WO2022215704A1 - Corps conjugué ligand-acide nucléique - Google Patents

Corps conjugué ligand-acide nucléique Download PDF

Info

Publication number
WO2022215704A1
WO2022215704A1 PCT/JP2022/017160 JP2022017160W WO2022215704A1 WO 2022215704 A1 WO2022215704 A1 WO 2022215704A1 JP 2022017160 W JP2022017160 W JP 2022017160W WO 2022215704 A1 WO2022215704 A1 WO 2022215704A1
Authority
WO
WIPO (PCT)
Prior art keywords
group
carbon atoms
formula
atom
bond
Prior art date
Application number
PCT/JP2022/017160
Other languages
English (en)
Japanese (ja)
Inventor
聡 小比賀
昂志 大澤
匠 奥田
哲也 兒玉
義大 百相
永士 三森
和馬 大石
篤志 中野
勇矢 笠原
春彦 鎌田
泰亮 中山
Original Assignee
国立大学法人大阪大学
国立大学法人東海国立大学機構
国立研究開発法人医薬基盤・健康・栄養研究所
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 国立大学法人大阪大学, 国立大学法人東海国立大学機構, 国立研究開発法人医薬基盤・健康・栄養研究所 filed Critical 国立大学法人大阪大学
Priority to JP2023513029A priority Critical patent/JPWO2022215704A1/ja
Publication of WO2022215704A1 publication Critical patent/WO2022215704A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445—Non condensed piperidines, e.g. piperocaine
    • A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7115—Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7125—Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/55—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug, i.e. a dimer, oligomer or polymer of pharmacologically or therapeutically active compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/18—Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Definitions

  • the present invention relates to ligand-nucleic acid conjugates.
  • Nucleic acid medicine which controls the expression of genes that cause diseases and attempts to treat or prevent them, has been attracting a lot of attention in recent years. Nucleic acid medicines are classified into various types according to their mechanisms of action and differences in the structure of nucleic acids, which are active ingredients. Many of them are characterized by being able to control the expression of target genes in a sequence-specific manner. Therefore, it is expected that this will lead to new treatments for many intractable diseases for which no effective treatments have been found.
  • nucleic acid drugs More than 140 clinical trials of nucleic acid drugs are currently underway in Japan and overseas, but many issues still remain to be resolved. In particular, “improvement of delivery technology” is an urgent issue. Techniques for delivering nucleic acid drugs are roughly divided into methods of loading nucleic acid drugs into nanoparticles, liposomes, and the like, and methods of conjugating the nucleic acid drugs themselves with a certain ligand. Particularly in the latter, antisense nucleic acids and siRNA conjugated with N-acetylgalactosamine (GalNAc) have achieved remarkable results in delivery to the liver (Non-Patent Documents 1 and 2). GalNAc conjugates are extremely effective when targeting the liver, but when targeting other organs, it is essential to search for ligands that serve as post-GalNAc.
  • GalNAc N-acetylgalactosamine
  • An object of the present invention is to solve the above problems, and the purpose thereof is to provide a conjugate of a ligand and a nucleic acid drug that can be useful for the development of delivery technology for nucleic acid drugs.
  • the present invention provides the following formula (I):
  • R 10 is an oxygen atom, a sulfur atom, —NH—, or —C(O)—
  • R 11 is a phenyl group optionally substituted with at least one group selected from the group consisting of a cyano group, a nitro group, and a halogen atom, or a heteroaryl group having 4 to 20 carbon atoms), and Less than:
  • a heteroaryl group optionally substituted with at least one group selected from the group consisting of; or; (iv) at least 1 to 3 carbon atoms in the ring may be substituted with at least one atom or group selected from the group consisting of an oxygen atom, a nitrogen atom and -NH-, having 8 to 8 carbon atoms; 15 polycyclic groups, an optionally branched alkyl group having 1 to 3 carbon atoms, an optionally branched alkoxy group having 1 to 3 carbon atoms, halogen atom, a benz
  • R 12 , R 13 , R 14 and R 15 are each independently a halogen atom, an optionally branched alkyl group having 1 to 3 carbon atoms, or a methoxy group and w is an integer from 1 to 5) is a group represented by (Group C) Formula (V) below:
  • R 18 , R 19 , R 20 and R 21 are each independently a halogen atom, an optionally branched C 1 to 3 an alkyl group or a methoxy group, R22 is a hydrogen atom, a methyl group, or an ethyl group, and q is 0 or 1) is a group represented by or (E group) Formula (VII) below:
  • Lg is a group belonging to Group A above.
  • Lg is a group belonging to Group B above.
  • Lg is a group belonging to Group C above.
  • Lg is a group belonging to Group D above.
  • Lg is a group belonging to Group E above.
  • Lg in formula (I) above is a group belonging to group A or group B above, and Lk is the following formula (VIIIa):
  • Lg in the formula (I) is a group belonging to the C group, the D group, or the E group, and Lk is the following formula (VIIIb):
  • Lk in formula (I) above is represented by the following formula (IX):
  • the NCA of formula (I) above has a nucleoside structure represented by the following formula (X):
  • BASE is a purin-9-yl group optionally having one or more substituents selected from the ⁇ group, or optionally having one or more substituents selected from the ⁇ group 2 - represents an oxo-1,2-dihydropyrimidin-1-yl group
  • the ⁇ group is a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, or a protecting group for nucleic acid synthesis.
  • A is:
  • R 25 is a divalent group represented by R 25 is selected from a hydrogen atom, an optionally branched or ring-forming alkyl group having 1 to 7 carbon atoms, an optionally branched or ring-forming alkenyl group having 2 to 7 carbon atoms, and the ⁇ group an aryl group having 3 to 12 carbon atoms which may have one or more optional substituents and may contain a heteroatom, and one or more optional substituents selected from the ⁇ group represents an aralkyl group having an aryl moiety of 3 to 12 carbon atoms which may optionally contain a heteroatom, or an amino group-protecting group for nucleic acid synthesis, R 26 and R 27 are each independently a hydrogen atom; optionally substituted with an aryl group having 3 to 12 carbon atoms which may contain a heteroatom, and optionally branched or forming a ring an alkyl group having 1 to 7 carbon atoms; or an aralkyl group having an aryl moiety having 3 to
  • R 39 , R 40 and R 41 each independently form a hydrogen atom, a branch or a ring an alkyl group having 1 to 7 carbon atoms, an amino group-protecting group, or
  • R 35 and R 36 each independently represents a hydrogen atom; a hydroxyl group; an alkyl group having 1 to 7 carbon atoms which may be branched or forming a ring; A group selected from the group consisting of an alkoxy group of 7; an amino group; and an amino group protected by a protecting group for nucleic acid synthesis; m is an integer from 0 to 2; n is an integer from 0 to 1; R 34 is a hydrogen atom, an optionally branched or ring-forming alkyl group having 1 to 7 carbon atoms, an amino-protecting group, or
  • R 29 and R 30 are each independently a hydrogen atom, an optionally branched or ring-forming alkyl group having 1 to 7 carbon atoms, or an amino group-protecting group. ,or
  • the present invention is also a pharmaceutical composition containing the above conjugate.
  • the means for enabling delivery of nucleic acid medicines to various organs or tissues can be expanded.
  • the conjugate of the present invention is capable of delivering nucleic acid drugs to organs or tissues such as skin, pancreas, heart, and skeletal muscle, and is thus useful for treating or preventing various diseases in the organs or tissues. means can be provided.
  • FIG. 4 shows the structure of conjugate ASO1 (2197-ASO) and conjugate ASO2 (444-ASO).
  • FIG. 3 shows the structure of conjugate ASO3 (2270-ASO) and conjugate ASO4 (2168-ASO).
  • FIG. 3 shows the structure of conjugate ASO5 (1204-ASO) and conjugate ASO6 (2009-ASO).
  • 1 is a reverse-phase HPLC chromatogram of ASO (1) (“H 2 N—C 6 —ASO”) with a linker from Preparation Example 1 (A) and ASO with a linker from Preparation Example 2 (2) (B).
  • FIG. 10 is a graph showing the results of Malat1 expression levels in each organ of mice to which conjugate ASO1 (2197-ASO) was administered.
  • FIG. 10 is a graph showing the results of Malat1 expression levels in each organ of mice to which conjugate ASO1 (2197-ASO) was administered.
  • FIG. 10 is a graph showing the results of Malat1 expression levels in each organ of mice to which conjugate ASO1 (2197-ASO) was administered.
  • FIG. 10 is a graph showing the results of Malat1 expression levels in each organ of mice to which conjugated ASO2 (444-ASO) was administered.
  • FIG. 10 is a graph showing the results of Malat1 expression levels in each organ of mice to which conjugated ASO3 (2270-ASO) was administered.
  • FIG. 10 is a graph showing the results of Malat1 expression levels in each organ of mice to which conjugated ASO3 (2270-ASO) was administered.
  • FIG. FIG. 10 is a graph showing the results of Malat1 expression levels in each organ of mice to which conjugate ASO4 (2168-ASO) was administered.
  • FIG. 10 is a graph showing the results of Malat1 expression levels in each organ of mice to which conjugate ASO5 (1204-ASO) was administered.
  • FIG. 10 is a graph showing the results of Malat1 expression levels in each organ of mice to which conjugate ASO6 (2009-ASO) was administered.
  • FIG. Reversed phase HPLC chromatograms of 2197-ASO-2 conjugate (A), 1204-ASO-2 conjugate (B) and 2270-ASO-2 conjugate (C).
  • FIG. 10 is a graph showing the results of Malat1 expression levels in each organ of mice to which 2197-ASO-2 conjugates were administered.
  • FIG. 10 is a graph showing the results of Malat1 expression levels in each organ of mice to which 444-ASO-2 conjugates were administered.
  • FIG. 10 is a graph showing the results of Malat1 expression levels in each organ of mice to which 2270-ASO-2 conjugates were administered.
  • FIG. 10 is a graph showing the results of Malat1 expression levels in each organ of mice to which 2168-ASO-2 conjugates were administered.
  • FIG. 10 is a graph showing the results of Malat1 expression levels in each organ of mice to which 1204-ASO-2 conjugates were administered.
  • FIG. FIG. 10 is a graph showing the results of Malat1 expression level in each organ of mice to which 2009-ASO-2 conjugate was administered.
  • alkyl group having 1 to n carbon atoms refers to any linear, branched or cyclic alkyl group having 1 to n carbon atoms, such as methyl group, ethyl group, n-propyl group, isopropyl group, n-butyl group, s-butyl group, t-butyl group, n-pentyl group, isopentyl group, neopentyl group, t-pentyl group, n-hexyl group, isohexyl group, n-heptyl group, n -octyl group, n-nonyl group and the like.
  • the term “optionally branched alkyl group having 1 to 9 carbon atoms” refers to a linear or branched alkyl group having 1 to 9 carbon atoms.
  • the term “optionally branched C 1-3 alkyl group” refers to any straight or branched C 1-3 alkyl group.
  • the term “linear alkyl group having 1 to 6 carbon atoms” refers to any linear alkyl group having 1 to 6 carbon atoms.
  • alkoxy group having 1 to n carbon atoms refers to any linear, branched or cyclic alkoxy group having 1 to n carbon atoms, such as methoxy group, ethoxy group, n-propoxy group, isopropoxy group, n-butoxy group, s-butoxy group, t-butoxy group and the like.
  • optionally branched C1-C3 alkoxy group refers to a linear or branched C1-C3 alkoxy group.
  • linear alkoxy group having 1 to 6 carbon atoms includes alkoxy groups having any linear alkyl group having 1 to 6 carbon atoms.
  • alkoxy group having 1 to 6 carbon atoms refers to any linear, branched or cyclic alkoxy group having 1 to 6 carbon atoms.
  • linear alkoxy group having 1 to 6 carbon atoms optionally substituted with a linear alkoxy group having 1 to 6 carbon atoms When the term “linear alkoxy group having 1 to 6 carbon atoms optionally substituted with a linear alkoxy group having 1 to 6 carbon atoms" is used, the above “linear alkoxy group having 1 to 6 carbon atoms” and " An alkoxy in which one or more hydrogen atoms constituting a "straight-chain alkoxy group having 1 to 6 carbon atoms" are substituted with other "straight-chain alkoxy groups having 1 to 6 carbon atoms" which may be the same or different base.
  • Such "linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms” includes, for example, a methoxy group, an ethoxy group, an n-propoxy group and a methoxymethoxy group. , ethoxymethoxy, n-propoxymethoxy, methoxyethoxy (eg 2-methoxyethoxy), ethoxyethoxy (eg 2-ethoxyethoxy), and n-propoxyethoxy.
  • cyanoalkoxy group having 1 to 6 carbon atoms means that at least one hydrogen atom in any linear, branched or cyclic alkoxy group having 1 to 6 carbon atoms is substituted with a cyano group. base.
  • linear alkylthio group having 1 to 6 carbon atoms includes an alkylthio group having any linear alkyl group having 1 to 6 carbon atoms. Examples thereof include a methylthio group, an ethylthio group and an n-propylthio group.
  • alkylthio group having 1 to 6 carbon atoms refers to any linear, branched or cyclic alkylthio group having 1 to 6 carbon atoms.
  • linear alkylamino group having 1 to 6 carbon atoms includes an alkylamino group having one or two alkylamino groups having any linear alkyl group having 1 to 6 carbon atoms. do. Examples thereof include methylamino group, dimethylamino group, ethylamino group, methylethylamino group and diethylamino group.
  • any straight chain alkyl group having 1 to 7 carbon atoms includes methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, and n-heptyl groups.
  • arbitrary branched chain alkyl groups having 3 to 7 carbon atoms include isopropyl group, isobutyl group, tert-butyl group, isopentyl group and the like, and arbitrary cyclic alkyl groups having 3 to 7 carbon atoms, A cyclobutyl group, a cyclopentyl group, a cyclohexyl group and the like can be mentioned.
  • alkenyl group having 2 to 7 carbon atoms means any linear alkenyl group having 2 to 7 carbon atoms, any branched alkenyl group having 3 to 7 carbon atoms, It includes chain alkenyl groups and any cyclic alkenyl groups having 3 to 7 carbon atoms. It may simply be referred to as a "lower alkenyl group”.
  • any linear alkenyl group having 2 to 7 carbon atoms includes ethenyl group, 1-propenyl group, 2-propenyl group, 1-butenyl group, 2-butenyl group, 1-pentenyl group, 2-pentenyl group, 3-pentenyl group, 4-pentenyl group, 1-hexenyl group and the like
  • arbitrary branched alkenyl groups having 3 to 7 carbon atoms include isopropenyl group, 1-methyl-1-propenyl group, 1-methyl -2-propenyl group, 2-methyl-1-propenyl group, 2-methyl-2-propenyl group, 1-methyl-2-butenyl group and the like
  • any cyclic alkenyl group having 3 to 7 carbon atoms includes a cyclobutenyl group, a cyclopentenyl group, a cyclohexenyl group, and the like.
  • aryl group having n 1 to n 2 carbon atoms refers to n 1 to n 2 carbon atoms, where n 1 and n 2 are integers and n 1 ⁇ n 2 .
  • the "aryl group having 6 to 20 carbon atoms” includes a phenyl group, a naphthyl group and the like.
  • heteroaryl group having n 1 to n 2 carbon atoms refers to n 1 to n 2 carbon atoms containing one or more heteroatoms, where n 1 and n 2 are integers. , n 1 ⁇ n 2 ).
  • heteroatoms constituting the heteroaryl group include an oxygen atom, a nitrogen atom, a sulfur atom and the like.
  • a "C4-C20 heteroaryl group” includes C4-C20 heteroaryl groups containing one or more such heteroatoms.
  • polycyclic group having n 1 to n 2 carbon atoms means n 1 to n 2 carbon atoms (where n 1 and n 2 is an integer and n 1 ⁇ n 2 ), including any group consisting of multiple condensed rings.
  • heteroatoms that may be included in the polycyclic group include oxygen atoms, nitrogen atoms, sulfur atoms, and the like.
  • a C8-C15 polycyclic group includes C8-C15 polycyclics containing one or more such heteroatoms.
  • an aryl group having 3 to 10 carbon atoms which may contain a heteroatom refers to any aryl group having 6 to 10 carbon atoms, which is composed only of hydrocarbons, and Any heteroaryl group having 3 to 12 carbon atoms in which at least one carbon atom constituting the ring structure is replaced with a heteroatom (e.g., nitrogen atom, oxygen atom, sulfur atom, and combinations thereof) do.
  • a heteroatom e.g., nitrogen atom, oxygen atom, sulfur atom, and combinations thereof
  • the aryl group having 6 to 10 carbon atoms includes phenyl group, naphthyl group, indenyl group, azulenyl group and the like, and the arbitrary heteroaryl group having 3 to 12 carbon atoms includes pyridyl group, pyrrolyl group, quinolyl group, indolyl group, imidazolyl group, furyl group, thienyl group and the like.
  • aralkyl group having an aryl moiety having 3 to 12 carbon atoms which may contain a heteroatom examples include a benzyl group, a phenethyl group, a naphthylmethyl group, a 3-phenylpropyl group, 2 -phenylpropyl group, 4-phenylbutyl group, 2-phenylbutyl group, pyridylmethyl group, indolylmethyl group, furylmethyl group, thienylmethyl group, pyrrolylmethyl group, 2-pyridylethyl group, 1-pyridylethyl group, 3 -thienylpropyl group and the like.
  • acyl group examples include aliphatic acyl groups and aromatic acyl groups.
  • examples of aliphatic acyl groups include formyl, acetyl, propionyl, butyryl, isobutyryl, pentanoyl, pivaloyl, valeryl, isovaleryl, octanoyl, nonanoyl, decanoyl, 3-methylnonanoyl group, 8-methylnonanoyl group, 3-ethyloctanoyl group, 3,7-dimethyloctanoyl group, undecanoyl group, dodecanoyl group, tridecanoyl group, tetradecanoyl group, pentadecanoyl group, hexadecanoyl group, 1-methylpentadecanoyl group, 14-methylpentadecanoyl group, 13,13-dimethyltetradecanoyl group,
  • aromatic acyl groups include arylcarbonyl groups such as benzoyl group, ⁇ -naphthoyl group and ⁇ -naphthoyl group; 2-bromobenzoyl group and halogenoarylcarbonyl group such as 4-chlorobenzoyl group; , 4,6-trimethylbenzoyl group, lower alkylated arylcarbonyl group such as 4-toluoyl group; lower alkoxylated arylcarbonyl group such as 4-anisoyl group; 2-carboxybenzoyl group, 3-carboxybenzoyl group, 4 -carboxylated arylcarbonyl group such as carboxybenzoyl group; nitrated arylcarbonyl group such as 4-nitrobenzoyl group and 2-nitrobenzoyl group; lower alkoxycarbonylated arylcarbonyl group such as 2-(methoxycarbonyl)benzoyl group group; an arylated aryl group
  • sil group examples include a trimethylsilyl group, a triethylsilyl group, an isopropyldimethylsilyl group, a t-butyldimethylsilyl group, a methyldiisopropylsilyl group, a methyldi-t-butylsilyl group, and a triisopropylsilyl group.
  • tri-lower alkylsilyl groups such as; tri-lower alkylsilyl groups substituted with 1 to 2 aryl groups such as diphenylmethylsilyl group, butyldiphenylbutylsilyl group, diphenylisopropylsilyl group and phenyldiisopropylsilyl group; mentioned.
  • Trimethylsilyl group, triethylsilyl group, triisopropylsilyl group, t-butyldimethylsilyl group and t-butyldiphenylsilyl group are preferred, and trimethylsilyl group is more preferred.
  • halogen atom includes, for example, a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom.
  • a fluorine atom or a chlorine atom is preferred.
  • protecting group for amino group for nucleic acid synthesis As used herein, the terms “protecting group for amino group for nucleic acid synthesis”, “protecting group for hydroxyl group for nucleic acid synthesis”, “hydroxyl group protected by protecting group for nucleic acid synthesis”, “protecting group for nucleic acid synthesis”
  • the “protecting group” of "phosphate group” and “mercapto group protected by a protecting group for nucleic acid synthesis” is a group capable of stably protecting an amino group, hydroxyl group, phosphoric acid group or mercapto group during nucleic acid synthesis. If so, it is not particularly limited. Specifically, it refers to protective groups that are stable under acidic or neutral conditions and cleavable by chemical methods such as hydrogenolysis, hydrolysis, electrolysis, and photolysis.
  • Such protecting groups include, for example, lower alkyl groups, lower alkenyl groups, acyl groups, tetrahydropyranyl or tetrahydrothiopyranyl groups, tetrahydrofuranyl or tetrahydrothiofuranyl groups, silyl groups, lower alkoxymethyl groups, lower alkoxy lower alkoxymethyl group, halogeno lower alkoxymethyl group, lower alkoxylated ethyl group, halogenated ethyl group, methyl group substituted with 1 to 3 aryl groups, "lower alkyl group, lower alkoxy group, halogen atom or cyano A methyl group substituted with 1 to 3 aryl groups substituted on an aryl ring with a group", a lower alkoxycarbonyl group, an "aryl group substituted with a halogen atom, a lower alkoxy group or a nitro group", a "halogen atom or Examples include a lower alkoxycarbony
  • the tetrahydropyranyl group or tetrahydrothiopyranyl group includes a tetrahydropyran-2-yl group, a 3-bromotetrahydropyran-2-yl group, a 4-methoxytetrahydropyran-4-yl group and a tetrahydropyranyl group.
  • a tetrahydrofuranyl group or a tetrahydrothiofuranyl group includes a tetrahydrofuran-2-yl group and a tetrahydrothiofuran-2-yl group.
  • the lower alkoxymethyl group includes methoxymethyl group, 1,1-dimethyl-1-methoxymethyl group, ethoxymethyl group, propoxymethyl group, isopropoxymethyl group, butoxymethyl group, t-butoxymethyl group and the like.
  • Lower alkoxylated lower alkoxymethyl groups include 2-methoxyethoxymethyl groups and the like.
  • Halogeno lower alkoxymethyl groups include 2,2,2-trichloroethoxymethyl groups and bis(2-chloroethoxy)methyl groups.
  • the lower alkoxylated ethyl group includes 1-ethoxyethyl group, 1-(isopropoxy)ethyl group and the like. Examples of halogenated ethyl groups include 2,2,2-trichloroethyl groups.
  • the methyl group substituted with 1 to 3 aryl groups includes a benzyl group, ⁇ -naphthylmethyl group, ⁇ -naphthylmethyl group, diphenylmethyl group, triphenylmethyl group, ⁇ -naphthyldiphenylmethyl group, 9-an thrylmethyl group and the like.
  • a methyl group substituted with 1 to 3 aryl groups whose aryl ring is substituted with a lower alkyl group, a lower alkoxy group, a halogen atom or a cyano group includes a 4-methylbenzyl group, a 2,4,6- trimethylbenzyl group, 3,4,5-trimethylbenzyl group, 4-methoxybenzyl group, 4-methoxyphenyldiphenylmethyl group, 4,4'-dimethoxytriphenylmethyl group, 2-nitrobenzyl group, 4-nitrobenzyl group , 4-chlorobenzyl group, 4-bromobenzyl group, 4-cyanobenzyl group and the like.
  • lower alkoxycarbonyl groups include methoxycarbonyl, ethoxycarbonyl, t-butoxycarbonyl and isobutoxycarbonyl groups.
  • the "aryl group substituted with a halogen atom, a lower alkoxy group or a nitro group” includes a 4-chlorophenyl group, a 2-fluorophenyl group, a 4-methoxyphenyl group, a 4-nitrophenyl group and a 2,4-dinitrophenyl group. etc.
  • lower alkoxycarbonyl group substituted with a halogen atom or a tri-lower alkylsilyl group includes a 2,2,2-trichloroethoxycarbonyl group and a 2-trimethylsilylethoxycarbonyl group.
  • alkenyloxycarbonyl groups include vinyloxycarbonyl groups and aryloxycarbonyl groups.
  • the "aralkyloxycarbonyl group optionally substituted on the aryl ring with a lower alkoxy or nitro group” includes a benzyloxycarbonyl group, a 4-methoxybenzyloxycarbonyl group, a 3,4-dimethoxybenzyloxycarbonyl group, a 2-nitro benzyloxycarbonyl group, 4-nitrobenzyloxycarbonyl group and the like.
  • the "hydroxyl-protecting group for nucleic acid synthesis” includes, for example, an aliphatic acyl group, an aromatic acyl group, a methyl group substituted with 1 to 3 aryl groups, "lower alkyl, lower alkoxy, halogen, a methyl group substituted with 1 to 3 aryl groups whose aryl ring is substituted with a cyano group, and a silyl group.
  • the "hydroxyl protecting group for nucleic acid synthesis” includes, for example, an acetyl group, a benzoyl group, a benzyl group, a p-methoxybenzoyl group, a dimethoxytrityl group, a monomethoxytrityl group, and a tert-butyldiphenylsilyl group.
  • the protecting group for "a hydroxyl group protected by a protecting group for nucleic acid synthesis” includes, for example, an aliphatic acyl group, an aromatic acyl group, and a "methyl group substituted with 1 to 3 aryl groups”. , “an aryl group substituted with a halogen atom, a lower alkoxy group or a nitro group”, a lower alkyl group, and a lower alkenyl group.
  • protective groups for "hydroxyl group protected by protective group for nucleic acid synthesis” include, for example, benzoyl group, benzyl group, 2-chlorophenyl group, 4-chlorophenyl group, and 2-propenyl group. be done.
  • the "amino group-protecting group for nucleic acid synthesis” includes, for example, an acyl group, preferably a benzoyl group.
  • the "protecting group" of "a phosphate group protected by a protecting group for nucleic acid synthesis” includes, for example, a lower alkyl group, a lower alkyl group substituted with a cyano group, an aralkyl group, a "nitro group or An aralkyl group in which an aryl ring is substituted with a halogen atom", and an "aryl group in which a lower alkyl group, a halogen atom or a nitro group is substituted”.
  • the "protecting group" of "a phosphate group protected with a protecting group for nucleic acid synthesis” includes, for example, 2-cyanoethyl group, 2,2,2-trichloroethyl group, benzyl group, 2 -chlorophenyl group, and 4-chlorophenyl group.
  • the "protecting group" of the "mercapto group protected by a protecting group for nucleic acid synthesis” includes, for example, an aliphatic acyl group and an aromatic acyl group, preferably a benzoyl group.
  • salts refers to a salt for a specific compound.
  • Such salts include, for example, alkali metal salts such as sodium salts, potassium salts and lithium salts, alkaline earth metal salts such as calcium salts and magnesium salts, aluminum salts, iron salts, zinc salts, copper salts, Metal salts such as nickel salts and cobalt salts; inorganic salts such as ammonium salts, t-octylamine salts, dibenzylamine salts, morpholine salts, glucosamine salts, phenylglycine alkyl ester salts, ethylenediamine salts, N-methylglucamine salts , guanidine salt, diethylamine salt, triethylamine salt, dicyclohexylamine salt, N,N'-dibenzylethylenediamine salt, chloroprocaine salt, procaine salt, diethanolamine salt, N-benzyl-phenethy
  • the term “pharmaceutically acceptable cation” means that when the conjugate of the present invention is used, for example, for pharmaceutical purposes, the purpose of such purposes may be wholly or partially inhibited. and includes, for example, hydrogen ions, sodium ions, potassium ions, animonium ions, and the like.
  • the term "pharmaceutically acceptable anion” means an anion that may wholly or partially inhibit the purpose of the use of the conjugate of the present invention, for example, for pharmaceutical use.
  • Anion includes, for example, chloride ion, bromide ion, hydroxide ion, acetate ion, carbonate ion, phosphate ion, and the like.
  • nucleoside includes “nucleosides” in which a purine or pyrimidine base and a sugar are attached, as well as aromatic heterocycles and aromatic hydrocarbon rings other than purines and pyrimidines that substitute for a purine or pyrimidine base. Includes “nucleosides” that are possible and sugar-linked. Natural nucleosides are also called “natural nucleosides”. Modified non-natural nucleosides are also referred to as “modified nucleosides”, and nucleotides with modified sugar moieties are particularly referred to as “sugar-modified nucleosides”. "Nucleotide” means a compound in which a phosphate group is attached to the sugar of a nucleoside. “Nucleoside” and “nucleotide” include those of DNA and RNA, respectively.
  • oligonucleotide refers to a polymer of “nucleotides” in which from 2 to 50 identical or different “nucleosides” are linked by phosphodiester or other linkages, naturally occurring and non-naturally occurring. Including those of type.
  • the non-natural "oligonucleotide” preferably includes a sugar derivative with a modified sugar moiety; a thioate derivative with a thioated phosphodiester moiety; an ester with an esterified terminal phosphate moiety; Examples include amides in which the amino group on the base is amidated, and more preferably sugar derivatives in which the sugar moiety is modified.
  • An "oligonucleotide” may be composed of natural or modified nucleosides, or may be a mixture of natural and modified nucleosides.
  • the linkages between sugars (internucleoside linkages) in oligonucleotides may be phosphodiester (D-oligo) linkages that are found in natural nucleic acids, or artificially modified linkages (for example, phosphorothioate (S- oligo), methylphosphonate (M-oligo), boranophosphonate, etc.). Any linkage known in the art can be used.
  • S-oligo(phosphorothioates) have a PS backbone in which the oxygen atoms in the phosphate groups of the internucleoside phosphodiester linkages are replaced by sulfur atoms. This modification is incorporated into the oligonucleotide according to known methods.
  • An antisense oligonucleotide (ASO) having one or more such modifications in the oligonucleotide is also called an S-oligo type (phosphorothioate type). All of the bonds in the oligonucleotide may be the same or may contain different bonds.
  • oligonucleotides in the present invention comprise D-oligos and/or S-oligos.
  • Nucleotide modifications known in the art are also available.
  • Sugar modification and nucleobase modification are known as modifications of nucleotides.
  • Such nucleic acid modifications can be performed based on methods known in the art.
  • Nucleobase modifications include, for example, 5-methylcytosine, 5-hydroxymethylcytosine, 5-propynylcytosine and the like.
  • Sugar modifications include, for example, substitutions at the 2' position of the sugar and bridging structures between the 4' and 2' positions of the sugar.
  • Substitutions at the 2' site of the sugar include, for example, 2'-F, 2'-OCH 3 (2'-OMe), 2'-OCH 2 CH 2 OCH 3 (2'-MOE) and the like.
  • the crosslinked structure between the 4'-position and 2'-position of the sugar will be described later.
  • conjugates of the invention have the following formula (I):
  • Lk is the linker moiety
  • NCA is the nucleic acid moiety
  • Lg is the ligand moiety
  • Lg ligand moiety
  • ligand moiety is a group belonging to any one of Groups A to E below.
  • Lg in formula (I) is a group belonging to group A
  • Lg is represented by the following formula (II):
  • R 10 is an oxygen atom, a sulfur atom, —NH—, or —C(O)—
  • R 11 is a phenyl group optionally substituted with at least one group selected from the group consisting of a cyano group, a nitro group, and a halogen atom, or a heteroaryl group having 4 to 20 carbon atoms), and Less than:
  • a heteroaryl group optionally substituted with at least one group selected from the group consisting of; or; (iv) at least 1 to 3 carbon atoms in the ring may be substituted with at least one atom or group selected from the group consisting of an oxygen atom, a nitrogen atom and -NH-, having 8 to 8 carbon atoms; 15 polycyclic groups, an optionally branched alkyl group having 1 to 3 carbon atoms, an optionally branched alkoxy group having 1 to 3 carbon atoms, halogen atom, a benz
  • Examples of Lg belonging to Group A include the following:
  • Lg is a group belonging to Group A because it has the property of being able to transfer the nucleic acid moiety (NCA) to a specific organ or tissue more effectively.
  • NCA nucleic acid moiety
  • Lg of formula (I) is a group belonging to group B
  • Lg is represented by the following formula (IV):
  • Lg of formula (I) is a group belonging to group C
  • Lg is represented by the following formula (V):
  • Examples of Lg belonging to group C include the following:
  • Lg of formula (I) is a group belonging to group D
  • Lg is represented by the following formula (VI):
  • R 18 , R 19 , R 20 and R 21 are each independently a halogen atom, an optionally branched C 1 to 3 an alkyl group or a methoxy group, R22 is a hydrogen atom, a methyl group, or an ethyl group, and q is 0 or 1) is a group represented by the following formula (VI'):
  • R 18 , R 19 , R 20 and R 21 each independently represent a halogen atom, optionally branched carbon atoms of 1 to 3 is an alkyl group, or a methoxy group, and R 22 is a hydrogen atom, a methyl group, or an ethyl group) is a group represented by Lg is a group belonging to group D because it has the property of being able to transfer the nucleic acid moiety (NCA) to a specific organ or tissue more effectively.
  • NCA nucleic acid moiety
  • Lg of formula (I) is a group belonging to group E
  • Lg is represented by the following formula (VII):
  • the ligand moieties (Lg) are, for example, carboxylic acid-based ligand moieties (e.g., groups A and B) and amine azide-based ligand moieties (e.g., groups C, D and E group).
  • the carboxylic acid-based ligand moiety is a group derived from a ligand compound having a carboxy group (--COOH) in its structure
  • the amine/azide-based ligand moiety has an amino group (--NH 2 ) and a hydroxyl group (--OH) in its structure.
  • the ligand portion (Lg) is bound to the nucleic acid portion (NCA) via the linker portion (Lk).
  • Lk (linker part) In the conjugate of the present invention, Lk (linker moiety) is, for example, the following:
  • Lg in formula (I) above is a group belonging to group A or group B
  • Lk may contain a structure represented by formula (VIIIa) above.
  • Lg of formula (I) above is a group belonging to Group C, Group D, or Group E
  • Lk contains a structure represented by formula (VIIIb) above. good too.
  • Lk has the following formula (IX):
  • X ii + is a pharmaceutically acceptable cation
  • R 24 is a hydroxyl group or a graft group
  • graft group as used herein means a part of the divalent group constituting R 23 in the linker portion (Lk), or a chain organic group extending from R 24 itself, wherein the linker portion is a group for grafting the main chain that constitutes the
  • graft groups include
  • * is a bond; at least one carbon atom constituting the main chain of R 45 may be substituted with an oxygen atom or —CO—NH—, —(CH 2 ) b —[formula wherein b is an integer from 4 to 40]; X iii + is a pharmaceutically acceptable cation; Lg 1 is the same as the ligand moiety (Lg) above ).
  • linker portion (Lk) is not necessarily limited, but includes, for example, those having the structure shown below as a whole:
  • the NCA (nucleic acid portion)
  • the NCA may be any molecule as long as it is composed of nucleic acid, and is, for example, an oligonucleotide.
  • the NCA may be an oligonucleotide that is desired to be delivered to the target organ and function. Oligonucleotides include, for example, those that suppress target gene expression and those that regulate target gene expression.
  • oligonucleotides include nucleic acid drugs.
  • Oligonucleotides can be either single-stranded or double-stranded and include, for example, siRNA, miRNA, antisense oligonucleotides (ASO).
  • An antisense oligonucleotide may form a double-stranded oligonucleotide with a sequence capable of binding to a target sequence.
  • An oligonucleotide is, for example, an 8- to 50-base oligonucleotide consisting of a sequence capable of binding to a target sequence in a target gene.
  • the length of the oligonucleotide is, for example, 8 bases or more, 9 bases or more, 10 bases or more, 11 bases or more, 12 bases or more, 13 bases or more, 14 bases or more, or 15 bases or more, and 50 bases or less, or 40 bases. 30 bases or less, 25 bases or less, or 20 bases or less.
  • the second strand consists of a sequence capable of binding to the oligonucleotide, which is the first strand consisting of a sequence capable of binding to the target sequence in the target gene. is an oligonucleotide.
  • the second strand is, for example, 8-60 bases, 8 bases or more, 9 bases or more, 10 bases or more, 11 bases or more, 12 bases or more, 13 bases or more, 14 bases or more, or 15 bases or more, and 60 No more than 50 bases, No more than 40 bases, No more than 30 bases, No more than 25 bases, or No more than 20 bases.
  • the length of the second strand may be the same length as the first strand, or one or several bases shorter than the first strand as long as it binds to the first strand, or The length of the second strand may be longer than the first strand by adding one or several bases on one or both sides of the site that binds the first strand.
  • "one or several bases” means 1 to 10, 1 to 5, 1 to 3, and 1 or 2 bases.
  • the preferred length of the second strand depends on the length of the first strand. For example, the length of the first strand is 50% or more, 60% or more, 70% or more, 50-100%, 60-100%, 70 ⁇ 100% length.
  • An oligonucleotide “binds” to a target sequence refers to the ability of different single-stranded oligonucleotides or nucleic acids to form two or more strands of nucleic acid due to nucleobase complementarity. Preferably, it refers to the ability to form a double-stranded nucleic acid.
  • the melting temperature (T m ) of a double-stranded or higher-stranded nucleic acid which is an index of thermal stability of binding, is not particularly limited.
  • the melting temperature (T m ) of a double-stranded nucleic acid can be determined, for example, as follows: Equimolar mixture of oligonucleotide and target RNA in buffer (8.1 mM Na 2 HPO 4 , 2.68 mM KCl, 1.47 mM KH 2 PO 4 , and pH 7.2) and incubated at 95° C. After heating for 5 minutes at room temperature, it is slowly cooled to room temperature and annealed to form a double-stranded nucleic acid. The change in absorbance (A) at 260 nm with temperature (T) was measured when the double-stranded nucleic acid was heated from 20°C to 95°C at a heating rate of 0.5°C/min.
  • a graph of dA/dT vs. T is prepared, and the temperature at which the value of dA/dT in this graph becomes the largest, that is, the temperature at which the change in A due to T is the largest is taken as the Tm of the double-stranded nucleic acid.
  • the melting temperature (T m ) is, for example, 40° C. or higher, preferably 50° C. or higher.
  • complementary means that two different single-stranded oligonucleotides or nucleic acids are in a pairing relationship that allows them to form a double-stranded nucleic acid.
  • the base sequences of the double-strand forming regions have complete complementarity, but as long as they can form the double-stranded nucleic acid and exhibit the desired function (e.g., suppression or regulation of expression), one or may have several mismatches.
  • One or several mismatches means 1 to 4, preferably 1 to 3, more preferably 1 or 2 mismatches, depending on the length of the oligonucleotide.
  • the oligonucleotide of the present invention is preferably 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more of the base sequence of the region forming the double strand or complete (100%) complementarity.
  • Oligonucleotides include both oligonucleotides containing natural DNA (unmodified oligonucleotides) and oligonucleotides containing chemically modified DNA. Such modifications may alter the activity of the oligonucleotide, eg, increase its affinity for a target nucleic acid, or increase its resistance to nucleases. Increasing the affinity of the oligonucleotide for its target allows the use of shorter oligonucleotides.
  • the oligonucleotide may contain at least one sugar-modified nucleoside at any position.
  • the sugar-modified nucleoside has a bridging moiety between the 2' and 4' positions of the sugar ring, eg, as described below.
  • the oligonucleotide of the present invention contains at least one nucleoside structure represented by the following formula (X) as a sugar-modified nucleoside:
  • BASE is a purin-9-yl group optionally having one or more substituents selected from the ⁇ group, or optionally having one or more substituents selected from the ⁇ group 2 - represents an oxo-1,2-dihydropyrimidin-1-yl group
  • the ⁇ group is a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, or a protecting group for nucleic acid synthesis.
  • a mercapto group a straight-chain alkylthio group having 1 to 6 carbon atoms, an amino group, a straight-chain alkylamino group having 1 to 6 carbon atoms, an amino group protected by a protecting group for nucleic acid synthesis, and a halogen atom,
  • A is the following:
  • R 25 is a divalent group represented by R 25 is selected from a hydrogen atom, an optionally branched or ring-forming alkyl group having 1 to 7 carbon atoms, an optionally branched or ring-forming alkenyl group having 2 to 7 carbon atoms, and the ⁇ group an aryl group having 3 to 12 carbon atoms which may have one or more optional substituents and may contain a heteroatom, and one or more optional substituents selected from the ⁇ group represents an aralkyl group having an aryl moiety of 3 to 12 carbon atoms which may optionally contain a heteroatom, or an amino group-protecting group for nucleic acid synthesis, R 26 and R 27 are each independently a hydrogen atom; optionally substituted with an aryl group having 3 to 12 carbon atoms which may contain a heteroatom, and optionally branched or forming a ring an alkyl group having 1 to 7 carbon atoms; or an aralkyl group having an aryl moiety having 3 to
  • R 39 , R 40 and R 41 each independently form a hydrogen atom, a branch or a ring an alkyl group having 1 to 7 carbon atoms, an amino group-protecting group, or
  • R 35 and R 36 each independently represents a hydrogen atom; a hydroxyl group; an alkyl group having 1 to 7 carbon atoms which may be branched or forming a ring; A group selected from the group consisting of an alkoxy group of 7; an amino group; and an amino group protected by a protecting group for nucleic acid synthesis; m is an integer from 0 to 2; n is an integer from 0 to 1; R 34 is a hydrogen atom, an optionally branched or ring-forming alkyl group having 1 to 7 carbon atoms, an amino-protecting group, or
  • R 29 and R 30 are each independently a hydrogen atom, an optionally branched or ring-forming alkyl group having 1 to 7 carbon atoms, or an amino group-protecting group. ,or
  • X is an oxygen atom, a sulfur atom, or an amino group;
  • Y is an oxygen atom or a sulfur atom, Z- is a pharmaceutically acceptable anion).
  • BASE is, for example, a purine base (ie purine-9-yl group) or a pyrimidine base (ie 2-oxo-1,2-dihydropyrimidin-1-yl group).
  • bases include a hydroxyl group, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, and a 6 linear alkylamino groups and one or more optional substituents selected from the ⁇ group consisting of halogen atoms.
  • BASE include an adenynyl group, a guanynyl group, a cytosinyl group, a uracinyl group, a thyminyl group, a 6-aminopurin-9-yl group, a 2,6-diaminopurin-9-yl group, a 2 -amino-6-chloropurin-9-yl group, 2-amino-6-fluoropurin-9-yl group, 2-amino-6-bromopurin-9-yl group, 2-amino-6-hydroxypurine- 9-yl group, 6-amino-2-methoxypurin-9-yl group, 6-amino-2-chloropurin-9-yl group, 6-amino-2-fluoropurin-9-yl group, 2,6 -dimethoxypurin-9-yl group, 2,6-dichloropurin-9-yl group, 6-mercaptopurin-9-yl
  • BASE is preferably one in which the hydroxyl group and amino group constituting the above group are protected by a protecting group during oligonucleotide synthesis.
  • Oligonucleotides in the present invention can be synthesized by conventional methods using sugar-modified nucleosides and natural nucleosides as described above. can be easily synthesized by manufacturing, etc.). Synthetic methods include a solid-phase synthesis method using phosphoramidite, a solid-phase synthesis method using hydrogenphosphonate, and the like. For example, disclosed in Tetrahedron Letters, 1981, vol.
  • the ligand portion is a linker at at least one of the 3′ end and the 5′ end of the oligonucleotide. It can be connected via parts.
  • the oligonucleotide in the conjugate of the invention is a double-stranded oligonucleotide
  • the ligand moiety is attached to the second strand via a linker moiety. More preferably, a linker moiety is attached to the 3' and/or 5' end of the second strand.
  • the 3' end or 5' end of the oligonucleotide to which the ligand portion is not bound via the linker portion may be further modified.
  • Modifications known in the art can be utilized to allow tracking of oligonucleotides, improve oligonucleotide pharmacokinetics or pharmacodynamics, or improve oligonucleotide stability or binding affinity.
  • Groups that can be used for such modification include, for example, hydroxyl-protecting groups, reporter molecules, cholesterol, phospholipids, dyes, and fluorescent molecules.
  • the 3'-end or 5'-end of the oligonucleotide to which the ligand moiety is not bound via the linker moiety may contain a phosphate ester moiety.
  • phosphate moiety herein is meant a terminal phosphate group, including phosphate esters as well as modified phosphate esters.
  • the phosphate ester moiety can be located at either terminus, but is preferably the 5' terminal nucleoside.
  • Synthesis of the conjugate of the present invention is carried out, for example, during the automatic synthesis of a nucleic acid moiety (eg, oligonucleotide) on a solid phase in advance, in addition to a nucleic acid molecule capable of constituting an oligonucleotide as its material, a linker moiety is constructed.
  • the linker moiety can be pre-attached to the nucleic acid moiety by adding a compound that binds.
  • nucleic acid portion having a linker portion By allowing a ligand compound to act on the thus obtained nucleic acid portion having a linker portion (hereinafter also referred to as a nucleic acid portion with a linker), the ligand portion and the nucleic acid portion were integrated via the linker portion. Conjugates can be synthesized.
  • the linker-attached nucleic acid portion when the linker-attached nucleic acid portion has an amino group at the end of the linker portion, the linker-attached nucleic acid portion can act with a ligand compound having a carboxy group (--COOH) to obtain a conjugate.
  • a ligand compound having a carboxy group --COOH
  • the ligand compound having a carboxy group is not necessarily limited, but includes, for example, the following compounds that can constitute the ligand portion of the above Groups A and B.
  • Boc represents a butoxycarbonyl group and Cbz represents a benzyloxycarbonyl group.
  • the nucleic acid moiety with linker acts with a ligand compound having an amino group (—NH 2 ), hydroxyl group (—OH) or azide group (—N 3 ). to obtain the conjugate.
  • the ligand compound having an amino group, a hydroxyl group, or an azide group is not necessarily limited, but includes, for example, the following compounds that can constitute the ligand portion of the C group, D group and E group.
  • the linker-attached nucleic acid portion and the ligand compound having a carboxy group are, for example, the conjugate of the present invention through an amidation reaction known to those skilled in the art. can be synthesized.
  • the nucleic acid portion with linker has a BCN linker at the end of the linker portion of the nucleic acid portion with linker
  • the nucleic acid portion with linker and the ligand compound having an amino group, a hydroxyl group, or an azide group are separated from each other by the click reaction known to those skilled in the art. can be synthesized.
  • the nucleic acid portion can be translocated to a specific organ to exhibit the function of the nucleic acid portion.
  • the conjugate of the present invention is useful for delivering nucleic acid drugs to organs or tissues such as skin, pancreas, heart, and skeletal muscle. This makes it possible to treat or prevent diseases in the organ or tissue.
  • composition of the present invention contains the above conjugate.
  • the administration method and dosage form of the pharmaceutical composition of the present invention are not particularly limited, and administration methods and dosage forms known in the art can be used.
  • composition of the present invention can be administered locally or systemically or by various methods depending on the area to be treated.
  • Methods of administration may be, for example, topical (including, for example, eye drops, intravaginal, intrarectal, intranasal and transdermal), oral, or parenteral.
  • Parenteral administration includes intravenous injection or infusion, subcutaneous, intraperitoneal or intramuscular injection, pulmonary administration through the respiratory tract by inhalation or inhalation, and the like.
  • dosage forms such as transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders can be adopted.
  • compositions for oral administration include powders, granules, suspensions or solutions dissolved in water or non-aqueous media, capsules, powders, tablets and the like.
  • compositions for parenteral administration include sterile aqueous solutions containing buffers, diluents and other suitable additives.
  • the pharmaceutical composition of the present invention contains an effective amount of the "nucleic acid moiety" in the conjugate and various pharmaceutical agents such as excipients, binders, wetting agents, disintegrants, lubricants, and diluents suitable for the dosage form. It can be obtained by mixing additives for use as necessary. In the case of an injection, it can be prepared by sterilizing it together with an appropriate carrier.
  • various pharmaceutical agents such as excipients, binders, wetting agents, disintegrants, lubricants, and diluents suitable for the dosage form. It can be obtained by mixing additives for use as necessary. In the case of an injection, it can be prepared by sterilizing it together with an appropriate carrier.
  • Individuals to be administered are preferably mammals, more preferably pets such as humans, monkeys, dogs and cats, livestock animals such as cows and pigs, and even more preferably humans.
  • the effective dose depends on the individual to be administered, but can be arbitrarily determined according to the individual's type, sex, age, body weight, symptoms, etc., as well as the administration method, route, frequency, and the like.
  • the antisense oligonucleotide (ASO) against the mouse Malat1 gene (NR_002847.3) used was commissioned to Genedesign Inc. and prepared.
  • ASO mMALAT1-cEt/LNA(16)
  • mMALAT1-cEt/LNA(16) is at position 1317 at the 5' end of the complementary mouse Malat1 sequence (NR_002847.3).
  • the preparation of the linker-attached ASO was also entrusted to Gene Design Co., Ltd.
  • the ASO for the mouse Malat1 gene (NR_002847.3) was extended by coupling MMT-hexylaminophosphoramidite.
  • the above linker-attached ASO was prepared by solid-phase nucleic acid synthesis.
  • the ASO for the mouse Malat1 gene (NR_002847.3) was extended by coupling the triethylene glycol phosphoramidite with the following BCN-amidites:
  • FIG. 4(B) A chromatogram of reversed-phase HPLC is shown in FIG. 4(B).
  • the results of ESI-TOF-MS were a calculated value [MH] ⁇ : 7345.2 and a measured value [MH] ⁇ : 7340.4.
  • Example 1 Synthesis of conjugate ASO1 containing a carboxylic acid ligand
  • a conjugate with the linker-attached ASO (1) obtained in Preparation Example 1 was synthesized using a ligand compound having a carboxyl group.
  • Example 2 Synthesis of conjugate ASO2 containing a carboxylic acid ligand
  • a conjugate of the ligand and ASO was synthesized in the same manner as in Example 1, except that the following compound (2.5 mg, 10 ⁇ mol) was used as the ligand compound (conjugate ASO2 (Fig. 1): yield 180 nmol, 54% yield).
  • a reversed-phase HPLC chromatogram is shown in FIG. 5(B).
  • the results of MALDI-TOF-MS were a calculated value [MH] ⁇ : 5704.5 and a measured value [MH] ⁇ : 5708.1.
  • Example 3 Synthesis of conjugate ASO3 containing a carboxylic acid ligand
  • a conjugate of the ligand and ASO was synthesized in the same manner as in Example 1, except that the following compound (1.8 mg, 10 ⁇ mol) was used as the ligand compound (conjugate ASO3 (Fig. 2): yield 159 nmol, 53% yield).
  • a reversed-phase HPLC chromatogram is shown in FIG. 5(C).
  • the results of MALDI-TOF-MS were a calculated value [MH] ⁇ : 5630.6 and a measured value [MH] ⁇ : 5634.9.
  • Example 4 Synthesis of conjugate ASO4 containing a carboxylic acid ligand
  • a conjugate of the ligand and ASO was synthesized in the same manner as in Example 1, except that the following compound (3.9 mg, 10 ⁇ mol) was used as the ligand compound (conjugate ASO4 (Fig. 2): yield 195 nmol, 65% yield).
  • a chromatogram of reversed-phase HPLC is shown in FIG. 6(A).
  • the results of MALDI-TOF-MS were a calculated value [MH] ⁇ : 5842.3 and a measured value [MH] ⁇ : 5864.3.
  • Example 5 Synthesis of conjugate ASO5 containing a carboxylic acid ligand
  • a conjugate of the ligand and ASO was synthesized in the same manner as in Example 1, except that the following compound (1.2 mg, 10 ⁇ mol) was used as the ligand compound (conjugate ASO5 (Fig. 3): yield 93 nmol, yield 31%)).
  • a chromatogram of reversed-phase HPLC is shown in FIG. 6(B).
  • the results of MALDI-TOF-MS were a calculated value [MH] ⁇ : 5576.5 and an actual value [MH] ⁇ : 5585.6.
  • Triethylamine (10 ⁇ L, 72 ⁇ mol) and a toluene solution of the acid chloride obtained above (100 ⁇ mol) were sequentially added to a 0.1 M DMF solution of Cobimetinib (5.3 mg, 10 ⁇ mol), and stirred at room temperature for 1 hour.
  • the progress of the reaction was confirmed by HPLC (HPLC, yield 90%).
  • HPLC HPLC, yield 90%
  • the organic layer was washed with saturated multistory water three times and dried over sodium sulfate.
  • the resulting crude product was purified by reverse phase column chromatography (C 18 , 40-90% methanol in 0.1 M TEAA) to give cobimetinib-N 3 derivative.
  • Table 1 shows the physical property data of the resulting cobimetinib - N3 derivative.
  • the conjugated ASO was dissolved in distilled water (180 ⁇ L), 3M sodium acetate aqueous solution (20 ⁇ L) and ethanol (800 ⁇ L) were added, left to stand at ⁇ 20° C. for 2 hours, and then 20. 000 ⁇ g at 4° C. for 15 minutes, the supernatant was removed, the pellet was rinsed with 80 (v/v)% ethanol (10 ⁇ L) and dried.
  • conjugate ASO1 (2197-ASO: FIG. 1) was administered to mice according to the procedure shown below, and the expression level of the target gene Malat1 in each organ 72 hours after administration was measured. Analyzed by real-time PCR method.
  • mice (Balb/c, female, 5 weeks old, 7 mice) were purchased from Japan SLC Co., Ltd. and brought into the animal experiment facility. After an acclimation period of at least 5-7 days for the mice, a single injection of conjugated ASO1 in saline solution at 33, 100, 300, 1000 ⁇ g per mouse was administered via the tail vein.
  • conjugated ASO1 in saline solution at 33, 100, 300, 1000 ⁇ g per mouse was administered via the tail vein.
  • non-conjugated ASO (ASO with no ligand or linker bound: “naked ASO”) was administered to each individual mouse in a physiological saline solution of 1000 ⁇ g once through the tail vein. Negative control was physiological saline.
  • mice 72 hours after ASO administration, the mice were anesthetized by intraperitoneal administration of a three-kind mixed anesthetic (medetomidine, midazolam, butorphanol). Collect the pieces and place them in 2 mL tubes of 96-well Collection Microtubes (Qiagen) in which 500 ⁇ L/tube of RNAprotect Tissue Reagent (Thermo) has been dispensed in advance, and store the organ pieces immersed in the reagent (-30°C )did.
  • a three-kind mixed anesthetic medetomidine, midazolam, butorphanol.
  • RNA preparation kits total RNA preparation, reverse transcription and real-time PCR
  • MagMAX mirVana Total RNA Isolation Kit (Thermo; hereinafter referred to as mirVana kit) was used for total RNA extraction from the collected organs. Centrifuge the 96-well Collection Microtubes storing the organs (1000 ⁇ g, 3 minutes, 4°C) to remove the RNAprotect Tissue Reagent, then add the lysis buffer (0.7% 2-mercapto Ethanol added) and 1 stainless steel bead (5 mm diameter, QIAGEN) are added to each tube of Collection Microtubes, and homogenized at room temperature at 30 Hz for 2 minutes with TissueLyser II (QIAGEN) for 5 times or more to prepare an organ homogenate. did.
  • RNA samples were prepared according to the mirVana kit protocol, and the process was automated by KingFisher Flex (Thermo). Nucleic acid concentration of each RNA sample was determined by Quant-iT RiboGreen RNA Assay Kit (Thermo). A reverse transcription product was prepared from about 10 ng of total RNA using High-Capacity cDNA Reverse Transcription Kit (Thermo). The reaction followed the protocol of the kit. Real-time PCR was performed for each reverse transcript using PowerUp SYBR Green Master Mix (Thermo). Gapdh was the internal control for PCR and 18S rRNA was used for lung samples.
  • the PCR reaction was performed by StepOnePlus real-time PCR system (Thermo), heat treatment at 95°C for 20 seconds, followed by 45 cycles of heat denaturation at 95°C for 3 seconds and extension reaction at 60°C for 30 seconds.
  • Malat1 expression level was analyzed by comparing Ct values obtained from amplification curves of Malat1 and Gapdh ( ⁇ Ct method).
  • mMalat1_F4 ACATTCCTTGAGGTCGGCAA (SEQ ID NO: 2)
  • mMalat1_R4 CACCCGCAAAGGCCTACATA (SEQ ID NO: 3)
  • mGapdh_F3 TCACCACCATGGAGAAGGC (SEQ ID NO: 4)
  • mGapdh_R3 GCTAAGCAGTTGGTGGTGCA (SEQ ID NO: 5)
  • m18S rRNA_F1 GTAACCCGTTGAACCCCATT (SEQ ID NO: 6)
  • m18S rRNA_R1 CCATCCAATCGGTAGTAGCG (SEQ ID NO: 7)
  • the analyzed organs were liver, kidney, brain, skeletal muscle, pancreas, lung, stomach and skin (8 organs in total). These results are shown in FIGS. 7 and 8.
  • FIG. In all analyzed organs except the brain (liver, kidney, skeletal muscle, skin, pancreas, lung and stomach), suppression of expression according to the dose of conjugate ASO1 (2197-ASO) was observed, and in the high dose group A significant difference from the saline-administered group was observed (significance levels of 1% and 5%). Of these, knockdown in the pancreas and skin of the 1000 ⁇ g/individual administration group significantly suppressed the inhibitory effect exhibited by naked ASO at the same dose by about 50% (significance level 5%).
  • Example 8 In vivo activity evaluation of conjugated ASO2
  • Conjugate ASO2 (444-ASO: FIG. 1) was administered to mice in the same manner as in Example 7, and the expression level of the target gene Malat1 in each organ 72 hours after administration was analyzed by real-time PCR.
  • the analyzed organs were the liver, kidney, heart, skeletal muscle, and skin (5 organs in total). These results are shown in FIG. Significant dose-dependent suppression of conjugated ASO2 (444-ASO) expression was observed in liver, kidney, heart and skeletal muscle (significance levels 1% and 5%). Of these, knockdown in the heart of the 1000 ⁇ g/individual administration group significantly suppressed the inhibitory effect exhibited by naked ASO at the same dose by about 45% (significance level 5%).
  • Example 9 In vivo activity evaluation of conjugated ASO3
  • Conjugate ASO3 (2270-ASO: FIG. 2) was administered to mice in the same manner as in Example 7, and the expression level of the target gene Malat1 in each organ 72 hours after administration was analyzed by real-time PCR. However, control naked ASO was administered at 100 and 1000 ⁇ g per mouse.
  • the analyzed organs were liver, kidney, large intestine, skeletal muscle, mammary gland, spleen, heart, lung, stomach and brain (10 organs in total). These results are shown in FIGS. 10 and 11.
  • FIG. 10 In all analyzed organs except the brain, suppression of expression according to the dose of conjugate ASO3 (2270-ASO) was observed, and a significant difference was observed in the high-dose group compared to the saline-administered group (significance level 1 %).
  • the antisense effect in the heart and skeletal muscle of the 100 ⁇ g/individual administration group significantly suppressed the inhibitory effect exhibited by naked ASO at the same dose by about 50% (significance level 1%).
  • Conjugate ASO4 (2168-ASO: FIG. 2) was administered to mice in the same manner as in Example 7, and the expression level of the target gene Malat1 in each organ 72 hours after administration was analyzed by real-time PCR.
  • the analyzed organs were the liver, kidney, brain, skeletal muscle, and skin (5 organs in total). These results are shown in FIG. Significant dose-dependent suppression of conjugated ASO4 (2168-ASO) expression was observed in liver, kidney and skeletal muscle (significance levels of 1% and 5%). Of these, the antisense effect in skeletal muscle of the 1000 ⁇ g/individual administration group significantly suppressed the effect exhibited by naked ASO at the same dose by about 40% (significance level 5%).
  • Example 11 In vivo activity evaluation of conjugated ASO5
  • Conjugate ASO5 (1204-ASO: FIG. 3) was administered to mice in the same manner as in Example 7, and the expression level of the target gene Malat1 in each organ 72 hours after administration was analyzed by real-time PCR.
  • the analyzed organs were the liver, kidney, heart, skeletal muscle, and skin (5 organs in total). These results are shown in FIG. In these organs, dose-dependent suppression of conjugated ASO5 (1204-ASO) expression was observed, and a significant difference was observed in the high-dose group compared to the saline-administered group (significance level 1%). Of these, the antisense effect in the heart and skeletal muscle of the 1000 ⁇ g/individual administration group significantly suppressed the inhibitory effect exhibited by naked ASO at the same dose by about 50% (significance level 5%).
  • Example 12 In vivo activity evaluation of conjugated ASO6
  • Conjugate ASO6 (2009-ASO: FIG. 3) was administered to mice in the same manner as in Example 8, and the expression level of the target gene Malat1 in each organ 72 hours after administration was analyzed by real-time PCR.
  • high-dose 1000 ⁇ g/individual mice
  • appearance changes such as piloerection and skin redness, enlarged liver and spleen evident at necropsy, wasting of adipose tissue, and yellowing of serum were observed.
  • doses of conjugated ASO were such that ASO was 0, 10, 30, 100 ⁇ g per mouse, control naked ASO was 100 per mouse, Dosed at 1000 ⁇ g.
  • conjugated ASO6 (2009-ASO) did not observe the aforementioned findings at doses of 10-100 ⁇ g/individual.
  • a dose-dependent antisense effect of conjugated ASO6 (2009-ASO) was observed in liver, pancreas, heart and skin.
  • administration of 100 ⁇ g/individual of conjugated ASO6 (2009-ASO) showed a significantly higher antisense effect than that of naked ASO at the same dose (significance levels of 1% and 5% ).
  • ASO-2 (mMalat1-4019-LNA(16)) used in this example is shown below. This ASO is at position 4019 at the 5' end of the complementary mouse Malat1 sequence (NR_002847.3).
  • mMalat1-4019-LNA(16) G(L)A(L)A(L)agcccat5ggT(L)G(L)5(L) (SEQ ID NO: 8) (This oligonucleotide has a PS backbone over its entire length)
  • the knockdown in the pancreas and skin of the 1000 ⁇ g/individual administration group significantly suppressed the suppressive effect exhibited by naked ASO-2 at the same dose by about 60% (1% significance level);
  • the analyzed organs were liver, kidney, heart, skeletal muscle and skin.
  • Significant dose-dependent suppression of 444-ASO-2 expression was observed in liver, kidney, heart and skeletal muscle (1% and 5% significance levels).
  • knockdown in the heart of the 1000 ⁇ g/individual administration group significantly suppressed the inhibitory effect exhibited by naked ASO-2 at the same dose by about 40% (1% significance level);
  • the analyzed organs were liver, kidney, heart, large intestine and skeletal muscle. In each organ, suppression of 2270-ASO-2 expression depending on the dose was observed, and a significant difference was observed in the high-dose group compared to the physiological saline-administered group (1% significance level).
  • ligand 2197 could selectively deliver nucleic acid drugs to the skin and pancreas, and ligand 444 to the heart.
  • the present invention is useful, for example, in the development and manufacture of pharmaceuticals.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Cardiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Diabetes (AREA)
  • Dermatology (AREA)
  • Pulmonology (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Hematology (AREA)
  • Vascular Medicine (AREA)
  • Analytical Chemistry (AREA)
  • Neurology (AREA)

Abstract

La présente invention concerne un corps conjugué représenté par Lg-Lk-NCA, Lk étant une fraction de liaison, NCA une fraction d'acide nucléique et Lg un groupe représenté par l'une des formules.
PCT/JP2022/017160 2021-04-09 2022-04-06 Corps conjugué ligand-acide nucléique WO2022215704A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2023513029A JPWO2022215704A1 (fr) 2021-04-09 2022-04-06

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2021-066809 2021-04-09
JP2021066809 2021-04-09

Publications (1)

Publication Number Publication Date
WO2022215704A1 true WO2022215704A1 (fr) 2022-10-13

Family

ID=83546216

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2022/017160 WO2022215704A1 (fr) 2021-04-09 2022-04-06 Corps conjugué ligand-acide nucléique

Country Status (2)

Country Link
JP (1) JPWO2022215704A1 (fr)
WO (1) WO2022215704A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130066063A1 (en) * 2011-09-09 2013-03-14 John Cooke Hodges Bicyclo[6.1.0]non-4-yne regents for chemical modification of oligonucleotides
US20210038605A1 (en) * 2018-04-03 2021-02-11 Shenzhen University Novel small molecule immune agonists and immune targeting compounds and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130066063A1 (en) * 2011-09-09 2013-03-14 John Cooke Hodges Bicyclo[6.1.0]non-4-yne regents for chemical modification of oligonucleotides
US20210038605A1 (en) * 2018-04-03 2021-02-11 Shenzhen University Novel small molecule immune agonists and immune targeting compounds and application thereof

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
BAEZA GEMA, BACHMAIR EVA-MARIA, WOOD SHARON, MATEOS RAQUEL, BRAVO LAURA, DE ROOS BAUKJE: "The colonic metabolites dihydrocaffeic acid and dihydroferulic acid are more effective inhibitors of in vitro platelet activation than their phenolic precursors", FOOD & FUNCTION, R S C PUBLICATIONS, GB, vol. 8, no. 3, 1 January 2017 (2017-01-01), GB , pages 1333 - 1342, XP055974878, ISSN: 2042-6496, DOI: 10.1039/C6FO01404F *
FONG PEDRO; TONG HENRY H Y; CHAO CHI M: "In silico prediction of tyrosinase and adenylyl cyclase inhibitors from natural compounds", NATURAL PRODUCT COMMUNICATIONS, vol. 9, 1 February 2014 (2014-02-01), pages 189 - 194, XP009194768, ISSN: 1934-578x *
INOUE, TAKAO: "Oligonucleotide therapeutics: past, present and future", DRUG DELIVERY SYSTEM., NIHON D D S GAKKAI, JAPAN, vol. 31, no. 1, 25 January 2016 (2016-01-25), Japan , pages 10 - 23, XP009540548, ISSN: 0913-5006, DOI: 10.2745/dds.31.10 *
KAWAMATA, YUJI ET AL.: "Development of delivery technology by ligand-added nucleic acid drug DDS", JOURNAL OF NUCLEIC ACID THERAPEUTICS SOCIETY OF JAPAN, NUCLEIC ACID THERAPEUTICS SOCIETY OF JAPAN, JP, vol. 21, no. 1, 1 January 2017 (2017-01-01), JP, pages 22 - 51, XP009540241 *
TAKAHASHI N, TOMINAGA M, KOSAKA R, KAMATA Y, UMEHARA Y, MATSUDA H, SAKAGUCHI A, OGAWA H, TAKAMORI K: "Involvement of µ-opioid Receptors and κ-opioid Receptors in Itch-related Scratching Behaviour of Imiquimod-induced Psoriasis-like Dermatitis in Mice", ACTA DERMATO-VENEREOLOGICA., TAYLOR & FRANCIS LTD., UNITED KINGDOM, vol. 97, no. 8, 1 January 2017 (2017-01-01), United Kingdom , pages 928 - 933, XP055974873, ISSN: 0001-5555, DOI: 10.2340/00015555-2704 *
YASUDA DAISUKE: "Requirement of atypical N-glycosylation motif for the surface expression and the intracellular signaling", RESEARCH REPORT OF GRANT-IN-AID FOR SCIENTIFIC RESEARCH, 1 January 2019 (2019-01-01), XP055974876, Retrieved from the Internet <URL:https://kaken.nii.ac.jp/file/KAKENHI-PROJECT-23770138/23770138seika.pdf> [retrieved on 20221026] *
YASUO KOMATSU: "Development of terminal or internal chemical modifications of nucleic acids", JOURNAL OF BIOCHEMISTRY, OXFORD UNIVERSITY PRESS, GB, vol. 82, no. 12, 1 December 2010 (2010-12-01), GB , pages 1141 - 1145, XP008173111, ISSN: 0021-924X *

Also Published As

Publication number Publication date
JPWO2022215704A1 (fr) 2022-10-13

Similar Documents

Publication Publication Date Title
JP6233903B2 (ja) 架橋型ヌクレオシドおよびヌクレオチド
JP6048982B2 (ja) グアニジン架橋を有する人工ヌクレオシドおよびオリゴヌクレオチド
JP6562517B2 (ja) 架橋型ヌクレオシドおよびヌクレオチド
WO2011052436A1 (fr) Nucléoside et nucléotide artificiels pontés
JP7473113B2 (ja) オリゴヌクレオチドを含有する小細胞肺癌治療薬
US11234995B2 (en) α-synuclein expression inhibitor
WO2020158910A1 (fr) Nucléoside modifié en position 5&#39; et nucléotide l&#39;utilisant
WO2019009298A1 (fr) INHIBITEUR DE L&#39;EXPRESSION DE L&#39;α-SYNUCLÉINE
US20220127300A1 (en) 5&#39;-modified nucleoside and nucleotide using same
WO2022215704A1 (fr) Corps conjugué ligand-acide nucléique
WO2023149038A1 (fr) Dérivé de phénoxazine et formulation de système d&#39;administration de médicament l&#39;utilisant
US20230340008A1 (en) Bridged nucleoside and nucleotide using same
WO2015125845A1 (fr) Modification de site phosphate d&#39;acide nucléique contenant un hétérocycle non aromatique contenant de l&#39;azote
WO2023021715A1 (fr) Dérivé de sucre et conjugué sucre-acide nucléique
WO2023167094A1 (fr) Nucléoside modifié en position 5&#39; et nucléotide l&#39;utilisant
WO2022181807A1 (fr) Oligonucléotide pour induire le saut de n-exons pendant le traitement des précurseurs de l&#39;arnm rest
US20230124641A1 (en) Cross-linked nucleoside and nucleotide using same
WO2021256297A1 (fr) Nucléoside et nucléotide pontés
WO2024101446A1 (fr) Nucléoside modifié ayant une structure guanidino dans une partie pontée et méthode de production d&#39;oligonucléotide l&#39;utilisant

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22784686

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2023513029

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22784686

Country of ref document: EP

Kind code of ref document: A1