vectors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y306/00—Hydrolases acting on acid anhydrides (3.6)
  • C12Y306/05—Hydrolases acting on acid anhydrides (3.6) acting on GTP; involved in cellular and subcellular movement (3.6.5)
  • C12Y306/05005—Dynamin GTPase (3.6.5.5)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/50—Physical structure
  • C12N2310/53—Physical structure partially self-complementary or closed
  • C12N2310/531—Stem-loop; Hairpin
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2320/00—Applications; Uses
  • C12N2320/30—Special therapeutic applications
  • C12N2320/32—Special delivery means, e.g. tissue-specific
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2330/00—Production
  • C12N2330/50—Biochemical production, i.e. in a transformed host cell
  • C12N2330/51—Specially adapted vectors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
  • C12N2750/00011—Details
  • C12N2750/14011—Parvoviridae
  • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
  • C12N2750/14141—Use of virus, viral particle or viral elements as a vector
  • C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

• RNA interference-based methods and products for inhibiting the expression of pathogenic dynamin-1 variants are provided.
• Delivery vehicles such as recombinant adeno- associated viruses deliver DNAs encoding RNAs that inhibit expression of the dynamin-1 variants.
• the methods treat developmental and epileptic encephalopathies.
• DNM1 encodes a critical multimeric brain-specific GTPase, dynamin-1 , that localizes to the presynapse where it mediates endocytosis.
• dynamin-1 a critical multimeric brain-specific GTPase
• Individuals with pathogenic DNM1 variants suffer from two of the most severe developmental and epileptic encephalopathy (DEE) syndromes, Lennox-Gastaut Syndrome and Infantile Spasms. The identification of affected individuals is likely to increase as DNM1 is now included on screening panels for severe childhood epilepsy.
• DEE developmental and epileptic encephalopathy
• the identification of affected individuals is likely to increase as DNM1 is now included on screening panels for severe childhood epilepsy.
• Children with DNM1 mutations suffer from intractable conditions manifesting as early-onset seizures, global developmental delay, profound intellectual disability, lack of speech, muscular hypotonia, dystonia and spasticity.
• Dnm1 m,+ heterozygous mice show only mild spontaneous and handling- induced seizures from 2 to 3 months of age and have a normal lifespan
• Dnm1 m,m homozygotes show a DEE-like phenotype with severe ataxia, developmental delay, and fully penetrant lethal seizures by the end of the third postnatal week.
• Dnmlb is expressed predominantly during gestation and expression wanes during early postnatal development
• Dnmla expression increases during early postnatal development and peaks during the second postnatal week, becoming the predominant isoform of adulthood.
• Dnmla nor Dnmlb isoform-specific homozygous knockout mice show seizures or other overt phenotypic characteristics associated with the Dnm1 m allele [Asinof et al., PLoS Genet., 11: e1005347 (2015) and Asinofet al., Neurobiol. Dis., 95: 1-11 (2016)].
• Dnm1 m exerts a dominant negative effect on protein function, as was modeled or predicted for all DNM1 pathogenic variants [Dhindsa etal., Neurol. Genet., 1: e4 (2015); Asinof (2016), supra; and von Spiczak, supra].
• Treatment of DEEs is currently limited to treatment of symptoms, primarily by use of antiepileptic drugs.
• the drugs do not address the underlying genetic defect and thus offer no hope of stopping or slowing disease progression and, when given for long durations, can result in loss of efficacy.
• the disclosure herein provides methods to specifically induce silencing of deleterious DNM1 isoforms by RNA interference (RNAi) using vectors expressing artificial inhibitory RNAs targeting the DMN1 mRNA.
• RNAi RNA interference
• the artificial DMN1 inhibitory RNAs contemplated include, but are not limited to, small interfering RNAs (siRNAs) (also referred to as short interfering RNAs, small inhibitory RNAs or short inhibitory RNAs), short hairpin RNAs (shRNAs) and miRNA shuttles (artificial miRNAs) that inhibit expression of pathgenic DNM1 isoforms.
• siRNAs small interfering RNAs
• shRNAs short hairpin RNAs
• miRNA shuttles artificial miRNAs
• the miDNMIs are small regulatory sequences that act post-transcriptionally by targeting, for example, a coding region or 3’UTR of DNM1 mRNA in a reverse complementary manner resulting in reduced DNM1 mRNA and protein levels. Use of the methods and products is indicated, for example, in preventing or treating DEE.
• DNM1 inhibitory RNAs are provided as well as polynucleotides encoding one or more of the RNAs.
• Exemplary DNM1 inhibitory RNAs provided are miRNAs that target Dnmla, the isoform which houses Dnm1 m .
• Other exemplary inhibitory RNAs provided target human DNM1a and DNM1b isoforms, which differ in an alternatively-spliced DNM1 exon 10, called 10a and 10b.
• the disclosure provides nucleic acids comprising RNA-encoding template DNA sequences comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to the sequence set forth in any one of SEQ ID NOs: 1-17.
• Exemplary miDNMI s comprise the full length sequences set out in any one of SEQ ID NOs: 18-34 or variants thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the sequence set forth in any one of SEQ ID NOs: 18-34.
• Corresponding final processed antisense guide strand sequences are respectively set out in SEQ ID NOs: 35-51 , or are variants thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to the sequence set forth in any one of SEQ ID NOs: 35-51 .
• the processed antisense guide strand is the strand of the mature miRNA duplex that becomes the RNA component of the RNA induced silencing complex ultimately responsible for sequence- specific gene silencing.
• miDNMI s can specifically bind to a segment of a messenger RNA (mRNA) encoded by a human DNM1 gene, including but not limited to, exon 10a (SEQ ID NO: 52)
• AAG of the human DNM1 gene wherein the segment is conserved relative to mRNA encoded by the wild-type mouse DNM1 gene, including but not limited to, exon 10a (SEQ ID NO: 54)
• a miDNMI can specifically bind a mRNA segment that is complementary to a sequence within nucleotides 115-136 of SEQ ID NO: 52.
• Delivery of DNA encoding miDNMI s can be achieved using a delivery vehicle that delivers the DNA(s) to a cell.
• a delivery vehicle that delivers the DNA(s) to a cell.
• recombinant AAV (rAAV) vectors can be used to deliver DNA encoding miDNMI s.
• Other vectors for example, other viral vectors such as lentivirus, adenovirus, retrovirus, equine-associated virus, alphavirus, pox viruses, herpes virus, polio virus, Sindbis virus and vaccinia viruses
• viral vectors encoding one or more miDNMI s.
• the rAAV When the viral vector is a rAAV, the rAAV lack AAV rep and cap genes.
• the rAAV can be self-complementary (sc) AAV.
• non-viral vectors such as lipid nanoparticles can be used for delivery.
• rAAV each encoding a miDNMI . Also provided are rAAV encoding one or more miDNMI s.
• a rAAV (with a single-stranded genome, scAAV) encoding one or more miDNMI s can encode one, two, three, four, five, six, seven or eight miDNMI s.
• a scAAV encoding one or more miDNMI s can encode one, two, three or four miDNMI s.
• Compositions are provided comprising the nucleic acids or viral vectors described herein.
• a delivery vehicle such as rAAV
• expression of the duplicated and/or mutant DNM1 allele is inhibited by at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent.
• expression of the wild-type DNM1 allele is inhibited by at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent.
• a delivery vehicle such as rAAV
• Other methods of delivering DNA encoding the miDNMI to an subject in need thereof comprise administering to the subject a delivery vehicle (such as rAAV) comprising DNA encoding one or more miDNMI wherein, if the delivery vehicle is rAAV, the rAAV lacks rep and cap genes.
• Methods are also provided of preventing or treating DEE comprising administering a delivery vehicle (such as rAAV) comprising DNA encoding a miDNMI wherein, if the delivery vehicle is rAAV, the rAAV lacks rep and cap genes.
• a delivery vehicle such as rAAV
• Other methods of preventing or treating DEE comprise administering a delivery vehicle (such as rAAV) comprising DNA encoding one or more miDNMI wherein, if the delivery vehicle is rAAV, the rAAV lacks rep and cap genes.
• the methods result in restoration of DNM1 expression to at least 25 percent, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent or more, of normal DNM1 expression in an unaffected subject.
• the disclosure provides a delivery vehicle that is a viral vector comprising the nucleic acids described herein and/or a combination of any one or more thereof.
• Viral vectors provided include, but are not limited to an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, or a synthetic virus.
• the viral vector can be an AAV.
• the AAV lacks rep and cap genes.
• the AAV can be a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV).
• the AAV is, for example, AAV-1 , AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8,
• the AAV can be AAV-9.
• the AAV can be a pseudotyped AAV, for example, an AAV2/8 or AAV2/9.
• the disclosure provides a composition comprising the nucleic acids described herein and a pharmaceutically acceptable carrier.
• the disclosure provides a composition comprising a viral vector comprising the nucleic acids described herein, and/or a combination of any one or more thereof and a pharmaceutically acceptable carrier.
• the disclosure provides a composition
• a delivery vehicle capable of delivering to cells a nucleic acid encoding a miDNMI , wherein the miDNMI binds a segment of a mRNA encoded by a human DNM1 gene (wherein the segment either does or does not encode sequence comprising a mutation associated with DEE); wherein the segment is conserved relative to the wild-type mouse DNM1 gene, and, optionally, a pharmaceutically acceptable carrier.
• the human DNM1 gene exon 10a can comprise the sequence of SEQ ID NO: 52, or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%,
• the mouse DNM1 gene exon 10a can comprise the sequence of SEQ ID NO: 54, or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, identity.
• a miDNMI specifically binds, for example, a mRNA segment that is complementary to a sequence within nucleotides 115-136 of SEQ ID NO: 52 (the nucleotides bound by, for example, miDNM1a-4).
• the human DNM1 gene exon 10b can comprise the sequence of SEQ ID NO: 53, or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, identity.
• the mouse DNM1 gene exon 10b can comprise the sequence of SEQ ID NO: 55, or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%,
• the disclosure provides a delivery vehicle in the compositions that is a viral vector.
• the viral vector in the compositions can be, for example, an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, or a synthetic virus.
• the viral vector can be an AAV.
• the AAV lacks rep and cap genes.
• the AAV can be a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV).
• the AAV is or has a capsid serotype selected from, for example, AAV-1 , AAV-2, AAV- 3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11 , AAV-12, AAV-13, AAV-anc80, and AAV rh.74.
• the AAV can be or can have a capsid serotype of AAV-9.
• the AAV can be a pseudotyped AAV, such as AAV2/8 or AAV2/9.
• the disclosure provides methods of delivering to a neuron comprising a duplicated and/or mutant DNM1 gene: (a) a nucleic acid comprising a template nucleic acid encoding a miDNMI comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence set forth in any one of SEQ ID NOs: 1 -17; a nucleic acid encoding the full length miDNMI sequences set out in any one of SEQ ID NOs: 9-16 or variants thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%
• the disclosure provides a method of treating a subject suffering from a duplicated and/or mutant DNM1 gene, the method comprising administering to the subject(a) a nucleic acid comprising a template nucleic acid encoding a miDNMI comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence set forth in any one of SEQ ID NOs: 1-17; a nucleic acid encoding the full length miDNMI sequences set out in any one of SEQ ID NOs: 9-16 or variants thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 9
• the disclosure contemplates the subject treated by methods herein suffers from DEE.
• the disclosure also contemplates treatment of a subject that is at risk for DEE due to a mutation of the DNM1 gene.
• the subject can be a mammalian animal.
• the subject can be a human subject.
• the disclosure also provides uses of at least one nucleic acid as described herein, at least one viral vector as described herein, or a composition as described herein in making a medicament for, or in treating a subject suffering from, a pathogenic DNM1 gene variant.
• the disclosure also provides uses of at least one nucleic acid as described herein, at least one viral vector as described herein, or a composition as described herein in making a medicament for or in treating DEE in a subject in need thereof.
• Figure 1 shows an example of an artificial miRNA shuttle sequence to demonstrate folding and processing sites.
• the mature guide strand is underlined.
• Grey arrowheads indicate Drosha cut sites; black arrowheads indicate Dicer cut sites. Shaded sequences at extreme 5’ and 3’ ends are restriction sites in the template DNA used to clone the miRNA shuttles in front of the U6 promoter.
• Figure 2A-D shows scAAV9- miDnml a selectively inhibits Dnmla.
• Figure 3A-D shows scAAV 9- miDnml a treatment of C57BL/6J mice improves survival, growth and seizure outcomes.
• FIG. 4A-C shows miDnmla improves survival in a dose dependent manner (C57BL/6J strain background pilot experiment; related to Figure 2A-C).
• Figure 5A-F shows scAAV9-miDnm1a treatment improves developmental outcomes.
• FIG. 6A-D shows miDnmla treatment diminishes gliosis and cellular degeneration at PND 18 until PND 30.
• A) Control-injected Dnm1 m,m mice showed strikingly increased gliosis specifically in the hippocampal CA1 as identified with the marker GFAP compared to treated Dnm 7 Ftfl/Ftfl mice (p 0.018). Treated Dnm1 Fwm mice did not differ from treated and control- injected Dnm1 +,+ mice (p>0.05) at PND 18.
• Treated Dnmf mm mice did not differ from treated and control-injected Dnm1 +,+ mice (p>0.05).
• treated Dnm 1 m,m mice had little apparent cell death as identified by FJC labeling. However, they did not differ from treated and control-injected Dnm1 +,+ mice (p>0.05).
• FIG. 7A-B shows PND 18 and PND 30 cellular phenotypes images (GFAP and FJC; two other representative replicate sets; related to Figure 6A-D).
• treated Dnm IFtfl/Ftf I mice show a significant increase in GFAP compared to Dnm1 +/+ controls. Scale bar correspond to 200 .Lm.
• Figure 8A-D shows miDnmla treatment improves metabolic cellular activity at PND 18 until PND 30.
• A) Aberrant NPY expression was observed in the hippocampus and specifically in the CA3 of control-injected Dnm1 m,m mice at PND 18; treatment with miDnmla reverted this phenotype (p 0.0012). Treated Dnm1 m,m mice did not differ from treated and control- injected Dnm1 +,+ mice (p>0.05).
• Figure 9A-B shows PND 18 and PND 30 cellular phenotypes images (NPY and c- Fos; two other representative replicate sets; related to Figure 8A-D).
• DnmlFtfl/Ftfl treated mice show a decrease of NPY+ cells in the hippocampus at PND 18 and PND 30 compared to control-injected Dnm 7 Ftfl/Ftfl mice. By PND 30 treated mice start to show increased NPY compared to Dnm1 +/+ controls in the CA3.
• B) Treated Dnm1 FW Ftfl mice show decrease in c- Fos compared to control-injected Dnm1 m,m mice at PND 18.
• PND 30 treated mice show variable increase in hippocampal c-Fos expression compared to Dnm1 +,+ mice. Scale bars correspond to 200 pm.
• Figure 10 shows the results of a luciferase assay demonstrating the miDNMI -1 Ob- 72 silences DNM1 exon 10 sequences that are conserved in human and mouse transcripts.
• Grip strength and negative geotaxis were analyzed using least squares regression after rank- and normal- quantile transformation of the data (JMP). Ataxia (counts of falls and wobbles) was analyzed using the log-Poisson test and contrast modeling to compare specific groups (JMP 14). IHC quantifications were analyzed using Poisson overdispersion option in the Generalized Analysis for Linear Models module (gamlj) in Jamovi. 31 P-values were Bonferroni adjusted.
• DNM1 diseases associated with a pathogenic DNM1 isoform.
• Diseases associated with DNM1 include, for example, DEEs.
• DEEs include, but are not limited to, Lennox-Gastout Syndrome and Infantile Spasms.
• a nucleic acid encoding human DNM1 exon 10a is set forth in SEQ ID NO: 52.
• a nucleic acid encoding human DNM1 exon 10b is set forth in SEQ ID NO: 53.
• Various products and methods of the disclosure can target variants of the human DNM1 nucleotide sequence set forth in SEQ ID NO: 52 or 53. The variants can exhibit 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%,
• a nucleic acid encoding mouse DNM1 exon 10a is set forth in SEQ ID NO: 54.
• a nucleic acid encoding mouse DNM1 exon 10b is set forth in SEQ ID NO: 54.
• Various products and methods of the disclosure can target variants of the nucleotide sequence set forth in SEQ ID NO: 54 or 55. The variants can exhibit 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%,
• RNA interference is a mechanism of gene regulation in eukaryotic cells that has been considered for the treatment of various diseases. RNAi refers to post-transcriptional control of gene expression mediated by inhibitory RNAs.
• the inhibitory RNAs are small (21-25 nucleotides in length), noncoding RNAs that share sequence homology and base-pair with cognate messenger RNAs (mRNAs).
• mRNAs messenger RNAs
• the interaction between the inhibitory RNAs and mRNAs directs cellular gene silencing machinery to prevent the translation of the mRNAs.
• the RNAi pathway is summarized in Duan (Ed.), Section 7.3 of Chapter 7 in Muscle Gene Therapy, Springer Science+Business Media, LLC (2010).
• RNAi pathways As an understanding of natural RNAi pathways has developed, researchers have designed artificial inhibitory RNAs for use in regulating expression of target genes for treating disease. Several classes of small RNAs are known to trigger RNAi processes in mammalian cells [Davidson etal., Nat. Rev. Genet., 12:329-40 (2011); Harper, Arch.
• RNAi therapy strategies are artificial inhibitory RNAs targeting disease genes-of-interest.
• shRNA is an artificial RNA molecule with a tight hairpin turn that can be used to silence target gene expression via RNA interference (RNAi).
• RNAi RNA interference
• shRNA is an advantageous mediator of RNAi in that it has a relatively low rate of degradation and turnover, but it requires use of an expression vector.
• the shRNA is then transcribed in the nucleus by polymerase II or polymerase III, depending on the promoter choice.
• the product mimics pri-microRNA (pri-miRNA) and is processed by Drosha.
• the resulting pre-shRNA is exported from the nucleus by Exportin 5. This product is then processed by Dicer and loaded into the RNA-induced silencing complex (RISC).
• RISC RNA-induced silencing complex
• the sense (passenger) strand is degraded.
• the antisense (guide) strand directs RISC to mRNA that has a complementary sequence. In the case of perfect complementarity, RISC cleaves the mRNA. In the case of imperfect complementarity, RISC represses translation of the mRNA. In both of these cases, the shRNA leads to target gene silencing.
• the disclosure includes the production and administration of viral vectors expressing artificial DMN1 inhibitory RNAs.
• the expression of the artificial DMN1 inhibitory RNAs is regulated by the use of various promoters.
• the disclosure contemplates use of polymerase III promoters, such as U6 and H1 promoters, or polymerase II promoters.
• the products and methods provided herein can comprise miRNA shuttles to modify DNM1 expression (e.g ., knockdown or inhibit expression).
• miRNA shuttles are expressed intracellularly from DNA transgenes.
• miRNA shuttles typically contain natural miRNA sequences required to direct correct processing, but the natural, mature miRNA duplex in the stem is replaced by the sequences specific for the intended target transcript ⁇ e.g., as shown in Figure 1).
• the artificial miRNA is cleaved by Drosha and Dicer to release the embedded siRNA-like region.
• Polymerase III promoters such as U6 and H1 promoters, and polymerase II promoters are also used to drive expression of the miRNA shuttles.
• the disclosure provides sequences encoding miDNMI s to inhibit the expression of the DNM1 gene.
• the disclosure provides a nucleic acid encoding a miDNMI comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the full length miDNMI polynucleotide sequence set forth in any one of SEQ ID NOs: 18-34.
• the disclosure provides a nucleic acid encoding a miDNMI processed antisense guide strand comprising at least about 70%, 75, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the antisense guide strand polynucleotide sequence set forth in any one of SEQ ID NOs: 35-51.
• the disclosure provides a nucleic acid encoding a miDNMI comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the polynucleotide sequence set forth in any one of SEQ ID NOs: 1 -17.
• Exemplary miDNMI s comprise the polynucleotide sequence set out in any one or more of SEQ ID NOs: 18-34, or a variant thereof comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any one of SEQ ID NOs 18-34.
• Final processed guide strand sequences corresponding to SEQ ID NOs: 18-34 are respectively set out in SEQ ID NOs: 35-51.
• the disclosure additionally provides the antisense guide strands set out in Figure ?
• each of those antisense guide strands that are at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical.
• the disclosure contemplates polynucleotides encoding one or more copies of these sequences are combined into a single delivery vehicle, such as a vector.
• a single delivery vehicle such as a vector.
• the disclosure includes vectors comprising a nucleic acid of the disclosure or a combination of nucleic acids of the disclosure.
• viral vectors such as adeno-associated virus (AAV), adenovirus, retrovirus, lentivirus, equine-associated virus, alphavirus, pox virus, herpes virus, herpes simplex virus, polio virus, Sindbis virus, vaccinia virus or a synthetic virus, e.g., a chimeric virus, mosaic virus, or pseudotyped virus, and/or a virus that contains a foreign protein, synthetic polymer, nanoparticle, or small molecule
• AAV vectors are exemplified.
• Adeno-associated virus is a replication-deficient parvovirus, the single- stranded DNA genome of which is about 4.7 kb in length including 145 nucleotide inverted terminal repeat (ITRs).
• ITRs nucleotide inverted terminal repeat
• AAV serotypes There are multiple serotypes of AAV.
• the nucleotide sequences of the genomes of the AAV serotypes are known.
• the complete genome of AAV- 1 is provided in GenBank Accession No. NC_002077
• the complete genome of AAV-2 is provided in GenBank Accession No. NC_001401 and Srivastava etal., J. Virol., 45: 555-564 (1983)
• the complete genome of AAV-3 is provided in GenBank Accession No.
• AAV-4 is provided in GenBank Accession No. NC_001829
• AAV-5 genome is provided in GenBank Accession No. AF085716
• the complete genome of AAV-6 is provided in GenBank Accession No. NC_00 1862
• at least portions of AAV-7 and AAV-8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively
• the AAV -9 genome is provided in Gao et al., J. Virol., 78: 6381-6388 (2004)
• the AAV-10 genome is provided in Mol.
• the sequence of the AAV rh.74 genome is provided in see U.S. Patent 9,434,928, incorporated herein by reference.
• the sequence of the AAV-B1 genome is provided in Choudhury etal., Mol. Ther., 24(7): 1247-1257 (2016).
• Cis-acting sequences directing viral DNA replication (rep), encapsidation/packaging and host cell chromosome integration are contained within the AAV ITRs.
• Three AAV promoters (named p5, p19, and p40 for their relative map locations) drive the expression of the two AAV internal open reading frames encoding rep and cap genes.
• the two rep promoters (p5 and p19), coupled with the differential splicing of the single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep 78, rep 68, rep 52, and rep 40) from the rep gene.
• Rep proteins possess multiple enzymatic properties that are ultimately responsible for replicating the viral genome.
• the cap gene is expressed from the p40 promoter and it encodes the three capsid proteins VP1 , VP2, and VP3. Alternative splicing and non-consensus translational start sites are responsible for the production of the three related capsid proteins.
• a single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology , 158 ⁇ 97-129 (1992).
• AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy.
• AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic.
• AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo.
• AAV transduces slowly dividing and non dividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element).
• the AAV proviral genome is infectious as cloned DNA in plasmids which makes construction of recombinant genomes feasible.
• AAV genome encapsidation and integration
• some or all of the internal approximately 4.3 kb of the genome encoding replication and structural capsid proteins, rep-cap
• the rep and cap proteins may be provided in trans.
• Another significant feature of AAV is that it is an extremely stable and hearty virus. It easily withstands the conditions used to inactivate adenovirus (56 to 65°C for several hours), making cold preservation of AAV less critical. AAV may even be lyophilized.
• AAV- infected cells are not resistant to superinfection.
• the AAV vector lacks rep and cap genes.
• the AAV can be a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV).
• the AAV has a capsid serotype can be from, for example, AAV-1 , AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV- 7, AAV-8, AAV-9, AAV-10, AAV-11 , AAV-12, AAV-13, AAV-anc80, AAV rh.74, AAV rh.8, or AAVrh.10.
• Viral vectors include, for example, AAV1 (i.e., an AAV containing AAV1 inverted terminal repeats (ITRs) and AAV1 capsid proteins), AAV2 (i.e., an AAV containing AAV2 ITRs and AAV2 capsid proteins), AAV3 (i.e., an AAV containing AAV3 ITRs and AAV3 capsid proteins), AAV4 (i.e., an AAV containing AAV4 ITRs and AAV4 capsid proteins),
• AAV1 i.e., an AAV containing AAV1 inverted terminal repeats (ITRs) and AAV1 capsid proteins
• AAV2 i.e., an AAV containing AAV2 ITRs and AAV2 capsid proteins
• AAV3 i.e., an AAV containing AAV3 ITRs and AAV3 capsid proteins
• AAV4 i.e., an AAV containing AAV4 ITRs and AAV
• AAV5 (/.e., an AAV containing AAV5 ITRs and AAV5 capsid proteins), AAV6 (i.e., an AAV containing AAV6 ITRs and AAV6 capsid proteins), AAV7 (i.e., an AAV containing AAV7 ITRs and AAV7 capsid proteins), AAV8 (i.e., an AAV containing AAV8 ITRs and AAV8 capsid proteins), AAV9 (i.e., an AAV containing AAV9 ITRs and AAV9 capsid proteins), AAVrh74 (i.e., an AAV containing AAVrh74 ITRs and AAVrh74 capsid proteins), AAVrh.8 (i.e., an AAV containing AAVrh.8 ITRs and AAVrh.8 capsid proteins), AAVrh.10 (i.e., an AAV containing AAVrh.10 ITRs and AAVrh.10 capsid
• DNA plasmids of the disclosure comprise recombinant AAV (rAAV) genomes of the disclosure.
• the DNA plasmids are transferred to cells permissible for infection with a helper virus of AAV (e.g ., adenovirus, E1 -deleted adenovirus or herpes virus) for assembly of the rAAV genome into infectious viral particles.
• helper virus of AAV e.g ., adenovirus, E1 -deleted adenovirus or herpes virus
• Techniques to produce rAAV particles, in which an AAV genome to be packaged, rep and cap genes, and helper virus functions are provided to a cell are standard in the art.
• rAAV Production of rAAV requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions.
• the AAV rep genes may be from any AAV serotype for which recombinant virus can be derived and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV-1 , AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV- 7, AAV-8, AAV-9, AAV-10, AAV-11 , AAV-12, AAV-13, AAV-anc80, and AAV rh.74.
• IAAV DNA in the rAAV genomes can be from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV-1 , AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11 , AAV-12, AAV-13, AAV- anc80, and AAV rh.74.
• Other types of rAAV variants for example rAAV with capsid mutations, are also included in the disclosure. See, for example, Marsic etai, Molecular Therapy 22(11): 1900-1909 (2014).
• nucleotide sequences of the genomes of various AAV serotypes are known in the art. Use of cognate components is specifically contemplated. Production of pseudotyped rAAV is disclosed in, for example, WO 01/83692 which is incorporated by reference herein in its entirety.
• the AAV vector can be a pseudotyped AAV, containing ITRs from one AAV serotype and capsid proteins from a different AAV serotype.
• the pseudo-typed AAV can be AAV2/9 (i.e., an AAV containing AAV2 ITRs and AAV9 capsid proteins).
• the pseudotyped AAV can be AAV2/8 (i.e., an AAV containing AAV2 ITRs and AAV8 capsid proteins).
• the pseudotyped AAV can be AAV2/1 (i.e., an AAV containing AAV2 ITRs and AAV1 capsid proteins).
• the AAV vector can contain a recombinant capsid protein, such as a capsid protein containing a chimera of one or more of capsid proteins from AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh74, AAVrh.8, or AAVrh.10, AAV10, AAV11 , AAV12, or AAV13.
• Other types of rAAV variants for example rAAV with capsid mutations, are also contemplated. See, for example, Marsic etal., Molecular Therapy, 22(11): 1900- 1909 (2014).
• the nucleotide sequences of the genomes of various AAV serotypes are known in the art.
• the disclosure provides AAV to deliver miDNMI s which target DNM1 mRNA to inhibit DNM1 expression.
• AAV can be used to deliver miDNMI s under the control of an RNA polymerase III (Pol 11 l)-based promoter.
• AAV is used to deliver miDNMI s under the control of a U6 promoter.
• AAV is used to deliver miDNMI s under the control of a H1 promoter.
• AAV is used to deliver miDNMI s under the control of an RNA polymerase II (Pol ll)-based promoter.
• AAV is used to deliver miDNMI s under the control of an U7 promoter.
• AAV is used to deliver miDNMI s under the control of a neuron-specific promoter.
• AAV is used to deliver miDNMI s under the control of a neuron-specific synapsin promoter.
• AAV is used to deliver miDNMI s under the control of a DNM1 promoter.
• the U6 promoter controls expression of the U6 RNA, a small nuclear RNA (snRNA) involved in splicing, and which has been well-characterized [Kunkel etal., Nature, 322(6074) :73-77 (1986); Kunkel etal., Genes Dev. 2( 2):196-204 (1988); Paule etal., Nuc. Acids Res., 23(6): 1283- 1298 (2000)].
• the U6 promoter is used to control vector-based expression in mammalian cells [Paddison etal., Proc. Natl. Acad. Sci. USA, 99(3):1443- 1448 (2002); Paul etal., Nat.
• RNA polymerase III poly III
• the disclosure includes use of both murine and human U6 promoters.
• AAV vectors herein lack rep and cap genes.
• the AAV can be a recombinant AAV, a recombinant single-stranded AAV (ssAAV), or a recombinant self-complementary AAV (scAAV).
• rAAV genomes of the disclosure comprise one or more AAV ITRs flanking a polynucleotide encoding, for example, one or more miDNMI s.
• Commercial providers such as Ambion Inc. (Austin, TX), Darmacon Inc. (Lafayette, CO), InvivoGen (San Diego, CA), and Molecular Research Laboratories, LLC (Herndon, VA) generate custom inhibitory RNA molecules.
• commercial kits are available to produce custom siRNA molecules, such as SILENCERTM siRNA Construction Kit (Ambion Inc., Austin, TX) or psiRNA System (InvivoGen, San Diego, CA).
• a method of generating a packaging cell is to create a cell line that stably expresses all the necessary components for AAV particle production.
• a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell.
• AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing [Samulski etal., Proc. Natl. Acad. S6.
• the packaging cell line is then infected with a helper virus such as adenovirus.
• a helper virus such as adenovirus.
• packaging cells that produce AAV vectors.
• Packaging cells may be stably transformed cancer cells such as HeLa cells, 293 cells and PerC.6 cells (a cognate 293 line).
• packaging cells are cells that are not transformed cancer cells, such as low passage 293 cells (human fetal kidney cells transformed with E1 of adenovirus), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells) and FRhL-2 cells (rhesus fetal lung cells).
• Recombinant AAV i.e., infectious encapsidated rAAV particles
• the genomes of the rAAV lack AAV rep and cap DNA, that is, there is no AAV rep or cap DNA between the ITRs of the genomes of the rAAV.
• the rAAV may be purified by methods standard in the art such as by column chromatography or cesium chloride gradients. Methods for purifying rAAV vectors from helper virus are known in the art and include methods disclosed in, for example, Clark etal., Hum. Gene Ther., 10(6) ⁇ 1031-1039 (1999); Schenpp and Clark, Methods Mol. Med., 69 ⁇ 427-443 (2002); U.S. Patent No. 6,566,118 and WO 98/09657.
• compositions comprising the nucleic acids and viral vectors of the disclosure are provided.
• Compositions comprising delivery vehicles (such as rAAV) described herein are provided.
• Such compositions also comprise a pharmaceutically acceptable carrier.
• the compositions may also comprise other ingredients such as diluents and adjuvants.
• Acceptable carriers, diluents and adjuvants are nontoxic to recipients and are preferably inert at the dosages and concentrations employed, and include buffers such as phosphate, citrate, or other organic acids; antioxidants such as ascorbic acid; low molecular weight polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as Tween, pluronics or polyethylene glycol (PEG).
• buffers such as phosphate, citrate, or other organic acids
• antioxidants such as ascorbic acid
• compositions provided herein can comprise a pharmaceutically acceptable aqueous excipient containing a non-ionic, low-osmolar compound or contrast agent such as iobitridol, iohexol, iomeprol, iopamidol, iopentol, iopromide, ioversol, or ioxilan, where the aqueous excipient containing the non-ionic, low-osmolar compound can have one or more of the following characteristics: about 180 mgl/mL, an osmolality by vapor-pressure osmometry of about 322mOsm/kg water, an osmolarity of about 273mOsm/L, an absolute viscosity of about 2.3cp at 20 °C and about 1.5cp at 37°C, and a specific gravity of about 1.164 at 37°C.
• compositions comprise about 20 to 40% non-ionic, low-osmolar compound or about 25% to about 35% non-ionic, low-osmolar compound.
• An exemplary composition comprises scAAV or rAAV viral particles formulated in 20mM Tris (pH8.0), 1mM MgCl2, 200mM NaCI, 0.001% poloxamer 188 and about 25% to about 35% non-ionic, low-osmolar compound.
• Another exemplary composition comprises scAAV formulated in and 1X PBS and 0.001% Pluronic F68.
• Titers of rAAV to be administered in methods of the invention will vary depending, for example, on the particular rAAV, the mode of administration, the treatment goal, the individual, and the cell type(s) being targeted, and may be determined by methods standard in the art. Titers of rAAV may range from about 1x10 6 , about 1x10 7 , about 1x10 s , about 1x10 9 , about 1x10 10 , about 1 x10 11 , about 1 x10 12 , about 1 x10 13 , about 1 x10 14 , about 1 x10 16 , or more DNase resistant particles (DRP) per ml. Dosages may be expressed in units of viral genomes (vg).
• Dosages contemplated herein include about 1x10 7 vg, about 1x10 8 vg, about 1x10 9 vg, about 5x10 9 vg, about 6 x10 9 vg, about 7x10 9 vg, about 8x10 9 vg, about 9x10 9 vg, about 1x10 1 °vg, about 2x10 1 °vg, about 3x10 10 vg, about 4x10 1 °vg, about 5x10 10 vg, about 1 x10 11 vg, about 1.1x10 11 vg, about 1.2x10 11 vg, about 1.3x10 11 vg, about 1.2x10 11 vg, about 1.3x10 11 vg, about 1.4x10 11 vg, about 1.5x10 11 vg, about 1.6x10 11 vg, about 1.7x10 11 vg, about 1.8x10 11 vg, about 1.9x10 11 vg, about 2x10 11
• Dosages of about 1x10 9 vg to about 1 x10 10 vg, about 5x 10 9 vg to about 5 x10 10 vg, about 1x10 10 vg to about 1x 10 11 vg, about 1 x10 11 vg to about 1x10 15 vg, about 1 x10 12 vg to about 1x10 15 vg, about 1 x10 12 vg to about 1 x10 14 vg, about 1x10 13 vg to about 6x10 14 vg, and about 6x10 13 vg to about 1.0x10 14 vg, 2.0x10 14 vg, 3.0x10 14 vg, 5.0x10 14 are also contemplated.
• CSF doses can range between about 1x10 13 vg/patient to about 1 x10 15 vg/patient based on age groups.
• intravenous delivery doses can range between 1 x10 13 vg/kilogram (kg) body weight and 2 x10 14 vg/kg.
• Methods of transducing a target cell with a delivery vehicle such as rAAV
• the in vivo methods comprise the step of administering an effective dose, or effective multiple doses, of a composition comprising a delivery vehicle (such as rAAV) to an subject (including a human patient) in need thereof. If the dose is administered prior to development of a disorder/disease, the administration is prophylactic.
• An effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disorder/disease state being treated, that slows or prevents progression to a disorder/disease state, that slows or prevents progression of a disorder/disease state, that diminishes the extent of disease, that results in remission (partial or total) of disease, and/or that prolongs survival.
• An example of a disease contemplated for prevention or treatment with methods of the invention is a DEE.
• DEE include, but are not limited to, Lennox-Gastaut Syndrome and Infantile Spasms.
• the methods can be carried out before the onset of disease. In other patients, the methods are carried out after diagnosis.
• the subject can be held in the Trendelenburg position (head down position) after injection of the rAAV (e.g ., for about 5, about 10, about 15 or about 20 minutes).
• the patient may be tilted in the head down position at about 1 degree to about 30 degrees, about 15 to about 30 degrees, about 30 to about 60 degrees, about 60 to about 90 degrees, or about 90 to about 180 degrees.
• Outcome measures demonstrate the therapeutic efficacy of the methods.
• Outcome measures include, but are not limited to, one or more of the reduction or elimination of mutant DNM1 mRNA or protein in affected tissues, DNM1 gene knockdown, increased survival, increased growth, and decreased seizures.
• Others include, but are not limited to, improved nerve histology (axon number, axon size and myelination), improved motor function, improved grip strength, reduction in gliosis and neurodegeneration in the brain, and improved metabolic activity.
• expression of variant DNM1 in a subject is inhibited by at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 95, at least 98 percent, at least 99 percent, or 100 percent compared to expression in the subject before treatment.
• Combination therapies are also contemplated by the invention.
• Combination as used herein includes both simultaneous treatment and sequential treatments.
• Combinations of methods described herein with standard medical treatments and supportive care are specifically contemplated.
• an effective dose of a nucleic acid, viral vector, or composition of the disclosure may be by routes standard in the art including, but not limited to, intramuscular, parenteral, intravascular, intravenous, oral, buccal, nasal, pulmonary, intracranial, intracerebroventricular, intrathecal, intraosseous, intraocular, rectal, or vaginal.
• An effective dose can be delivered by a combination of routes. For example, an effective dose is delivered intravenously and intramuscularly, or intravenously and intracerebroventricularly, and the like. An effective dose can be delivered in sequence or sequentially. An effective dose can be delivered simultaneously.
• Route(s) of administration and serotype(s) of AAV components of the rAAV (in particular, the AAV ITRs and capsid protein) of the invention are chosen and/or matched by those skilled in the art taking into account the infection and/or disease state being treated and the target cells/tissue(s) that are to express the miRNAs.
• actual administration of delivery vehicle may be accomplished by using any physical method that will transport the delivery vehicle (such as rAAV) into a target cell of an subject.
• Administration includes, but is not limited to, injection into muscle, the bloodstream and/or directly into the nervous system or liver. Simply resuspending a rAAV in phosphate buffered saline has been demonstrated to be sufficient to provide a vehicle useful for muscle tissue expression, and there are no known restrictions on the carriers or other components that can be co-administered with the rAAV (although compositions that degrade DNA should be avoided in the normal manner with rAAV).
• Capsid proteins of a rAAV may be modified so that the rAAV is targeted to a particular target tissue of interest such as neurons. See, for example, WO 02/053703, the disclosure of which is incorporated by reference herein.
• Pharmaceutical compositions can be prepared as injectable formulations or as topical formulations to be delivered to the muscles by transdermal transport. Numerous formulations for both intramuscular injection and transdermal transport have been previously developed and can be used in the practice of the invention.
• the delivery vehicle (such as rAAV) can be used with any pharmaceutically acceptable carrier for ease of administration and handling.
• a dispersion of delivery vehicle (such as rAAV) can also be prepared in glycerol, sorbitol, liquid polyethylene glycols and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
• the sterile aqueous media employed are all readily obtainable by standard techniques well-known to those skilled in the art.
• the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
• the form must be sterile and must be fluid to the extent that easy syringeability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating actions of microorganisms such as bacteria and fungi.
• the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, sorbitol and the like), suitable mixtures thereof, and vegetable oils.
• the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of a dispersion and by the use of surfactants.
• the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases it will be preferable to include isotonic agents, for example, sugars or sodium chloride.
• Prolonged absorption of the injectable compositions can be brought about by use of agents delaying absorption, for example, aluminum monostearate and gelatin.
• Sterile injectable solutions are prepared by incorporating rAAV in the required amount in the appropriate solvent with various other ingredients enumerated above, as required, followed by filter sterilization.
• dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
• the preferred methods of preparation are vacuum drying and the freeze drying technique that yield a powder of the active ingredient plus any additional desired ingredient from the previously sterile-filtered solution thereof.
• Transduction of cells such as neurons with rAAV provided herein results in sustained expression of DNM1 miRNAs.
• the present invention thus provides methods of administering/delivering rAAV which express DNM1 miRNAs to a subject, preferably a human being. These methods include transducing cells and tissues (including, but not limited to, central nervous system neurons) with one or more rAAV described herein. Transduction may be carried out with gene cassettes comprising cell-specific control elements.
• transduction is used to refer to, as an example, the administration/delivery of miDNMIs to a target cell either in vivo or in vitro, via a replication- deficient rAAV described herein resulting in the expression of miDNMIs by the target cell (e.g ., neurons).
• Example 1 Aspects and exemplary embodiments of the invention are illustrated by the following examples.
• Example 1 Aspects and exemplary embodiments of the invention are illustrated by the following examples.
• miDnmla- 1 through miDnm1a-4 Four microRNAs targeting Dnmla (termed miDnmla- 1 through miDnm1a-4) were designed and cloned into a mir-30 based construct with expression driven by the U6 promoter, as previously described in Wallace etai., Mol. Ther. J. Am. Soc. Gene Then, 20 ⁇ 1417-1423 (2012).
• the miDNMI sequences were generally designed according to Boudreau etai., Chapter 2 of Flarper (Ed.), RNA Interference Techniques, Neuromethods, Vol. 58, Springer Science+Business Media, LLC (2011 ).
• Qualifying miRNAs were 22 nt long, with the first four and last four nucleotides being at least 75% GC rich and AU rich respectively. Additionally, the string of 22 nucleotides were 40% AU rich. miRNA specific targeting of Dnmla capitalized on the 42 nt difference between Dnmla and Dnmlb.
• the activity of the miRNAs was tested in vitro using a dual luciferase reporter assay.
• the luciferase assay requires development of a dual reporter plasmid containing 2 different luciferase genes from firefly and Renilla reniformis, respectively.
• DNM1 gene sequences are inserted as the 3’ UTR of Renilla luciferase, while firefly luciferase serves as an internal control.
• U6. miDNMI plasmids are co-transfected into FIEK293 cells with the dual luciferase plasmid.
• DNM1 gene knockdown is determined by measuring activity of Renilla luciferase tagged with DNM1 sequences, relative to the control firefly luciferase activity.
• miDnmla- 1 exhibited about 84% knockdown
• miDnm1a-2 exhibited about 64% knockdown
• miDnm1a-3 exhibited about 80% knockdown.
• miDnm1a-4 was the most effective at reducing the amount of Dnmla mRNA ( Figure 2A), exhibiting about 95% knockdown.
• the full length miDnm1a-4 miRNA sequence is as follows.
• the antisense strand of the mature miRNA (underlined) binds Dnmla mRNA.
• miDnm1a-4 template DNA was cloned into a scAAV9 virus vector (scAAV9- miDnmla) for in vivo validation (Figure 2B).
• the miDNMI template sequences were cloned into the scAAV9 construct generically named “scAAV9-NP vectors” for in vivo delivery.
• the scAAV9 also contained a CMV promoter-driven eGFP reporter gene.
• the scAAV9 comprised a mutant AAV2 inverted terminal repeat (ITR) and a wild type AAV2 ITR that enable packaging of self complementary AAV genomes.
• ITR inverted terminal repeat
• the resulting scAAV9 are referred to as “scAAV9-NP vectors”.
• a non-targeting scAAV referred to as “AAV9-miRLacZ” (short for a scAAV construct scAAV-NP.U6.miRLacZ. CMV. eGFP).
• the scAAV9 were produced by transient transfection procedures using a double- stranded AAV2-ITR-based vector, with a plasmid encoding Rep2Cap9 sequence as previously described [Gao etai, J. Virol., 78 ⁇ 6381-6388 (2004)] along with an adenoviral helper plasmid pHelper (Stratagene, Santa Clara, CA) in 293 cells.
• the scAAV9 were produced in three separate batches for the experiments and purified by two cesium chloride density gradient purification steps, dialyzed against PBS and formulated with 0.001% Pluronic-F68 to prevent virus aggregation and stored at 4°C.
• vector preparations were titered by quantitative PCR using Taq-Man technology. Purity of vectors was assessed by 4-12% sodium dodecyl sulfate-acrylamide gel electrophoresis and silver staining (Invitrogen, Carlsbad, CA). scAAV9 viruses were generated and titered by the Viral Vector Core at The Research Institute at Nationalwide Children’s Hospital.
• mice were either administered the treatment (scAAV9-miDnm1a) or control (scAAV9-eGFP) AAV via a one-time bilateral intracerebroventricular (ICV) injection at postnatal day zero (PND 0).
• scAAV9-miDnm1a or control
• scAAV9-eGFP a one-time bilateral intracerebroventricular (ICV) injection at postnatal day zero (PND 0).
• mice were anesthetized using hypothermia by being placed on a chilled metal block until properly anesthetized.
• the injection site was approximately 2/5 th the distance from the lambda suture to each eye. All injections were executed free hand using a point style 4, 33-gauge needle and a 10mI_ or 25mI_ Hamilton syringe (Cat# 65460-06 and Cat# 65460-10).
• Control scAAV9-eGFP injections were matched to miDnmla dosage, and saline controls were matched to the volume of virus injected.
• Dnmla knock down was assessed using the primers 5’-CTCGCTTTTGAAGCCACAGT- 3’ (SEQ ID NO: 56) and 3’- TTTCTGATGGTGGACGTGAG - 5’ (SEQ ID NO: 57).
• Dnm 1b expression was evaluated using the primers 5’- GGCCTTT G AAACCATT GT G A -3’ (SEQ ID NO: 58), and 3’- GCACT GT CT AACCGT GCT G A - 5’ (SEQ ID NO: 59).
• SYBRTM Select Master Mix (Applied Biosystems, Waltham, MA, Cat# 4472903) was used for qPCR which was run using Applied Biosystems-Quant Studio 5.
• mice were randomly assigned to either miDnmla treatment or control condition which included eGFP or saline administration; in analysis for simplicity the two control conditions were combined since they did not differ in effect.
• control- injected groups we combined as covariates the two dose-experiments and sexes (using categorical indicator variables for each) and litter size.
• Cellular analysis was executed at PND 18, because that is the timepoint by which almost all untreated or control-injected mice become moribund, and PND 30, the endpoint of the study. For this study, we show three representative replicates for the cellular characterization of the effect of miDnmla treatment.
• B6J-D/im7 Ftfl fl0X mice used for these studies were generated in D/im7 A1aM1a mice by The Jackson Laboratory’s Genetic Engineering Technology core, introducing the Dnm1 Ftfl mutation using CRISPR/Cas9.
• B6J- Dnm 1 m,+ mice were mated to FVB/NJ females (JAX, Bar Harbor, ME, stock 004624), and Fi hybrid mice mated inter se. Mice were genotyped with a PCR protocol designed to detect the presence of loxP sites in the fitful allele.
• mice for this study were between 0 and 30 days old. To identify individual pups, they were tattooed at PND 0 according to the AIMS pup tattoo identification system (Budd Lake, NJ) using Ketchum Animal Tattoo Ink (Cat# 329AA). Mice were also ear notched at PND 10. Post weaning at PND 21 , mice had access to food and water in their home cages ad libitum.
• Example 5 mice were weighed every other day. In addition, general health and survival were monitored every day from PND 0 to PND 30 (study endpoint).
• Seizure activity was characterized by wild runs, Straub tail, vertical jumps that lasted more than 10 sec with subsequent facial grooming, continuous jerking of the forelimbs and hindlimbs and tonic-clonic seizures. All seizures within the observation window were counted as one event. The assessments were done on alternate days, starting at PND 14 during weight examination sessions. Table 1. Observed seizure or seizure associated behaviors in treated or control-injected Dnm1 m/m mice a Fisher exact test, 2-tail, 2 x 2 contingency analysis.
• mice from both groups were handled every day from PND 4-12. On all even days (PND 4 to PND 12) they were weighed and on odd days (PND 5 to PND 11), they were assessed for strength and sensorimotor development. From PND 14 to PND 30 mice were weighed on every other day on even days. Testing was executed blind.
• mice were placed on a vertical mesh screen and their latency to fall off the screen was recorded. Mice were observed for 30 sec and were allowed two attempts to complete the task. The scores from both trials were averaged. Mice were tested at PND 9 and PND 11 because the average age of a rodent to perform this task is PND 8.
• Treated Dnm1 Fm,Fm mice showed extended survival, improved growth, decreased lethal seizures, improved developmental outcomes, and an absence of ataxia. These data together show the effectiveness of miDnmla at curbing or eliminating the most severe fitful behavioral phenotypes including seizures, growth and ataxia, culminating in an overall improvement in their quality of life and survival to the endpoint.
• mice from each group were perfused with 4% PFA for immunohistochemical assessment at PND 18.
• Free floating 40mhi sections were collected using a cryostat (Leica CM3050S). The sections were permeabilized with 0.1% Triton X in PBS for 30 minutes and blocked with 5% normal goat serum in PBS (blocking buffer) for 1 h at room temperature. Slices were incubated with either anti-NPY (1 :500, ImmunoStar, Hudson, Wl Cat# 22940), anti-c-Fos (1 :250, Abeam, Cambridge, UK, Cat# ab190289), anti-GFP (1 :250, Invitrogen, Carlsbad, CA, Cat# A11120) or anti-GFAP (1 :750, Sigma, Saint Louis, MO, Cat. # M4403) in blocking buffer overnight at 4°C.
• mice For FJC labeling, 3-5 PND 18 and PND 30 mice (genotype x treatment) were euthanized, and their brains dissected and flash frozen. 20mhi thick sections were collected with a cryostat and mounted on gelatin coated slides (FD Neurosciences, Inc.
• slides were washed 3 times for 2 mins each in deionized water, air dried completely and cleared in xylene for at least 1 min before they were cover slipped with mounting media (DPX, Saint Louis, MO, Cat# 06522).
• 30 Slides were imaged using a Zeiss LSM-800 confocal microscope and Zen v2.3. Tiled images of 10X magnification were acquired of the hippocampus for each section keeping the laser and gain settings constant. For FJC, the Axio X-Cite series 120 Q epifluorescence microscope was used and images of 10X magnification were acquired. Post processing of images was carried out with Adobe Photoshop. All image processing was kept consistent.
• IHC images were quantified blind using ImageJ (Fiji; nih.gov). Images were converted to 8-bit and brightness and contrast keep constant.
• the cell counter plugin was used to count aberrant NPY and c-Fos positive cells in the whole hippocampal CA3 and to count FJC positive cells in the hippocampal CA1.
• GFAP fluorescence intensity was determined using the measure tool with the region of interest (ROI) in the CA1 . Measurements were set to include area, min and max gray value and integrated density. For fluorescence intensity measurement, background intensity was collected. Relative fluorescence was calculated by first subtracting the integrated intensity of the background from the integrated intensity of the CA1 ROI to yield a background corrected intensity. Area was kept constant across all intensity measures. The corrected intensities of the wildtype control group was then averaged. Each corrected intensity was divided by the average of the wildtype control corrected intensity and multiplied by 100.
• NPY Neuropeptide Y
• upregulation of NPY in the hippocampus is a known method of evidencing hyperexcitability in rodent models of epilepsy.
• Treated Dnm1 Fm/Fm mice showed NPY expression similar to treated and control-injected Dnm1 +/+ mice at PND 18 (p>0.05; Figure 8A, Figure 9A).
• treated Dnm1TM Ftfl mice still did not differ from treated and control-injected Dnm 1 +l+ mice, although treated Dnm 7 Ftfl/Ftfl mice tended to have more aberrant NPY + cells in the CA3 (p>0.05; Figure 8B, Figure 9A).
• immunostaining for the immediate early gene marker of neuronal activity, c-Fos was also performed.
• a microRNA was designed that specifically and efficiently targets exon 10b from both species.
• the miDNMI -1 Ob-72 miRNA was cloned into a mir-30 based construct by the methods described in Example 1 . It binds both the human and murine exon 10b with perfect complementarity.
• the full length miDnml b-72 miRNA sequence is as follows.
• the mature antisense guide strand sequence is shown (5’ to 3’) in SEQ ID NO: 46.
• miDNMI -1 Ob-72 The activity of the miDNMI -1 Ob-72 was tested in vitro using the dual luciferase reporter assay described in Example 1. miDNMI -1 OB-72 exhibited about 90% knockdown compared to non-targeting controls (empty U6 plasmid, U6T6 or miLacZ) ( Figure 10).

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Biomedical Technology (AREA)
• Organic Chemistry (AREA)
• Zoology (AREA)
• General Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Wood Science & Technology (AREA)
• Biotechnology (AREA)
• Molecular Biology (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• Microbiology (AREA)
• Plant Pathology (AREA)
• Physics & Mathematics (AREA)
• Virology (AREA)
• Epidemiology (AREA)
• Pharmacology & Pharmacy (AREA)
• Medicinal Chemistry (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Medicines Containing Material From Animals Or Micro-Organisms (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Priority Applications (2)

Applications Claiming Priority (2)

Publications (2)

Family

ID=83602203

Family Applications (1)

Country Status (4)

Families Citing this family (1)

Family Cites Families (26)

• 2021
  • 2021-04-15 US US17/231,963 patent/US12275941B2/en active Active
• 2022
  • 2022-04-14 JP JP2023562865A patent/JP2024514160A/ja active Pending
  • 2022-04-14 WO PCT/US2022/024885 patent/WO2022221574A2/en not_active Ceased
  • 2022-04-14 EP EP22788958.1A patent/EP4322964A4/en active Pending
• 2025
  • 2025-03-12 US US19/077,861 patent/US20250230443A1/en active Pending

Also Published As

Similar Documents

Legal Events