WO2021256674A1 - Method for increasing stability of target protein immobilized in silica nanoparticle through salt treatment - Google Patents

Method for increasing stability of target protein immobilized in silica nanoparticle through salt treatment Download PDF

Info

Publication number
WO2021256674A1
WO2021256674A1 PCT/KR2021/004311 KR2021004311W WO2021256674A1 WO 2021256674 A1 WO2021256674 A1 WO 2021256674A1 KR 2021004311 W KR2021004311 W KR 2021004311W WO 2021256674 A1 WO2021256674 A1 WO 2021256674A1
Authority
WO
WIPO (PCT)
Prior art keywords
silica
immobilized
target protein
protein
salt
Prior art date
Application number
PCT/KR2021/004311
Other languages
French (fr)
Korean (ko)
Inventor
조병훈
임균택
Original Assignee
경상국립대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경상국립대학교산학협력단 filed Critical 경상국립대학교산학협력단
Publication of WO2021256674A1 publication Critical patent/WO2021256674A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K17/00—Carrier-bound or immobilised peptides; Preparation thereof
    • C07K17/14—Peptides being immobilised on, or in, an inorganic carrier
    • C—CHEMISTRY; METALLURGY
    • C01—INORGANIC CHEMISTRY
    • C01B—NON-METALLIC ELEMENTS; COMPOUNDS THEREOF; METALLOIDS OR COMPOUNDS THEREOF NOT COVERED BY SUBCLASS C01C
    • C01B33/00—Silicon; Compounds thereof
    • C01B33/113—Silicon oxides; Hydrates thereof
    • C01B33/12—Silica; Hydrates thereof, e.g. lepidoic silicic acid
    • C01B33/18—Preparation of finely divided silica neither in sol nor in gel form; After-treatment thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/01—Hydro-lyases (4.2.1)
    • C12Y402/01001—Carbonate dehydratase (4.2.1.1), i.e. carbonic anhydrase
    • C—CHEMISTRY; METALLURGY
    • C01—INORGANIC CHEMISTRY
    • C01P—INDEXING SCHEME RELATING TO STRUCTURAL AND PHYSICAL ASPECTS OF SOLID INORGANIC COMPOUNDS
    • C01P2004/00—Particle morphology
    • C01P2004/60—Particles characterised by their size
    • C01P2004/64—Nanometer sized, i.e. from 1-100 nanometer
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/35—Fusion polypeptide containing a fusion for enhanced stability/folding during expression, e.g. fusions with chaperones or thioredoxin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/60—Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]

Definitions

  • the present invention relates to a method for increasing the stability of a target protein immobilized on silica nanoparticles through salt treatment.
  • Enzymes are biocatalysts and have advantages in environmental friendliness and substrate specificity compared to conventional chemical catalysts. However, it reacts very sensitively to the surrounding environment, so its activity changes, recycling is difficult, and it is difficult to separate and purify from the reaction product, which limits its industrial use. To solve this problem, various studies have been made, and the most actively studied among them is the method of immobilizing an enzyme.
  • the immobilized enzyme can maintain its activity for a long time, can be used repeatedly, and can be usefully used in industrial fields because the product and the enzyme are easy to separate, so it is possible to overcome the disadvantages of the existing enzyme.
  • the stability of the enzyme can be increased in reactions in organic solvents and high-temperature reactions, it is possible to develop various reaction systems.
  • the biological process using enzymes is performed under mild conditions to reduce energy consumption, and it is possible to improve the quality of products by suppressing by-products by the substrate specificity of the enzyme. In addition, it has the advantage of suppressing the generation of pollutants from an environmental point of view.
  • the enzyme immobilization method can be divided into a chemical method such as an ion exchange method, a covalent bonding method, and a crosslinking method, and a physical method such as an adsorption method, a blanket method, a microencapsulation method, and a membrane use method according to the binding method.
  • a chemical method such as an ion exchange method, a covalent bonding method, and a crosslinking method
  • a physical method such as an adsorption method, a blanket method, a microencapsulation method, and a membrane use method according to the binding method.
  • a sol-gel inorganic support linkage is formed around it, and since the enzyme is present in the pore, it can protect the enzyme from entanglement or modification, and the biggest problem in enzyme immobilization is ejection.
  • the silica structure formed by the sol-gel process is chemically stable and hydrophilic, has low synthesis cost, and has excellent mechanical strength and thermal stability compared to enzymes immobilized by organic polymers, etc., and has the advantage of being protected from bacteria. .
  • the shape of the enzyme is easily generated due to the harsh synthetic conditions and reagents applied when the sol-gel material is prepared. Recently, research on methods for producing and applying biomimetic silica by discovering biological-derived organic molecules (proteins, peptides, etc.) involved in the formation of babiosilica are being conducted.
  • Agglomerated silica powder can be formed at room temperature and neutral pH through biomimetic silica synthesis, and enzyme immobilization is possible at the same time.
  • an additional high-temperature process is required after the gel is formed, and it has the disadvantage that it takes a long time.
  • Korean Patent No. 0837375 discloses cationic surfactants such as benzoalkonium chloride, myristalkonium chloride, cetylpyridinium chloride, and cetyltrimethyl ammonium bromide.
  • cationic surfactants such as benzoalkonium chloride, myristalkonium chloride, cetylpyridinium chloride, and cetyltrimethyl ammonium bromide.
  • a 'method for preparing an enzyme-immobilized silica' using cetyltrimethyl ammonium chloride is disclosed, but silica nano
  • silica nano There is no disclosure of a method for increasing the stability of a target protein immobilized on a particle.
  • the present invention has been derived from the above needs, and the present inventors have prepared a bovine carbonic anhydrase (bCA) coding gene or a fluorescent protein DsRed (red fluorescent protein) coding gene; and a biomimetic silica-forming peptide ( E. coli strain was transformed with a recombinant vector containing the coding sequence of the fusion protein in which the silica forming peptide) R5 coding sequence was sequentially linked to express the fusion protein bCA-R5 or DsRed-R5, and the fusion protein was immobilized on silica synthesis.
  • bCA bovine carbonic anhydrase
  • DsRed red fluorescent protein
  • a fusion protein for this purpose, by mixing a fusion protein, various salts (CsCl, LiCl, NaCl, KCl, RbCl, NaF, NaBr, NaI or NaNO 3 ) and a hydrolyzed silica precursor (TMOS), bCA or DsRed protein is immobilized on silica nano Particles were prepared.
  • the fusion protein bCA-R5 or DsRed-R5 was treated with high temperature (60° C.) on the immobilized silica nanoparticles.
  • high temperature 60° C.
  • the present invention provides the stability of the target protein immobilized on silica nanoparticles, characterized in that it comprises the step of mixing a fusion protein, a salt, and a silica precursor of the target protein and silica forming peptide provides a way to increase
  • the present invention comprises the steps of transforming a host cell with a recombinant vector comprising a coding sequence of a fusion protein in which a target protein coding gene and a silica forming peptide coding sequence are sequentially linked; culturing the transformed host cell to induce expression of a fusion protein of the target protein and the silica-forming peptide R5 and obtain the same; and mixing a salt and a silica precursor with the obtained fusion protein; provides a method for producing silica nanoparticles with increased stability of the immobilized target protein.
  • the present invention provides silica nanoparticles with increased stability of the immobilized target protein prepared by the above preparation method.
  • the present invention provides a composition for increasing the stability of a target protein immobilized on silica nanoparticles containing cesium chloride (CsCl) as an active ingredient.
  • CsCl cesium chloride
  • the method of the present invention is a bioprocess, food, pharmaceutical, bioprocess using an immobilized enzyme It may be usefully used in related industries.
  • bCA-R5 A is a fusion protein bCA-R5 (A) in which bovine carbonic anhydrase (bCA) and silica-forming peptide R5 are coupled, and DsRed-R5 (B), a fusion protein in which red fluorescent protein DsRed and silica-forming peptide R5 are coupled.
  • DsRed-R5 B
  • CsCl Cesium chloride, LiCl: lithium chloride (Lithium chloride), NaCl: sodium chloride (Sodium chloride), KCl: potassium chloride (Potassium chloride), RbCl: rubidium chloride (Rubidium chloride), NaF: sodium fluoride (Sodium) fluoride), NaBr: sodium bromide, NaI: sodium iodide (Sodium iodide), NaNO 3 : sodium nitrate.
  • Figure 3 shows bCA-R5@silica particles synthesized in conditions not treated with salt (CsCl) and bCA-R5@silica (0.1 M CsCl) particles synthesized in conditions in which salt (CsCl) was not treated during the immobilization of the fusion protein bCA-R5. This is a photograph observed with a runner electron microscope (SEM).
  • Figure 4 is the result of confirming the thermal (60 °C, 48 hours) stability of the immobilized bCA enzyme according to the salt treatment during immobilization of the fusion protein bCA-R5
  • A is a chloride salt (LiCl, NaCl, KCl, RbCl, CsCl) treatment and a result of a then measuring the residual activity (residual activity) of immobilized bCA
  • B is the result of measuring a residual activity after treated with Sodium salt (NaF, NaCl, NaBr , NaI or NaNO 3) immobilized bCA
  • C is These are the results of measuring the residual activity of the immobilized bCA enzyme after treatment with various concentrations (0.01 M, 0.1 M, 0.5 M and 1 M) to confirm the optimal concentration of CsCl, which exhibited the best residual activity of the immobilized bCA enzyme.
  • Statistical analysis was performed using t- test, and the asterisk(*) just above the bar graph is
  • FIG. 6 is a result showing the fold change in half life of the bCA enzyme immobilized in bCA-R5@silica and bCA-R5@silica (salt) according to the pH conditions of the dialysis buffer of the fusion protein bCA-R5. .
  • the present invention provides a target protein immobilized on silica nanoparticles, characterized in that it comprises the step of mixing a fusion protein, a salt, and a silica precursor of the target protein and silica forming peptide
  • a method for increasing the stability of a target protein immobilized on silica nanoparticles characterized in that it comprises the step of mixing a fusion protein, a salt, and a silica precursor of the target protein and silica forming peptide
  • target protein refers to a protein to be immobilized on silica nanoparticles.
  • the target protein may be any one protein selected from the group consisting of medical, research and industrial proteins, for example, enzymes, fluorescent proteins, antigens, antibodies, cell receptors, structural proteins, serum and cellular proteins, preferably may be an enzyme protein or a fluorescent protein, more preferably carbonic anhydrase or DsRed (red fluorescent protein), but is not limited thereto.
  • the carbonic anhydrase may preferably be bovine carbonic anhydrase (bCA), but is not limited thereto.
  • the bovine carbonic anhydrase and DsRed may consist of the amino acid sequences of SEQ ID NO: 1 and SEQ ID NO: 3, respectively, and encode the bovine carbonic anhydrase and DsRed
  • the gene may consist of the nucleotide sequence of SEQ ID NO: 2 and SEQ ID NO: 4, respectively, but is not limited thereto.
  • the silica-forming peptide may preferably be a silica-forming peptide R5 consisting of the amino acid sequence of SEQ ID NO: 5, but is not limited thereto.
  • the silica-forming peptide R5 is a peptide consisting of 19 amino acid residues including lysine, arginine and serine found in diatoms, and functions as a template and catalyst for silica formation together with polyamines.
  • the salt may be an alkali metallic salt, preferably cesium chloride (CsCl), lithium chloride (LiCl), sodium chloride (Sodium) chloride, NaCl), potassium chloride (KCl), rubidium chloride (RbCl), sodium fluoride (NaF), sodium bromide (NaBr), sodium iodide (Sodium iodide, NaI) or sodium nitrate (Sodium nitrate, NaNO 3 ) may be, and more preferably, cesium chloride, but is not limited thereto.
  • CsCl cesium chloride
  • LiCl lithium chloride
  • NaCl sodium chloride
  • KCl potassium chloride
  • RbCl rubidium chloride
  • NaF sodium fluoride
  • NaBr sodium bromide
  • sodium iodide Sodium iodide, NaI
  • sodium nitrate sodium nitrate, NaNO 3
  • the silica precursor may be tetramethyl orthosilicate (TMOS) or tetraethyl orthosilicate (TEOS), preferably TMOS, but this not limited
  • transforming the host cell with a recombinant vector comprising the coding sequence of the fusion protein in which the target protein coding gene and the silica forming peptide coding sequence are sequentially linked;
  • silica nanoparticles Mixing a salt and a silica precursor to the obtained fusion protein; a method for producing silica nanoparticles with increased stability of the immobilized target protein, and a method for increasing the stability of the immobilized target protein prepared by the method Silica nanoparticles are provided.
  • the silica-forming peptide may preferably be a silica-forming peptide R5 consisting of the amino acid sequence of SEQ ID NO: 5, but is not limited thereto.
  • the recombinant vector is a target protein, wherein the cow-derived carbonic anhydrase coding gene and the silica-forming peptide R5 coding sequence are sequentially linked, or the target protein DsRed coding gene and silica are formed
  • the peptide R5 coding sequence may be sequentially linked, but it is not particularly limited thereto, and it may be constructed by sequentially linking a protein coding gene to be mass-produced by those skilled in the art and a silica-forming peptide R5 coding sequence.
  • bovine carbonic anhydrase, DeRed protein, salt and silica precursor are the same as described above.
  • the salt may be cesium chloride (CsCl), and the salt may be mixed to a final concentration of 0.05 to 1M, preferably 0.1M, but is not limited thereto. does not
  • the silica-forming peptide R5 is used to form silica nanoparticles in powder form at room temperature and neutral pH, and forms silica nanoparticles in powder form in the conventional chemical silica synthesis method It is not necessary to carry out the process of heat treatment at high temperature (about 600° C.) for a long time, and it is possible to improve the fact that silica is formed only in the form of a gel at a very slow rate or that a gel is not formed near neutral pH.
  • Recombinant refers to a cell in which the cell replicates, expresses a heterologous nucleic acid, or expresses a peptide, heterologous peptide or protein encoded by the heterologous nucleic acid.
  • Recombinant cells can express genes or gene segments not found in the native form of the cell, either in sense or antisense form.
  • Recombinant cells can also express genes found in cells in a natural state, but the genes are modified and re-introduced into cells by artificial means.
  • vector is used to refer to a DNA fragment(s), a nucleic acid molecule, that is delivered into a cell.
  • the vector replicates DNA and can be reproduced independently in a host cell.
  • carrier is often used interchangeably with “vector.”
  • the expression vector preferably comprises one or more selectable markers.
  • the marker is a nucleic acid sequence having a characteristic that can be selected by a conventional chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples thereof include, but are not limited to, ampicillin, tetracycline, and the like.
  • any host cell known in the art may be used, for example, E. coli BL21, E. coli JM109, E. coli RR1 , E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus genus strains such as Bacillus thuringiensis, and Salmonella typhimurium, Serratia marcesens and various Pseudomonas There are enterobacteriaceae and strains such as species.
  • the host cell according to an embodiment of the present invention is preferably Escherichia coli BL21 (DE3), but is not limited thereto.
  • the method of delivering the recombinant vector of the present invention into a host cell may be carried out by the CaCl 2 method, the Hanhan method (Hanahan, D., 1983 J. Mol. Biol. 166, 557-580) and the electroporation method.
  • the transformed host cell can be cultured in a medium suitable for expression of the fusion protein of the target protein and the silica-forming peptide R5 using a known technique.
  • a suitable culture medium can be obtained commercially or can be prepared according to the ingredients and composition ratios described in publications such as, for example, catalogs of the American Type Culture Collection, but is not limited thereto.
  • the preparation method of the present invention may further include isolating and purifying the fusion protein from the host cell in which the fusion protein of the target protein and the silica-forming peptide R5 is expressed.
  • the separation method may be separated from the medium by a conventional method including, for example, centrifugation, filtration, extraction, spray drying, evaporation or precipitation, but is not limited thereto.
  • the isolated protein can further be purified by known methods including chromatography (eg ion exchange, affinity, hydrophobicity and size exclusion), dialysis, electrophoresis, fractional dissolution (eg ammonium sulfate precipitation), SDS-PAGE or extraction. It can be purified through various methods.
  • the present invention provides a composition for increasing the stability of a target protein immobilized on silica nanoparticles containing cesium chloride (CsCl) as an active ingredient.
  • the target protein is as described above.
  • Escherichia coli TOP10 strain was used for gene recombination vector production, and E. coli BL21(DE3) strain was used for protein expression.
  • E. coli was cultured in LB (Luria-Bertani) medium at 37° C. and 180 rpm, and 50 ⁇ g/ml ampicillin was added as needed.
  • bovine carbonic anhydrase bCA
  • monomeric DsRed a red fluorescent protein
  • the bCA coding gene was chemically synthesized and DsRed was obtained from pDsRed-Monomer-N1, and the genes were amplified using the primers in Table 1.
  • the PCR product of each gene was first cloned into the pGEM-T Easy vector, and the sequence was confirmed through sequencing. These genes were cloned into pET-22b(+) vector using Nde I and Hind III restriction enzymes, respectively, to prepare pET-bCA and pET-DsRed.
  • pET-bCA and pET-DsRed were cut with Hind III and Xho I, respectively, and the gene fragment bound with the R5 primer of Table 1 was inserted between them.
  • pET-bCA-R5 and pET-DsRed-R5 were prepared.
  • a hexahistidine tag provided from the pET-22b(+) vector is fused to the C-terminus of the sequence and expressed.
  • Primer information for fusion protein cloning of target protein and silica-forming peptide R5 primer designation Primer sequence (5' ⁇ 3') (SEQ ID NO:) bCA F: CATATG AGCCACCACTG (6) R: AAGCTT CTTCGGGAAGCC (7) DsRed F: CATATG GACAACACCGAGGACG (8) R: AAGCTT CTGGGAGCCGGAGT (9) R5 F: AGCTTAGCAGCAAAAAAAATCTGGCTCCTATTCAGGCTCGAAAGGTTCTAAACGTCGCATTCTGC (10) R: TCGAGCAGAATGCGACGTTTAGAACCTTTCGAGCCTGAATAGGAGCCAGATTTTTTGCTGCTA (11)
  • the prepared recombinant vector pET-bCA-R5 or pET-DsRed-R5 was introduced into the E. coli BL21 (DE3) strain and cultured at 37° C. and 180 rpm. 25 °C (for DeRed) or 37 °C after addition of 0.1 mM (for DeRed) or 1 mM (for bCA) IPTG (isopropyl-bD-thiogalactopyranoside) when the cell concentration reached 0.6-0.8 at OD 600 (in the case of bCA) for 20 hours or 10 hours, respectively.
  • the cells were centrifuged for 10 minutes at 4°C and 4,000 x g to recover the cells, and the cells were washed with a lysis buffer (50 mM sodium phosphate, 300 mM NaCl, 10 mM imidazole, pH 8.0). resuspended.
  • the suspended cells were disrupted by sonication in a cold state, and the lysate was centrifuged for 10 minutes at 4°C and 10,000 x g conditions. Thereafter, the supernatant was named as a soluble fraction (S), and the pellet was resuspended in the same volume of dissolution buffer and named as an insoluble fraction (IS).
  • SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis
  • nickel-nitrilotriacetic acid agarose beads (Ni 2+ -nitrilotriacetic acid) were added to the aqueous fraction of the lysate. agarose beads) were added to bind the protein, and then the non-specifically bound protein was removed using a wash buffer (50 mM sodium phosphate, 300 mM NaCl, 30 mM imidazole, pH 8.0).
  • a purified protein was obtained using an elution buffer (50 mM sodium phosphate, 300 mM NaCl, 250 mM imidazole, pH 8.0), and the purified fusion proteins bCA-R5 and DsRed-R5 were pH 8.0, respectively.
  • the buffer was exchanged by dialysis with 20 mM sodium phosphate buffer of 7.5 and 20 mM sodium phosphate buffer of pH 5.5.
  • the fusion proteins bCA-R5 and DsRed-R5 were mixed with a denaturing buffer (6 M guanidine hydrochloride GuHCl/20 mM sodium phosphate buffer, pH 7.5) and denatured by heating at 100° C. for 10 minutes. Absorbance at 280 nm was measured. The concentration of the protein was confirmed through the measured absorbance and the extinction coefficient at 280 nm calculated from the protein amino acid sequence. The extinction coefficient calculation was performed using ProtParam (http://web.expasy.org/protparam/).
  • TMOS acid-hydrolyzed 1 M tetramethyl orthosilicate
  • Salts added during silica synthesis are cesium chloride (CsCl), lithium chloride (LiCl), sodium chloride (NaCl), potassium chloride (KCl), rubidium chloride (RbCl), sodium fluoride (NaF), sodium bromide (NaBr), Sodium iodide (NaI) or sodium nitrate (NaNO 3 ) were all dissolved in distilled water, and the final concentration of the salt was 0.1 M when silica was formed.
  • distilled water was added in the same ratio, and 1 M TMOS was pre-hydrolyzed with 1 mM HCl for 20 minutes before silica synthesis.
  • the silica on which the fusion protein was immobilized was named bCA-R5@silica and DsRed-R5@silica, respectively, and the silica treated with salt during immobilization was named bCA-R5@silica (salt) and DsRed-R5@silica (salt), respectively. named.
  • the synthesized silica was washed twice with distilled water and then resuspended in 20 mM sodium phosphate buffer (pH 7.5).
  • the amount of silica formed upon immobilization of the fusion protein bCA-R5 was measured by ⁇ -silicomolybdate assay.
  • bCA-R5@silica and bCA-R5@silica (salt) were washed twice with distilled water and then resuspended in 1 ml of distilled water, and a sample of 100 ml was taken and mixed with 900 ml of 0.5 M NaOH for 1 hour. melted 40 ml of the dissolved sample, 160 ml of distilled water, and 800 ml of molybdate solution were mixed and dispensed in a 96-well plate, and absorbance was measured at 370 nm in a plate reader.
  • the preparation method of the molybdate solution is as follows: 1.35 ml of HCl (37%) is diluted in distilled water to make 40.3 ml, and 774.2 mg of ammonium heptamolybdate tetrahydrate (AHT) is dissolved in distilled water to make 9.7 ml of the solution. were mixed and the pH was adjusted to 1.12 with NaOH. For quantitative analysis, the calibration curve was performed with a silicon standard solution dissolved in 0.5 M NaOH.
  • the activity of bCA immobilized on silica was measured using a CO 2 hydration assay. After mixing 600 ⁇ l of 20 mM Tris buffer (100 ⁇ M phenol red, pH 8.3) kept cold and 10 ⁇ l of bCA sample, put it in a disposable cuvette, and put it in a spectrometer set at 4°C. 400 ⁇ l of a saturated solution of CO 2 kept cold was rapidly added and mixed, and the change in absorbance at 570 nm was measured. The time (t) for the absorbance to decrease from the absorbance 1.1 corresponding to pH 7.5 to 0.2, the absorbance corresponding to pH 6.5, was calculated.
  • the time taken by the natural CO 2 hydration reaction (t0; blank) was obtained using a dialysis buffer instead of the bCA sample, and the enzyme activity was determined using (t0-t)/t Calculated.
  • the activity of DsRed immobilized on silica was confirmed by measuring the fluorescence intensity.
  • each sample was heated at 60° C. and then the activity was measured, and the relative activity was compared with the activity of the non-heat-treated sample.
  • the half-life was calculated using the activity reduction data over time.
  • the fusion protein bCA-R5 was dialyzed against pH 5.5, 6.5, 7.5 or 8.0 buffer (20 mM sodium phosphate) to compare the effect of salt treatment according to pH conditions during protein immobilization.
  • Cesium chloride (CsCl) was used as the salt, and the final concentration was 0.1M.
  • Silica synthesized at each pH condition was washed twice with distilled water and then resuspended in the same pH 7.5 buffer (20 mM sodium phosphate), and stability was measured and half-life was calculated in the same manner as above.
  • bCA-R5@silica and bCA-R5@silica were washed twice with distilled water and dried at 60° C. for 24 hours. The dried silica sample was observed through a scanning electron microscope (SEM).
  • PDB ID: 1V9E for bCA and PDB ID: 2VAD for DsRed were used and visualized using the UCSF chimera program.
  • the ratio of charged amino acids to the total surface area of the protein was calculated by applying the dssp algorithm (https://www3.cmbi.umcn.nl/xssp/).
  • the isoelectric point of the protein was calculated from the amino acid sequence using Compute pI/Mw (https://web.expas y.org/compute_pi/).
  • Silica formed upon immobilization of the fusion protein bCA-R5 was analyzed by ⁇ -silicomolybdate assay. As a result, silica of 2.75 ( ⁇ 0.1) g/L was formed when immobilization was carried out in the untreated condition, and 3.06 to 3.4 g/L of silica was formed in the condition in which the salt was treated, especially among various salts. It was confirmed that silica was formed at the highest concentration of 3.4 g/L when CsCl was treated (FIG. 2). That is, since the concentration of silica formed in the salt-treated condition increased by about 10% or more compared to the non-salt-treated condition, it was found that the amount of silica synthesis could be increased when the salt was treated during the protein immobilization process.
  • bCA-R5@silica and bCA-R5@silica were heated at 60° C. for 48 hours, and then the residual activity of the immobilized bCA enzyme was measured.
  • Example 5 Effect of salt treatment according to pH conditions upon immobilization of bCA enzyme
  • the property of the enzyme surface that can interact with silica was expected to be important, so the pH of the dialysis buffer of the fusion protein bCA-R5 was adjusted to have different surface charges. And since silica was not synthesized at a pH condition of 8.5 or higher, the pH adjustment range was set to 5.5 to 8.0, and bCA-R5@silica and bCA-R5@silica (0.1 M CsCl) synthesized at each pH condition were reacted at 60°C. The thermal stability of the immobilized bCA enzyme was analyzed by measuring the half-life.
  • the half-life of bCA-R5@silica (0.1 M CsCl) immobilized at pH 6.5, pH 7.5, and pH 8.0 was generally higher than that of pH 5.5.
  • the half-life increased by about 1.3 times after the addition of CsCl, showing the lowest stability increase, whereas at the pH 8.0 condition, the half-life increased by about 32 times, showing the highest stability increase (Fig. 6). Therefore, in order to increase the high stability of bCA-R5@silica (salt) compared to bCA-R5@silica, it was considered that the condition in which the surface charge of the enzyme was relatively negative during immobilization was considered optimal.
  • DsRed-R5@silica and DsRed-R5@silica were heated at 60° C. for 24 hours, and then the fluorescence intensity of the immobilized DsRed protein was measured. .
  • the residual fluorescence of the DsRed protein immobilized on DsRed-R5@silica was higher than that of DsRed-R5@silica, and through this, the salt treatment resulted in a higher stability of the immobilized DsRed-R5 as well as bCA-R5. It was also confirmed to be effective for improvement. Unlike the bCA-R5 result (FIG. 5C), it was confirmed that the residual fluorescence intensity of the immobilized DsRed protein increased in proportion to the concentration of CsCl treated during the protein immobilization process (FIG. 7).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Inorganic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Immobilizing And Processing Of Enzymes And Microorganisms (AREA)

Abstract

The present invention relates to a method for increasing the stability of a target protein immobilized in a silica nanoparticle through salt treatment. The method of the present invention can be usefully utilized in, for example, bio-related industries, pharmaceuticals, food products and biological processes which use immobilized enzymes.

Description

염 처리를 통해 실리카 나노입자에 고정화된 목적 단백질의 안정성을 증가시키는 방법Method to increase the stability of target protein immobilized on silica nanoparticles through salt treatment
본 발명은 염 처리를 통해 실리카 나노입자에 고정화된 목적 단백질의 안정성을 증가시키는 방법에 관한 것이다.The present invention relates to a method for increasing the stability of a target protein immobilized on silica nanoparticles through salt treatment.
효소는 생체 촉매로서 기존의 화학 촉매에 비해서 환경 친화적이고 기질 특이성이 뛰어난 장점을 가지고 있다. 그러나 주변 환경에 매우 민감하게 반응하여 활성이 변하고 재활용이 어려우며, 반응 생성물로부터 분리·정제하는 것이 어려워 산업적으로 사용하는데 한계가 있다. 이러한 문제를 해결하기 위해 다양한 연구가 이루어져 왔는데, 그 중 가장 활발히 연구된 것이 효소를 고정화하는 방법이다. 고정화 효소(immobilized enzyme)는 장기간 활성을 유지할 수 있고 반복 사용이 가능할 뿐만 아니라 생성물과 효소의 분리가 용이하여 산업현장에서 유용하게 활용할 수 있으므로 기존 효소의 단점을 극복할 수 있다. 또한, 유기용매에서의 반응과 고온 반응 등에서 효소의 안정성을 증대시킬 수 있어서 다양한 반응 시스템 개발이 가능하다. 에너지 소비 측면에서도 효소를 이용한 생물학적 공정은 온화한 조건에서 수행되어 에너지 소비가 절감되며, 효소의 기질 특이성에 의한 부산물 억제로 생산물의 품질 향상을 이룰 수 있다. 그리고 환경적인 측면에서도 공해물질의 발생을 억제할 수 있는 장점이 있다. Enzymes are biocatalysts and have advantages in environmental friendliness and substrate specificity compared to conventional chemical catalysts. However, it reacts very sensitively to the surrounding environment, so its activity changes, recycling is difficult, and it is difficult to separate and purify from the reaction product, which limits its industrial use. To solve this problem, various studies have been made, and the most actively studied among them is the method of immobilizing an enzyme. The immobilized enzyme can maintain its activity for a long time, can be used repeatedly, and can be usefully used in industrial fields because the product and the enzyme are easy to separate, so it is possible to overcome the disadvantages of the existing enzyme. In addition, since the stability of the enzyme can be increased in reactions in organic solvents and high-temperature reactions, it is possible to develop various reaction systems. In terms of energy consumption, the biological process using enzymes is performed under mild conditions to reduce energy consumption, and it is possible to improve the quality of products by suppressing by-products by the substrate specificity of the enzyme. In addition, it has the advantage of suppressing the generation of pollutants from an environmental point of view.
효소 고정화 방법은 결합 방법에 따라 이온교환법, 공유결합법, 가교법 등의 화학적 방법과 흡착법, 포괄법, 미세캡슐화법, 막(membrane) 이용법 등의 물리적 방법으로 구분될 수 있다. 다양한 효소 고정화 방법 중에서 졸-겔 공정(sol-gel process)에 의해 효소를 졸-겔 구조 안에 고정화시키고 이들을 고정화 효소로서 활용하는 연구가 많이 진행되고 있다. 이 방법은 효소가 존재하는 상태에서 이 주위로 졸-겔의 무기 지지체 연결 구조가 형성되고, 효소는 기공안에 존재하기 때문에 효소가 엉키거나 변형되는 것을 보호할 수 있으며 효소 고정화에서 가장 큰 문제인 분출되는 형상을 줄일 수 있다는 장점이 있다. 또한 졸-겔 공정에 의해서 형성되는 실리카 구조는 화학적으로 안정하고 친수성이며, 합성 시 비용이 적게 들고 유기 폴리머 등에 의해 고정화된 효소와 비교하여 기계적 강도와 열 안정성이 우수하고 세균으로부터 보호되는 장점이 있다. 하지만, 졸-겔 물질이 제조될 때 적용되는 가혹한 합성 조건과 시약으로 인하여 효소가 변하는 형상이 발생되기 쉽다는 단점도 존재한다. 최근에는 바비오실리카 형성에 관여하는 생물 유래 유기 분자들(단백질, 펩타이드 등)을 발굴하고 이를 활용하여 생체 모방 실리카를 생산·적용하는 방법에 대한 연구가 이루어지고 있다. 생체 모방 실리카 합성법을 통해 상온·중성 pH 하에서 응집된 실리카 분말을 형성할 수 있으며 동시에 효소 고정화가 가능하다. 기존 졸-겔 공정을 통해 이러한 실리카 분말을 얻기 위해서는 겔 형성 이후 추가적인 고온 공정이 필요하며 시간이 오래 걸리는 단점을 지닌다. 또한 실리카 파우더 외부에 효소를 고정화하는 것만 가능하며, 내부에 효소를 고정화·담지하는 것은 불가능하다.The enzyme immobilization method can be divided into a chemical method such as an ion exchange method, a covalent bonding method, and a crosslinking method, and a physical method such as an adsorption method, a blanket method, a microencapsulation method, and a membrane use method according to the binding method. Among various enzyme immobilization methods, many studies have been conducted to immobilize enzymes in a sol-gel structure by a sol-gel process and utilize them as immobilized enzymes. In this method, in the presence of the enzyme, a sol-gel inorganic support linkage is formed around it, and since the enzyme is present in the pore, it can protect the enzyme from entanglement or modification, and the biggest problem in enzyme immobilization is ejection. It has the advantage of being able to reduce the shape. In addition, the silica structure formed by the sol-gel process is chemically stable and hydrophilic, has low synthesis cost, and has excellent mechanical strength and thermal stability compared to enzymes immobilized by organic polymers, etc., and has the advantage of being protected from bacteria. . However, there is also a disadvantage that the shape of the enzyme is easily generated due to the harsh synthetic conditions and reagents applied when the sol-gel material is prepared. Recently, research on methods for producing and applying biomimetic silica by discovering biological-derived organic molecules (proteins, peptides, etc.) involved in the formation of babiosilica are being conducted. Agglomerated silica powder can be formed at room temperature and neutral pH through biomimetic silica synthesis, and enzyme immobilization is possible at the same time. In order to obtain such silica powder through the conventional sol-gel process, an additional high-temperature process is required after the gel is formed, and it has the disadvantage that it takes a long time. In addition, it is only possible to immobilize the enzyme on the outside of the silica powder, and it is impossible to immobilize and support the enzyme inside.
한편, 한국등록특허 제0837375호에는 양이온성 계면활성제인 벤조알코늄 클로라이드(benzoalkonium chloride), 미리스탈코늄클로라이드(miristalkonium chloride), 세틸피리디늄 클로라이드(Cetylpyridinium chloride), 세틸트리메틸 암모늄 브로마이드(cetyltrimethyl ammonium bromide) 또는 세틸트리메틸 암모늄 클로라이드(cetyltrimethyl ammonium chloride)를 이용한 '효소가 고정화된 실리카의 제조방법'이 개시되어 있으나, 본 발명의 알칼리 금속 클로라이드(Alkali metal chloride) 또는 나트륨 염(Sodium salts) 처리를 통해 실리카 나노입자에 고정화된 목적 단백질의 안정성을 증가시키는 방법에 대해서는 개시된 바가 없다.Meanwhile, Korean Patent No. 0837375 discloses cationic surfactants such as benzoalkonium chloride, myristalkonium chloride, cetylpyridinium chloride, and cetyltrimethyl ammonium bromide. Alternatively, a 'method for preparing an enzyme-immobilized silica' using cetyltrimethyl ammonium chloride is disclosed, but silica nano There is no disclosure of a method for increasing the stability of a target protein immobilized on a particle.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자들은 소 유래 탄산무수화효소(bovine carbonic anhydrase, bCA) 코딩 유전자 또는 형광 단백질 DsRed(red fluorescent protein) 코딩 유전자;와 생체 모방 실리카 형성 펩타이드(silica forming peptide) R5 코딩 서열이 순차적으로 연결된 융합 단백질의 코딩 서열을 포함하는 재조합 벡터로 대장균 균주를 형질전환하여 융합 단백질 bCA-R5 또는 DsRed-R5를 발현시키고, 상기 융합 단백질이 고정화된 실리카 합성을 위해, 융합단백질, 다양한 종류의 염(CsCl, LiCl, NaCl, KCl, RbCl, NaF, NaBr, NaI 또는 NaNO 3) 및 가수분해된 실리카 전구체(TMOS)를 혼합하여 bCA 또는 DsRed 단백질이 고정화된 실리카 나노입자를 제조하였다. 상기 융합 단백질 bCA-R5 또는 DsRed-R5가 고정화된 실리카 나노입자에 고온(60℃)을 처리한 결과, 단백질이 고정화된 실리카 합성 과정에서 염이 처리되지 않은 조건에 비해 염이 처리된 조건에서 합성된 실리카에 고정화되어 있는 bCA 또는 DsRed 단백질의 잔여 활성(residual activity)이 증가된 것을 확인하였고, 특히 염화세슘(CsCl)을 0.1M의 농도로 처리한 조건이 고정화 bCA 또는 DsRed 단백질의 열 안정성을 향상시킬 수 있는 최적의 염 처리 조건임을 확인함으로써, 본 발명을 완성하였다.The present invention has been derived from the above needs, and the present inventors have prepared a bovine carbonic anhydrase (bCA) coding gene or a fluorescent protein DsRed (red fluorescent protein) coding gene; and a biomimetic silica-forming peptide ( E. coli strain was transformed with a recombinant vector containing the coding sequence of the fusion protein in which the silica forming peptide) R5 coding sequence was sequentially linked to express the fusion protein bCA-R5 or DsRed-R5, and the fusion protein was immobilized on silica synthesis. For this purpose, by mixing a fusion protein, various salts (CsCl, LiCl, NaCl, KCl, RbCl, NaF, NaBr, NaI or NaNO 3 ) and a hydrolyzed silica precursor (TMOS), bCA or DsRed protein is immobilized on silica nano Particles were prepared. The fusion protein bCA-R5 or DsRed-R5 was treated with high temperature (60° C.) on the immobilized silica nanoparticles. As a result, in the process of synthesizing silica on which the protein was immobilized, it was synthesized under the salt-treated condition compared to the non-salt-treated condition. It was confirmed that the residual activity of the bCA or DsRed protein immobilized on the immobilized silica was increased. In particular, the condition treated with cesium chloride (CsCl) at a concentration of 0.1 M improved the thermal stability of the immobilized bCA or DsRed protein. By confirming that it is the optimal salt treatment condition that can be made, the present invention was completed.
상기 과제를 해결하기 위해, 본 발명은 목적 단백질 및 실리카 형성 펩타이드(silica forming peptide)의 융합 단백질, 염 및 실리카 전구체를 혼합하는 단계를 포함하는 것을 특징으로 하는 실리카 나노입자에 고정화된 목적 단백질의 안정성을 증가시키는 방법을 제공한다.In order to solve the above problems, the present invention provides the stability of the target protein immobilized on silica nanoparticles, characterized in that it comprises the step of mixing a fusion protein, a salt, and a silica precursor of the target protein and silica forming peptide provides a way to increase
또한, 본 발명은 목적 단백질 코딩 유전자 및 실리카 형성 펩타이드(silica forming peptide) 코딩 서열이 순차적으로 연결된 융합 단백질의 코딩 서열을 포함하는 재조합 벡터로 숙주 세포를 형질전환하는 단계; 상기 형질전환된 숙주세포를 배양하여 목적 단백질 및 실리카 형성 펩타이드 R5의 융합 단백질의 발현을 유도하고 이를 수득하는 단계; 및 상기 수득한 융합 단백질에 염 및 실리카 전구체를 혼합하는 단계;를 포함하는, 고정화된 목적 단백질의 안정성이 증가된 실리카 나노입자의 제조방법을 제공한다.In addition, the present invention comprises the steps of transforming a host cell with a recombinant vector comprising a coding sequence of a fusion protein in which a target protein coding gene and a silica forming peptide coding sequence are sequentially linked; culturing the transformed host cell to induce expression of a fusion protein of the target protein and the silica-forming peptide R5 and obtain the same; and mixing a salt and a silica precursor with the obtained fusion protein; provides a method for producing silica nanoparticles with increased stability of the immobilized target protein.
또한, 본 발명은 상기 제조방법에 의해 제조된 고정화된 목적 단백질의 안정성이 증가된 실리카 나노입자를 제공한다.In addition, the present invention provides silica nanoparticles with increased stability of the immobilized target protein prepared by the above preparation method.
또한, 본 발명은 염화세슘(CsCl)을 유효성분으로 함유하는 실리카 나노입자에 고정화된 목적 단백질의 안정성을 증가시키기 위한 조성물을 제공한다.In addition, the present invention provides a composition for increasing the stability of a target protein immobilized on silica nanoparticles containing cesium chloride (CsCl) as an active ingredient.
본 발명은 목적 단백질이 고정화된 실리카 합성 과정에서 염을 처리함에 따라 실리카에 고정화된 목적 단백질의 열 안정성을 증가시킬 수 있으므로, 본 발명의 방법은 고정화 효소를 사용하는 생물공정, 식품, 제약, 바이오 관련 산업 등에서 유용하게 사용될 수 있을 것이다.Since the present invention can increase the thermal stability of the target protein immobilized on silica by treating the salt in the process of synthesizing the silica immobilized with the target protein, the method of the present invention is a bioprocess, food, pharmaceutical, bioprocess using an immobilized enzyme It may be usefully used in related industries.
도 1은 소 유래 탄산무수화효소(bCA)와 실리카 형성 펩타이드 R5가 결합된 융합 단백질 bCA-R5(A), 및 red 형광 단백질인 DsRed와 실리카 형성 펩타이드 R5가 결합된 융합 단백질 DsRed-R5(B)의 발현 경향을 확인한 쿠마씨 블루(Coomassie blue) 염색 겔 사진이다. (A); 형질전환된 세포에 1 mM IPTG를 첨가하여 37℃에서 단백질 발현을 유도한 결과, (B); 형질전환된 세포에 0.1 mM IPTG를 첨가하여 25℃에서 단백질 발현을 유도한 결과, S; 수용성(soluble) 분획, IS; 불용성(insoluble) 분획, 화살표; 재조합 단백질.1 is a fusion protein bCA-R5 (A) in which bovine carbonic anhydrase (bCA) and silica-forming peptide R5 are coupled, and DsRed-R5 (B), a fusion protein in which red fluorescent protein DsRed and silica-forming peptide R5 are coupled. ) is a photograph of a Coomassie blue stained gel confirming the expression trend. (A); As a result, protein expression was induced at 37°C by adding 1 mM IPTG to the transformed cells, (B); As a result of inducing protein expression at 25°C by adding 0.1 mM IPTG to the transformed cells, S; soluble fraction, IS; insoluble fraction, arrow; Recombinant Protein.
도 2는 융합 단백질 bCA-R5의 고정화 과정에서 처리된 염(LiCl, NaCl, KCl, RbCl, CsCl, NaF, NaBr, NaI 또는 NaNO 3)의 종류에 따른 실리카 합성량을 확인한 결과이다. 통계 분석은 t-test를 이용하였으며, bar graph 바로 위의 asterisk(*)는 염 첨가하지 않은 대조군 대비 비교 결과이다( * p<0.05, ** p<0.01). CsCl: 염화세슘(Cesium chloride), LiCl: 염화리튬(Lithium chloride), NaCl: 염화나트륨(Sodium chloride), KCl: 염화칼륨(Potassium chloride), RbCl: 염화루비듐(Rubidium chloride), NaF: 플루오린화나트륨(Sodium fluoride), NaBr: 브로민화나트륨(Sodium bromide), NaI: 아이오딘화나트륨(Sodium iodide), NaNO 3: 질산나트륨(Sodium nitrate). 2 is a result of confirming the amount of silica synthesis according to the type of salt (LiCl, NaCl, KCl, RbCl, CsCl, NaF, NaBr, NaI or NaNO 3 ) treated in the immobilization process of the fusion protein bCA-R5. Statistical analysis was performed using the t- test, and the asterisk(*) just above the bar graph is the comparison result compared to the control group without the addition of salt ( * p <0.05, ** p <0.01). CsCl: Cesium chloride, LiCl: lithium chloride (Lithium chloride), NaCl: sodium chloride (Sodium chloride), KCl: potassium chloride (Potassium chloride), RbCl: rubidium chloride (Rubidium chloride), NaF: sodium fluoride (Sodium) fluoride), NaBr: sodium bromide, NaI: sodium iodide (Sodium iodide), NaNO 3 : sodium nitrate.
도 3은 융합 단백질 bCA-R5 고정화 과정에서 염(CsCl)이 처리되지 않은 조건에서 합성된 bCA-R5@silica 입자와 염이 처리된 조건에서 합성된 bCA-R5@silica(0.1 M CsCl) 입자를 주자전자현미경(SEM)으로 관찰한 사진이다.Figure 3 shows bCA-R5@silica particles synthesized in conditions not treated with salt (CsCl) and bCA-R5@silica (0.1 M CsCl) particles synthesized in conditions in which salt (CsCl) was not treated during the immobilization of the fusion protein bCA-R5. This is a photograph observed with a runner electron microscope (SEM).
도 4는 융합 단백질 bCA-R5의 고정화 시 염 처리에 따른 고정화 bCA 효소의 열(60℃, 48시간) 안정성을 확인한 결과로, A는 Chloride salt(LiCl, NaCl, KCl, RbCl, CsCl)를 처리한 후 고정화 bCA의 잔여 활성(residual activity)을 측정한 결과이고, B는 Sodium salt(NaF, NaCl, NaBr, NaI 또는 NaNO 3)를 처리한 후 고정화 bCA의 잔여 활성을 측정한 결과이며, C는 고정화 bCA 효소의 잔여 활성이 가장 우수하였던 CsCl의 최적 농도를 확인하기 위해 다양한 농도(0.01 M, 0.1 M, 0.5 M 및 1 M)를 처리한 후 고정화 bCA 효소의 잔여 활성을 측정한 결과이다. 통계 분석은 t-test를 이용하였으며, bar graph 바로 위의 asterisk(*)는 염 첨가하지 않은 대조군 대비 비교 결과이다( * p<0.05, ** p<0.01, *** p<0.001).Figure 4 is the result of confirming the thermal (60 ℃, 48 hours) stability of the immobilized bCA enzyme according to the salt treatment during immobilization of the fusion protein bCA-R5, A is a chloride salt (LiCl, NaCl, KCl, RbCl, CsCl) treatment and a result of a then measuring the residual activity (residual activity) of immobilized bCA, B is the result of measuring a residual activity after treated with Sodium salt (NaF, NaCl, NaBr , NaI or NaNO 3) immobilized bCA, C is These are the results of measuring the residual activity of the immobilized bCA enzyme after treatment with various concentrations (0.01 M, 0.1 M, 0.5 M and 1 M) to confirm the optimal concentration of CsCl, which exhibited the best residual activity of the immobilized bCA enzyme. Statistical analysis was performed using t- test, and the asterisk(*) just above the bar graph is a comparison result compared to the control group without salt ( * p <0.05, ** p <0.01, *** p <0.001).
도 5는 융합 단백질 bCA-R5, 융합 단백질 bCA-R5의 고정화 시 염이 처리되지 않은 조건에서 합성된 bCA-R5@silica, 및 염이 처리된 조건에서 합성된 bCA-R5@silica(0.1 M CsCl)를 고온(60℃)에서 반응시킨 후 고정화 bCA 효소의 잔여 활성(A) 및 반감기(B)를 측정한 결과이다.5 shows the fusion protein bCA-R5, bCA-R5@silica synthesized in unsalted conditions during immobilization of fusion protein bCA-R5, and bCA-R5@silica synthesized in salt-treated conditions (0.1 M CsCl). ) is the result of measuring the residual activity (A) and half-life (B) of the immobilized bCA enzyme after reacting it at a high temperature (60 ° C).
도 6은 융합 단백질 bCA-R5의 투석 버퍼의 pH 조건에 따라 bCA-R5@silica 및 bCA-R5@silica(salt)에 고정화된 bCA 효소의 반감기 증가 배수(fold change in half life)를 보여주는 결과이다.6 is a result showing the fold change in half life of the bCA enzyme immobilized in bCA-R5@silica and bCA-R5@silica (salt) according to the pH conditions of the dialysis buffer of the fusion protein bCA-R5. .
도 7은 융합 단백질 DsRed-R5의 고정화 시 염 처리에 따른 고정화 DsRed 단백질의 열(60℃, 24시간) 안정성을 확인한 결과로, 다양한 농도(0.1 M, 0.5 M 또는 1 M)의 CsCl를 처리하여 합성된 DsRed-R5@silica를 고온(60℃, 24시간)에서 반응시킨 후 고정화 DsRed 단백질의 형광 세기를 측정한 결과이다.7 is a result of confirming the thermal (60° C., 24 hours) stability of the immobilized DsRed protein according to salt treatment during immobilization of the fusion protein DsRed-R5, and various concentrations (0.1 M, 0.5 M or 1 M) of CsCl were treated These are the results of measuring the fluorescence intensity of the immobilized DsRed protein after reacting the synthesized DsRed-R5@silica at a high temperature (60° C., 24 hours).
본 발명의 목적을 달성하기 위하여, 본 발명은 목적 단백질 및 실리카 형성 펩타이드(silica forming peptide)의 융합 단백질, 염 및 실리카 전구체를 혼합하는 단계를 포함하는 것을 특징으로 하는 실리카 나노입자에 고정화된 목적 단백질의 안정성을 증가시키는 방법을 제공한다.In order to achieve the object of the present invention, the present invention provides a target protein immobilized on silica nanoparticles, characterized in that it comprises the step of mixing a fusion protein, a salt, and a silica precursor of the target protein and silica forming peptide A method for increasing the stability of
본 발명에서 용어 "목적 단백질(target protein)"은 실리카 나노입자에 고정하고자 하는 단백질을 의미한다.As used herein, the term “target protein” refers to a protein to be immobilized on silica nanoparticles.
상기 목적 단백질은 의료, 연구용 및 산업용 단백질, 예를 들어, 효소, 형광 단백질, 항원, 항체, 세포수용체, 구조 단백질, 혈청 및 세포 단백질로 이루어진 군으로부터 선택되는 어느 하나의 단백질일 수 있고, 바람직하게는 효소 단백질 또는 형광 단백질일 수 있으며, 더욱 바람직하게는 탄산무수화효소(carbonic anhydrase) 또는 DsRed(red fluorescent protein)일 수 있으나, 이에 제한되지 않는다. 또한, 상기 탄산무수화효소는 바람직하게는 소 유래 탄산무수화효소(bovine carbonic anhydrase, bCA)일 수 있으나, 이에 제한되지 않는다.The target protein may be any one protein selected from the group consisting of medical, research and industrial proteins, for example, enzymes, fluorescent proteins, antigens, antibodies, cell receptors, structural proteins, serum and cellular proteins, preferably may be an enzyme protein or a fluorescent protein, more preferably carbonic anhydrase or DsRed (red fluorescent protein), but is not limited thereto. In addition, the carbonic anhydrase may preferably be bovine carbonic anhydrase (bCA), but is not limited thereto.
본 발명의 일 구현 예에 따른 방법에 있어서, 상기 소 유래 탄산무수화효소 및 DsRed는 각각 서열번호 1 및 서열번호 3의 아미노산 서열로 이루어질 수 있고, 상기 소 유래 탄산무수화효소 및 DsRed를 코딩하는 유전자는 각각 서열번호 2 및 서열번호 4의 염기서열로 이루어질 수 있으나, 이에 제한되지 않는다.In the method according to one embodiment of the present invention, the bovine carbonic anhydrase and DsRed may consist of the amino acid sequences of SEQ ID NO: 1 and SEQ ID NO: 3, respectively, and encode the bovine carbonic anhydrase and DsRed The gene may consist of the nucleotide sequence of SEQ ID NO: 2 and SEQ ID NO: 4, respectively, but is not limited thereto.
또한, 본 발명의 일 구현 예에 따른 방법에 있어서, 상기 실리카 형성 펩타이드는 바람직하게는 서열번호 5의 아미노산 서열로 이루어진 실리카 형성 펩타이드 R5일 수 있으나, 이에 제한되지 않는다. In addition, in the method according to an embodiment of the present invention, the silica-forming peptide may preferably be a silica-forming peptide R5 consisting of the amino acid sequence of SEQ ID NO: 5, but is not limited thereto.
상기 실리카 형성 펩타이드 R5는 돌말류에서 발견된 라이신, 아르기닌 및 세린이 포함된 19개의 아미노산 잔기로 이루어진 펩타이드로, 폴리아민과 함께 실리카 형성을 위한 주형 및 촉매제로 작용한다. The silica-forming peptide R5 is a peptide consisting of 19 amino acid residues including lysine, arginine and serine found in diatoms, and functions as a template and catalyst for silica formation together with polyamines.
본 발명의 일 구현 예에 따른 방법에 있어서, 상기 염은 알칼리 금속염(alkali metallic salt)일 수 있고, 바람직하게는 염화세슘(Cesium chloride, CsCl), 염화리튬(Lithium chloride, LiCl), 염화나트륨(Sodium chloride, NaCl), 염화칼륨(Potassium chloride, KCl), 염화루비듐(Rubidium chloride, RbCl), 플루오린화나트륨(Sodium fluoride, NaF), 브로민화나트륨(Sodium bromide, NaBr), 아이오딘화나트륨(Sodium iodide, NaI) 또는 질산나트륨(Sodium nitrate, NaNO 3)일 수 있으며, 더욱 바람직하게는 염화세슘일 수 있으나, 이에 제한되지 않는다.In the method according to an embodiment of the present invention, the salt may be an alkali metallic salt, preferably cesium chloride (CsCl), lithium chloride (LiCl), sodium chloride (Sodium) chloride, NaCl), potassium chloride (KCl), rubidium chloride (RbCl), sodium fluoride (NaF), sodium bromide (NaBr), sodium iodide (Sodium iodide, NaI) or sodium nitrate (Sodium nitrate, NaNO 3 ) may be, and more preferably, cesium chloride, but is not limited thereto.
특히, 실리카에 단백질을 고정화할 시 염화세슘을 0.05~1 M의 최종농도로, 더욱 바람직하게는 염화세슘을 0.1M의 최종농도로 처리할 경우 실리카 나노입자에 고정화된 목적 단백질의 안정성을 증가시키는 효과가 우수하다.In particular, when protein is immobilized on silica, when cesium chloride is treated with a final concentration of 0.05 to 1 M, more preferably, cesium chloride is treated with a final concentration of 0.1 M, which increases the stability of the target protein immobilized on silica nanoparticles. The effect is excellent.
본 발명의 일 구현 예에 따른 방법에 있어서, 상기 실리카 전구체는 테트라메틸 오르토실리케이트(tetramethyl orthosilicate, TMOS) 또는 테트라에틸 오르토실리케이트(tetraethyl orthosilicate, TEOS)일 수 있고, 바람직하게는 TMOS일 수 있으나, 이에 제한되지 않는다.In the method according to an embodiment of the present invention, the silica precursor may be tetramethyl orthosilicate (TMOS) or tetraethyl orthosilicate (TEOS), preferably TMOS, but this not limited
또한, 본 발명은 Also, the present invention
목적 단백질 코딩 유전자 및 실리카 형성 펩타이드(silica forming peptide) 코딩 서열이 순차적으로 연결된 융합 단백질의 코딩 서열을 포함하는 재조합 벡터로 숙주 세포를 형질전환하는 단계;transforming the host cell with a recombinant vector comprising the coding sequence of the fusion protein in which the target protein coding gene and the silica forming peptide coding sequence are sequentially linked;
상기 형질전환된 숙주세포를 배양하여 목적 단백질 및 실리카 형성 펩타이드 R5의 융합 단백질의 발현을 유도하고 이를 수득하는 단계; 및culturing the transformed host cell to induce expression of a fusion protein of the target protein and the silica-forming peptide R5 and obtain the same; and
상기 수득한 융합 단백질에 염 및 실리카 전구체를 혼합하는 단계;를 포함하는, 고정화된 목적 단백질의 안정성이 증가된 실리카 나노입자의 제조방법 및 상기 방법에 의해 제조된 고정화된 목적 단백질의 안정성이 증가된 실리카 나노입자를 제공한다.Mixing a salt and a silica precursor to the obtained fusion protein; a method for producing silica nanoparticles with increased stability of the immobilized target protein, and a method for increasing the stability of the immobilized target protein prepared by the method Silica nanoparticles are provided.
또한, 본 발명의 일 구현 예에 따른 방법에 있어서, 상기 실리카 형성 펩타이드는 바람직하게는 서열번호 5의 아미노산 서열로 이루어진 실리카 형성 펩타이드 R5일 수 있으나, 이에 제한되지 않는다. In addition, in the method according to an embodiment of the present invention, the silica-forming peptide may preferably be a silica-forming peptide R5 consisting of the amino acid sequence of SEQ ID NO: 5, but is not limited thereto.
본 발명의 일 구현 예에 따른 제조방법에 있어서, 상기 재조합 벡터는 목적 단백질인 소 유래 탄산무수화효소 코딩 유전자 및 실리카 형성 펩타이드 R5 코딩 서열이 순차적으로 연결되거나, 목적 단백질인 DsRed 코딩 유전자 및 실리카 형성 펩타이드 R5 코딩 서열이 순차적으로 연결된 것일 수 있으나, 이에 특별히 제한되지 않고, 당업자가 대량으로 생산하고자 하는 단백질 코딩 유전자와 실리카 형성 펩타이드 R5 코딩 서열을 순차적으로 연결하여 구축될 수 있다.In the production method according to an embodiment of the present invention, the recombinant vector is a target protein, wherein the cow-derived carbonic anhydrase coding gene and the silica-forming peptide R5 coding sequence are sequentially linked, or the target protein DsRed coding gene and silica are formed The peptide R5 coding sequence may be sequentially linked, but it is not particularly limited thereto, and it may be constructed by sequentially linking a protein coding gene to be mass-produced by those skilled in the art and a silica-forming peptide R5 coding sequence.
또한, 본 발명의 일 구현 예에 따른 제조방법에 있어서, 상기 소 유래 탄산무수화 효소, DeRed 단백질, 염 및 실리카 전구체는 전술한 것과 같다.In addition, in the manufacturing method according to an embodiment of the present invention, the bovine carbonic anhydrase, DeRed protein, salt and silica precursor are the same as described above.
본 발명의 일 구현 예에 따른 제조방법에 있어서, 상기 염은 염화세슘(CsCl)일 수 있으며, 상기 염은 최종농도가 0.05~1M, 바람직하게는 0.1M이 되도록 혼합할 수 있으나, 이에 제한되지 않는다.In the preparation method according to an embodiment of the present invention, the salt may be cesium chloride (CsCl), and the salt may be mixed to a final concentration of 0.05 to 1M, preferably 0.1M, but is not limited thereto. does not
본 발명의 일 구현 예에 따른 제조방법에 있어서, 상기 실리카 형성 펩타이드 R5는 상온 및 중성 pH에서 분말 형태의 실리카 나노입자를 형성하기 위해 사용한 것으로, 기존 화학적 실리카 합성법에서 분말 형태의 실리카 나노입자를 형성할 때 장시간 고온(약 600℃)에서 열처리하는 과정을 수행하지 않아도 되고, 실리카가 아주 느린 속도로 겔(gel) 형태로만 형성되거나 중성 pH 부근에서 겔이 형성되지 않는 점을 개선시킬 수 있다. 또한, 실리카 형성 펩타이드 R5를 이용한 단백질 고정화는 실리카 합성과 동시에 단백질을 내부에 가둬두는 캡슐화(encapsulation)를 통한 고정화가 일어나므로, 단백질 고정화 시 염을 처리할 경우 첨가된 염은 실리카 내부에서 실리카와 효소 간의 안정화를 증진시키는 역할을 한다.In the preparation method according to an embodiment of the present invention, the silica-forming peptide R5 is used to form silica nanoparticles in powder form at room temperature and neutral pH, and forms silica nanoparticles in powder form in the conventional chemical silica synthesis method It is not necessary to carry out the process of heat treatment at high temperature (about 600° C.) for a long time, and it is possible to improve the fact that silica is formed only in the form of a gel at a very slow rate or that a gel is not formed near neutral pH. In addition, since protein immobilization using silica-forming peptide R5 is immobilized through encapsulation that traps the protein inside at the same time as silica synthesis, the added salt is added to the silica and enzyme inside the silica when the salt is processed during protein immobilization. It promotes liver stabilization.
용어 "재조합"은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 암호된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로서 인위적인 수단에 의해 세포 내 재도입된 것이다.The term “recombinant” refers to a cell in which the cell replicates, expresses a heterologous nucleic acid, or expresses a peptide, heterologous peptide or protein encoded by the heterologous nucleic acid. Recombinant cells can express genes or gene segments not found in the native form of the cell, either in sense or antisense form. Recombinant cells can also express genes found in cells in a natural state, but the genes are modified and re-introduced into cells by artificial means.
용어 "벡터"는 세포 내로 전달하는 DNA 단편(들), 핵산 분자를 지칭할 때 사용된다. 벡터는 DNA를 복제시키고, 숙주세포에서 독립적으로 재생산될 수 있다. 용어 "전달체"는 흔히 "벡터"와 호환하여 사용된다.The term “vector” is used to refer to a DNA fragment(s), a nucleic acid molecule, that is delivered into a cell. The vector replicates DNA and can be reproduced independently in a host cell. The term "carrier" is often used interchangeably with "vector."
발현 벡터는 바람직하게는 하나 이상의 선택성 마커를 포함한다. 상기 마커는 통상적으로 화학적인 방법으로 선택될 수 있는 특성을 갖는 핵산 서열로, 형질전환된 세포를 비형질전환 세포로부터 구별할 수 있는 모든 유전자가 이에 해당된다. 그 예로는 암피실린, 테트라사이클린 등이 있으나, 이에 한정되는 것은 아니다.The expression vector preferably comprises one or more selectable markers. The marker is a nucleic acid sequence having a characteristic that can be selected by a conventional chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples thereof include, but are not limited to, ampicillin, tetracycline, and the like.
본 발명의 벡터를 원핵 세포에 안정되면서 연속적으로 클로닝 및 발현시킬 수 있는 숙주세포는 당업계에 공지된 어떠한 숙주세포도 이용할 수 있으며, 예컨대, E. coli BL21, E. coli JM109, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, 바실러스 서브틸리스, 바실러스 츄린겐시스와 같은 바실러스 속 균주, 그리고 살모넬라 티피무리움, 세라티아 마르세슨스 및 다양한 슈도모나스 종과 같은 장내균과 균주 등이 있다.As a host cell capable of continuously cloning and expressing the vector of the present invention in a prokaryotic cell, any host cell known in the art may be used, for example, E. coli BL21, E. coli JM109, E. coli RR1 , E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus genus strains such as Bacillus thuringiensis, and Salmonella typhimurium, Serratia marcesens and various Pseudomonas There are enterobacteriaceae and strains such as species.
본 발명의 일 구현 예에 따른 숙주세포는 바람직하게는 대장균( Escherichia coli) BL21(DE3)일 수 있으나, 이에 제한되지 않는다.The host cell according to an embodiment of the present invention is preferably Escherichia coli BL21 (DE3), but is not limited thereto.
본 발명의 재조합 벡터를 숙주세포 내로 운반하는 방법은 CaCl 2 방법, 하나한 방법(Hanahan, D., 1983 J. Mol. Biol. 166, 557-580) 및 전기천공 방법 등에 의해 실시될 수 있다.The method of delivering the recombinant vector of the present invention into a host cell may be carried out by the CaCl 2 method, the Hanhan method (Hanahan, D., 1983 J. Mol. Biol. 166, 557-580) and the electroporation method.
본 발명의 제조방법에 있어서, 상기 형질전환된 숙주세포의 배양은 공지된 기술을 이용하여 목적 단백질 및 실리카 형성 펩타이드 R5의 융합 단백질의 발현에 적합한 배지에서 이루어질 수 있다. 적합한 배양 배지는 상업적으로 입수하시거나 예를 들면, American Type Culture Collection의 카탈로그와 같은 간행물에 기재된 성분 및 조성비에 따라 제조할 수 있으나, 이에 제한되지 않는다.In the production method of the present invention, the transformed host cell can be cultured in a medium suitable for expression of the fusion protein of the target protein and the silica-forming peptide R5 using a known technique. A suitable culture medium can be obtained commercially or can be prepared according to the ingredients and composition ratios described in publications such as, for example, catalogs of the American Type Culture Collection, but is not limited thereto.
또한, 본 발명의 제조방법은, 목적 단백질 및 실리카 형성 펩타이드 R5의 융합 단백질이 발현된 숙주세포로부터 융합 단백질을 분리 및 정제하는 단계를 추가로 포함할 수 있다. 상기 분리 방법은 예를 들어 원심분리, 여과, 추출, 분무 건조, 증발 또는 침전을 포함하는 통상적인 방법에 의해서 배지로부터 분리될 수 있지만, 이에 제한되는 것은 아니다. 더 나아가 분리된 단백질은 크로마토그래피(예를 들면 이온 교환, 친화성, 소수성 및 크기별 배제), 투석, 전기영동, 분별 용해(예를 들면 암모늄 설페이트 침전), SDS-PAGE 또는 추출을 포함하는 공지된 다양한 방법을 통해서 정제될 수 있다.In addition, the preparation method of the present invention may further include isolating and purifying the fusion protein from the host cell in which the fusion protein of the target protein and the silica-forming peptide R5 is expressed. The separation method may be separated from the medium by a conventional method including, for example, centrifugation, filtration, extraction, spray drying, evaporation or precipitation, but is not limited thereto. The isolated protein can further be purified by known methods including chromatography (eg ion exchange, affinity, hydrophobicity and size exclusion), dialysis, electrophoresis, fractional dissolution (eg ammonium sulfate precipitation), SDS-PAGE or extraction. It can be purified through various methods.
또한, 본 발명은 염화세슘(CsCl)을 유효성분으로 함유하는 실리카 나노입자에 고정화된 목적 단백질의 안정성을 증가시키기 위한 조성물을 제공한다. 본 발명의 조성물에서, 목적 단백질은 전술한 바와 같다.In addition, the present invention provides a composition for increasing the stability of a target protein immobilized on silica nanoparticles containing cesium chloride (CsCl) as an active ingredient. In the composition of the present invention, the target protein is as described above.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples only illustrate the present invention, and the content of the present invention is not limited to the following examples.
재료 및 방법Materials and Methods
1. 균주 배양 1. strain culture
유전자 재조합 벡터 제작을 위해서는 Escherichia coli TOP10 균주를, 단백질 발현을 위해서는 E. coli BL21(DE3) 균주를 사용하였다. 대장균은 LB(Luria-Bertani) 배지에서 37℃, 180 rpm 조건하에 배양되었으며 필요에 따라 50 ㎍/㎖ 암피실린(ampicillin)이 첨가되었다. Escherichia coli TOP10 strain was used for gene recombination vector production, and E. coli BL21(DE3) strain was used for protein expression. E. coli was cultured in LB (Luria-Bertani) medium at 37° C. and 180 rpm, and 50 μg/ml ampicillin was added as needed.
2.2. 목적 단백질 및 실리카 형성 펩타이드 R5가 결합된 융합 단백질 클로닝Cloning of a fusion protein in which the target protein and the silica-forming peptide R5 are bound
모델 효소로서 소 유래 탄산무수화효소(bovine carbonic anhydrase, bCA)와 red 형광 단백질인 monomeric DsRed를 선정하였다. bCA 코딩 유전자는 화학적으로 합성하였고 DsRed는 pDsRed-Monomer-N1으로부터 얻었으며, 상기 유전자들은 표 1의 프라이머를 이용하여 증폭하였다. 각 유전자의 PCR 산물은 우선 pGEM-T Easy 벡터에 클로닝되었고, 시퀀싱을 통해 서열을 확인하였다. 이들 유전자를 pET-22b(+) 벡터에 NdeI 및 HindⅢ 제한효소를 이용하여 각각 클로닝하여 pET-bCA와 pET-DsRed를 제작하였다. 그리고, 실리카 형성 펩타이드 R5 코딩 서열이 융합된 플라스미드를 제작하기 위해 상기 pET-bCA 및 pET-DsRed를 각각 HindⅢ와 XhoI으로 절단한 후 이 사이에 표 1의 R5 프라이머를 결합한 유전자 조각을 삽입하여 pET-bCA-R5와 pET-DsRed-R5를 제작하였다. 재조합 단백질 발현 시 서열의 C-말단에는 pET-22b(+) 벡터로부터 제공되는 헥사 히스티딘 태그(Hexa histidine-tag)가 융합되어 발현된다.As model enzymes, bovine carbonic anhydrase (bCA) and monomeric DsRed, a red fluorescent protein, were selected. The bCA coding gene was chemically synthesized and DsRed was obtained from pDsRed-Monomer-N1, and the genes were amplified using the primers in Table 1. The PCR product of each gene was first cloned into the pGEM-T Easy vector, and the sequence was confirmed through sequencing. These genes were cloned into pET-22b(+) vector using Nde I and Hind III restriction enzymes, respectively, to prepare pET-bCA and pET-DsRed. Then, in order to construct a plasmid in which the silica-forming peptide R5 coding sequence is fused, the pET-bCA and pET-DsRed were cut with Hind Ⅲ and Xho I, respectively, and the gene fragment bound with the R5 primer of Table 1 was inserted between them. pET-bCA-R5 and pET-DsRed-R5 were prepared. When expressing the recombinant protein, a hexahistidine tag provided from the pET-22b(+) vector is fused to the C-terminus of the sequence and expressed.
목적 단백질 및 실리카 형성 펩타이드 R5의 융합 단백질 클로닝을 위한 프라이머 정보Primer information for fusion protein cloning of target protein and silica-forming peptide R5
프라이머
명칭primer
designation 		프라이머 서열(5'→3') (서열번호)Primer sequence (5'→3') (SEQ ID NO:)
bCAbCA F: CATATGAGCCACCACTG (6)F: CATATG AGCCACCACTG (6)
R: AAGCTTCTTCGGGAAGCC (7)R: AAGCTT CTTCGGGAAGCC (7)
DsRedDsRed F: CATATGGACAACACCGAGGACG (8)F: CATATG GACAACACCGAGGACG (8)
R: AAGCTTCTGGGAGCCGGAGT (9)R: AAGCTT CTGGGAGCCGGAGT (9)
R5R5 F: AGCTTAGCAGCAAAAAATCTGGCTCCTATTCAGGCTCGAAAGGTTCTAAACGTCGCATTCTGC (10)F: AGCTTAGCAGCAAAAAATCTGGCTCCTATTCAGGCTCGAAAGGTTCTAAACGTCGCATTCTGC (10)
R: TCGAGCAGAATGCGACGTTTAGAACCTTTCGAGCCTGAATAGGAGCCAGATTTTTTGCTGCTA (11)R: TCGAGCAGAATGCGACGTTTAGAACCTTTCGAGCCTGAATAGGAGCCAGATTTTTTGCTGCTA (11)
밑줄 : 제한효소 서열Underline: restriction enzyme sequence
3. 단백질 발현 및 세포 분획3. Protein Expression and Cell Fractionation
상기 제작된 재조합 벡터 pET-bCA-R5 또는 pET-DsRed-R5를 E. coli BL21(DE3) 균주에 도입하여 이들을 37℃, 180 rpm에서 배양하였다. 세포 농도가 OD 600에서 0.6~0.8에 도달했을 때 0.1 mM(DeRed의 경우) 또는 1 mM(bCA의 경우) IPTG(isopropyl-b-D-thiogalactopyranoside)를 첨가한 후 25℃(DeRed의 경우) 또는 37℃(bCA의 경우)에서 각각 20시간 또는 10시간 동안 배양하였다. 배양이 완료된 후 세포를 4℃, 4,000 xg 조건으로 10분간 원심분리하여 세포를 회수하였고, 용해버퍼(lysis buffer; 50 mM sodium phosphate, 300 mM NaCl, 10 mM imidazole, pH 8.0)를 사용하여 세포를 재현탁시켰다. 상기 현탁된 세포들은 차가운 상태에서 초음파 처리(ultrasonication)를 통해 파쇄하였고, 파쇄액을 4℃, 10,000 xg 조건으로 10분간 원심분리하였다. 이후 상등액은 수용성 분획물(soluble fraction, S)로 명명하였고, 펠렛은 동일한 부피의 용해 버퍼로 재현탁시켜 불용성 분획물(insoluble fraction, IS)로 명명하였다. 각각의 세포 분획물은 이후 SDS-PAGE(sodium dodecyl sulfate-polyacrylamide gel electrophoresis) 및 쿠마씨 블루(coomassie blue) 염색을 통해 재조합 단백질의 발현 양상을 분석하였다. The prepared recombinant vector pET-bCA-R5 or pET-DsRed-R5 was introduced into the E. coli BL21 (DE3) strain and cultured at 37° C. and 180 rpm. 25 °C (for DeRed) or 37 °C after addition of 0.1 mM (for DeRed) or 1 mM (for bCA) IPTG (isopropyl-bD-thiogalactopyranoside) when the cell concentration reached 0.6-0.8 at OD 600 (in the case of bCA) for 20 hours or 10 hours, respectively. After the culture was completed, the cells were centrifuged for 10 minutes at 4°C and 4,000 x g to recover the cells, and the cells were washed with a lysis buffer (50 mM sodium phosphate, 300 mM NaCl, 10 mM imidazole, pH 8.0). resuspended. The suspended cells were disrupted by sonication in a cold state, and the lysate was centrifuged for 10 minutes at 4°C and 10,000 x g conditions. Thereafter, the supernatant was named as a soluble fraction (S), and the pellet was resuspended in the same volume of dissolution buffer and named as an insoluble fraction (IS). Each cell fraction was then analyzed for expression of the recombinant protein by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) and Coomassie blue staining.
4. 단백질 정제 4. Protein Purification
재조합 벡터 pET-bCA-R5 및 pET-DsRed-R5로부터 발현된 융합 단백질 bCA-R5 및 DsRed-R5의 정제를 위해 파쇄액의 수용성 분획물에 니켈-니트릴로트리아세트산 아가로스 비즈(Ni 2+-nitrilotriacetic acid agarose beads)를 첨가하여 단백질을 결합시킨 후 세척 버퍼(wash buffer; 50 mM sodium phosphate, 300 mM NaCl, 30 mM imidazole, pH 8.0)를 이용하여 비특이적으로 결합된 단백질을 제거하였다. 그 다음으로, 용출 버퍼(elution buffer; 50 mM sodium phosphate, 300 mM NaCl, 250 mM imidazole, pH 8.0)를 이용하여 정제된 단백질을 수득하였고, 정제된 융합 단백질 bCA-R5 및 DsRed-R5를 각각 pH 7.5의 20 mM sodium phosphate buffer 및 pH 5.5의 20 mM sodium phosphate buffer로 투석시켜 버퍼를 교환하였다.For purification of the fusion proteins bCA-R5 and DsRed-R5 expressed from the recombinant vectors pET-bCA-R5 and pET-DsRed-R5, nickel-nitrilotriacetic acid agarose beads (Ni 2+ -nitrilotriacetic acid) were added to the aqueous fraction of the lysate. agarose beads) were added to bind the protein, and then the non-specifically bound protein was removed using a wash buffer (50 mM sodium phosphate, 300 mM NaCl, 30 mM imidazole, pH 8.0). Next, a purified protein was obtained using an elution buffer (50 mM sodium phosphate, 300 mM NaCl, 250 mM imidazole, pH 8.0), and the purified fusion proteins bCA-R5 and DsRed-R5 were pH 8.0, respectively. The buffer was exchanged by dialysis with 20 mM sodium phosphate buffer of 7.5 and 20 mM sodium phosphate buffer of pH 5.5.
5. 단백질 정량5. Protein Quantification
투석을 마친 융합 단백질 bCA-R5 및 DsRed-R5를 변성 버퍼(denaturing buffer; 6 M guanidine hydrochloride GuHCl/20 mM sodium phosphate buffer, pH 7.5)와 섞어 100℃에서 10분간 가열하여 변성시킨 후 280 nm에서 흡광도를 측정하였다. 측정된 흡광도와 단백질 아미노산 서열을 통해 계산된 280 nm에서의 흡광 계수를 통해 단백질의 농도를 확인하였다. 흡광 계수 계산은 ProtParam (http://web.expasy.org/protparam/)을 이용하여 수행되었다. After dialysis, the fusion proteins bCA-R5 and DsRed-R5 were mixed with a denaturing buffer (6 M guanidine hydrochloride GuHCl/20 mM sodium phosphate buffer, pH 7.5) and denatured by heating at 100° C. for 10 minutes. Absorbance at 280 nm was measured. The concentration of the protein was confirmed through the measured absorbance and the extinction coefficient at 280 nm calculated from the protein amino acid sequence. The extinction coefficient calculation was performed using ProtParam (http://web.expasy.org/protparam/).
6. 생체 모방 실리카를 이용한 효소 고정화6. Enzyme Immobilization Using Biomimetic Silica
융합 단백질 bCA-R5 또는 DsRed-R5이 고정화된 실리카 합성을 위해 단백질 용액 700 ㎕, 염 200 ㎕, TMOS(acid-hydrolyzed 1 M tetramethyl orthosilicate) 100 ㎕(7:2:1의 부피 비율)를 섞어 1시간 동안 반응시켰다. 실리카 합성 시 첨가된 염은 염화세슘(CsCl), 염화리튬(LiCl), 염화나트륨(NaCl), 염화칼륨(KCl), 염화루비듐(RbCl), 플루오린화나트륨(NaF), 브로민화나트륨(NaBr), 아이오딘화나트륨(NaI) 또는 질산나트륨(NaNO 3)은 모두 증류수에 녹였으며, 실리카 형성 시 염의 최종 농도가 0.1 M이 되도록 하였다. 염이 첨가되지 않은 샘플을 제조할 경우 증류수를 같은 비율로 첨가하였고, 1 M TMOS는 실리카 합성 전에 1 mM HCl을 이용하여 20분 동안 미리 가수분해시켰다. 융합 단백질이 고정화된 실리카는 각각 bCA-R5@silica 및 DsRed-R5@silica로 명명하였고, 고정화 시 염이 처리된 실리카는 각각 bCA-R5@silica(salt) 및 DsRed-R5@silica(salt)로 명명하였다. 합성된 실리카는 증류수로 2회 세척한 후 20 mM sodium phosphate buffer(pH 7.5)에 재현탁되었다.For the synthesis of silica on which the fusion protein bCA-R5 or DsRed-R5 is immobilized, 700 μl of protein solution, 200 μl of salt, and 100 μl of TMOS (acid-hydrolyzed 1 M tetramethyl orthosilicate) (volume ratio of 7:2:1) were mixed 1 reacted for an hour. Salts added during silica synthesis are cesium chloride (CsCl), lithium chloride (LiCl), sodium chloride (NaCl), potassium chloride (KCl), rubidium chloride (RbCl), sodium fluoride (NaF), sodium bromide (NaBr), Sodium iodide (NaI) or sodium nitrate (NaNO 3 ) were all dissolved in distilled water, and the final concentration of the salt was 0.1 M when silica was formed. When preparing a sample without added salt, distilled water was added in the same ratio, and 1 M TMOS was pre-hydrolyzed with 1 mM HCl for 20 minutes before silica synthesis. The silica on which the fusion protein was immobilized was named bCA-R5@silica and DsRed-R5@silica, respectively, and the silica treated with salt during immobilization was named bCA-R5@silica (salt) and DsRed-R5@silica (salt), respectively. named. The synthesized silica was washed twice with distilled water and then resuspended in 20 mM sodium phosphate buffer (pH 7.5).
7. 실리카 정량 분석7. Silica Quantitative Analysis
융합 단백질 bCA-R5 고정화 시 형성된 실리카의 양은 β-silicomolybdate assay를 통해 측정되었다. bCA-R5@silica 및 bCA-R5@silica(salt)를 증류수로 2번 세척한 후 다시 1 ㎖의 증류수에 재현탁하였고, 이 중 100 ㎖의 샘플을 취하여 0.5 M NaOH 900 ㎖와 섞어 1시간 동안 녹였다. 상기 녹인 샘플 40 ㎖, 증류수 160 ㎖, molybdate 용액 800 ㎖를 섞어 96웰 플레이트에 분주한 후 plate reader의 370 nm에서 흡광도를 측정하였다. Molybdate 용액의 제조방법은 다음과 같다: 1.35 ㎖의 HCl(37%)을 증류수에 희석하여 40.3 ㎖로 만들고, 774.2 mg의 AHT(ammonium heptamolybdate tetrahydrate)를 증류수에 녹여 9.7 ㎖의 용액을 만든 후 두 용액을 섞고 NaOH를 이용해 pH를 1.12로 맞췄다. 정량분석에 있어 calibration curve는 0.5 M NaOH에 녹아있는 실리콘 표준 용액(silicon standard solution)으로 수행되었다. The amount of silica formed upon immobilization of the fusion protein bCA-R5 was measured by β-silicomolybdate assay. bCA-R5@silica and bCA-R5@silica (salt) were washed twice with distilled water and then resuspended in 1 ml of distilled water, and a sample of 100 ml was taken and mixed with 900 ml of 0.5 M NaOH for 1 hour. melted 40 ml of the dissolved sample, 160 ml of distilled water, and 800 ml of molybdate solution were mixed and dispensed in a 96-well plate, and absorbance was measured at 370 nm in a plate reader. The preparation method of the molybdate solution is as follows: 1.35 ml of HCl (37%) is diluted in distilled water to make 40.3 ml, and 774.2 mg of ammonium heptamolybdate tetrahydrate (AHT) is dissolved in distilled water to make 9.7 ml of the solution. were mixed and the pH was adjusted to 1.12 with NaOH. For quantitative analysis, the calibration curve was performed with a silicon standard solution dissolved in 0.5 M NaOH.
8. 단백질 활성 및 안정성 측정8. Measurement of protein activity and stability
실리카에 고정화된 bCA 활성은 CO 2 hydration assay를 이용하여 측정하였다. 차갑게 유지된 20 mM Tris buffer(100 μM phenol red, pH 8.3) 600 ㎕와 10 ㎕의 bCA 샘플과 섞어 1회용 큐벳에 넣은 뒤 4℃로 맞춰진 분광기에 넣어두었다. 차갑게 유지된 CO 2 포화 용액 400 ㎕를 재빠르게 첨가하고 섞은 후 570 nm에서 흡광도 변화를 측정하였다. pH 7.5에 해당하는 흡광도인 1.1에서 pH 6.5에 해당하는 흡광도인 0.2까지 흡광도가 떨어지는 데 걸리는 시간(t)을 구하였다. 또한, bCA 샘플 대신에 투석 버퍼(dialysis buffer)를 이용하여 자연적인 CO 2 수화(hydration) 반응에 의해 걸리는 시간(t0; blank)을 구하였으며, 효소 활성은 (t0-t)/t를 이용하여 계산하였다. 또한, 실리카에 고정화된 DsRed 활성은 형광세기 측정을 통해 확인하였다. DsRed-R5@silica 및 DsRed-R5@silica(salt) 샘플을 1/80로 희석하고 plate reader 상에서 excitation=550 nm, emission=590 nm으로 형광을 측정하였다. 열 안정성 측정을 위하여 각 샘플을 60℃에서 가열한 후 활성을 측정하였고, 이를 열 처리하지 않은 샘플의 활성과 비교하여 상대 활성을 나타내었다. 또한 시간에 따른 활성 감소 데이터를 이용하여 반감기를 계산하였다.The activity of bCA immobilized on silica was measured using a CO 2 hydration assay. After mixing 600 μl of 20 mM Tris buffer (100 μM phenol red, pH 8.3) kept cold and 10 μl of bCA sample, put it in a disposable cuvette, and put it in a spectrometer set at 4°C. 400 μl of a saturated solution of CO 2 kept cold was rapidly added and mixed, and the change in absorbance at 570 nm was measured. The time (t) for the absorbance to decrease from the absorbance 1.1 corresponding to pH 7.5 to 0.2, the absorbance corresponding to pH 6.5, was calculated. In addition, the time taken by the natural CO 2 hydration reaction (t0; blank) was obtained using a dialysis buffer instead of the bCA sample, and the enzyme activity was determined using (t0-t)/t Calculated. In addition, the activity of DsRed immobilized on silica was confirmed by measuring the fluorescence intensity. DsRed-R5@silica and DsRed-R5@silica (salt) samples were diluted to 1/80 and fluorescence was measured on a plate reader at excitation=550 nm and emission=590 nm. In order to measure thermal stability, each sample was heated at 60° C. and then the activity was measured, and the relative activity was compared with the activity of the non-heat-treated sample. In addition, the half-life was calculated using the activity reduction data over time.
9. 단백질 고정화 시 pH 조건에 따른 염 처리 효과9. Effect of salt treatment according to pH conditions during protein immobilization
융합 단백질 bCA-R5를 pH 5.5, 6.5, 7.5 또는 8.0의 버퍼(20 mM sodium phosphate)에서 투석함으로써, 단백질 고정화 과정에서 pH 조건에 따른 염 처리 효과를 비교하였다. 염은 염화세슘(CsCl)을 사용하였으며 최종 농도가 0.1M이 되도록 하였다. 각 pH 조건에서 합성된 실리카는 증류수로 2번 세척한 후 동일하게 pH 7.5 버퍼(20 mM sodium phosphate)에 재현탁하였고, 상기와 같은 방법으로 안정성을 측정하고 반감기를 계산하였다. The fusion protein bCA-R5 was dialyzed against pH 5.5, 6.5, 7.5 or 8.0 buffer (20 mM sodium phosphate) to compare the effect of salt treatment according to pH conditions during protein immobilization. Cesium chloride (CsCl) was used as the salt, and the final concentration was 0.1M. Silica synthesized at each pH condition was washed twice with distilled water and then resuspended in the same pH 7.5 buffer (20 mM sodium phosphate), and stability was measured and half-life was calculated in the same manner as above.
10. 실리카의 형태 분석10. Morphological Analysis of Silica
bCA-R5@silica 및 bCA-R5@silica(salt)를 증류수로 2회 세척하고 60℃에서 24시간 동안 건조시켰다. 건조된 실리카 샘플은 주사전자현미경(scanning electron microscope, SEM)을 통해 관찰되었다.bCA-R5@silica and bCA-R5@silica (salt) were washed twice with distilled water and dried at 60° C. for 24 hours. The dried silica sample was observed through a scanning electron microscope (SEM).
11. 단백질 구조 모델링 및 표면 전하 계산11. Protein Structure Modeling and Surface Charge Calculation
단백질 구조 모델링을 위해 bCA는 PDB ID: 1V9E를, DsRed는 PDB ID: 2VAD를 이용하였으며 UCSF chimera 프로그램을 사용하여 시각화하였다. 그리고, 단백질 전체 표면적에 대한 charged 아미노산의 비율은 dssp 알고리즘 (https://www3.cmbi.umcn.nl/xssp/)에 적용하여 계산하였다. 단백질의 등전점 (isoelectric point)은 Compute pI/Mw(https://web.expas y.org/compute_pi/)를 이용하여 아미노산 서열로부터 계산되었다.For protein structure modeling, PDB ID: 1V9E for bCA and PDB ID: 2VAD for DsRed were used and visualized using the UCSF chimera program. And, the ratio of charged amino acids to the total surface area of the protein was calculated by applying the dssp algorithm (https://www3.cmbi.umcn.nl/xssp/). The isoelectric point of the protein was calculated from the amino acid sequence using Compute pI/Mw (https://web.expas y.org/compute_pi/).
실시예 1. 융합 단백질 bCA-R5 및 DsRed-R5의 발현Example 1. Expression of fusion proteins bCA-R5 and DsRed-R5
소 유래 탄산무수화효소(bCA)와 실리카 형성 펩타이드 R5가 결합된 융합 단백질 bCA-R5를 37℃에서 1 mM IPTG 첨가를 통해 발현을 유도한 결과, 수용성 분획에서 과발현된 것을 확인하였다. 또한, red 형광 단백질인 DsRed와 실리카 형성 펩타이드 R5가 결합된 DsRed-R5를 25℃에서 0.1 mM IPTG 첨가를 통해 발현을 유도한 결과, bCA-R5와 마찬가지로 수용성 분획에서 과발현된 것을 확인하였다(도 1). As a result of inducing expression of the fusion protein bCA-R5 in which bovine carbonic anhydrase (bCA) and silica-forming peptide R5 were combined at 37° C. by addition of 1 mM IPTG, it was confirmed that overexpression in the aqueous fraction was obtained. In addition, as a result of inducing expression of DsRed-R5, which is a red fluorescent protein, and DsRed-R5, to which silica-forming peptide R5 is bound, at 25°C by addition of 0.1 mM IPTG, it was confirmed that it was overexpressed in the water-soluble fraction like bCA-R5 (FIG. 1). ).
실시예 2. 융합 단백질 bCA-R5 및 DsRed-R5의 실리카 고정화Example 2. Silica immobilization of fusion proteins bCA-R5 and DsRed-R5
융합 단백질 bCA-R5(pI=6.5) 또는 DsRed-R5(pI=5.4)의 고정화는 각각의 등전점보다 높거나 비슷한 pH(각각 pH 7.5 및 pH 5.5) 조건에서 진행되었다. 그 결과, 실리카가 형성됨과 동시에 융합 단백질이 성공적으로 고정화되었고, 단백질 고정화 과정에서 0.1 M의 CsCl을 첨가한 경우에도 융합 단백질이 성공적으로 고정화되었음을 확인하였다. Immobilization of the fusion proteins bCA-R5 (pI = 6.5) or DsRed-R5 (pI = 5.4) was performed at a pH higher than or similar to the respective isoelectric point (pH 7.5 and pH 5.5, respectively). As a result, it was confirmed that the fusion protein was successfully immobilized at the same time as silica was formed, and that the fusion protein was successfully immobilized even when 0.1 M CsCl was added during the protein immobilization process.
실시예 3. 실리카 정량 및 SEM 분석Example 3. Silica Quantification and SEM Analysis
융합 단백질 bCA-R5 고정화 시 형성된 실리카는 β-silicomolybdate assay를 통해 분석하였다. 그 결과, 염이 처리되지 않은 조건에서 고정화가 이루어진 경우 2.75(±0.1) g/L의 실리카가 형성되었고, 염을 처리한 조건에서는 3.06~3.4 g/L의 실리카가 형성되었으며, 특히 다양한 염 중에서 CsCl을 처리했을 때 실리카가 3.4 g/L의 가장 높은 농도로 형성되었음을 확인하였다(도 2). 즉, 염을 처리하지 않은 조건에 비해 염을 처리한 조건에서 형성된 실리카의 농도가 약 10% 이상 증가하였으므로, 단백질 고정화 과정에서 염을 처리할 경우 실리카 합성량을 증가시킬 수 있음을 알 수 있었다.Silica formed upon immobilization of the fusion protein bCA-R5 was analyzed by β-silicomolybdate assay. As a result, silica of 2.75 (±0.1) g/L was formed when immobilization was carried out in the untreated condition, and 3.06 to 3.4 g/L of silica was formed in the condition in which the salt was treated, especially among various salts. It was confirmed that silica was formed at the highest concentration of 3.4 g/L when CsCl was treated (FIG. 2). That is, since the concentration of silica formed in the salt-treated condition increased by about 10% or more compared to the non-salt-treated condition, it was found that the amount of silica synthesis could be increased when the salt was treated during the protein immobilization process.
또한, 합성된 실리카의 형태를 주사전자현미경(SEM)으로 관찰한 결과, bCA-R5@silica(0.1 M CsCl) 입자는 bCA-R5@silica 입자에 비해 큰 구형의 입자를 형성하였고(도 3), 이를 통해 생체모방 실리카 고정화에서 염의 첨가는 실리카 입자 성장에 긍정적인 역할을 수행하고 있음을 알 수 있었다.In addition, as a result of observing the form of the synthesized silica with a scanning electron microscope (SEM), the bCA-R5@silica (0.1 M CsCl) particles formed larger spherical particles compared to the bCA-R5@silica particles (Fig. 3). , it can be seen that the addition of salt plays a positive role in the growth of silica particles in biomimetic silica immobilization.
실시예 4. bCA 효소 고정화 시 염 처리에 따른 열 안정성 분석Example 4. Analysis of thermal stability according to salt treatment upon immobilization of bCA enzyme
염 처리를 통해 고정화된 bCA의 열 안정성을 분석하기 위해, bCA-R5@silica와 bCA-R5@silica(salt)를 60℃에서 48시간 동안 가열한 후 고정화된 bCA 효소의 잔여 활성을 측정하였다. To analyze the thermal stability of immobilized bCA through salt treatment, bCA-R5@silica and bCA-R5@silica (salt) were heated at 60° C. for 48 hours, and then the residual activity of the immobilized bCA enzyme was measured.
우선, 다양한 chloride salt를 처리한 결과, 염이 처리되지 않은 조건에서 합성된 bCA-R5@silica 보다 염이 처리된 조건에서 합성된 bCA-R5@silica(LiCl, NaCl, KCl, RbCl 또는 CsCl)에서 잔여 활성이 증가하였으며, LiCl=NaCl<KCl<RbCl<CsCl 순으로 높은 잔여 활성을 보였다(도 4A). 또한, 다양한 sodium salt(NaF, NaCl, NaBr, NaI 또는 NaNO 3)를 처리한 경우에는 모든 실험군에서 유사한 수준으로 잔여 활성을 보였다(도 4B). 따라서 염에 의한 효소 안정화 효과는 양이온에 의존적인 것으로 보이며, Hofmeister series에 따라 수화가 잘 되지 않는 양이온일수록 안정화 효과가 큰 것으로 나타났다.First, as a result of treatment with various chloride salts, bCA-R5@silica (LiCl, NaCl, KCl, RbCl or CsCl) synthesized under salt-treated conditions was higher than bCA-R5@silica synthesized under salt-untreated conditions. Residual activity increased, and showed a high residual activity in the order of LiCl=NaCl<KCl<RbCl<CsCl ( FIG. 4A ). In addition, when various sodium salts (NaF, NaCl, NaBr, NaI or NaNO 3 ) were treated, residual activity was exhibited at a similar level in all experimental groups ( FIG. 4B ). Therefore, the enzyme stabilizing effect by salt seems to be dependent on the cation, and according to the Hofmeister series, the more poorly hydrated cation, the greater the stabilizing effect.
또한, 고정화 bCA 효소의 잔여 활성 증가에 가장 효과적이었던 CsCl의 최적 처리 농도를 선별하기 위해 다양한 농도(0.01 M, 0.1 M, 0.5 M 또는 1 M)로 테스트한 결과, 가열 후 고정화 bCA 효소의 잔여 활성이 CsCl 무처리 대조군에 비해 CsCl 처리군에서 증가한 것을 확인하였고, 특히 0.01 M의 CsCl 처리군에 비해 0.1 M, 0.5 M 또는 1 M의 CsCl 처리군에서 잔여 활성이 현저히 증가한 것을 확인하였다(도 4C). 0.1 M, 0.5 M 또는 1 M의 CsCl 처리군은 서로 유사한 수준으로 높은 잔여 활성을 나타내었으므로, CsCl을 0.1 M의 농도로 처리하는 것이 가장 적절할 것으로 사료되었다. In addition, as a result of testing at various concentrations (0.01 M, 0.1 M, 0.5 M or 1 M) to select the optimal treatment concentration of CsCl that was most effective in increasing the residual activity of immobilized bCA enzyme, residual activity of immobilized bCA enzyme after heating It was confirmed that the CsCl treatment group increased compared to the CsCl untreated control group, and in particular, it was confirmed that the residual activity was significantly increased in the CsCl treatment group of 0.1 M, 0.5 M or 1 M compared to the CsCl treatment group of 0.01 M (Fig. 4C) . Since the 0.1 M, 0.5 M, or 1 M CsCl treatment groups exhibited high residual activity at a similar level to each other, it was considered that treatment with CsCl at a concentration of 0.1 M would be most appropriate.
그리고, 최적 농도인 0.1 M의 CsCl 존재 하에 bCA-R5를 고정화시킨 후 60℃에서 고정화된 bCA 효소의 잔여 활성 및 반감기를 측정한 결과, bCA-R5(비고정화) 및 bCA-R5@silica 보다 bCA-R5@silica(0.1 M CsCl)에 고정화된 bCA 효소의 잔여 활성이 장시간 유지되고 있음을 확인하였다(도 5A). 또한 고정화된 bCA 효소의 반감기는 bCA-R5(비고정화)에 비해 bCA-R5@silica에서 약 280배, bCA-R5@silica(0.1 M CsCl)에서 약 5,600배 증가한 것을 확인하였고, 특히 염이 처리되지 않은 bCA-R5@silica에 비해 염이 처리된 bCA-R5@silica(0.1 M CsCl)에서 고정화된 bCA의 반감기가 약 20배 증가된 것을 확인하였다(도 5B).In addition, after immobilizing bCA-R5 in the presence of 0.1 M CsCl, which is an optimal concentration, the residual activity and half-life of the immobilized bCA enzyme at 60 ° C. It was confirmed that the residual activity of the bCA enzyme immobilized in -R5@silica (0.1 M CsCl) was maintained for a long time (FIG. 5A). In addition, it was confirmed that the half-life of the immobilized bCA enzyme was increased by about 280 times in bCA-R5@silica and 5,600 times in bCA-R5@silica (0.1 M CsCl) compared to bCA-R5 (non-immobilized), especially salt treatment. It was confirmed that the half-life of the immobilized bCA in the salt-treated bCA-R5@silica (0.1 M CsCl) was increased by about 20 times compared to the non-bCA-R5@silica ( FIG. 5B ).
실시예 5. bCA 효소 고정화 시 pH 조건에 따른 염 처리 효과Example 5. Effect of salt treatment according to pH conditions upon immobilization of bCA enzyme
bCA 효소의 실리카 고정화 과정에서 실리카와 상호작용할 수 있는 효소 표면의 특성이 중요할 것이라 예상되어, 융합 단백질 bCA-R5의 투석 버퍼 pH를 조정하여 서로 다른 표면 전하를 가지도록 하였다. 그리고 8.5 이상의 pH 조건에서는 실리카가 합성되지 않았기 때문에 pH 조정 범위는 5.5~8.0으로 설정하였고, 각 pH 조건에서 합성된 bCA-R5@silica 및 bCA-R5@silica(0.1 M CsCl)를 60℃에서 반응시킨 후 반감기를 측정함으로서 고정화된 bCA 효소의 열 안정성을 분석하였다.In the process of silica immobilization of the bCA enzyme, the property of the enzyme surface that can interact with silica was expected to be important, so the pH of the dialysis buffer of the fusion protein bCA-R5 was adjusted to have different surface charges. And since silica was not synthesized at a pH condition of 8.5 or higher, the pH adjustment range was set to 5.5 to 8.0, and bCA-R5@silica and bCA-R5@silica (0.1 M CsCl) synthesized at each pH condition were reacted at 60°C. The thermal stability of the immobilized bCA enzyme was analyzed by measuring the half-life.
그 결과, pH 5.5에 비해 pH 6.5, pH 7.5 및 pH 8.0 조건에서 고정화를 진행한 bCA-R5@silica(0.1 M CsCl) 반감기가 대체로 높은 수준을 나타내었다. 또한 pH 5.5 조건에서 염을 첨가하지 않은 대조군에 비해 CsCl 첨가 후 반감기 증가 폭이 약 1.3배로 가장 낮은 안정성 증가를 보인 반면, pH 8.0 조건에서는 반감기 증가 폭이 약 32배로 가장 높은 안정성 증가를 보였다(도 6). 따라서, bCA-R5@silica 대비 bCA-R5@silica(salt)의 높은 안정성 증가를 위해서는 고정화 시 효소의 표면 전하가 상대적으로 (-) 전하를 띠는 조건이 최적인 것으로 사료되었다.As a result, the half-life of bCA-R5@silica (0.1 M CsCl) immobilized at pH 6.5, pH 7.5, and pH 8.0 was generally higher than that of pH 5.5. In addition, compared to the control without adding salt in the pH 5.5 condition, the half-life increased by about 1.3 times after the addition of CsCl, showing the lowest stability increase, whereas at the pH 8.0 condition, the half-life increased by about 32 times, showing the highest stability increase (Fig. 6). Therefore, in order to increase the high stability of bCA-R5@silica (salt) compared to bCA-R5@silica, it was considered that the condition in which the surface charge of the enzyme was relatively negative during immobilization was considered optimal.
실시예 6. DsRed 단백질 고정화 시 염 처리에 따른 열 안정성 분석Example 6. Thermal stability analysis according to salt treatment during DsRed protein immobilization
염 처리를 통해 고정화된 DsRed 단백질의 열 안정성을 분석하기 위해, DsRed-R5@silica와 DsRed-R5@silica(salt)를 60℃에서 24시간 동안 가열한 후 고정화된 DsRed 단백질의 형광 세기를 측정하였다. To analyze the thermal stability of the immobilized DsRed protein through salt treatment, DsRed-R5@silica and DsRed-R5@silica (salt) were heated at 60° C. for 24 hours, and then the fluorescence intensity of the immobilized DsRed protein was measured. .
그 결과, DsRed-R5@silica에 비해 DsRed-R5@silica(0.1M CsCl)에 고정화된 DsRed 단백질의 잔여 형광이 더 높았으며, 이를 통해 염 처리는 bCA-R5뿐만 아니라 고정화된 DsRed-R5의 안정성 향상에도 효과적임을 확인하였다. 상기 bCA-R5 결과(도 5C)와는 다르게 단백질 고정화 과정에서 처리된 CsCl의 농도에 비례하여 고정화된 DsRed 단백질의 잔여 형광 세기가 증가한 것을 확인하였다(도 7).As a result, the residual fluorescence of the DsRed protein immobilized on DsRed-R5@silica (0.1 M CsCl) was higher than that of DsRed-R5@silica, and through this, the salt treatment resulted in a higher stability of the immobilized DsRed-R5 as well as bCA-R5. It was also confirmed to be effective for improvement. Unlike the bCA-R5 result (FIG. 5C), it was confirmed that the residual fluorescence intensity of the immobilized DsRed protein increased in proportion to the concentration of CsCl treated during the protein immobilization process (FIG. 7).
이러한 결과는 bCA와 DsRed의 염(salt) 요구량 차이에 의한 것으로 보이며, 효소의 표면에 존재하는 음전하 아미노산의 비율에 의해 달라지는 것으로 사료되었다. 많은 음전하 아미노산을 지닐수록 고정화 시 안정화를 위해 높은 농도의 염이 필요한 것으로 판단된다. 즉, bCA의 표면은 산성 아미노산(acidic amino acid)이 20.7%를 차지하고 있는 반면, DsRed의 표면은 산성 아미노산이 26.9%를 차지하고 있다. 따라서, 단백질 표면의 산성 아미노산의 비율이 높을 수록 안정화를 위해 더 높은 농도의 염이 필요할 것으로 사료되었다.This result appears to be due to the difference in salt requirements between bCA and DsRed, and it is thought to be different depending on the ratio of negatively charged amino acids present on the surface of the enzyme. It is judged that a higher concentration of salt is required for stabilization during immobilization as it has more negatively charged amino acids. That is, the surface of bCA occupies 20.7% of acidic amino acids, whereas the surface of DsRed occupies 26.9% of acidic amino acids. Therefore, it was thought that the higher the ratio of acidic amino acids on the protein surface, the higher the salt concentration would be required for stabilization.

Claims (12)

  1. 목적 단백질 및 실리카 형성 펩타이드(silica forming peptide)의 융합 단백질, 염 및 실리카 전구체를 혼합하는 단계를 포함하는 것을 특징으로 하는 실리카 나노입자에 고정화된 목적 단백질의 안정성을 증가시키는 방법.A method of increasing the stability of a target protein immobilized on silica nanoparticles, comprising mixing a fusion protein, a salt, and a silica precursor of the target protein and silica forming peptide.
  2. 제1항에 있어서, 상기 실리카 형성 펩타이드는 서열번호 5의 아미노산 서열로 이루어진 실리카 형성 펩타이드 R5인 것을 특징으로 하는 실리카 나노입자에 고정화된 목적 단백질의 안정성을 증가시키는 방법.The method of claim 1, wherein the silica-forming peptide is a silica-forming peptide R5 consisting of the amino acid sequence of SEQ ID NO: 5. The method for increasing the stability of a target protein immobilized on silica nanoparticles.
  3. 제1항에 있어서, 상기 염은 알칼리 금속염인 것을 특징으로 하는 실리카 나노입자에 고정화된 목적 단백질의 안정성을 증가시키는 방법.The method of claim 1, wherein the salt is an alkali metal salt.
  4. 제3항에 있어서, 상기 알칼리 금속염은 염화세슘(CsCl), 염화리튬(LiCl), 염화나트륨(NaCl), 염화칼륨(KCl), 염화루비듐(RbCl), 플루오린화나트륨(NaF), 브로민화나트륨(NaBr), 아이오딘화나트륨(NaI) 또는 질산나트륨(NaNO 3)인 것을 특징으로 하는 실리카 나노입자에 고정화된 목적 단백질의 안정성을 증가시키는 방법.4. The method of claim 3, wherein the alkali metal salt is cesium chloride (CsCl), lithium chloride (LiCl), sodium chloride (NaCl), potassium chloride (KCl), rubidium chloride (RbCl), sodium fluoride (NaF), sodium bromide (NaBr) ), sodium iodide (NaI) or sodium nitrate (NaNO 3 ) Method of increasing the stability of the target protein immobilized on silica nanoparticles, characterized in that.
  5. 제1항에 있어서, 상기 실리카 전구체는 테트라메틸 오르토실리케이트(tetramethyl orthosilicate) 또는 테트라에틸 오르토실리케이트(tetraethyl orthosilicate)인 것을 특징으로 하는 실리카 나노입자에 고정화된 목적 단백질의 안정성을 증가시키는 방법.The method of claim 1, wherein the silica precursor is tetramethyl orthosilicate or tetraethyl orthosilicate.
  6. 목적 단백질 코딩 유전자 및 실리카 형성 펩타이드(silica forming peptide) 코딩 서열이 순차적으로 연결된 융합 단백질의 코딩 서열을 포함하는 재조합 벡터로 숙주 세포를 형질전환하는 단계;transforming the host cell with a recombinant vector comprising the coding sequence of the fusion protein in which the target protein coding gene and the silica forming peptide coding sequence are sequentially linked;
    상기 형질전환된 숙주세포를 배양하여 목적 단백질 및 실리카 형성 펩타이드 R5의 융합 단백질의 발현을 유도하고 이를 수득하는 단계; 및culturing the transformed host cell to induce expression of a fusion protein of the target protein and the silica-forming peptide R5 and obtain the same; and
    상기 수득한 융합 단백질에 염 및 실리카 전구체를 혼합하는 단계;를 포함하는, 고정화된 목적 단백질의 안정성이 증가된 실리카 나노입자의 제조방법.Mixing a salt and a silica precursor to the obtained fusion protein; A method for producing silica nanoparticles with increased stability of the immobilized target protein.
  7. 제6항에 있어서, 상기 목적 단백질은 효소, 형광 단백질, 항원, 항체, 세포수용체, 구조 단백질, 혈청 및 세포 단백질로 이루어진 군으로부터 선택되는 어느 하나의 단백질인 것을 특징으로 하는 고정화된 목적 단백질의 안정성이 증가된 실리카 나노입자의 제조방법.The stability of the immobilized target protein according to claim 6, wherein the target protein is any one protein selected from the group consisting of enzymes, fluorescent proteins, antigens, antibodies, cell receptors, structural proteins, serum and cellular proteins. A method for producing this increased silica nanoparticles.
  8. 제6항에 있어서, 상기 염은 염화세슘(CsCl)인 것을 특징으로 하는 고정화된 목적 단백질의 안정성이 증가된 실리카 나노입자의 제조방법.The method of claim 6, wherein the salt is cesium chloride (CsCl).
  9. 제6항에 있어서, 상기 염은 최종 농도가 0.05~1M이 되도록 혼합하는 것을 특징으로 하는 고정화된 목적 단백질의 안정성이 증가된 실리카 나노입자의 제조방법.[Claim 7] The method of claim 6, wherein the salt is mixed so as to have a final concentration of 0.05 to 1M.
  10. 제6항에 있어서, 상기 숙주 세포는 대장균인 것을 특징으로 하는 고정화된 목적 단백질의 안정성이 증가된 실리카 나노입자의 제조방법.The method of claim 6, wherein the host cell is E. coli. The method for producing silica nanoparticles with increased stability of the immobilized target protein.
  11. 제6항 내지 제10항 중 어느 한 항의 방법에 의해 제조된 고정화된 목적 단백질의 안정성이 증가된 실리카 나노입자.The silica nanoparticles having increased stability of the immobilized target protein prepared by the method of any one of claims 6 to 10.
  12. 염화세슘(CsCl)을 유효성분으로 함유하는 실리카 나노입자에 고정화된 목적 단백질의 안정성을 증가시키기 위한 조성물.A composition for increasing the stability of a target protein immobilized on silica nanoparticles containing cesium chloride (CsCl) as an active ingredient.
PCT/KR2021/004311 2020-06-15 2021-04-07 Method for increasing stability of target protein immobilized in silica nanoparticle through salt treatment WO2021256674A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0072553 2020-06-15
KR1020200072553A KR102420704B1 (en) 2020-06-15 2020-06-15 Method for increasing stability of target protein immobilized in silica nanoparticle by salt treatment

Publications (1)

Publication Number Publication Date
WO2021256674A1 true WO2021256674A1 (en) 2021-12-23

Family

ID=79164326

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/004311 WO2021256674A1 (en) 2020-06-15 2021-04-07 Method for increasing stability of target protein immobilized in silica nanoparticle through salt treatment

Country Status (2)

Country Link
KR (1) KR102420704B1 (en)
WO (1) WO2021256674A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114702832B (en) * 2022-06-07 2022-08-23 江西中医药大学 Corn protein-silicon dioxide compound emulsion and preparation method and application thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140030419A (en) * 2012-08-28 2014-03-12 고려대학교 산학협력단 Modified green fluorescent protein capable of silica deposition and use thereof
US9920304B2 (en) * 2011-09-30 2018-03-20 Korea University Research And Business Foundation, Sejong Campus Peptide capable of silica deposition and use thereof
US20180244725A1 (en) * 2017-02-15 2018-08-30 Massachusetts Institute Of Technology Peptide-based synthetic molecules and silica nanostructures
KR102107515B1 (en) * 2016-04-22 2020-05-07 고려대학교 세종산학협력단 Recombinant protein capable of silica deposition and use thereof
KR20200053289A (en) * 2018-11-08 2020-05-18 한국전력공사 Fusion protein comprising carbonic anhydrase and silica affinity peptide, and preparation method thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101964155B1 (en) * 2016-05-10 2019-04-02 포항공과대학교 산학협력단 A fusion protein comprising virus coat protein and silica forming peptide and its use
KR102401223B1 (en) * 2019-02-15 2022-05-25 고려대학교 세종산학협력단 Linker composition comprising silica-forming peptides

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9920304B2 (en) * 2011-09-30 2018-03-20 Korea University Research And Business Foundation, Sejong Campus Peptide capable of silica deposition and use thereof
KR20140030419A (en) * 2012-08-28 2014-03-12 고려대학교 산학협력단 Modified green fluorescent protein capable of silica deposition and use thereof
KR102107515B1 (en) * 2016-04-22 2020-05-07 고려대학교 세종산학협력단 Recombinant protein capable of silica deposition and use thereof
US20180244725A1 (en) * 2017-02-15 2018-08-30 Massachusetts Institute Of Technology Peptide-based synthetic molecules and silica nanostructures
KR20200053289A (en) * 2018-11-08 2020-05-18 한국전력공사 Fusion protein comprising carbonic anhydrase and silica affinity peptide, and preparation method thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
LIM, GYUNTAEK: "Enhancing the Stability of the Enzyme Immobilized on Biomimetic Silica by Adding Salt", THESIS, February 2021 (2021-02-01), Korea, pages 1 - 65, XP009533128 *

Also Published As

Publication number Publication date
KR20210155257A (en) 2021-12-22
KR102420704B1 (en) 2022-07-14

Similar Documents

Publication Publication Date Title
JPH07502647A (en) Ubiquitin-specific protease
KR20200135191A (en) Novel EctP1-peptide tag and method for immobilization or purification of recombinant proteins using thereof
KR101218206B1 (en) Gold-doped fluorescent silica nanoparticles composite and Preparing method thereof
CN113603756B (en) Corynebacterium glutamicum membrane protein Ncgl2775, surface display system and construction method thereof
JP2009502125A5 (en)
EP3613851A1 (en) Recombinant dna polymerase
CN113195521A (en) Mtu Delta I-CM intein variants and uses thereof
WO2021256674A1 (en) Method for increasing stability of target protein immobilized in silica nanoparticle through salt treatment
Nam et al. A novel route for immobilization of proteins to silica particles incorporating silaffin domains
CN109952149A (en) Improved chromatography resin, its production and application
CN112941062A (en) Nitrile hydratase lysine mutant HBA-K2H1, coding gene and application
CN112175980B (en) Method for improving activity of polymerase large fragment through site-directed mutagenesis and application
KR20170126794A (en) A fusion protein comprising virus coat protein and silica forming peptide and its use
CN104130996B (en) Arginine deiminase mutant from arthritis-type mycoplasma and application thereof
CN113151234B (en) Nitrile hydratase lysine mutant HBA-K2H2R, coding gene and application
KR102107515B1 (en) Recombinant protein capable of silica deposition and use thereof
CN111019922B (en) Mutant restriction enzyme BsaI and preparation method and application thereof
CN114645033A (en) Nucleoside triphosphate hydrolase and purification method and application thereof
CN110484518B (en) Self-assembled short peptide tag marked fluoridase aggregate and application
CN114134128A (en) Omega-transaminase mutant based on ancestral sequence reconstruction
CN115698281A (en) Protein immobilization support and method for producing same
CN113151233A (en) Nitrile hydratase lysine mutant HBA-K2H2, coding gene and application
WO2022211277A1 (en) Method for immobilization of biomimetic silica in whole cell catalyst for increased thermal stability
US8137943B2 (en) Heat-resistant DNA ligase with high reactivity
WO2008047936A1 (en) LYTIC ENZYME INHIBITOR, LYSIS INHIBITOR, INHIBITOR OF DEGRADATION OF POLY-γ-GLUTAMIC ACID, AND METHOD FOR PRODUCTION OF POLY-γ-GLUTAMIC ACID

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21824778

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21824778

Country of ref document: EP

Kind code of ref document: A1