WO2022211277A1 - Method for immobilization of biomimetic silica in whole cell catalyst for increased thermal stability - Google Patents

Abstract

The present invention relates to a method for immobilization of biomimetic silica in a whole cell catalyst for increased thermal stability. Since the method according to the present invention can very effectively increase the thermal stability of a whole cell catalyst immobilized in silica capsules, the method of the present invention can be advantageously used in bioprocess, food, pharmaceutical, chemical, and bio-related industries and the like using a whole cell catalyst.

Description

Biomimetic Silica Immobilization Method of Whole Cell Catalyst for Increased Thermal Stability

The present invention relates to a biomimetic silica immobilization method of a whole cell catalyst for increasing thermal stability.

In general, enzymes and whole cells are used in many biocatalytic reactions. Although they have the disadvantage of lower speed compared to chemical catalysts, they have the advantage that the reaction proceeds under mild conditions of room temperature and atmospheric pressure and the reaction specificity is excellent. In the case of a catalytic reaction using an enzyme, it is widely used for organic synthesis of optically active compounds because of its simplicity, flexibility and efficiency, but unrefined enzymes interfere with the desired reaction, resulting in poor stereoselectivity and productivity. Therefore, it is more preferable to use a highly purified enzyme catalyst. However, when only the desired enzyme is isolated and purified through a procedure such as cell disruption after production of an enzyme from a living organism such as a microorganism, the process is complicated and expensive.

A whole cell catalyst intends to use the cell itself in which the enzyme is produced for the same purpose as a catalyst. Such a whole-cell catalyst can be used more advantageously when a coenzyme is absolutely necessary for a biocatalyst process, or when the activity of an enzyme is significantly reduced during a process involving several steps of reaction or purification, but compared to an enzyme catalyst, a whole-cell catalyst In organic solvents, the stability of the cell itself may be reduced, or problems such as by-products or growth conditions may occur, so studies on ways to solve these problems are needed.

On the other hand, Korean Patent Publication No. 2020-0053289 discloses 'fusion protein comprising carbonic anhydrase and silica-affinity peptide and method for preparing the same', and Korean Patent No. 1591992 discloses a transformant as a whole cell catalyst 'Novel carbonic anhydrase 1 derived from Dunaliella salina' isolated from has been disclosed, but the method for immobilizing a biomimetic silica of a whole cell catalyst for increasing thermal stability of the present invention has not been disclosed.

The present invention has been derived from the above needs, and the present inventors have pelB signal peptide (pelB signal peptide), Thermosulfurimonas dismutans derived carbonic anhydrase (carbonic anhydrase) and silica-forming peptide ( Silica forming peptide) R5 was sequentially fused to a whole cell catalyst expressed in the cell gap of E. coli, a salt and a biomimetic silica precursor (tetramethyl orthosilicate) were mixed to form a whole cell catalyst on biomimetic silica. immobilized. As a result of treating the biomimetic silica immobilized with the whole cell catalyst at a high temperature (60° C.), in the whole cell catalyst treatment group immobilized on the biomimetic silica compared to the whole cell catalyst treatment group (control group) not immobilized on the biomimetic silica By confirming that the half-life of carbonic anhydrase significantly increased and the enzyme leakage rate decreased, the present invention was completed.

In order to solve the above problems, the present invention provides a biomimetic silica immobilization method for increasing the thermal stability of a whole cell catalyst, comprising mixing a whole cell catalyst, a salt and a silica precursor provides

In addition, the present invention provides a pelB signal peptide coding sequence; Thermosulfurimonas dismutans ( Thermosulfurimonas dismutans ) derived carbonic anhydrase (carbonic anhydrase) coding sequence; And silica forming peptide (silica forming peptide) coding sequence; preparing a whole-cell catalyst by transforming the host cell with a recombinant vector that is sequentially linked; and mixing the prepared whole-cell catalyst with a salt and a silica precursor to immobilize the whole-cell catalyst on biomimetic silica.

In addition, the present invention provides a biomimetic silica to which the whole-cell catalyst prepared by the above preparation method is immobilized.

In addition, the present invention provides a recombinant vector in which the pelB signal peptide coding sequence, the thermosulfurimonas dismutans-derived carbonic anhydrase coding sequence and the silica-forming peptide coding sequence are sequentially linked; salt; and a silica precursor; as an active ingredient, it provides a composition for increasing the thermal stability of the whole-cell catalyst immobilized on biomimetic silica.

Since the method according to the present invention can increase the thermal stability of the whole-cell catalyst immobilized on biomimetic silica, the method of the present invention is useful for biological processes using whole-cell catalysts, food, pharmaceuticals, bio-related industries, etc. It is expected that it can be used.

1 is a pelB signal peptide coding sequence, Thermosulforimonas dismutans-derived carbonic anhydrase (tdCA) coding sequence, and silica-forming peptide R5 coding sequence pelB- expressed in E. coli cells transformed with a recombinant vector sequentially linked. The figure shows the amino acid sequence of the tdCA-R5 fusion protein and the nucleotide sequence information of the gene encoding it.

Figure 2 shows the pelB signal peptide coding sequence, Thermosulforimonas dismutans-derived carbonic anhydrase (tdCA) coding sequence, and silica-forming peptide R5 coding sequence in E. coli BL21 (DE3) cells transformed with a recombinant vector sequentially linked This is the result of confirming the expression tendency of the pelB-tdCA-R5 fusion protein or the expression tendency of tdCA-R5 formed by cleavage of the pelB signal peptide. M: marker, S; soluble fraction, IS; insoluble fraction.

3 is a whole-cell catalyst in which a pelB signal peptide coding sequence, a carbonic anhydrase (tdCA) coding sequence derived from Thermosulforimonas dismutans and a silica-forming peptide R5 coding sequence are fused (pelB-tdCA-R5) is expressed. (Whole cell) and biomimetic silica (Whole cell@SiO ₂ ) immobilized with a whole cell catalyst prepared by treating the whole cell catalyst with a salt and a silica precursor (0.5 M or 1 M TMOS) at 60° C. for 3 days, respectively. This is the result of comparing the residual activity of carbonic anhydrase after heating.

Figure 4 is a pelB signal peptide coding sequence, Thermosulforimonas dismutans-derived carbonic anhydrase (tdCA) coding sequence and silica-forming peptide R5 coding sequence fused protein (pelB-tdCA-R5) expression whole-cell catalyst (Whole cell) and biomimetic silica (Whole cell@SiO ₂ ) immobilized with a whole cell catalyst prepared by treating a silica precursor (1 M TMOS) on the whole cell catalyst were heated at 60° C. for 3 days, respectively, and then centrifuged. This is the result of confirming the level of the tdCA-R5 fusion protein in the supernatant (supernatant, Sup) and the entire sample (Total).

In order to achieve the object of the present invention, the present invention is a whole cell catalyst (whole cell catalyst), characterized in that it comprises the step of mixing a salt and a silica precursor, biomimetic silica immobilization for increasing the thermal stability of the whole cell catalyst provide a way

In the method according to an embodiment of the present invention, the whole-cell catalyst is Thermosulfurimonas dismutans ) The pelB signal peptide is fused to the amino terminus of carbonic anhydrase derived from dismutans, and the carboxy terminus It refers to a cell expressing a protein fused to a silica forming peptide in the cell gap.

As used herein, the term 'cell gap' refers to a portion made of a gel-like material existing in the space between the inner membrane and the outer membrane of a cell. In the case of Escherichia coli, it is surrounded by two membranes, the inner and outer membranes. Based on these two membranes, the inner space of the inner membrane is the cytoplasm, the space between the inner and outer membrane is the periplasm space, and the outer space of the outer membrane is the extracellular space. classified into extracellular space.

In addition, the pelB signal peptide is a secretory sequence targeting the cell gap. In the present invention, the pelB signal peptide is expressed in the cytoplasm in a fused form with a carbonic anhydrase and silica-forming peptide derived from Thermosulforimonas dismutans and passes through the cell inner membrane by signal peptidase As it is cut, a fusion protein of carbonic anhydrase and silica-forming peptide exists in the cell gap in a form in which the pelB signal peptide has been removed.

In the method according to an embodiment of the present invention, the thermosulfurimonas dismutans-derived carbonic anhydrase may increase the expression level of the silica-forming peptide fused with carbonic anhydrase in the intercellular space.

In the method according to an embodiment of the present invention, the pelB signal peptide may consist of the amino acid sequence of SEQ ID NO: 1, and the Thermosulforimonas dismutans-derived carbonic anhydrase is the amino acid sequence of SEQ ID NO: 2 It may be formed, and the silica-forming peptide may be formed of the amino acid sequence of SEQ ID NO: 3, but is not limited thereto.

The silica-forming peptide is a peptide consisting of 19 amino acid residues including lysine, arginine and serine found in diatoms, and functions as a template and catalyst for silica formation together with polyamines.

In the method according to an embodiment of the present invention, the salt is cesium chloride (CsCl), lithium chloride (LiCl), sodium chloride (NaCl), potassium chloride (KCl), chloride Rubidium chloride (RbCl), sodium fluoride (Sodium fluoride, NaF), sodium bromide (Sodium bromide, NaBr), sodium iodide (Sodium iodide, NaI) or sodium nitrate (Sodium nitrate, NaNO ₃ ) can be and more preferably cesium chloride, but is not limited thereto.

In addition, the silica precursor may be tetramethyl orthosilicate (TMOS) or tetraethyl orthosilicate (TEOS), preferably TMOS, but is not limited thereto.

The present invention also

pelB signal peptide coding sequence; Thermosulfurimonas dismutans ( Thermosulfurimonas dismutans ) derived carbonic anhydrase (carbonic anhydrase) coding sequence; And silica forming peptide (silica forming peptide) coding sequence; transforming the host cell with the sequentially linked recombinant vector to prepare a whole cell catalyst (whole cell catalyst); and

Mixing the prepared whole-cell catalyst with a salt and a silica precursor to immobilize the whole-cell catalyst on biomimetic silica; a method for preparing biomimetic silica to which a whole-cell catalyst is immobilized, and the method prepared by the method To provide a biomimetic silica immobilized with a whole cell catalyst.

In the production method according to an embodiment of the present invention, the pelB signal peptide may consist of the amino acid sequence of SEQ ID NO: 1, and the Thermosulforimonas dismutans-derived carbonic anhydrase is the amino acid sequence of SEQ ID NO: 2 It may consist of, and the silica-forming peptide may consist of the amino acid sequence of SEQ ID NO: 3, but is not limited thereto.

In addition, in the preparation method according to an embodiment of the present invention, the whole-cell catalyst, the salt and the silica precursor are the same as described above.

In the preparation method according to an embodiment of the present invention, the silica-forming peptide is used to form biomimetic silica nanoparticles in powder form at room temperature and neutral pH, and in the existing chemical silica synthesis method, biomimetic silica nanoparticles in powder form When forming particles, it is not necessary to carry out a process of heat treatment at high temperature (about 600°C) for a long time, and it is possible to improve the point that silica is only formed in the form of a gel at a very slow rate or that a gel is not formed near neutral pH. have. In addition, since enzyme immobilization using a silica-forming peptide occurs through encapsulation that traps the enzyme inside at the same time as silica synthesis, the added salt is added when the salt is processed during the enzyme immobilization inside the silica between the silica and the enzyme. It promotes stabilization.

The biomimetic silica on which the whole-cell catalyst of the present invention is immobilized is prepared by mixing a whole-cell catalyst with a salt and a silica precursor, and the whole-cell catalyst in which the silica-forming peptide is expressed and the silica precursor react to form biomimetic silica, , a whole-cell catalyst immobilized on the formed biomimetic silica. In the biomimetic silica to which the whole-cell catalyst according to the present invention is immobilized, the whole-cell catalyst immobilized on the biomimetic silica has superior thermal stability compared to the whole-cell catalyst not immobilized on the biomimetic silica.

The term "recombinant" refers to a cell in which the cell replicates, expresses a heterologous nucleic acid, or expresses a peptide, a heterologous peptide, or a protein encoded by the heterologous nucleic acid. Recombinant cells can express genes or gene segments not found in the native form of the cell, either in sense or antisense form. Recombinant cells can also express genes found in cells in a natural state, but the genes are modified and re-introduced into cells by artificial means.

The term “vector” is used to refer to a DNA fragment(s), a nucleic acid molecule, that is delivered into a cell. The vector replicates DNA and can be reproduced independently in a host cell. The term "carrier" is often used interchangeably with "vector."

The expression vector preferably comprises one or more selectable markers. The marker is a nucleic acid sequence having characteristics that can be selected by conventional chemical methods, and includes all genes that can distinguish transformed cells from non-transformed cells. Examples thereof include, but are not limited to, ampicillin, tetracycline, and the like.

As a host cell capable of continuously cloning and expressing the vector of the present invention in a prokaryotic cell, any host cell known in the art may be used, for example, E. coli BL21, E. coli JM109, E. coli RR1 , E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus genus strains such as Bacillus thuringiensis, and Salmonella typhimurium, Serratia marcesens and various Pseudomonas There are enterobacteriaceae and strains such as species.

The host cell according to an embodiment of the present invention is preferably Escherichia coli BL21 (DE3), but is not limited thereto.

The method of delivering the recombinant vector of the present invention into a host cell can be carried out by the CaCl ₂ method, the Hanhan method (Hanahan, D., 1983 J. Mol. Biol. 166, 557-580) and the electroporation method.

In the production method of the present invention, the transformed host cell can be cultured in a medium suitable for the expression of a fusion protein of Thermosulforimonas dismutans-derived carbonic anhydrase and silica-forming peptide using known techniques. . A suitable culture medium can be obtained commercially or can be prepared according to the ingredients and composition ratios described in publications such as, for example, catalogs of the American Type Culture Collection, but is not limited thereto.

The present invention also provides a recombinant vector in which the pelB signal peptide coding sequence, the Thermosulfurimonas dismutans derived carbonic anhydrase coding sequence and the silica forming peptide coding sequence are sequentially linked. ; salt; and a silica precursor; as an active ingredient, it provides a composition for increasing the thermal stability of the whole-cell catalyst immobilized on biomimetic silica.

In the composition of the present invention, the pelB signal peptide may consist of the amino acid sequence of SEQ ID NO: 1, and the Thermosulfur limonas dismutans-derived carbonic anhydrase may consist of the amino acid sequence of SEQ ID NO: 2, The silica-forming peptide may consist of the amino acid sequence of SEQ ID NO: 3, but is not limited thereto.

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples are only illustrative of the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. strain culture

Escherichia coli TOP10 strain was used to construct the recombinant vector, and E. coli BL21(DE3) strain was used for protein expression. Escherichia coli was cultured in LB (Luria-Bertani) medium at 37° C. and 180 rpm, and 50 μg/ml ampicillin was added as needed.

2. Plasmid Vector Construction

The pelB signal peptide for secretion into the periplasm space is linked to the N-terminus (amino terminus) of the Thermosulforimonas dismutans-derived carbonic anhydrase (tdCA), and the C-terminus (carboxy terminus) to the biological Cloning of the gene encoding the fusion protein (pelB-tdCA-R5) linked to the silica-forming peptide R5 for mimetic silica synthesis was performed. Specifically, the tdCA gene was amplified by PCR using pET-tdCA, which is a previously synthesized expression vector of the tdCA gene, as a template. The amplified gene was cloned into the pGEM-T Easy vector, and the sequence was confirmed through sequencing. Thereafter, the tdCA gene was cloned into pET-22b(+), a vector containing the pelB signal peptide coding sequence, using Nco I and Hind III restriction enzyme sequences. After further cleavage with Hind III and Xho I, a gene fragment annealed with the R5 primer of Table 1 was inserted therebetween to finally construct pET-pelb-tdCA-R5. At the time of protein expression, a His6 tag (hexa histidine tag) provided from the pET-22b(+) vector was fused to the C-terminus and expressed. The amino acid sequence of the pelB-tdCA-R5 fusion protein fused with the His6 tag and the nucleotide sequence information of the gene encoding the same are shown in FIG. 1 .

Primer information used in the present invention

primer designation	Sequence information (5'→3') (SEQ ID NO:)
NcoI-tdCA -HindIII	F: CCATGG GTGGCGGTCA (4)
	R: AAGCTT TTTCAGAATCTTACGCGCG (5)
R5	F: AGCTTAGCAGCAAAAAATCTGGCTCCTATTCAGGCTCGAAAGGTTCTAAACGTCG CATTCTGC (6)
	R: TCGAGCAGAATGCGACGTTTAGAACCTTTCGAGCCTGAATAGGAGCCAGATTTTT TGCTGCTA (7)

Underline: Restriction enzyme position

3. Whole Cell Catalyst Fabrication

The constructed recombinant vector was introduced into the E. coli BL21 (DE3) strain and cultured at 37° C. and 180 rpm. When the cell concentration reached OD ₆₀₀ =0.6-0.8, 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) was added to express the tdCA-R5 fusion protein in the cell gap. After incubation at 37°C for 12 hours, cells were recovered by centrifugation at 4°C and 4,000 x g conditions for 10 minutes after the incubation was completed.

4. Cell Fraction and Protein Expression Analysis

The recovered cells are resuspended in a lysis buffer (lysis buffer; 50 mM sodium phosphate, 300 mM NaCl, 10 mM imidazole, pH 8.0), and then disrupted by ultrasonication in a cold state at 4 ° C., It was centrifuged for 10 minutes under 10,000 x g conditions. Thereafter, the supernatant was named as a soluble fraction (S), and the pellet was resuspended in the same volume of dissolution buffer and named as an insoluble fraction (IS). Each cell fraction was separated using SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and analyzed by Coomassie blue staining.

5. Whole Cell Catalyst Immobilization Using Biomimetic Silica

The recovered cells were resuspended using 20 mM sodium phosphate buffer (pH 7.5) added with 0.5 M cesium chloride (CsCl), and the cell concentration was adjusted so that the absorbance value at 600 nm was 100. . Biomimetic silica precursor TMOS (Tetramethyl orthosilicate) was hydrolyzed in 1 mM HCl at a concentration of 1 M for 20 minutes, mixed with 100 μl of hydrolyzed TMOS and 900 μl of cell solution, and left at room temperature for 5 minutes to react. Immobilization (encapsulation) of the whole cell catalyst through silica synthesis was performed. Thereafter, the immobilized whole-cell catalyst was washed twice by centrifugation and resuspension using distilled water, and finally resuspended in 1 ml of 20 mM sodium phosphate buffer.

6. Thermal stability measurement

In order to confirm the thermal stability of the whole-cell catalyst on biomimetic silica with or without immobilization, the whole-cell catalyst not immobilized on the biomimetic silica and the whole-cell catalyst immobilized on the biomimetic silica were heated in a water bath at 60° C. for 3 days. In order to remove the enzyme potentially released outside the cell, the cells before heating and after heating were washed three times with 20 mM sodium phosphate butter and resuspended, and then the enzyme activity was measured using a CO ₂ hydration assay. Specifically, 600 μl of 20 mM Tris buffer (100 μM phenol red, pH 8.3) kept cold in ice water and 10 μl of the whole cell catalyst sample were mixed and placed in a disposable cuvette and placed in a spectrometer set at 4°C. After adding and mixing 400 μl of a saturated CO ₂ solution kept cold in ice water, the change in absorbance at 570 nm was observed. The time (t) for the absorbance to fall from the absorbance 1.2 corresponding to pH 7.5 to 0.2, the absorbance corresponding to pH 6.5, was calculated. In addition, the time taken by the natural CO ₂ hydration reaction using a buffer instead of the whole cell sample (t0; blank) was obtained, and the enzyme activity was calculated using (t0-t)/t.

7. Analysis of Released Proteins after Heating

Enzyme release from cells by heating was analyzed by Western blot. SDS-PAGE was performed by preparing a heated sample (Total) and a supernatant (supernatant, Sup) sample obtained by centrifugation. After treatment with a primary antibody (monoclonal anti-His6 tag antibody) and a secondary antibody (polyclonal anti-mouse IgG, alkaline phosphatase conjugated), NBT/BCIP substrate solution was treated to develop color.

8. EDS Analysis

A sample treated with a silica precursor (TMOS) in wild-type E. coli BL21 (DE3) strain (control) and biomimetic silica immobilized with a whole cell catalyst were dried at 60° C. for 24 hours, and then EDS (Energy Dispersive X-ray Spectroscopy) , Oxford instruments) were used for elemental analysis.

Example 1. Expression of tdCA-R5 fusion protein in the cell gap

pelB-tdCA in E. coli BL21(DE3) cells transformed with a recombinant vector in which the coding sequence for the pelB signal peptide, the thermosulfurimonas dismutans-derived carbonic anhydrase (tdCA) coding sequence, and the silica-forming peptide R5 coding sequence were sequentially linked Expression levels of -R5 or tdCA-R5 fusion proteins were analyzed.

As a result, it was confirmed that the band corresponding to the pelB-tdCA-R5 fusion protein (31.6 kDa) was clearly displayed in the insoluble fraction of E. coli cells, and the band corresponding to the tdCA-R5 fusion protein (29.4 kDa) was clearly displayed in the soluble fraction. . The tdCA-R5 fusion protein expressed in the soluble fraction showed a truncated band size of the pelB signal peptide (2.2 kDa), indicating that the tdCA-R5 fusion protein was expressed in the cell gap ( FIG. 2 ).

Example 2. Thermal Stability Analysis of Whole Cell Catalysts by Biomimetic Silica Encapsulation

Whole cell catalyst (hereinafter, whole cell) expressing pelB-tdCA-R5 fusion protein not immobilized on biomimetic silica, and a whole cell catalyst prepared by treating silica precursor (TMOS) on the whole cell catalyst is immobilized in the living body After the mimic silica (hereinafter, Whole cell@SiO ₂ ) was heated at 60° C. for 3 days, the residual activity was compared.

As a result, the whole cell showed a residual activity of 12% compared to the initial activity without heating (the activity of the refrigerated sample), whereas the residual activity of the whole cell@SiO ₂ using 0.5 M TMOS was 45% and 1 M TMOS. Residual activity of Whole cell@SiO ₂ using was 86%, confirming that the thermal stability of the whole cell catalyst was increased in a TMOS concentration-dependent manner (FIG. 3).

Through this, it was found that the immobilization of the whole-cell catalyst on biomimetic silica can contribute to the improvement of the thermal stability of the whole-cell catalyst. In particular, the method of immobilizing the whole-cell catalyst on the biomimetic silica in the present invention can be performed more simply and quickly by mixing the whole-cell catalyst and the silica precursor and reacting for 5 minutes, so that the thermal stability of the whole-cell catalyst can be very effectively improved. was expected to be possible.

In addition, since the temperature of 60 ° C is a high temperature that can damage the E. coli cell membrane, Western blot was performed to analyze the leakage rate of the tdCA-R5 fusion protein expressed in the E. coli cell gap after high temperature treatment at 60 ° C.

As a result, it was confirmed that the tdCA-R5 fusion protein was detected in the supernatant of the whole cell, whereas the tdCA-R5 fusion protein was hardly detected in the supernatant of the whole cell@SiO ₂ (1 M TMOS) ( FIG. 4 ). Through this, it was found that when the whole-cell catalyst was immobilized on silica, the rate of enzyme leakage from the cells could be significantly reduced.

Example 3. EDS analysis

Whole cell@SiO ₂ After drying, elemental analysis was performed through EDS. As a control, the wild-type E. coli BL21 (DE3) strain was treated with TMOS, washed and dried for elemental analysis. In the case of wild-type E. coli , the silicon (Si) content was 0.14% to 0.28% despite TMOS treatment, whereas in the case of Whole cell@SiO ₂ , the silicon content was 0.85% to 1.75% (Table 2). Through this, it was confirmed that the biomimetic silica was properly formed by the expression of the fusion protein of the thermosulfurimonas dismutans-derived carbonic anhydrase and the silica-forming peptide R5 in the cell gap.

EDS analysis results

	Wild type E. coli BL21(DE3) (1 M TMOS)		pelB-tdCA-R5 (1M TMOS)
Element	wt%	at%	wt%	at%
C	56.11	62.41	55.21	62.69
N	18.58	17.72	15.35	14.95
O	21.90	18.29	22.43	19.12
Na	0.71	0.41	0.54	0.32
P	2.41	1.04	4.71	2.07
Si	0.28	0.14	1.75	0.85
Total	100.00	100.00	100.00	100.00

wt%: weight percent (composition ratio of atomic weight)

at% : atomic percent (composition ratio of the number of atoms)

Claims (10)

1. A biomimetic silica immobilization method for increasing the thermal stability of a whole cell catalyst, comprising mixing a whole cell catalyst, a salt and a silica precursor.
2. According to claim 1, wherein the whole-cell catalyst is Thermosulfurimonas dismutans ( Thermosulfurimonas dismutans ) pelB signal peptide is fused to the amino terminus of carbonic anhydrase derived from, and silica forming peptide (silica) at the carboxy terminus Forming peptide) is a cell that expresses the fused protein in the intercellular space, characterized in that the biomimetic silica immobilization method for increasing the thermal stability of the whole cell catalyst.
3. According to claim 2, wherein the silica-forming peptide is biomimetic silica immobilization method for increasing the thermal stability of the whole-cell catalyst, characterized in that consisting of the amino acid sequence of SEQ ID NO: 3.
4. According to claim 1, wherein the salt is cesium chloride (CsCl), lithium chloride (LiCl), sodium chloride (NaCl), potassium chloride (KCl), rubidium chloride (RbCl), sodium fluoride (NaF), sodium bromide (NaBr) , Sodium iodide (NaI) or sodium nitrate (NaNO ₃ ) Biomimetic silica immobilization method for increasing the thermal stability of the whole-cell catalyst, characterized in that.
5. The method of claim 1, wherein the silica precursor is tetramethyl orthosilicate or tetraethyl orthosilicate.
6. pelB signal peptide coding sequence; Thermosulfurimonas dismutans ( Thermosulfurimonas dismutans ) derived carbonic anhydrase (carbonic anhydrase) coding sequence; And silica forming peptide (silica forming peptide) coding sequence; transforming the host cell with the sequentially linked recombinant vector to prepare a whole cell catalyst (whole cell catalyst); and

   Mixing the prepared whole-cell catalyst with a salt and a silica precursor to immobilize the whole-cell catalyst on biomimetic silica;
7. A biomimetic silica to which the whole-cell catalyst prepared by the method of claim 6 is immobilized.
8. pelB signal peptide coding sequence, Thermosulfurimonas dismutans ( Thermosulfurimonas dismutans ) derived carbonic anhydrase coding sequence and silica forming peptide (silica forming peptide) a recombinant vector in which the coding sequence is sequentially linked; salt; and a silica precursor; as an active ingredient, a composition for increasing the thermal stability of a whole-cell catalyst immobilized on biomimetic silica.
9. The composition for increasing the thermal stability of the whole-cell catalyst immobilized on biomimetic silica according to claim 8, wherein the silica-forming peptide consists of the amino acid sequence of SEQ ID NO: 3.
10. According to claim 8, wherein the salt is cesium chloride (CsCl), lithium chloride (LiCl), sodium chloride (NaCl), potassium chloride (KCl), rubidium chloride (RbCl), sodium fluoride (NaF), sodium bromide (NaBr) , Sodium iodide (NaI) or sodium nitrate (NaNO ₃ ) Composition for increasing the thermal stability of the whole-cell catalyst immobilized on biomimetic silica.

Images