KR101218206B1 - Gold-doped fluorescent silica nanoparticles composite and Preparing method thereof - Google Patents
Gold-doped fluorescent silica nanoparticles composite and Preparing method thereof Download PDFInfo
- Publication number
- KR101218206B1 KR101218206B1 KR1020100135843A KR20100135843A KR101218206B1 KR 101218206 B1 KR101218206 B1 KR 101218206B1 KR 1020100135843 A KR1020100135843 A KR 1020100135843A KR 20100135843 A KR20100135843 A KR 20100135843A KR 101218206 B1 KR101218206 B1 KR 101218206B1
- Authority
- KR
- South Korea
- Prior art keywords
- gold
- nanoparticles
- fluorescent
- fluorescent silica
- silica
- Prior art date
Links
Images
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Food Science & Technology (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Inorganic Chemistry (AREA)
- Crystallography & Structural Chemistry (AREA)
- Nanotechnology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Manufacturing & Machinery (AREA)
- Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
Abstract
Gold-fluorescent silica nanoparticle composite of the present invention is fluorescent silica nanoparticles, gold nanoparticles ultrasonically deposited on the surface of the fluorescent silica nanoparticles; And a gold binding peptide bound to the surface of the gold nanoparticles.
Since the gold-fluorescence silica nanoparticle composite of the present invention is excellent in light stability, it is very suitable for use in biosensors, bioseparation membranes, and the like, and its commercial process is excellent because of its simple manufacturing process.
Description
The present invention relates to a gold-fluorescent silica nanoparticle composite and a method for producing the same.
Metal nanoparticles such as gold, silver, platinum and palladium are widely used in various catalysts, preservatives, chemicals and biosensors, and the like, and are prepared by reducing metals from aqueous solutions of metal ions. However, if the generated metal nanoparticles are not stabilized, the metal nanoparticles are bonded to each other to form a metal mass, and thus the size of the nanoparticles is not uniform, and the surface area per unit weight of the nanoparticles is reduced.
In order to solve such a problem, a stable polymer material for supporting the prepared metal nanoparticles is required. However, a polymer material for supporting the reducing agent, the reducing agent by-product, and the nano metal particles remaining after the reduction reaction has a problem of becoming a major pollutant that contaminates the produced metal nanoparticles. In the case of the polymer material for supporting the nano metal particles, since it is essential to keep the metal nanoparticles in a stable state and cannot be essentially removed, the use of the metal nanoparticles may vary depending on the characteristics of the polymer material for supporting the nano metal particles. It may be determined. For example, in the manufacture of medical metal nanoparticles there is a restriction that can not use a toxic polymer material.
In addition, in addition to manufacturing metal nanoparticles, fixing metal nanoparticles to a polymer material is also an important problem. For example, in the case of an unfixed metal nanoparticle, such as a catalyst, which must be continuously fixed, Not suitable for use Conventional methods for fixing metal nanoparticles include coating a predetermined material with a molecule containing a thiol group, an amine group, etc., and positioning the molecular nanoparticles with active groups by mutual attraction between them. The metal nanoparticles were fixed to the. However, this method not only complicates the manufacturing process because the metal nanoparticles have to be prepared separately, but it is also difficult to stably coat molecules with specific active groups on all materials, thereby limiting its application.
Recently, hybrid fluorescent organic nanoparticles have been very interested in chemistry, biotechnology, and medicine because of their excellent biocompatibility and light stability, and have been developed using quantum dots, gold, silica, and europium oxide. However, the developed hybrid fluorescent organic nanoparticles also do not overcome the toxicity problem of nanoparticles, and has a problem of low light stability.
In addition, in order to fix the protein on the metal nanoparticles, complex surface chemistry is required, and high protein purity is required, and complex purification processes must be included.
Therefore, one of the requirements for the development of biosensors is the development of a technology that can selectively and stably fix biomaterials to desired nanoparticles. Traditional immobilization methods can be largely divided into four. The first is to physically or chemically adsorb biomaterials to the surface of the sensor chip, and the second is to generate covalent bonds to the biomaterial on the sensor chip surface. The third method is to capture biomaterials in membranes, matrices, polymers, and the like. Finally, there is a method of inducing crosslinking between biomaterials and immobilizing them on the sensor chip surface.
Recently, a base sequence of a metal binding protein (MBP), a peptide that selectively binds to inorganic metals such as gold, iron oxide, zinc oxide, platinum, silver, silicon dioxide, and zeolite has been identified using phage display or bacterial display technology. (Sarikaya, M. et al., Nature Materials, 2: 577, 2003). Among the metal binding proteins, gold binding protein (GBD) consisting of 14 amino acids was found to selectively bind to the gold surface (Brown, S., Nature Biotechnol., 15: 269, 1997). There is progress, but the exact mechanism by which GBP recognizes and binds to the gold surface is still unknown.
The present inventors have tried to solve the problems of the existing metal-organic nanocomposites or metal-polymer nanocomposites, so as to fix the gold nanoparticles on the silica surface, without using an amine compound or a thiol compound that is toxic by using ultrasonic waves It was also found that the deposition can be effectively deposited, and the present invention was also completed by introducing a gold-binding polypeptide onto gold nanoparticles deposited on a silica surface for application to a biosensor, a bioseparation membrane, or the like.
Gold-fluorescent silica nanoparticle composite according to one feature of the present invention for solving the above problems is fluorescent silica nanoparticles; Gold nanoparticles ultrasonically deposited on the surface of the fluorescent silica nanoparticles; And a gold binding peptide bound to the surface of the gold nanoparticles.
According to another aspect of the present invention, a method for preparing a gold-fluorescence silica nanoparticle composite includes rupee, FITC, DAPI, TRTIC, lohodamine, Texas red, Alexa Fluor 350, 405, 430, 488, 500, 514, 633, 647 1, preparing a fluorescent dye solution containing 660, 680, 700, cy3, cy5, or cy7; Preparing a fluorescent silica nanoparticle (SiNPs) solution by adding and reacting a silica precursor and NH 4 OH to the fluorescent dye solution; And adding gold precursor solution and NH 4 OH to the solution of the fluorescent silica nanoparticles (SiNPs), and then irradiating with ultrasonic waves, gold-silica nanoparticles (gold-fluorescence silica nanoparticles) in which gold nanoparticles were deposited on the outer circumferential surface of the fluorescent SiNPs. 3) preparing particles); .
The gold-fluorescent silica nanoparticle composite of the present invention is free of biotoxicity because it is composed of fluorescent silica nanoparticles, gold nanoparticles, and gold-binding polypeptides, which do not use amine compounds or thiol compounds and have no toxicity in vivo.
In addition, since the gold-fluorescence silica nanoparticle composite of the present invention is excellent in light stability, it is very suitable for use in biosensors, bioseparation membranes, and the like, and its commercialization is excellent because of its simple manufacturing process.
1A to 1C are FE-SEM photographs of fluorescent silica nanoparticles prepared in Examples 1- (1) to 1- (3), respectively.
2A to 2C are results of measurement of photoluminescence spectra (PL) of fluorescent silica nanoparticles prepared in Examples 1- (1) to 1- (3), respectively.
3 is a fluorescence image photograph of the fluorescent silica nanoparticle powder prepared in Examples 1- (1) to 1- (3).
4A to 4C are FE-SEM photographs of the gold-fluorescence silica nanoparticles prepared in Example 2, respectively.
5 schematically shows the construction of the recombinant plasmid pET-6HisGBP used in Example 3. FIG.
6 is a confocal micrograph of the gold-fluorescence silica nanoparticle composite according to Example 4. FIG.
7 is a TEM photograph of the gold-fluorescence silica nanoparticle composite according to Example 4. FIG.
8 is a TEM photograph of the gold-fluorescence silica nanoparticle composite according to Comparative Example 1.
9 is a TEM image of the gold-fluorescence silica nanoparticle composite according to Comparative Example 2.
The present inventors, by ultrasonically depositing the gold nanoparticles to the fluorescent silica nanoparticles, without using a biotoxic material such as an amine compound or a thiol compound, the gold-fluorescence nanoparticle composite (or gold-fluorescence silica nanoparticles ( It was found that Au-Si Nanoparticles)) can be obtained, thus leading to the present invention.
The gold-fluorescent nanoparticle complex of the present invention may further add a gold binding polypeptide (GBP) in order to improve binding with a biological material. Through such gold binding polypeptides, biological substances such as antigens can be further bound.
In particular, the antigen-binding form is defined herein as a 'GBP-a (gold binding polypeptide-antigen) complex'.
Hereinafter, the present invention will be described in more detail.
Gold-fluorescent silica nanoparticle composite of the present invention comprises fluorescent silica nanoparticles, and gold nanoparticles deposited on the surface of the fluorescent silica nanoparticles. In addition, the gold-fluorescence silica nanoparticle complex of the present invention may further include a gold binding polypeptide on the surface of the gold nanoparticles. Here, the gold binding polypeptide allows the biomaterial to bind to the gold-fluorescent silica nanoparticle complex. Such biological materials are not particularly limited, but antiviral antibodies or antigens can be used, for example. And for labeling such a biomaterial, the biomaterial may further include magnetic nanoparticles as a label.
In the present invention, the fluorescent silica (silica) nanoparticles are prepared by reacting a silica precursor and a fluorescent dye, the fluorescent dye is Rupy (Rubpy) (tris (2,2-bipyridyl) ruthenium (II)), FITC ( fluorescein isothiocyanate, DAPI (4 ', 6-diamidino-2-phenylindole), TRTIC (Tetramethylrhodamine-5- (and 6) -isothiocyanate), Rohodamine, Texas red, Alexa fluor ) 350, 405, 430, 488, 500, 514, 633, 647, 660, 680, 700, cy3, cy5, or cy7 may be selected and used depending on the application.
The fluorescent silica nanoparticles are not particularly limited, but are preferably spherical particles having an average diameter of 20 to 900 nm, preferably spherical particles having an average diameter of 40 to 100 nm, more preferably 40 to 80 nm.
In this case, when the average diameter is less than 20 nm, the particle size is too small, so that the possibility of permeation into the cell increases, and it may be difficult to fuse the gold nanoparticles. Since the surface area may be small, it is preferable to use one having a diameter within the above range.
In addition, the silica precursor may be used generally used in the art, preferably tetraethylorthosilicate, trimethoxyphenylsilane, (3-aminopropyl) trimethoxysilane or trimethoxysilane It is recommended to use one selected from phosphorus.
The gold nanoparticles are introduced in consideration of factors such as biocompatibility, biocompatibility, and bioactivity among various metal particles, and those having an average diameter of 1 to 10 nm, preferably 1 to 5 nm, more preferably It is preferable to have 1 to 3 nm. In this case, when the average diameter is less than 1 nm buried between the silica nanoparticles may be low reactivity, when the average diameter exceeds 10 nm, the reactivity of the gold nanoparticles is increased, the fusion of the gold nanoparticles on the outer peripheral surface of the fluorescent silica nanoparticles Since the number becomes relatively small, it is preferable to have an average diameter within the above range.
The gold binding polypeptide is selectively immobilized on top of the surface of the gold nanoparticles fused to the outer circumferential surface of the fluorescent silica nanoparticles. To this end, the purified polypeptide is immobilized by hybridization with 1 mg gold-fluorescent silica nanoparticle complex at room temperature for 1 hour. These gold binding polypeptides serve to link gold-fluorescent silica nanoparticle complexes with biological materials such as antigens. The biomaterial is bound to one end of the polypeptide bound to the top of the gold nanoparticles fused to the outer peripheral surface of the fluorescent silica nanoparticles.
Although the antigen is not particularly limited in the present invention, for example, a viral surface antigen may be used, and the type of antigen may be selectively used depending on the type of antibody.
In addition, the present invention may further include magnetic nanoparticles for labeling the antigen. There is no particular limitation on the magnetic nanoparticles, and iron oxide having low biotoxicity is preferably used.
Hereinafter, a method of preparing the gold-fluorescent silica nanoparticle composite of the present invention will be described in detail.
Gold-fluorescent silica nanoparticle composite of the present invention is Rupy (tris (2,2-bipyridyl) ruthenium (II)), FITC (fluorescein isothiocyanate), DAPI (4 ', 6-diamidino-2-phenylindole), Tetramethylrhodamine-5- (and 6) -isothiocyanate (TRTIC), Rohodamine, Texas red,
In addition, the manufacturing method of the present invention may further comprise a four-step to bind the gold-binding polypeptide on the surface of the gold nanoparticles of the gold-fluorescence silica nanoparticles. The gold-fluorescent silica nanoparticle complex of the present invention may further include five steps of binding a biomaterial such as an antigen using a gold-binding polypeptide.
The fluorescent dye solution of
The two-step fluorescent SiNPs were reacted by adding a silica precursor and NH 4 OH to the fluorescent dye solution in one step, and then separating the nanoparticles generated after 24 hours, washing them several times, and drying at 65 to 85 ° C. You can get it by Here, the silica precursor may be used as commonly used in the art, preferably tetraethylorthosilicate, trimethoxyphenylsilane, (3-aminopropyl) trimethoxysilane or trimethoxysilane Any one selected from phosphorus can be used. The fluorescent SiNPs prepared in step 2 are spherical and have an average diameter of 20 to 900 nm, preferably 40 to 100 nm, and more preferably 40 to 80 nm.
In addition, the fluorescent SiNPs are mixed with deionized water to obtain a mixed solution, but the content thereof is not particularly limited, but it is preferable to use fluorescent SiNPs: deionized water = 1: 1 to 1000 by weight in terms of preparing nanoparticle composites.
The gold precursor solution of step 3 is a solution in which the gold precursor is dissolved in deionized water, and the type of the gold precursor is not particularly limited in the present invention, but HAuCl 4 is preferably used.
The ultrasonic wave is preferably irradiated for 10 to 30 minutes at an intensity of 50 to 200 W / cm 2 , preferably at an intensity of 50 to 150 W / cm 2 , more preferably of 60 to 100 W / cm 2 . It is good to investigate by the century.
At this time, if the intensity of the ultrasonic wave is less than 50 W / cm 2 gold nanoparticles may not be sufficiently fused to the outer surface of the fluorescent silica, the problem of generating gold nanoparticles separately when irradiated with an intensity exceeding 200 W / cm 2 It is preferable to irradiate the ultrasonic waves with an intensity within the above range as it may occur.
The gold nanoparticles of the gold-fluorescence silica nanoparticles prepared in step 3 have an average diameter of 1 to 10 nm, preferably 1 to 5 nm, and more preferably 1 to 3 nm.
As a specific example of preparing the GBP-a complex of
Here, the antigen may be an antiviral surface antigen, and the present invention is not limited thereto, but may be, for example, an anti-avian influenza surface antigen. The antigen may further include magnetic nanoparticles. The magnetic nanoparticles are not particularly limited, and iron oxide having low biotoxicity is preferably used.
Until now it is disclosed that the antibody is detected by binding the antigen to the gold-fluorescence silica nanoparticle complex of the present invention, on the contrary, it can be used to detect the antigen by binding the antibody to the gold-fluorescence silica nanoparticle complex. . In such a case, it is possible to confirm whether the antibody binds to the target antigen in vivo.
Hereinafter, the present invention will be described in detail with reference to a preferred embodiment so that those skilled in the art can easily practice the present invention. The following examples are provided only to help a more general understanding of the present invention, the present invention is not limited to the above embodiments, and those skilled in the art to which the present invention pertains various modifications and Modifications are possible.
Preparation of Fluorescent Silica Nanoparticles
Example 1- (1): Red ( red ) Preparation of Fluorescent Silica Nanoparticles
1.44 mg of tris (2,2-bipyridyl) ruthenium (II), 22.5 mL of cyclohexane, 5.4 g of Triton X-100, 1.68 mL of deionized water and 4.8 mL of n-hexanol were mixed, followed by stirring for 10 minutes. To prepare a fluorescent dye solution.
Next, 300 µl of tetraethylorthosilicate (TEOS) and 180 µl of NH 4 OH were added to the fluorescent dye solution, followed by stirring to proceed with the reaction.
After 24 hours, the nanoparticles were separated from the reactants using a centrifuge, and the nanoparticles separated by ethanol, acetone and distilled water were washed several times, and then dried at 70 ° C. for 10 hours to prepare red fluorescent silica nanoparticles. It was.
In addition, the FE-SEM (field-emission scanning electron microscopy, Hitachi S4800) photograph of the prepared fluorescent silica nanoparticles is shown in Figure 3a, it can be seen that the size of the prepared red fluorescent silica nanoparticles. In addition, the photoluminescence spectra (PL) measurement results of the prepared fluorescent silica nanoparticles are shown in Figure 2a, through which the optical properties of the resulting nanoparticles could be confirmed. And the fluorescent image of the green fluorescent silica nanoparticle powder prepared in Figure 3 is shown.
Example 1- (2): Green ( green ) Preparation of Fluorescent Silica Nanoparticles
63 μl of aqueous solution of fluorescein isothiocyanate (FITC) (7.5 mg FITC / ml DMF), 15 μl of 3-aminopropyltriethoxysilane (APTS), 22.5 ml of cyclohexane, 5.4 g of Triton X-100, 1.68 ml of deionized water and 4.8 ml of n-hexanol After mixing, the mixture was sufficiently stirred for 30 minutes to prepare a fluorescent dye solution.
Next, 300 μl of TEOS and 180 μl of NH 4 OH were added to the fluorescent dye solution, followed by stirring.
After 24 hours, the nanoparticles were separated from the reactants using a centrifuge, and the nanoparticles separated with ethanol, acetone and distilled water were washed several times, and then dried at 70 ° C. for 10 hours to prepare green fluorescent silica nanoparticles. It was.
And, the FE-SEM picture of the prepared fluorescent silica nanoparticles is shown in Figure 1b, it can be seen that the size of the prepared green fluorescent silica nanoparticles are even. In addition, the photoluminescence spectra (PL) measurement results of the prepared fluorescent silica nanoparticles are shown in Figure 2b, through which the optical properties of the resulting nanoparticles can be confirmed. And the fluorescent image of the green fluorescent silica nanoparticle powder prepared in Figure 3 is shown.
Example 1- (3): blue ( blue ) Preparation of Fluorescent Silica Nanoparticles
1 ml of a solution of DAPI (4 ', 6-diamidino-2-phenylindole) (20 μl DAPI / ml distilled water), 22.5 ml of cyclohexane, 5.4 g of Triton X-100, 1.68 ml of deionized water and 4.8 ml of n-hexanol After stirring for 10 minutes, a fluorescent dye solution was prepared.
Next, 300 μl of TEOS and 180 μl of NH 4 OH were added to the fluorescent dye solution, followed by stirring.
After 24 hours, the nanoparticles were separated from the reactants using a centrifuge, and the nanoparticles separated by ethanol, acetone and distilled water were washed several times, and then dried at 70 ° C. for 10 hours to prepare blue fluorescent silica nanoparticles. It was. In addition, the FE-SEM photograph of the prepared fluorescent silica nanoparticles is shown in Figure 1c, it can be seen that the size of the prepared green fluorescent silica nanoparticles are even. In addition, the photoluminescence spectra (PL) measurement results of the prepared fluorescent silica nanoparticles are shown in Figure 2c, through which the optical properties of the resulting nanoparticles can be confirmed. And the fluorescent image of the green fluorescent silica nanoparticle powder prepared in Figure 3 is shown.
Preparation of Gold-Fluorescent Silica Nanoparticle Composites
Example 2- (1) to 2- (3)
100 mg of red, green, and blue fluorescent silica nanoparticles prepared in Examples 1- (1) to 1- (3) were added to three beakers containing 30 ml of deionized water, thereby preparing a mixed solution.
Next, a gold solution (2.5 mg HAuCl 4 / ml deionized water) and NH 4 OH 4 ml were added to the mixed solution, and ultrasonic waves were irradiated for 15 minutes at an intensity of 80 W / cm −2 .
Next, the product was separated and washed, and then dried at 70 ° C. for about 10 hours to prepare gold-silica nanoparticle composites emitting red, green, and blue fluorescence, respectively. Examples 2- (1) to 2- (3) was carried out, and the average diameter of the prepared nanoparticles is shown in Table 1 below.
The FE-SEM images of each of the prepared gold-fluorescent silica nanoparticle composites are shown in FIGS. 4A to 4C, respectively, and have a gold having a diameter of about 1 to 2 nm on the outer circumferential surface of the fluorescent silica nanoparticles having a diameter of about 45 to 65 nm. It can be confirmed that the nanoparticles are fused.
Comparative example 1 to 2
Example 2- (1) was carried out in the same manner as in Comparative Example 1 and Comparative Example 2 to prepare a gold-fluorescence silica nanoparticle composite, Comparative Example 1 is the intensity of the ultrasonic wave 30 W / cm 2 Irradiation was carried out for 30 minutes, and Comparative Example 3 was irradiated for 10 minutes with an intensity of 250 W / cm 2 .
8, in Comparative Example 1 in which the ultrasonic intensity is too weak, gold nanoparticles may not be fused to the silica surface.
9, in Comparative Example 2 in which the ultrasonic intensity is too strong, the gold nanoparticles are not only fused to the surface of the silica particles, but also gold nanoparticles are formed separately.
Preparation of Gold Binding Polypeptide Fusion Proteins
Example 3- (1) ( Gold-binding polypeptide The fusion protein Preparation of E. coli with the coding gene)
In order to clone the gene for fusion expression of the gold binding polypeptide (GBP) of SEQ ID NO: 1 with the target protein to recombinant E. coli, PCR was performed using only the primers of SEQ ID NOs: 2 and 3 without template DNA to obtain a DNA gene product. .
The DNA gene thus obtained was introduced into plasmid pET-22b (+) using restriction enzyme NdeI and restriction enzyme NcoI to obtain a pET-6HisGBP cassette (see Fig. 5). At this time, the cleavage position of restriction enzyme NdeI is located at the primer of SEQ ID NO: 2, and the cleavage position of restriction enzyme NcoI is located at the primer of SEQ ID NO: 3.
In order to improve hydrophilicity, GBP fusion protein (GBP-A1a), in which the hydrophilic domain of neuraminidase (NA), a surface antigen of avian influenza (hereinafter referred to as 'AIa'), is fused with GBP at the gene level DNA gene product was obtained. That is, pET-6HisGBP was used as a template and PCR was performed using only primers of SEQ ID NOs: 2 and 4 to obtain a DNA gene product of GBP-H1a.
SEQ ID NO: 1 H2N-MHGKTQATSGTIQSMHGKTQATSGTIQSMHGKTQATSGTIQS-COOH (GBP)
SEQ ID NO 2:
5'- GATATACATATGGGCCACCATCACCATCACCACGGCAAAACCCAGGCGACCAGCGGCACCATCCAGAGCATGCATGGTAAAACGCAAGCCACG -3 '(primer 1)
SEQ ID NO 3:
5'- ATATCCATGGAGACTGAATGGTACCGCTCGTCGCTTGGGTTTTACCGTGCATAGATTGAATCGTACCAGACGTGGCTTGCGTTTTACCA -3 '(primer 2)
SEQ ID NO 4:
5'- AAACTCGAGGATCGGACGGTTGCTGCCTTTCCAGTTATCACGACACCATGGAGACTGAATGGTACCGCT -3 '(primer 3)
Under these PCR conditions, the first denaturation was performed once at 94 ° C for 5 minutes, after which the second denaturation was at 94 ° C for 30 seconds, the annealing at 56 ° C for 30 seconds, and the extension at 72 ° C. 30 seconds were performed and this was repeated 30 times. It was then extended for 5 minutes at 72 ° C.
The DNA obtained by PCR was subjected to agarose gel electrophoresis to separate DNA fragments of about 200 bp (GBP-AIa fusion) size.
The DNA fragment was digested with NdeI and XhoI restriction enzymes, and then cloned into plasmid pET-22b (+) (Novagen, Darmstadt, Germany) digested with NdeI and XhoI to prepare a recombinant plasmid pET-GBP-AIa.
The prepared pET-GBP-AIa was introduced into Escherichia coli BL21 (DE3) (Novagen, Darmstadt, Germany) using a heat shock method to add LB plate medium to which ampicillin (ampicillin, 100 mg / L) was added ( Recombinant Escherichia coli BL21 (DE3) / pET-GBP-AIa was prepared by selecting from yeast extract, 5 g / L; tryptone, 10 g / L; NaCl, 10 g / L).
In the present embodiment, although the form of binding the GBP protein to the N-terminus of AIa, the same result can be obtained even if the form of the GBP protein binds to the C-terminus of the present invention. It is obvious to those who have knowledge.
Example 3- (2) (Preparing a GBP Fusion Protein)
E. coli BL1 (DE3) transformed with pET-GBP-AIa prepared in Example 3- (1) was inoculated into a 500 mL flask containing 200 mL of LB liquid medium and incubated at 37 ° C.
When the optical density (OD) measured at 600 nm with a spectrophotometer was 0.4, 1 mM of IPTG (isopropyl-β-thiogalactoside) was added to induce the expression of the gene of the pET-CBP2-H1a recombinant plasmid. IPTG acts on the T7 promoter in the recombinant plasmid pET-GBP-AIa to induce expression.
Four hours after induction, the whole culture was centrifuged at 6000 rpm for 5 minutes at 4 ° C, and then the supernatant was discarded and washed once with 100 mL TE buffer (Tris-HCl 10 mM;
The crushed solution was centrifuged at 6000 rpm for 30 minutes at 4 rpm to discard insoluble protein and filtered through a 0.2 μm filter to obtain an aqueous protein fraction containing GBP-AIa fusion protein. The protein was quantified using the Bradford method (Bradford, M. et al., Anal. Biochem., 72: 248, 1976).
GBP Preparation of -a Complex
Example 4- (1) to 4- (3)
Each of the gold-fluorescent silica nanoparticles prepared in Examples 2- (1) to 2- (3) was placed in three beakers containing phosphate-buffered saline (PBS), followed by Examples 3- (1) and 3 Avian influenza (AI) surface antigen fusion protein prepared and purified by-(2) was added, and then reacted (or cultured) at 25 ° C for 1 hour. After the reaction was completed, the fusion protein that was not bound to the gold-fluorescence silica nanoparticles was removed by washing with PBS to prepare GBP-a complexes showing red, green, and blue fluorescence coupled with the antigen through the polypeptide.
Experimental Example
Antibody Detection Experiment
Phosphoric acid-buffered saline containing iron oxide nanoparticles (average diameter 10 nm) -labeled anti-avian influenza (AI) antibody was prepared by the red fluorescence prepared in Example 4- (1). After soaking the GBP-a complex, it was reacted (or incubated) at 25 ° C. for 1 hour to bind the AI surface antigen of the GBP-a complex with the AI antibody. Next, after washing the binder, it was observed by confocal microscopy (confocal microscopy, Carl Zeiss LSM 510 Meta, Germany) and transmission electron microscopy (TEM, Transmission electron microscopy, JEOL JEM-2100F, Japan), The results are shown in FIGS. 6 and 7, respectively.
As such, the gold-fluorescent silica nanoparticle complex of the present invention can be used for antibody detection, and furthermore, can be applied as a biosensor, a bio separation membrane, and the like.
While the present invention has been described in connection with what is presently considered to be practical exemplary embodiments, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, Do.
Claims (17)
Gold nanoparticles ultrasonically deposited on the surface of the fluorescent silica nanoparticles;
A gold binding polypeptide bound to the surface of the gold nanoparticles; And
A biomaterial further bound to the gold binding polypeptide;
Gold-fluorescent silica nanoparticles composite, comprising a.
The biomaterial is a gold-fluorescent silica nanoparticles composite, characterized in that it comprises an antibody and magnetic nanoparticles.
The gold-binding polypeptide is a gold-fluorescence silica nanoparticle complex, characterized in that the fusion protein fusion probe protein.
The gold-binding polypeptide is a gold-fluorescence silica nanoparticle complex, characterized in that the fusion protein is further fused to a hydrophilic protein.
The magnetic nanoparticles are gold-fluorescent silica nanoparticles composite, characterized in that the iron oxide.
Preparing a fluorescent silica nanoparticle (SiNPs) solution by adding and reacting a silica precursor and NH 4 OH to the fluorescent dye solution; And
Gold precursor solution and NH 4 OH were added to the fluorescent silica nanoparticles (SiNPs) solution, and then ultrasonic waves were applied to the gold-silica nanoparticles (gold-fluorescent silica nanoparticles) in which gold nanoparticles were deposited on the outer circumferential surface of the fluorescent SiNPs. 3) manufacturing);
Method for producing a gold-fluorescent silica nanoparticle composite comprising a.
The third step is a method of producing a gold-fluorescence silica nanoparticle composite, characterized in that for 10 to 30 minutes to irradiate the ultrasonic wave with an intensity of 50 ~ 1500 W / cm 2 .
The fluorescent dye solution is a manufacturing method of gold-fluorescence silica nanoparticles composite further comprises cyclohexane, triton X-100 (triton X-100), n-hexanol and DI water.
Binding a gold binding polypeptide on top of a gold nanoparticle surface of the gold-fluorescent silica nanoparticles;
Method for producing a gold-fluorescent silica nanoparticles composite further comprises.
6 additionally binding a biological material to the gold binding polypeptide;
Method for producing a gold-fluorescent silica nanoparticles composite further comprises.
The biological material is a method for producing a gold-fluorescence silica nanoparticle composite, characterized in that it contains magnetic nanoparticles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020100135843A KR101218206B1 (en) | 2010-12-27 | 2010-12-27 | Gold-doped fluorescent silica nanoparticles composite and Preparing method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020100135843A KR101218206B1 (en) | 2010-12-27 | 2010-12-27 | Gold-doped fluorescent silica nanoparticles composite and Preparing method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| KR20120089928A KR20120089928A (en) | 2012-08-16 |
| KR101218206B1 true KR101218206B1 (en) | 2013-01-03 |
Family
ID=46883167
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020100135843A KR101218206B1 (en) | 2010-12-27 | 2010-12-27 | Gold-doped fluorescent silica nanoparticles composite and Preparing method thereof |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR101218206B1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20160018905A (en) | 2014-08-07 | 2016-02-18 | (주)해밀 | Evacuation Door for Tunnel |
| KR20170091045A (en) | 2016-01-29 | 2017-08-08 | 가톨릭대학교 산학협력단 | Hyperbranched polymer nanoparticles and preparing method thereof |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101660399B1 (en) | 2013-08-23 | 2016-09-28 | 주식회사 메디센서 | Fluorescent particle including lanthanide complexes |
| WO2015026117A1 (en) * | 2013-08-23 | 2015-02-26 | 주식회사 메디센서 | Fluorescent particle comprising gold nanoparticles and method for manufacturing same |
| KR101515155B1 (en) * | 2013-11-29 | 2015-04-27 | (주)씽크루트 | Electrochemical immunoassay system utilizing gold doped silica nanoparticles, electrochemical immunoassay method and electrochemical immunoassay device using the same. |
| KR101639473B1 (en) * | 2014-04-18 | 2016-07-14 | 연세대학교 산학협력단 | Development of hydrogel microarray biosensor utilizing metal enhanced fluorescence effect |
| KR101579812B1 (en) * | 2014-12-23 | 2015-12-24 | 한국생명공학연구원 | Composite for diagnosis for obtaining quantitative of osteoblast differentiation and measurement method for obtaining quantitative of osteoblast differentiation using the same |
| KR101944346B1 (en) | 2017-09-20 | 2019-01-31 | 한양대학교에리카산학협력단 | Composite particle comprising nano gap, and method of fabricating of the same |
| CN113484383B (en) * | 2021-07-05 | 2022-10-28 | 中国科学院长春应用化学研究所 | Nano particle film and preparation method and application thereof |
| KR20240140562A (en) | 2023-03-17 | 2024-09-24 | 주식회사 네오바이오 | A silica nano particles having embedded gold nano particles and a method for manufacturing the same |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100740891B1 (en) * | 2006-02-27 | 2007-07-19 | 한국과학기술원 | - Novel construction of gold nanoparticle-based peptide chip and assaying enzyme activity and inhibitor effect using secondary ion mass spectrometric analysis thereof |
| KR20080027716A (en) * | 2006-09-25 | 2008-03-28 | 삼성전자주식회사 | Method of manufacturing layered nano structures and layered nano structures prepared thereby |
| KR20100012316A (en) * | 2008-07-28 | 2010-02-08 | 한국과학기술원 | Preparing method for fluorescent silica and fluorescent silica thereof |
| KR20100102273A (en) * | 2009-03-11 | 2010-09-24 | 서울대학교산학협력단 | Method for quantification of multiple markers using f-sers dots |
-
2010
- 2010-12-27 KR KR1020100135843A patent/KR101218206B1/en active IP Right Grant
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100740891B1 (en) * | 2006-02-27 | 2007-07-19 | 한국과학기술원 | - Novel construction of gold nanoparticle-based peptide chip and assaying enzyme activity and inhibitor effect using secondary ion mass spectrometric analysis thereof |
| KR20080027716A (en) * | 2006-09-25 | 2008-03-28 | 삼성전자주식회사 | Method of manufacturing layered nano structures and layered nano structures prepared thereby |
| KR20100012316A (en) * | 2008-07-28 | 2010-02-08 | 한국과학기술원 | Preparing method for fluorescent silica and fluorescent silica thereof |
| KR20100102273A (en) * | 2009-03-11 | 2010-09-24 | 서울대학교산학협력단 | Method for quantification of multiple markers using f-sers dots |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20160018905A (en) | 2014-08-07 | 2016-02-18 | (주)해밀 | Evacuation Door for Tunnel |
| KR20170091045A (en) | 2016-01-29 | 2017-08-08 | 가톨릭대학교 산학협력단 | Hyperbranched polymer nanoparticles and preparing method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20120089928A (en) | 2012-08-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101218206B1 (en) | Gold-doped fluorescent silica nanoparticles composite and Preparing method thereof | |
| Simmchen et al. | Asymmetric hybrid silica nanomotors for capture and cargo transport: towards a novel motion‐based DNA sensor | |
| JP5047783B2 (en) | Device for binding a target entity to a decoy entity and detection method using the device | |
| KR101975754B1 (en) | Peptides capable of silica deposition and use thereof | |
| CN111587291A (en) | Proteins for rapid and efficient capture of antigens | |
| US8541005B2 (en) | Cysteine-tagged streptococcal protein G variant | |
| JP5883386B2 (en) | Protein or peptide printing method, protein array or peptide array production method, and functional protein or functional peptide identification method | |
| Nam et al. | A novel route for immobilization of proteins to silica particles incorporating silaffin domains | |
| Jin et al. | Magnetic nanoplatforms for covalent protein immobilization based on spy chemistry | |
| Liu et al. | Superior binding of proteins on a silica surface: Physical insight into the synergetic contribution of polyhistidine and a silica-binding peptide | |
| KR102401223B1 (en) | Linker composition comprising silica-forming peptides | |
| KR101964155B1 (en) | A fusion protein comprising virus coat protein and silica forming peptide and its use | |
| Luo et al. | A potential method for one-step purification and direct immobilization of target protein in cell lysate with magnetic microbeads | |
| KR100877187B1 (en) | Protein chip and detection method of the same comprising protein nanoparticles linked with epitope recognizing disease marker for diagnosis | |
| KR101457186B1 (en) | Novel protein and use thereof | |
| Yu et al. | Nucleic Acid‐Modified Liposome: Construction Methods and Biological Applications | |
| WO2021256674A1 (en) | Method for increasing stability of target protein immobilized in silica nanoparticle through salt treatment | |
| JPWO2007037315A1 (en) | Novel nanostructure and its construction method | |
| KR101990773B1 (en) | Modified green fluorescent protein capable of silica deposition and use thereof | |
| JP2013151454A (en) | Gold carrier with immobilized protein, and method of producing the same | |
| Wang et al. | Bioinspired Amyloid Fibril‐Based Hydrogel with Engineering Programable Functionalities for Diverse Applications | |
| KR20110115659A (en) | Carbon nanotube complex coated by porous metal oxide nanostructure and use thereof | |
| JPWO2012090789A1 (en) | Polypeptide for distinguishing between silicon oxide and silicon nitride and use thereof | |
| KR100718207B1 (en) | Bio-metal Chip Using Metal Binding Protein and Method for Fabricating the Same | |
| Dixit | Surface modification and conjugation strategies for bioassay/biomaterial applications |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| A201 | Request for examination | ||
| E701 | Decision to grant or registration of patent right | ||
| GRNT | Written decision to grant | ||
| FPAY | Annual fee payment |
Payment date: 20161129 Year of fee payment: 5 |
|
| FPAY | Annual fee payment |
Payment date: 20171124 Year of fee payment: 6 |
|
| FPAY | Annual fee payment |
Payment date: 20181203 Year of fee payment: 7 |