WO2022211129A1 - Atn1のアンチセンスオリゴヌクレオチド誘導体 - Google Patents
Atn1のアンチセンスオリゴヌクレオチド誘導体 Download PDFInfo
- Publication number
- WO2022211129A1 WO2022211129A1 PCT/JP2022/017009 JP2022017009W WO2022211129A1 WO 2022211129 A1 WO2022211129 A1 WO 2022211129A1 JP 2022017009 W JP2022017009 W JP 2022017009W WO 2022211129 A1 WO2022211129 A1 WO 2022211129A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- oligonucleotide
- nucleosides
- group
- acceptable salt
- nucleoside
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7125—Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K49/00—Preparations for testing in vivo
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
- C07H21/04—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
Definitions
- the present invention relates to antisense oligonucleotide derivatives of ATN1.
- DRPLA Dentate red nucleus pallidus Louis body atrophy
- Substances that inhibit the expression of the ATN1 gene include RNaseH-independent antisense oligonucleotides for CAG repeats (see, for example, Non-Patent Document 2) and ss-siRNA (see, for example, Patent Document 1 and Non-Patent Document 3), etc. have been reported, showing that the repeat selectively inhibits the aberrantly expanded allele. It has also been reported that morpholino nucleic acids or RNaseH-dependent LNA gapmers inhibit the expression of the ATN1 gene, but the sequence and degree of inhibition have not been described (see, for example, Non-Patent Document 4).
- An object of the present invention is to provide novel antisense oligonucleotide derivatives that inhibit the expression of the ATN1 gene.
- the present inventors have made extensive studies to discover compounds having an antisense effect on ATN1, and have found that the compounds of the present invention have an excellent ATN1 gene expression inhibitory effect, leading to the completion of the present invention. That is, the present invention is characterized by the following.
- a single-stranded oligonucleotide in which the first oligonucleotide and the second oligonucleotide are linked by a third oligonucleotide the first oligonucleotide comprises a sequence that allows it to hybridize with Atrophin1 mRNA or pre-mRNA; consisting of 8 to 30 nucleosides independently selected from deoxyribonucleosides, ribonucleosides and sugar-modified nucleosides; comprising at least one sugar-modified nucleoside;
- the second oligonucleotide comprises a sequence that allows it to hybridize with at least a portion of the first oligonucleotide; consisting of 8 to 30 nucleosides independently selected from deoxyribonucleosides, ribonucleosides and sugar-modified nucleosides;
- the third oligonucleotide consists of 1-20 nucleosides independently selected from deoxyribon
- the nucleosides contained in the third oligonucleotide are linked together by phosphodiester bonds,1. or a pharmaceutically acceptable salt thereof.
- the third oligonucleotide is DNA or RNA;1. or 2. or a pharmaceutically acceptable salt thereof.
- the 3' end of the third oligonucleotide is bound to the 5' end of the first oligonucleotide;
- the 5' end of the third oligonucleotide is linked to the 3' end of the second oligonucleotide,1. to 3. or a pharmaceutically acceptable salt thereof. 5.
- the first oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of the nucleobase sequence of any one of SEQ ID NOs: 3-716 and 718-770; to 4. or a pharmaceutically acceptable salt thereof.
- 6. 1. the first oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 3-716 and 718-770; to 5. or a pharmaceutically acceptable salt thereof.
- 7. 1. the first oligonucleotide has the nucleobase sequence of any one of SEQ ID NOs: 3-716 and 718-770; to 6. or a pharmaceutically acceptable salt thereof.
- the first oligonucleotide comprises nucleobase positions 59 to 104, 109 to 133, 173 to 192, 207 to 272, 300 to 319, 353 to 372, 419 to 434, 458 to 509, 523-559, 561-618, 626-685, 766-785, 787-819, 838-855, 880-922, 924-943, 970-989, 994-1039, 1055-1074, 1079-1098, 1157-1176, 1196-1223, 1310-1329, 1339-1399, 1423-1442, 1614-1633, 1650-1670, 1806-1833, 1844-1865, 1896-1915, 1924-1992, 2023-2042, 2058- 2081, 2103-2124, 2398-2417, 2480-2520, 2526-2562, 2568-2587, 2853-2872, 2876-2923, 2931-2950, 2972-3016, 3072-3099, 3109-3128, 3192-3211, Nucleic acid base sequence
- the first oligonucleotide is at least part of the nucleobase sequence selected from the group consisting of the nucleobase sequences represented by position numbers 3451 to 3475 and 3490 to 3505 of the Atrophin1 mRNA represented by SEQ ID NO: 1. 7. consists of 8-30 complementary nucleosides and is at least 80% complementary to a portion within said selected nucleobase sequence of SEQ ID NO:1; or a pharmaceutically acceptable salt thereof.
- the first oligonucleotide comprises nucleobase positions 383-398, 986-1001, 1004-1019, 1378-1393, 1398-1413, 1853-1868, 1971-1986 of the Atrophin1 pre-mRNA represented by SEQ ID NO: 2, 2189-2204, 2522-2537, 2562-2577, 3662-3677, 3987-4002, 4217-4232, 4266-4281, 4335-4350, 4360-4375, 4477-4492, 4562-4577, 4636-4651, 4687- 4702,4734-4749,4840-4855,5536-5563,5568-5592,5632-5651,5666-5715,5906-5925,5959-5978,6176-6191,6215-6266,6963-6978,7248-7284, 7286-7343, 7351-7410, 7491-7510, 7512-7544, 7563-7580, 7605-7647, 7649-7668, 7695-
- the first oligonucleotide has at least one nucleobase sequence selected from the group consisting of the nucleobase sequences represented by position numbers 12574 to 12598 and 12613 to 12628 of the Atrophin1 pre-mRNA represented by SEQ ID NO: 2. 10. consists of 8-30 nucleosides complementary to a portion and is at least 80% complementary to a portion within said selected nucleobase sequence of SEQ ID NO:2; or a pharmaceutically acceptable salt thereof.
- the first oligonucleotide has SEQ ID NOs: 3, 4, 9, 10, 12, 13, 18, 19, 20, 21, 26, 29, 34, 37, 38, 39, 40, 44, 45, 46, 47, 48, 49, 50, 52, 55, 59, 60, 61, 62, 63, 66, 67, 68, 69, 70, 72, 74, 75, 78, 79, 82, 83, 84, 85, 86, 87, 88, 89, 91, 92, 94, 95, 97, 99, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 126, 127, 128, 131, 132, 133, 137, 138, 139, 148, 151, 152, 153, 154, 156, 157, 158
- the first oligonucleotide consists of 16 to 20 nucleosides having a nucleobase sequence comprising any one nucleobase sequence selected from the group consisting of SEQ ID NOs: 209, 215, 216, 221, and 715; or a pharmaceutically acceptable salt thereof.
- the first oligonucleotide consists of 16-20 nucleosides having a nucleobase sequence containing any one nucleobase sequence selected from the group consisting of SEQ ID NOs: 47, 105, 174, 214, 240, 585 and 586. , 12. or a pharmaceutically acceptable salt thereof.
- 15. 1 The first oligonucleotide contains at least one phosphorothioate linkage; to 14.
- the first oligonucleotide comprises at least one nucleoside selected from the group consisting of 2'-modified nucleosides and 2'-4'-bridged nucleosides; to 15. or a pharmaceutically acceptable salt thereof.
- the 2'-4'-bridged nucleoside is at least one selected from the group consisting of LNA, ENA, cEt, AmNA, scpBNA and GuNA;
- the 2' modified nucleoside is at least one selected from the group consisting of 2'-O-MCE nucleoside, 2'-O-MOE nucleoside, 2'-O-NMA nucleoside, and 2'-O-Me nucleoside Yes, 16.
- the 2'-4'-bridged nucleoside is LNA; or a pharmaceutically acceptable salt thereof.
- the 2'-modified nucleoside is at least one selected from the group consisting of 2'-O-MCE nucleoside and 2'-O-MOE nucleoside; or a pharmaceutically acceptable salt thereof.
- the first oligonucleotide comprises a gap segment, a 5' wing segment and a 3' wing segment;
- the gap segment comprises at least two deoxyribonucleosides, the 5′ and 3′ ends of the gap segment being deoxyribonucleosides;
- the nucleoside at the 3' end of the 5' wing segment is a sugar modified nucleoside and is linked to the 5' end of the gap segment; 1.
- the nucleoside at the 5' end of the 3' wing segment is a sugar modified nucleoside and is linked to the 3' end of the gap segment; to 19. or a pharmaceutically acceptable salt thereof.
- said gap segment consists of 5 to 16 deoxyribonucleosides
- the 5′ wing segment and the 3′ wing segment are each independently selected from 1 to 7 independently selected from the group consisting of LNA, 2′-O-MCE nucleosides and 2′-O-MOE nucleosides. consisting of sugar-modified nucleosides, each wing segment comprises at least one phosphorothioate linkage; 20. each cytosine of the gap segment and each wing segment is replaced with a 5-methylcytosine; or a pharmaceutically acceptable salt thereof. 22.
- said gap segment consists of 8-12 deoxyribonucleosides
- the 5′ wing segment and the 3′ wing segment each independently consist of 2-5 sugar modified nucleosides independently selected from the group consisting of LNA and 2′-O-MCE nucleosides; containing two 2'-O-MCE nucleosides, 21.
- the gap segment contains at least one phosphorothioate bond; or a pharmaceutically acceptable salt thereof.
- said gap segment consists of 8-12 deoxyribonucleosides, said 5′ wing segment and said 3′ wing segment each independently have 3 to 6 sugar modifications independently selected from the group consisting of 2′-O-MOE nucleosides and 2′-O-MCE nucleosides; made up of nucleosides, 21.
- the gap segment contains at least one phosphorothioate bond; or a pharmaceutically acceptable salt thereof.
- the 5' wing segment and the 3' wing segment each independently consist of five 2'-O-MOE nucleosides; or a pharmaceutically acceptable salt thereof.
- the 5' wing segment and the 3' wing segment each independently consist of five 2'-O-MCE nucleosides; or a pharmaceutically acceptable salt thereof.
- the arrangement of the sugar-modified nucleosides in the 5′ wing segment and the 3′ wing segment are each independently VLL, LVL, LLV, LVV, VLV, VVL, LLL, VVLL, VLVL, VLLV, LVLV, LLVV, LVVL, 21. selected from the group consisting of VLLL, LVLL, LLVL, LLLV, LVVV, VLVV, VVLV and VVVL, wherein L represents LNA and V represents a 2'-O-MCE nucleoside; or a pharmaceutically acceptable salt thereof.
- the first oligonucleotide is an antisense oligonucleotide; to 26.
- the second oligonucleotide comprises at least one ribonucleoside; to 27. or a pharmaceutically acceptable salt thereof.
- the second oligonucleotide comprises at least four consecutive ribonucleosides; to 28. or a pharmaceutically acceptable salt thereof.
- the second oligonucleotide is RNA;1. to 29. or a pharmaceutically acceptable salt thereof.
- the second oligonucleotide is DNA;1. to 27. or a pharmaceutically acceptable salt thereof. 32. 1.
- the second oligonucleotide contains one or more sugar-modified nucleosides on at least one of the 5'-terminal side and the 3'-terminal side of the second oligonucleotide. to 29. or a pharmaceutically acceptable salt thereof. 33.
- the nucleosides contained in the second oligonucleotide are linked together by phosphodiester bonds,1. to 32. or a pharmaceutically acceptable salt thereof.
- 34. 1 contains one or more phosphorothioate linkages on at least one of the 5'-terminal side and the 3'-terminal side of the second oligonucleotide; to 32. or a pharmaceutically acceptable salt thereof. 35. 1.
- the single-stranded oligonucleotide has a nucleobase sequence containing any one nucleobase sequence selected from the group consisting of SEQ ID NOs:772 to 776; to 34. or a pharmaceutically acceptable salt thereof.
- the single-stranded oligonucleotide has a nucleobase sequence comprising any one nucleobase sequence selected from the group consisting of SEQ ID NOS: 797-801, 803-808 and 810; to 34. or a pharmaceutically acceptable salt thereof.
- a double-stranded oligonucleotide complex comprising a first oligonucleotide and a second oligonucleotide
- the first oligonucleotide comprises a sequence that allows it to hybridize with Atrophin1 mRNA or pre-mRNA; consisting of 8 to 30 nucleosides independently selected from deoxyribonucleosides, ribonucleosides and sugar-modified nucleosides; comprising at least one sugar-modified nucleoside
- the second oligonucleotide comprises a sequence that allows it to hybridize with at least a portion of the first oligonucleotide; consisting of 8 to 30 nucleosides independently selected from deoxyribonucleosides, ribonucleosides and sugar-modified nucleosides
- a medicament comprising the single-stranded oligonucleotide or double-stranded oligonucleotide complex according to any one of , or a medically acceptable salt thereof as an active ingredient.
- a disease or condition in which the ATN1 gene expression inhibitory action is effective comprising the single-stranded oligonucleotide or double-stranded oligonucleotide complex according to any one of or a medically acceptable salt thereof as an active ingredient A therapeutic, preventive and/or ameliorative agent. 43. 1. to 40.
- ATN1 gene expression inhibitor comprising the single-stranded oligonucleotide or double-stranded oligonucleotide complex according to any one of or a medically acceptable salt thereof as an active ingredient.
- 44. 1. to 40. The single-stranded oligonucleotide or double-stranded oligonucleotide complex according to any one of, or a medically acceptable salt thereof, as an active ingredient, of dentate nucleus pallidus Louis body atrophy A therapeutic, prophylactic, and/or ameliorative agent.
- a medicament comprising the oligonucleotide described in 1. or a pharmaceutically acceptable salt thereof as an active ingredient. 47. 45. 3. A therapeutic, preventive and/or ameliorating agent for diseases or conditions for which ATN1 gene expression inhibitory action is effective, comprising the oligonucleotide according to 1. or a medically acceptable salt thereof as an active ingredient. 48. 45. 3. An ATN1 gene expression inhibitor comprising the oligonucleotide according to 1. or a medically acceptable salt thereof as an active ingredient. 49. 45. 3. A therapeutic, preventive and/or ameliorating agent for dentate nucleus pallidus louis body atrophy comprising the oligonucleotide according to 1. or a medically acceptable salt thereof as an active ingredient.
- the present invention provides a novel antisense oligonucleotide derivative that has an excellent ATN1 gene expression inhibitory activity and is particularly useful for the treatment, amelioration and/or prevention of dentate nucleus pallidus louis body atrophy. can do.
- 1 is a graph showing the results of administering single-stranded oligonucleotides according to the present embodiment to DRPLA model mice and evaluating their effects on motor function improvement.
- 1 is a graph showing the results of administering single-stranded oligonucleotides according to the present embodiment to DRPLA model mice and evaluating their effects on motor function improvement.
- 1 is a graph showing the results of administering single-stranded oligonucleotides according to the present embodiment to DRPLA model mice and evaluating their effects on motor function improvement.
- 1 is a graph showing the results of administering single-stranded oligonucleotides according to the present embodiment to DRPLA model mice and evaluating their effects on motor function improvement.
- 1 is a graph showing the results of administering single-stranded oligonucleotides according to the present embodiment to DRPLA model mice and evaluating their effects on motor function improvement.
- an antisense oligonucleotide derivative is an oligonucleotide in which a first oligonucleotide and a second oligonucleotide are linked by a third oligonucleotide (hereinafter referred to as a single-stranded oligonucleotide).
- the first oligonucleotide comprises a sequence that allows it to hybridize with Atrophin1 mRNA or pre-mRNA, and consists of 8-30 nucleosides independently selected from deoxyribonucleosides, ribonucleosides and sugar-modified nucleosides, and at least comprising one sugar-modified nucleoside
- the second oligonucleotide comprises a sequence capable of hybridizing with at least a portion of the first oligonucleotide and consists of 8-30 nucleosides independently selected from deoxyribonucleosides, ribonucleo
- the third oligonucleotide consists of 1-20 nucleosides independently selected from deoxyribonucleosides, ribonucleosides and sugar-modified nucleosides; A first oligonucleotide and a second oligonucleotide hybridize.
- the first oligonucleotide comprises a sequence that allows it to hybridize with Atrophin1 mRNA or pre-mRNA, and consists of 8-30 nucleosides independently selected from deoxyribonucleosides, ribonucleosides and sugar-modified nucleosides, and at least comprising one sugar-modified nucleoside
- the second oligonucleotide comprises a sequence capable of hybridizing with at least a portion of the first oligonucleotide and consists of 8-30 nucleosides independently selected from deoxyribonucleosides, ribonucleosides and sugar modified nucleosides.
- a first oligonucleotide and a second oligonucleotide are hybridized.
- Nucleic acids in nature are most basically composed of adenosine (A), thymidine (T) (or uridine (U)), cytidine (C) and guanosine (G).
- Their basic nucleic acids are often referred to as AT(U)GC and the like. Therefore, in this specification, when a sequence is indicated by "nucleobase sequence” or “sequence number" with respect to, for example, the ATN1 gene sequence, it is basically a sequence of A, T, G, C and U.
- the nucleic acids constituting the ASO derivatives of the present invention include basic nucleic acids (AT(U)CG) as well as structurally modified versions thereof.
- Modifications are detailed below and include modifications to sugar moieties, internucleoside linkages, and/or nucleobases. Therefore, herein, for example, in the description of "compounds” or “compounds given compound numbers (M-number and L-number)", or “nucleobase sequences indicated by SEQ No. ”, the ASO derivative of the present invention, and the first oligonucleotide, second oligonucleotide, third oligonucleotide, etc. constituting the derivative have a nucleic acid base sequence of A, T, G, C and U. When given, A, T, G, C and U also include those that have undergone structural modifications.
- Optionally substituted means unsubstituted or substituted.
- nucleoside is a term well known to those skilled in the art, and is generally understood to be a molecule in which a sugar and a nucleobase are bound, and which can be a unit constituting a nucleic acid. As used herein, nucleoside is a broader concept and includes deoxyribonucleosides, ribonucleosides and sugar-modified nucleosides described below. The nucleobases may be modified.
- Deoxyribonucleoside means a molecule having a nucleobase at the 1-position carbon atom of 2-deoxyribose.
- Deoxyribonucleosides in the present invention may be naturally occurring deoxyribonucleosides or deoxyribonucleosides obtained by modifying the nucleobase portion of naturally occurring deoxyribonucleosides.
- a naturally occurring deoxyribonucleoside is a deoxyribonucleoside having a naturally occurring nucleobase.
- a single deoxyribonucleoside may be modified in combination of multiple types.
- the modified deoxyribonucleosides are, for example, Journal of Medicinal Chemistry, 2016, 59, pp 9645-9667, Medicinal Chemistry Communication, 2014, 5, pp 1454-1471, Future Medicinal Chemistry, 2011, 3, pp 339-365, It is described in International Publication No. 2018/155450 and the like.
- “Ribonucleoside” means a molecule having a nucleobase at the carbon atom at position 1 of ribose.
- a ribonucleoside in the present invention may be a naturally occurring ribonucleoside or a ribonucleoside in which the nucleobase portion of a naturally occurring ribonucleoside is modified.
- a naturally occurring ribonucleoside is a ribonucleoside having a naturally occurring nucleobase.
- a single ribonucleoside may be modified in combination of multiple types.
- modified ribonucleosides are, for example, Journal of Medicinal Chemistry, 2016, 59, pp 9645-9667, Medicinal Chemistry Communication, 2014, 5, pp 1454-1471, Future Medicinal Chemistry, 2011, 3, pp 339-365, It is described in International Publication No. 2018/155450 and the like.
- a "modified sugar” is (Z1) molecules in which the ribose or 2-deoxyribose is partially substituted by one or more substituents, (Z2) a molecule in which ribose or 2-deoxyribose is replaced by a penta- or hexose (e.g., hexitol, threose, etc.) different from ribose and 2-deoxyribose; (Z3) the entirety of ribose or 2-deoxyribose, or the tetrahydrofuran ring thereof, binds to a 5- to 7-membered saturated or unsaturated ring (e.g., cyclohexane, cyclohexene, morpholine, etc.), or a 5- to 7-membered ring via hydrogen bonding; molecules that have been replaced by substructures that can form (e.g., peptide structures), or (Z4) refers to molecules in which ribos
- Modified sugars include "2-modified sugars” and "2-4 bridged sugars” described below.
- modified sugars and sugar-modified nucleosides described later include, for example, JP-A-10-304889, WO-2005/021570, JP-A-10-195098, JP-A-2002-521310, and WO-2007. / 143315, International Publication No. 2008/043753, International Publication No. 2008/029619, International Publication No. 2008/049085 and International Publication No. 2017/142054 (hereinafter, these documents are referred to as "documents related to antisense method") et al., sugars and sugar-modified nucleosides disclosed as being suitable for use in the antisense method.
- modified sugars partially substituted with one substituent include ribose or 2-deoxyribose substituted with (i) or (ii) below at any position of the sugar moiety.
- a C 1-6 alkyl group (ii) a halogen atom, a C 1-6 alkoxy group, a haloC 1-6 alkoxy group, a mono- or di-C 1-6 alkylamino group, a 5-10 membered heterocyclic group, a carboxy group, a carbamoyl group, or N - a C 1-6 alkyl group substituted with at least one selected from the group consisting of substituted carbamoyl groups;
- the N-substituted carbamoyl group includes an N-methyl-carbamoyl group and an N-ethyl-carbamoyl group, where the methyl group and the ethyl group of the N-methyl-carbamoyl group and N-ethyl-car
- N-substituted carbamoyl groups include N-methylcarbamoyl group, N-ethylcarbamoyl group, N-dimethylaminoethyl-carbamoyl group, N-morpholinoethylcarbamoyl group, N-(2-pyridylethyl)carbamoyl group, N-((benzimidazol-1-yl)ethyl)carbamoyl group and the like.
- “Sugar-modified nucleoside” means a molecule having the aforementioned "modified sugar” in place of the sugar moiety of a deoxyribonucleoside or ribonucleoside. Examples include “2'-modified nucleosides” and “2'-4'-bridged nucleosides” described below. When the modified sugar is (Z3) as defined above, sugar-modified nucleosides also include molecules in which the modified sugar and a nucleobase are linked via a methylene chain or the like.
- 2-modified sugar means a non-bridged sugar in which the oxygen atom or carbon atom at the 2-position of ribose is modified, such as "2-O-Me”, “2-O-MOE”, “2-O -MCE”, “2-O-NMA”, “2-O-AP”, “2-F”, “2-DMAECE”, “2-MorECE”, “2-PyECE” and “2-BimECE” contain.
- “2'-modified nucleoside” means a molecule having a nucleobase at position 1 of said two modified sugars, e.g., "2'-O-Me nucleoside”, “2'-O-MOE nucleoside”, “2' -O-MCE nucleoside”, “2'-O-NMA nucleoside”, “2'-O-AP nucleoside”, “2'-F nucleoside”, “2'-DMAECE nucleoside”, “2'-MorECE nucleoside” , “2′-PyECE nucleoside” and “2′-BimECE nucleoside”.
- 2-O-Me also called 2-O-methyl
- 2-O-Me nucleoside also called 2'-O-methyl nucleoside
- 2-O-MOE also called 2-O-methoxyethyl
- 2-O-methoxyethyl means a sugar in which the hydroxy group at position 2 of ribose has been replaced with a 2-methoxyethyloxy group.
- 2-O-MOE nucleoside also referred to as 2'-O-methoxyethyl nucleoside
- 2-O-MCE also called 2-O-methylcarbamoylethyl
- 2-O-methylcarbamoylethyl means a sugar in which the hydroxy group at position 2 of ribose has been replaced with a methylcarbamoylethyloxy group.
- 2'-O-MCE nucleoside also referred to as 2'-O-methylcarbamoylethyl nucleoside
- 2-O-NMA means a sugar in which the hydroxy group at position 2 of ribose has been replaced with a 2-[(methylamino)-2-oxoethyl]oxy group.
- 2-O-NMA nucleoside means a molecule having the nucleobase at position 1 of "2-O-NMA”.
- 2-O-AP means a sugar in which the hydroxy group at position 2 of ribose has been replaced with a 3-aminopropyloxy group.
- 2'-O-AP nucleoside means a molecule having the nucleobase at position 1 of "2-O-AP”.
- 2-F means a sugar in which the hydroxy group at the 2-position of ribose is replaced with a fluorine atom.
- 2'-F nucleoside means a molecule with a nucleobase at position 1 of "2-F”.
- 2-DMAECE 2-MorECE
- 2-PyECE 2-PyECE
- 2-BimECE are structures in which the hydroxy group at the 2-position of ribose is represented by DMAECE, MorECE, PyECE, and BimECE, respectively. is a modified sugar replaced with In the structure below, the wavy line indicates the bonding position with the carbon atom to which the hydroxy group at the 2-position of ribose is bonded.
- a "2-4 bridged sugar” means a sugar in which the bridging unit has been substituted by two substitutions at positions 2 and 4 on ribose.
- the bridging unit include a C 2-6 alkylene group (the alkylene group is unsubstituted or substituted with one or more substituents selected from the group consisting of a halogen atom, an oxo group and a thioxo group.
- alkylene group and one or two methylene groups of said alkylene group are either unsubstituted or independently —O—, —NR 1 — (R 1 is a hydrogen atom, a C 1-6 alkyl group or haloC 1 -6 alkyl group) and replaced with a group selected from the group consisting of -S-).
- a "2'-4'-bridged nucleoside"(2',4'-BNA) refers to a molecule having a nucleobase at position 1 of said 2-4 bridged sugar.
- ⁇ -D-methyleneoxy (4′-CH 2 -O-2′) BNA also called LNA (Locked Nucleic Acid®)
- ⁇ -L-methyleneoxy (4′ —CH 2 —O-2′)BNA ethyleneoxy (4′-(CH 2 ) 2 —O-2′)BNA also called ENA
- ⁇ -D-thio(4′-CH 2 —S-2 ') BNA also called aminooxy(4'- CH2 -ON(R11)-2')BNA ( R11 is H or CH3 )
- 2 ',4'-BNA NC oxyamino(4′-CH 2 —N(R 12 )-O-2′)BNA R 12 is H or CH 3
- 2′,4′-BNA COC 3′-a
- the bond between the carbon atom at position 1' and the nucleobase is an ⁇ -glycosidic bond and A ⁇ -glycosidic bond is included, but usually a ⁇ -glycosidic bond. Therefore, ⁇ -D-methyleneoxy BNA is usually used as LNA.
- n- means normal, "s-” means secondary, and "t-" means tertiary.
- Halogen atom means a fluorine atom, a chlorine atom, a bromine atom or an iodine atom.
- C 1-6 alkyl group means a linear or branched saturated hydrocarbon group having 1 to 6 carbon atoms, such as methyl group, ethyl group, n-propyl group, isopropyl group, n -butyl group, isobutyl group, s-butyl group, t-butyl group, n-pentyl group, isopentyl group, neopentyl group, n-hexyl group and isohexyl group.
- halo C 1-6 alkyl group means a group in which a hydrogen atom at any position in the above “C 1-6 alkyl group” is substituted with one or more above-mentioned “halogen atoms”.
- C 2-6 alkylene group means a divalent group obtained by removing one hydrogen atom at any position from a linear or branched saturated hydrocarbon group having 2 to 6 carbon atoms, for example Examples include ethylene (ethanediyl) group, propane-1,3-diyl (trimethylene) group, propane-2,2-diyl group, 2,2-dimethyl-propane-1,3-diyl group, hexane-1,6 -diyl (hexamethylene) group and 3-methylbutane-1,2-diyl group.
- the “C 1-20 alkylene group” means a divalent group obtained by removing one hydrogen atom at an arbitrary position from a linear or branched saturated hydrocarbon group having 1 to 20 carbon atoms.
- C 2-20 alkenylene group refers to a linear or branched unsaturated hydrocarbon group containing at least one double bond having 2 to 20 carbon atoms and one hydrogen atom at any position It means a removed divalent group.
- C 1-6 alkoxy group means a group in which the above “C 1-6 alkyl group” is bonded to an oxy group.
- halo C 1-6 alkoxy group means a group in which a hydrogen atom at an arbitrary position in the above “C 1-6 alkoxy group” is substituted with one or more above-mentioned “halogen atoms”.
- “Mono- or di-C 1-6 alkylamino group” means a group in which one hydrogen atom of an amino group is replaced with one "C 1-6 alkyl group", or two hydrogen atoms of an amino group are means a group replaced by two identical or different "C 1-6 alkyl groups", for example, methylamino group, ethylamino group, propylamino group, isopropylamino group, butylamino group, dimethylamino group, diethylamino group , dipropylamino group, dibutylamino group, and N-ethyl-N-methylamino group.
- 5- to 10-membered heterocyclic group is a 5- to 10-membered monocyclic or condensed ring system containing 1 to 4 heteroatoms selected from nitrogen atoms, sulfur atoms and oxygen atoms in addition to carbon atoms as ring-constituting atoms It means a polycyclic aromatic or non-aromatic heterocyclic group.
- the "5- to 10-membered heterocyclic group” include a thienyl group, a furyl group, a pyrrolyl group, an imidazolyl group, a pyrazolyl group, a thiazolyl group, an isothiazolyl group, an oxazolyl group, an isoxazolyl group, a pyridyl group, a pyrazinyl group, pyrimidinyl group, pyridazinyl group, triazolyl group, tetrazolyl group, triazinyl group, benzothiophenyl group, benzofuranyl group, benzimidazolyl group, benzoxazolyl group, benzoisoxazolyl group, benzothiazolyl group, benzoisothiazolyl group, benzotria solyl group, imidazopyridinyl group, thienopyridinyl group, pyrrolopyridin
- nucleobase is a purine base or a pyrimidine base, and may be a naturally occurring nucleobase or a modified naturally occurring nucleobase.
- Naturally occurring nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U).
- the “nucleobase” includes naturally occurring nucleobases and "modified nucleobases" described later.
- nucleobase modifications in "modified nucleobases” include halogenation, methylation, ethylation, n-propylation, isopropylation, cyclopropylation, n-butylation, isobutylation, s-butylation, t -butylation, cyclobutylation, hydroxylation, amination, thiolation and demethylation.
- the nucleobase in the nucleoside is preferably at least one selected from the group consisting of adenine, guanine, thymine, cytosine, uracil and 5-methylcytosine.
- 5-methylcytosine means cytosine having a methyl group at the 5-position.
- Nucleobase sequence means the sequence from the 5' side to the 3' side of the nucleobase of each nucleoside contained in the oligonucleotide.
- Contiguous nucleobase means a sequence from the 5' side to the 3' side of a part of consecutive nucleobases in the above-mentioned “nucleobase sequence”.
- Internucleoside linkage means a group or bond that forms a covalent bond between adjacent nucleosides in an oligonucleotide.
- Internucleoside linkages include phosphodiester linkages and "modified internucleoside linkages” described below.
- Modified internucleoside linkage means a modified phosphodiester linkage, e.g., phosphorothioate linkage, methylphosphonate linkage (including chiral-methylphosphonate linkage), methylthiophosphonate linkage, phosphorodithioate linkage, phosphoramidate bond, phosphorodiamidate bond, phosphoramidothioate bond, boranophosphate bond and the like. Also, Journal of Medicinal Chemistry, 2016, 59, pp 9645-9667, Medicinal Chemistry Communication, 2014, 5, pp 1454-1471, Future Medicinal Chemistry, 2011, 3, pp 339-365, etc. Examples are disclosed and can be used for modified phosphodiester linkages.
- Modified nucleoside means a nucleoside having a modified sugar and/or a modified nucleobase.
- Oligodeoxyribonucleotide has a structure in which two or more identical or different “nucleosides” are linked by the independently selected “internucleoside linkage” (e.g., phosphodiester linkage or modified phosphodiester linkage). means molecules.
- An “oligodeoxyribonucleotide” means a polynucleotide or oligonucleotide in which two or more of the same or different “deoxyribonucleosides” are linked by the “internucleoside linkages” selected independently of each other.
- “Oligoribonucleotide” means a polynucleotide or oligonucleotide in which two or more of the same or different “ribonucleosides” are linked by the “internucleoside linkage” independently selected from each other.
- DNA means a polynucleotide or oligonucleotide in which two or more naturally occurring "deoxyribonucleosides” are linked by phosphodiester bonds. Natural deoxyribonucleosides that constitute DNA may be the same or different.
- RNA means a polynucleotide or oligonucleotide in which two or more naturally occurring "ribonucleosides” are linked by phosphodiester bonds. The natural ribonucleosides that make up RNA may be the same or different.
- oligonucleotide complex is a complex in which a plurality of the “oligonucleotides” (molecules) that are not covalently linked to each other are hybridized intermolecularly so that the plurality of oligonucleotides are integrated. means.
- antisense effect means that the function of the target RNA is controlled by hybridizing the target RNA selected corresponding to the target gene and, for example, an oligonucleotide having a sequence complementary to its partial sequence.
- hybridization inhibits the translation of the target RNA, a splicing function conversion effect such as exon skipping, and the target RNA is degraded by recognition of the hybridized portion. etc.
- the target RNA is "ATN1 mRNA" and/or "ATN1 pre-mRNA".
- an "antisense oligonucleotide” is an oligonucleotide that produces the antisense effect. Examples include, but are not limited to, DNA, oligodeoxyribonucleotides, gapmers, and mixmers. RNA, oligoribonucleotides, or oligonucleotides designed to normally produce an antisense effect may be used.
- Hybridize refers to the act of forming a duplex between oligonucleotides containing complementary sequences or portions thereof, and oligonucleotides containing complementary sequences or portions thereof forming duplexes means phenomenon.
- “Complementary” means that two nucleobases can form Watson-Crick base pairs (natural base pairs) or non-Watson-Crick base pairs (Hoogsteen base pairs, etc.) through hydrogen bonding.
- Two oligonucleotides or portions thereof can "hybridize” if their sequences are complementary. Although it is not necessary for two oligonucleotides or portions thereof to hybridize they must be perfectly complementary, the complementarity for two oligonucleotides or portions thereof to hybridize is preferably 70%. or more, more preferably 80% or more, and still more preferably 90% or more (for example, 95%, 96%, 97%, 98%, or 99% or more).
- Sequence complementarity is determined by utilizing computer programs that automatically identify subsequences of oligonucleotides.
- OligoAnalyzer is one such software and is provided by Integrated DNA Technologies. The program is also available on the website.
- One skilled in the art can determine that two oligonucleotides hybridize when the two oligonucleotides have the preferred complementarity described above.
- Gapmer means an oligonucleotide containing a "gap segment", a "5' wing segment” and a “3' wing segment” described below.
- a “gap segment” is a region containing "at least four consecutive nucleosides recognized by RNase H", and is not particularly limited as long as it contains four or more consecutive nucleosides and is recognized by RNase H, but said consecutive Nucleosides are preferably independently selected from deoxyribonucleosides and sugar-modified nucleosides and comprise at least two deoxyribonucleosides.
- the 5' and 3' terminal nucleosides of the gap segment are preferably deoxyribonucleosides.
- a “5' wing segment” is a region that is linked to the 5' side of the gap segment and contains "at least one nucleoside” without the "at least four consecutive nucleosides recognized by RNase H". where the 3'-terminal nucleoside sugar moiety of the 5' wing segment is different from the 5'-terminal nucleoside sugar moiety of the gap segment. Differences in sugar moieties confirm the boundaries of the 5' wing and gap segments. In one embodiment of the present invention, the difference in sugar moieties is preferably determined by the presence or absence of modification at the 2-position of the corresponding sugar.
- the "2-modified sugar” is a non-crosslinked sugar in which the oxygen atom or carbon atom at the 2-position of ribose is modified
- the "2-4 bridged sugar” is defined as 2 Both are modified at the 2-position because they are sugars in which the bridging unit is substituted by two substitutions at the position and the 4-position.
- the nucleosides at the 5' end of the gap segment are deoxyribonucleosides and the nucleosides at the 3' end of the 5' wing segment are sugar-modified nucleosides.
- the sugar-modified nucleosides are 2'-4'-bridged nucleosides.
- the nucleoside at the 3' end of the 5' wing segment is generally a sugar modified nucleoside.
- the 5′ wing segment is not particularly limited as long as it satisfies the above definition, but said at least one nucleoside is preferably independently selected from deoxyribonucleosides and sugar-modified nucleosides and includes at least one sugar-modified nucleoside.
- a "3' wing segment” is a region that is linked to the 3' side of the gap segment and contains "at least one nucleoside" without the "at least four consecutive nucleosides recognized by RNase H".
- the difference in sugar moieties identify the boundary between the 3' wing segment and the gap segment.
- the difference in sugar moieties is preferably determined by the presence or absence of modification at the 2-position of the corresponding sugar.
- the nucleosides at the 3' end of the gap segment are deoxyribonucleosides and the nucleosides at the 5' end of the 3' wing segment are sugar-modified nucleosides.
- the sugar-modified nucleosides are 2'-4'-bridged nucleosides.
- the 5' terminal nucleoside of the 3' wing segment is generally a sugar modified nucleoside.
- the 3′ wing segment is not particularly limited as long as it satisfies the above definition, but said at least one nucleoside is preferably independently selected from deoxyribonucleosides and sugar-modified nucleosides and includes at least one sugar-modified nucleoside.
- the portion where the 2'-modified nucleoside or the 2'-4'-bridged nucleoside continues from the 5'-end is the 5'-wing segment, and the nucleoside at the 3'-end of the 5'-wing segment is 2'-modified.
- the boundary connecting nucleosides or other nucleosides (deoxyribonucleosides, ribonucleosides, etc.) except 2'-4'-bridged nucleosides is the boundary between the 5' wing segment and the gap segment.
- the portion where the 2'-modified nucleoside or the 2'-4'-bridged nucleoside continues from the 3'-end is the 3'-wing segment, and the nucleoside at the 5'-end of the 3'-wing segment is 2'-modified.
- the boundary connecting nucleosides or other nucleosides (deoxyribonucleosides, ribonucleosides, etc.) other than 2'-4'-bridged nucleosides is the boundary between the 3' wing segment and the gap segment.
- RNase H is generally known as a ribonuclease that recognizes a double strand in which DNA and RNA hybridize in vivo and cleaves the RNA to generate single-stranded DNA.
- RNase H recognizes not only double strands in which DNA and RNA hybridize, but also double strands in which at least one of the nucleobase moiety, phosphodiester linkage moiety and sugar moiety of at least one of DNA and RNA is modified. obtain. For example, it can also recognize duplexes in which DNA modified with phosphorothioate linkages and RNA are hybridized. It can also recognize double strands in which oligodeoxyribonucleotides and oligoribonucleotides are hybridized.
- DNA can be recognized by RNaseH when hybridized with RNA.
- RNA can also be cleaved by RNase H when hybridized with DNA.
- RNase H when hybridized with DNA.
- typical examples include oligonucleotides in which the phosphodiester binding portion of DNA is modified with phosphorothioate.
- RNase H is preferably mammalian RNase H, more preferably human RNase H, and particularly preferably human RNase H1.
- At least 4 consecutive nucleosides recognized by RNaseH includes 4 or more consecutive nucleosides, and is not particularly limited as long as it is recognized by RNaseH, for example, “at least 4 consecutive deoxyribonucleosides", etc. are mentioned.
- the number of nucleosides constituting "at least four consecutive nucleosides recognized by RNaseH” is, for example, 5 to 30, preferably 5 to 15, more preferably 8 to 12, particularly preferably 10. Whether a given at least four consecutive nucleosides are "at least four consecutive nucleosides recognized by RNase H" can be determined by those skilled in the art from the structure of the sugar portion of the consecutive nucleosides.
- Oligonucleotides that contain multiple sugar-modified nucleosides and produce an antisense effect without the gap segment. Oligonucleotides in which nucleosides consisting of three deoxyribonucleosides or oligonucleotides are alternately linked, oligonucleotides consisting of only sugar-modified nucleosides as nucleosides, and the like.
- ATN1 (Atrophin1) means any protein of Atrophin1.
- ATN1 mRNA means mRNA encoding ATN1 protein
- ATN1 pre-mRNA means pre-mRNA encoding ATN1 protein.
- ATN1 nucleic acid means any nucleic acid encoding ATN1, including, for example, “ATN1 mRNA” and "ATN1 pre-mRNA”.
- ATN1 mRNA is represented, for example, by SEQ ID NO: 1
- ATN1 pre-mRNA is represented, for example, by SEQ ID NO: 2 or 717. Both "ATN1 mRNA” and “ATN1 pre-mRNA” have nucleosides linked together by phosphodiester bonds, and thymine is usually replaced with uracil. "ATN1 mRNA” and “ATN1 pre-mRNA” do not otherwise have modified sugars, modified nucleobases, or modified internucleoside linkages.
- Gene expression refers to the conversion of gene code information into structures or functions in cells. Such structures include, but are not limited to, transcription and translation products (mRNA, pre-mRNA, proteins, etc.).
- DRPLA Dentate-rubropallid-louis-body atrophy
- CAG repeats are present in many genes other than ATN1 and thus may have off-target effects.
- the ASO derivatives of the present invention are complementary to ATN1 mRNA and/or ATN1 pre-mRNA and do not target the CAG repeat of the ATN1 gene. That is, since it has complementarity with other than the CAG repeat sequence, it is expected that the variation in efficacy is small and the off-target effect is small.
- a “CAG repeat sequence” is a sequence in which three base units of cytosine (C), adenine (A), and guanine (G) are repeated in this order. Those skilled in the art can determine from the base sequence of ASO that the CAG repeat sequence is not the target.
- the first oligonucleotide targets the ATN1 mRNA or pre-mRNA.
- the first oligonucleotide contains a sequence that allows it to hybridize with the ATN1 mRNA or pre-mRNA.
- the first oligonucleotide need not hybridize with the entire ATN1 mRNA or pre-mRNA, but usually hybridizes with at least a portion.
- an oligonucleotide having a sequence complementary to a partial sequence of ATN1 mRNA or pre-mRNA (such as a gapmer or an oligonucleotide generally designed to produce an antisense effect) and an ATN1 mRNA or pre-mRNA
- the expression of the ATN1 gene is controlled by hybridizing a part. Also, the entire first oligonucleotide need not be hybridized, and a portion thereof may not be hybridized.
- the complementarity between the nucleic acid base sequence of the first oligonucleotide and the partial sequence of ATN1 mRNA or pre-mRNA is preferably 70% or more, more preferably 80% or more, still more preferably 90% or more (e.g., 95% , 96%, 97%, 98% or 99% or more).
- their sequences need not be completely complementary, but must be completely complementary. is even more preferred.
- the first oligonucleotide consists of 8-30 nucleosides independently selected from deoxyribonucleosides, ribonucleosides and sugar-modified nucleosides and includes at least one sugar-modified nucleoside.
- the number of nucleosides contained in the first oligonucleotide is 8 to 30, preferably 8 to 25, more preferably 13 to 23, still more preferably 15 to 21, still more Preferably 16 to 20, particularly preferably 16 or 20.
- Nucleosides comprised in the first oligonucleotide are preferably independently selected from deoxyribonucleosides and sugar-modified nucleosides.
- the first oligonucleotide has a gap segment, a 5' wing segment and a 3' wing segment.
- the gap segment consists of at least five nucleosides independently selected from the group consisting of deoxyribonucleosides, ribonucleosides and sugar-modified nucleosides, and includes at least two deoxyribonucleosides, the 3' and 5' ends of which are respectively Independently, it is a deoxyribonucleoside.
- a gap segment preferably comprises "at least 4 consecutive deoxyribonucleosides".
- the number of nucleosides contained in the gap segment is preferably 5-28, more preferably 5-16, even more preferably 8-12, still more preferably 9 or 10. .
- the gap segment is composed of deoxyribonucleosides.
- the internucleoside linkages contained in the gap segment are preferably independently selected from phosphodiester linkages and modified phosphodiester linkages. and more preferably at least one independently selected from a phosphodiester bond and a phosphorothioate bond.
- the internucleoside linkages contained in the gap segment preferably contain at least one phosphorothioate linkage, more preferably 50% or more are phosphorothioate linkages, more preferably 75% or more are phosphorothioate linkages, and 80% More preferably, the above are phosphorothioate bonds, even more preferably 90% or more are phosphorothioate bonds, and most preferably all are phosphorothioate bonds.
- the 5' wing segment consists of at least one nucleoside independently selected from the group consisting of deoxyribonucleosides, ribonucleosides and sugar-modified nucleosides, provided that its 3' end attached to the gap segment is sugar-modified is a nucleoside and does not contain "at least 4 consecutive nucleosides recognized by RNase H".
- the 3' wing segment consists of at least one nucleoside independently selected from the group consisting of deoxyribonucleosides, ribonucleosides and sugar-modified nucleosides, provided that its 5' end attached to the gap segment is sugar-modified is a nucleoside and does not contain "at least 4 consecutive nucleosides recognized by RNase H".
- the 5' and 3' wing segments preferably do not contain "at least 4 consecutive deoxyribonucleosides”.
- wing segments the properties common to the 5′ wing segment and the 3′ wing segment are referred to as wing segments.
- the number of nucleosides contained in the wing segment is respectively 1 to 15, preferably 1 to 10, more preferably 1 to 7, still more preferably 2 to 6, still more preferably 2 to 5, more preferably 3 to 5, and particularly preferably 3 or 4.
- the sugar-modified nucleoside contained in the wing segment is preferably a nucleoside with increased affinity for the partial sequence of ATN1 mRNA and/or ATN1 pre-mRNA or a nucleoside with increased resistance to nucleolytic enzymes due to substitution or the like. More preferably, they are independently selected from 2' modified nucleosides and 2',4'-BNAs.
- 2′-modified nucleosides contained in the wing segment are preferably 2′-O-Me nucleosides, 2′-O-MOE nucleosides, 2′-O-AP nucleosides, 2′-F nucleosides, 2′-O-NMA at least one independently selected from the group consisting of nucleosides, 2′-O-MCE nucleosides, 2′-DMAECE nucleosides, 2′-MorECE nucleosides, 2′-PyECE nucleosides and 2′-BimECE nucleosides, and more Preferably at least one independently selected from the group consisting of 2'-O-Me nucleosides, 2'-O-MOE nucleosides, 2'-O-NMA nucleosides and 2'-O-MCE nucleosides, and further More preferably, it is at least one independently selected from 2'-O-MOE nucleosides and 2'-O
- 2',4'-BNA contained in the wing segment is preferably at least one independently selected from the group consisting of LNA, cEt, ENA, BNA NC , AmNA, GuNA and scpBNA, more preferably It is an LNA.
- the sugar-modified nucleosides contained in the wing segment are more preferably at least one independently selected from 2'-O-MOE nucleosides, LNA and 2'-O-MCE nucleosides, and more preferably 2' -O-MOE nucleosides, 2'-O-MCE nucleosides, or combinations of LNA and 2'-O-MCE nucleosides, even more preferably 2'-O-MOE nucleosides , or a combination of LNA and 2'-O-MCE nucleosides, particularly preferably a combination of LNA and 2'-O-MCE nucleosides.
- Each wing segment preferably consists of 1-10 nucleosides independently selected from the group consisting of sugar-modified nucleosides and deoxyribonucleosides and includes at least one sugar-modified nucleoside. More preferably, it consists of 2 to 6 nucleosides independently selected from the group consisting of sugar-modified nucleosides and deoxyribonucleosides, and contains at least two sugar-modified nucleosides.
- each wing segment is more specifically 1 to 10, preferably 1 to 7, more preferably independently selected from LNA, 2'-O-MCE nucleosides and 2'-O-MOE nucleosides.
- Each wing segment even more preferably consists of two LNAs and one or two 2'-O-MCE nucleosides, particularly preferably two LNAs and one 2'-O-MCE nucleoside.
- each wing segment more preferably consists of 3 to 6, particularly preferably 5, 2'-O-MOE nucleosides. In still another aspect, it is more preferably composed of 3 to 6, particularly preferably 5, 2'-O-MCE nucleosides.
- each wing segment consists of 2-5 nucleosides independently selected from the group consisting of 2',4'-BNA and deoxyribonucleosides, and at least two 2',4' -An oligonucleotide containing BNA, such an oligonucleotide can be referred to WO 2016/127002 and the like.
- a preferred LNA contained in each wing segment is ⁇ -D-methyleneoxy BNA.
- the 5' and 3' wing segments each independently comprise 3, 4, 5, or 6 sugar modified nucleosides and the gap segment comprises 8, 9, 10 , 11, 12, 13, or 14 deoxyribonucleosides.
- the number of nucleosides of such gapmers can be expressed as [the number of nucleosides in the 5' wing segment - the number of nucleosides in the gap segment - the number of nucleosides in the 3' wing segment], for example, 5-10-5, 5- 11-4, 4-11-5, 4-12-4, 3-14-3, 6-8-6, 3-12-3, 3-10-3, 4-10-4, 3-10- 4, 4-10-3, 3-9-3, 4-9-4, 3-9-4, 4-9-3, 3-8-3, 3-8-4, 4-8-3 and It is represented by 4-8-4.
- the first oligonucleotide has at least 11, 12, 13, 14 or 15 consecutive nucleosides and the gap segment has at least 5, 6, 7, 8, or 9 consecutive nucleosides, and the 5′ wing segment and the 3′ wing segment are any of (i) to (iv) below.
- the 5' and 3' wing segments each independently contain 3, 4, 5 or 6 2'-O-MOE nucleosides;
- the 5' and 3' wing segments each independently contain 3, 4, 5 or 6 2'-O-MCE nucleosides;
- the 5' and 3' wing segments each independently comprise 2, 3, 4, 5 or 6 LNAs;
- the 5' wing segment and the 3' wing segment each independently comprise 3 or 4 selected from 2'-O-MCE nucleosides and LNAs, and at least one 2'-O-MCE nucleoside; and at least one LNA.
- the arrangement of sugar-modified nucleosides in the 5′ wing segment and the 3′ wing segment is preferably VLL, LVL, LLV, LVV, VLV, VVL, LLL, VVLL, VLVL, VLLV, LVLV, LLVV, LVVL , VLLL, LVLL, LLVL, LLLV, LVVV, VLVV, VVLV, and VVVL.
- the placement of the sugar modified nucleosides in the 5' wing segment is selected from the group consisting of LLL, VLL, LVL, VVL, LLV, VLVL, LVLV, LLVV and VLLV
- the placement of the sugar modified nucleosides in the 3' wing segment is selected from the group consisting of LLL, LLV, LVL, LVV, VLL, LVLV, VLVL, VVLL and VLLV.
- the sugar-modified nucleoside placement in the 5' wing segment is selected from the group consisting of LLL, VLL, LVL, VVL, LLV, VLVL, LVLV, LLVV and VLLV
- the sugar-modified nucleoside placement in the 3' wing segment is selected from the group consisting of LLL, LLV, LVL, LVV, VLL, LVLV and VLLV.
- the placement of the sugar-modified nucleosides in the 5' wing segment is selected from the group consisting of VLL, LVL, VVL, LLV, VLVL and VLLV, and the placement of the sugar-modified nucleosides in the 3' wing segment is LLV, It is selected from the group consisting of LVL, LVV, VLL, LVLV and VLLV.
- L and V in the 5' wing segment and 3' wing segment are sugar-modified nucleosides having different modified sugars, and the left side indicates the 5' side and the right side indicates the 3' side.
- L represents a 2'-4'-bridged nucleoside and V represents a 2' modified nucleoside.
- L denotes LNA and V denotes a 2'-O-MCE nucleoside.
- the internucleoside linkages contained in the 5' wing segment is preferably at least one independently selected from a phosphodiester bond and a modified phosphodiester bond, more preferably at least one independently selected from a phosphodiester bond and a phosphorothioate bond. Seeds.
- the internucleoside linkages contained in the 5' wing segment preferably comprise at least one phosphorothioate linkage, preferably 50% or more are phosphorothioate linkages, more preferably 60% or more are phosphorothioate linkages, 75 % or more are phosphorothioate linkages, even more preferably 80% or more are phosphorothioate linkages, even more preferably 90% or more are phosphorothioate linkages, and particularly preferably all are phosphorothioate linkages. .
- the 3' wing segment is similar to the 5' wing segment.
- the internucleoside linkages contained in the wing segment may be all phosphodiester linkages from the viewpoint of reducing toxicity, but are preferably partially phosphodiester linkages.
- the 5' terminal internucleoside linkages contained in the 5' wing segment are preferably phosphorothioate linkages.
- the 3' terminal internucleoside linkages contained in the 3' wing segment are preferably phosphorothioate linkages.
- Other internucleoside linkages of the 5' wing segment, except for the 5' terminal internucleoside linkage included in the 5' wing segment may be phosphodiester linkages or phosphorothioate linkages, but 50% or more are phosphodiester linkages.
- the other internucleoside linkages of the 3' wing segment may be phosphodiester linkages or phosphorothioate linkages, but may be 50% or more phosphodiester linkages.
- the internucleoside bond located closest to the gap segment is preferably a phosphodiester bond.
- the 5′ terminal internucleoside bond is preferably a phosphorothioate bond
- the gap segment side internucleoside bond is preferably a phosphodiester bond.
- the internucleoside linkage at the 5' end is preferably a phosphorothioate bond
- the other two internucleoside linkages contained in the 5' wing segment are independent. is preferably a phosphodiester bond or a phosphorothioate bond, and particularly preferably a phosphodiester bond.
- the 5′ terminal internucleoside bond is preferably a phosphorothioate bond, and the other three internucleoside bonds contained in the 5′ wing segment are independent.
- a phosphodiester bond or a phosphorothioate bond is preferred, and a phosphodiester bond is particularly preferred.
- the 3′ wing segment contains two internucleoside bonds
- the 3′ terminal internucleoside bond is preferably a phosphorothioate bond
- the gap segment side internucleoside bond is preferably a phosphodiester bond.
- the internucleoside bond at the 3′ end is preferably a phosphorothioate bond, and the other two internucleoside bonds contained in the 3′ wing segment are independent. is preferably a phosphodiester bond or a phosphorothioate bond, and particularly preferably a phosphodiester bond.
- the internucleoside linkage at the 3' end is preferably a phosphorothioate linkage, and the other three internucleoside linkages contained in the 3' wing segment are independent.
- a phosphodiester bond or a phosphorothioate bond is preferred, and a phosphodiester bond is particularly preferred.
- the 5' wing segment contains one nucleoside
- the 5' wing segment contains 0 internucleoside bonds.
- the 3' wing segment contains one nucleoside
- the 3' The wing segment contains 0 internucleoside linkages.
- the 3' end of the 5' wing segment and the 5' end of the gap segment are linked by forming a phosphodiester bond or a modified phosphodiester bond, and the 5' end of the 3' wing segment
- the 'end and the 3' end of the gap segment are linked by forming a phosphodiester bond or a modified phosphodiester bond.
- the 3' end of the 5' wing segment and the 5' end of the gap segment are linked by forming a modified phosphodiester bond, and the 5' end of the 3' wing segment and the 3' end of the gap segment are linked.
- the ends are ligated forming a modified phosphodiester bond.
- the 3' end of the 5' wing segment and the 5' end of the gap segment are linked by forming a phosphorothioate bond, and the 5' end of the 3' wing segment and the 3' end of the gap segment are linked by phosphorothioate linked by forming a bond.
- the 3' end of the 5' wing segment and the 5' end of the gap segment are linked by forming a phosphodiester bond, and the 5' end of the 3' wing segment The 'end and the 3' end of the gap segment are linked by forming a phosphorothioate bond.
- the 3' end of the 5' wing segment and the 5' end of the gap segment are linked by forming a phosphorothioate bond, and the 5' end of the 3' wing segment and the 3' end of the gap segment are , may be linked by forming a phosphodiester bond, the 3′ end of the 5′ wing segment and the 5′ end of the gap segment are linked by forming a phosphodiester bond, and the 5′ end of the 3′ wing segment The 'end and the 3' end of the gap segment may be linked by forming a phosphodiester bond.
- the first oligonucleotide preferably comprises positions 59 to 104, 109 to 133, 173 to 192, 207 to 272, 300 to 319, 353 to 372, 419 to 434, 458-509, 523-559, 561-618, 626-685, 766-785, 787-819, 838-855, 880-922, 924-943, 970-989, 994-1039, 1055-1074, 1079-1098, 1157-1176, 1196-1223, 1310-1329, 1339-1399, 1423-1442, 1614-1633, 1650-1670, 1806-1833, 1844-1865, 1896-1915, 1924-1992, 2023- 2042, 2058-2081, 2103-2124, 2398-2417, 2480-2520, 2526-2562, 2568-2587, 2853-2872, 2876-2923, 2931-2950, 2972-3016, 3072-3099, 3109-3128, 3192-3211, 3267-3290, 3333-33
- the first oligonucleotide is more preferably located at position numbers 238-272, 537-559, 585-618, 664-683, 787-819, 838-855, 924 of the nucleobase of ATN1 mRNA represented by SEQ ID NO: 1 ⁇ 943, 972 ⁇ 987, 994 ⁇ 1029, 1055 ⁇ 1074, 1080 ⁇ 1095, 1204 ⁇ 1219, 1310 ⁇ 1329, 1362 ⁇ 1397, 1650 ⁇ 1670, 1806 ⁇ 1833, 1844 ⁇ 1865, 1896 ⁇ 1915, 1955 ⁇ 1992 . -3926, 4022-4062, 4118-4137, 4218-4236, and 4266-4281.
- the first oligonucleotide is more preferably complementary to at least part of the nucleobase sequence represented by position numbers 3419-3557 of the ATN1 mRNA nucleobase represented by SEQ ID NO:1.
- the first oligonucleotide is more preferably complementary to at least part of the nucleobase sequence represented by position numbers 3449-3557 of the ATN1 mRNA nucleobase represented by SEQ ID NO:1.
- the first oligonucleotide is more preferably complementary to at least part of the nucleobase sequence represented by position numbers 3451-3520 of the ATN1 mRNA nucleobase represented by SEQ ID NO:1.
- the first oligonucleotide is even more preferably a nucleobase sequence selected from the group consisting of the nucleobase sequences represented by position numbers 3451 to 3484 and 3487 to 3520 of the ATN1 mRNA nucleobase represented by SEQ ID NO: 1.
- the first oligonucleotide is complementary to at least a portion of The first oligonucleotide is even more preferably a nucleobase sequence selected from the group consisting of the nucleobase sequences represented by position numbers 3451 to 3475 and 3490 to 3505 of the ATN1 mRNA nucleobase represented by SEQ ID NO: 1. is complementary to at least a portion of
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 3451-3468 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by position numbers 3452-3467 of the ATN1 mRNA nucleobase represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 3453-3468 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 3457-3476 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 3458-3477 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 3459-3474 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 3459-3476 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 3460-3475 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 3461-3476 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 3465-3484 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 3487-3502 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 3488-3503 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 3490-3505 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by position numbers 3501-3520 of the ATN1 mRNA nucleobase represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 538-553 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 587-602 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 666-681 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 1363-1378 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase position numbers 1975-1990 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 2888-2903 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 2979-2994 of the ATN1 mRNA represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by position numbers 3520-3535 of the ATN1 mRNA nucleobase represented by SEQ ID NO:1.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 4221-4236 of the ATN1 mRNA represented by SEQ ID NO:1.
- the complementarity between the first oligonucleotide and the corresponding portion of ATN1 mRNA represented by SEQ ID NO: 1 is at least 80% or more, preferably 85% or more, more preferably 90% or more, Even more preferably, it is 95%, 96%, 97%, 98%, 99% or more.
- the first oligonucleotide preferably consists of 8-30 nucleosides complementary to at least a portion of each of the above target regions of ATN1 mRNA represented by SEQ ID NO:1. More preferably 10 to 25, more preferably 16 to 20, particularly preferably 16 or 20 nucleosides.
- the first oligonucleotide preferably comprises nucleobase positions 383-398, 986-1001, 1004-1019, 1378-1393, 1398-1413, 1853-1868 of the ATN1 pre-mRNA represented by SEQ ID NO: 2, 1971-1986, 2189-2204, 2522-2537, 2562-2577, 3662-3677, 3987-4002, 4217-4232, 4266-4281, 4335-4350, 4360-4375, 4477-4492, 4562-4577, 4636- 4651, 4687-4702, 4734-4749, 4840-4855, 5536-5563, 5568-5592, 5632-5651, 5666-5715, 5906-5925, 5959-5978, 6176-6191, 6215-6266, 6963-6978, 7248-7284, 7286-7343, 7351-7410, 7491-7510, 7512-7544, 7563-7580, 7605-7647, 7649-7668,
- the first oligonucleotide is more preferably the position numbers 986 to 1001, 1004 to 1019, 1378 to 1393, 1398 to 1413, 4217 to 4232, 4335 to 4350 of the nucleobases of the ATN1 pre-mRNA represented by SEQ ID NO: 2 ,4360-4375,4477-4492,4562-4577,4636-4651,4687-4702,4734-4749,4840-4855,5697-5715,6963-6978,7262-7284,7310-7343,7389-7408,7512 ⁇ 7544, 7563 ⁇ 7580, 7649 ⁇ 7668, 7697 ⁇ 7712, 7719 ⁇ 7754, 7780 ⁇ 7799, 7805 ⁇ 7820, 7929 ⁇ 7944, 8035 ⁇ 8054, 8087 ⁇ 8122, 8375 ⁇ 8395, 8531 ⁇ 8558, 8569 ⁇ 8590 .
- 13931-13946 is complementary to at least a portion within the nucleobase sequence that is identified.
- the first oligonucleotide is more preferably complementary to at least part of the nucleobase sequence represented by nucleobase position numbers 12508-12680 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is even more preferably complementary to at least part of the nucleobase sequence represented by nucleobase positions 12572-12680 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is more preferably complementary to at least part of the nucleobase sequence represented by nucleobase positions 12574-12643 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is more preferably a nucleobase selected from the group consisting of the nucleobase sequences represented by position numbers 12574 to 12607 and 12610 to 12643 of the ATN1 pre-mRNA represented by SEQ ID NO: 2. It is complementary to at least part of the sequence.
- the first oligonucleotide is even more preferably a nucleic acid selected from the group consisting of the nucleobase sequences represented by nucleobase position numbers 12574 to 12598 and 12613 to 12628 of the ATN1 pre-mRNA represented by SEQ ID NO: 2. It is complementary to at least part of the base sequence.
- the first oligonucleotide is complementary to at least part of the nucleobase sequence represented by nucleobase positions 12574-12591 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase position numbers 12575-12590 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase position numbers 12576-12591 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 12580-12599 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least part of the nucleobase sequence represented by nucleobase position numbers 12581-12600 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 12582-12597 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 12582-12599 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase position numbers 12583-12598 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 12584-12599 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least part of the nucleobase sequence represented by nucleobase position numbers 12588-12607 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least part of the nucleobase sequence represented by nucleobase positions 12610-12625 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase position numbers 12611-12626 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 12613-12628 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least part of the nucleobase sequence represented by nucleobase position numbers 12624-12643 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 4335-4350 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 4360-4375 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 7263-7278 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 7312-7327 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 7391-7406 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 8088-8103 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least part of the nucleobase sequence represented by nucleobase position numbers 10309-10324 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least part of the nucleobase sequence represented by nucleobase positions 10400-10415 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase positions 12643-12658 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- the first oligonucleotide is complementary to at least a portion of the nucleobase sequence represented by nucleobase position numbers 13886-13901 of the ATN1 pre-mRNA represented by SEQ ID NO:2.
- Complementarity between the first oligonucleotide and the corresponding portion of ATN1 pre-mRNA represented by SEQ ID NO: 2 is at least 80% or more, preferably 85% or more, more preferably 90% Above, and more preferably above 95%, 96%, 97%, 98%, 99%.
- the first oligonucleotide preferably consists of 8 to 30 nucleosides complementary to at least a portion of each of the above target regions of ATN1 pre-mRNA represented by SEQ ID NO:2. More preferably 10 to 25, more preferably 16 to 20, particularly preferably 16 or 20 nucleosides.
- the nucleobase sequence of the first oligonucleotide is preferably at least 8, more preferably 8, 9, 10, 11, 12, 13 of any of SEQ ID NOS: 3-716 and 718-770. , 14 or 15 contiguous nucleobases.
- the nucleobase sequence of the first oligonucleotide more preferably includes any one of the nucleobase sequences of SEQ ID NOs: 3-716 and 718-770.
- the nucleobase sequence of the first oligonucleotide is preferably at least 8 nucleobase sequences in any one of nucleobase sequence group A, more preferably 8, 9, 10, 11, 12, 13, 14 or It has a nucleobase sequence containing 15 contiguous nucleobases, and more preferably contains any one nucleobase sequence of nucleobase sequence group A.
- the nucleobase sequence of the first oligonucleotide is more preferably at least 8 nucleobase sequences in any one of nucleobase sequence group B, more preferably 8, 9, 10, 11, It has a nucleobase sequence containing 12, 13, 14 or 15 contiguous nucleobases, and more preferably contains any one nucleobase sequence of nucleobase sequence group B.
- the nucleobase sequence of the first oligonucleotide is more preferably at least 8 nucleobase sequences of any one of nucleobase sequence group C, still more preferably 8, 9, 10, 11 , 12, 13, 14 or 15 contiguous nucleobases, particularly preferably any one of nucleobase sequence group C.
- Nucleic acid base sequence group A SEQ. 52, 55, 59, 60, 61, 62, 63, 66, 67, 68, 69, 70, 72, 74, 75, 78, 79, 82, 83, 84, 85, 86, 87, 88, 89, 91, 92, 94, 95, 97, 99, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 126, 127, 128, 131, 132, 133, 137, 138, 139, 148, 151, 152, 153, 154, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174
- Nucleic acid base sequence group B SEQ. 103, 104, 105, 106, 107, 109, 111, 112, 113, 114, 117, 120, 121, 122, 124, 128, 138, 151, 152, 153, 154, 156, 157, 159, 160, 161, 163, 168, 169, 171, 174, 180, 181, 184, 185, 186, 187, 188, 189, 190, 192, 194, 195, 196, 197, 198, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 238, 239, 240, 241, 298, 299,
- Nucleic acid base sequence group C The group consisting of SEQ. Preferred sequence numbers among the sequence numbers listed in the nucleobase sequence group C are listed below. SEQ ID NO:209, SEQ ID NO:215, SEQ ID NO:216, SEQ ID NO:221, SEQ ID NO:715. Among the SEQ ID NOs listed in the nucleobase sequence group C, particularly preferred SEQ ID NOs are listed below in addition to the above. SEQ ID NO:47, SEQ ID NO:105, SEQ ID NO:174, SEQ ID NO:214, SEQ ID NO:240, SEQ ID NO:585, SEQ ID NO:586.
- the nucleobase sequence of the first oligonucleotide is preferably at least 8, more preferably 8, 9, 10 or 11, of any one of nucleobase sequence groups D1 and D3. , 12, 13, 14 or 15 contiguous nucleobases, more preferably any one of nucleobase sequence groups D1 and D3.
- the number of first oligonucleotides is preferably 8-30, more preferably 12-25, even more preferably 12-22, even more preferably 16-20, even more preferably 16-18. , particularly preferably consisting of 16 nucleosides.
- the nucleobase sequence of the first oligonucleotide is preferably at least 8, more preferably 8, 9, 10, 11, 12 nucleobase sequences of any one of the nucleobase sequence group D2. , 13, 14 or 15 contiguous nucleobases, more preferably any one of the nucleobase sequence group D3.
- the first oligonucleotide preferably comprises 8 to 30, more preferably 12 to 25, even more preferably 12 to 22, even more preferably 16 to 20, particularly preferably 18 nucleosides. Become.
- the nucleobase sequence of the first oligonucleotide is more preferably at least 8, more preferably 8, 9, 10 or 11, of any one of the nucleobase sequences of nucleobase sequence group E. , 12, 13, 14 or 15 contiguous nucleobases, more preferably any one of nucleobase sequence group E.
- the first oligonucleotide preferably comprises 8 to 30, more preferably 16 to 25, even more preferably 16 to 22, even more preferably 16 to 20, particularly preferably 20 nucleosides. Become.
- Nucleic acid base sequence group D1 SEQ. 52, 55, 59, 60, 61, 62, 63, 66, 67, 68, 69, 70, 72, 74, 75, 78, 79, 82, 83, 84, 85, 86, 87, 88, 89, 91, 92, 94, 95, 97, 99, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 126, 127, 128, 131, 132, 133, 137, 138, 139, 148, 151, 152, 153, 154, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173,
- SEQ ID NO:208 SEQ ID NO:215, SEQ ID NO:220, SEQ ID NO:221, SEQ ID NO:222.
- SEQ ID NO: 222 SEQ ID NO: 221, SEQ ID NO:222.
- SEQ ID NO: 47 SEQ ID NO: 105, SEQ ID NO: 174, SEQ ID NO: 214, SEQ ID NO: 240, SEQ ID NO: 585, SEQ ID NO: 586.
- Nucleic acid base sequence group D2 the group consisting of: .
- Nucleic acid base sequence group D3 SEQ. The group consisting of 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769 and 770.
- Nucleic acid base sequence group E SEQ. 294, 296, 297, 298, 299, 300, 302, 303, 304, 305, 306, 307, 309, 310, 311, 313, 314, 315, 316, 317, 319, 320, 321, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 335, 337, 338, 339, 340, 341, 342, 344, 345, 346, 347, 348, 349, 350, 355, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 369, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 382, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 409, 410, 411, 412
- the first oligonucleotide having a nucleobase sequence comprising at least 8 contiguous nucleobases of any one of the nucleobase sequences of nucleobase sequence group D1 preferably has at least one LNA and at least have one 2'-O-MCE nucleoside, preferably 1 or 2 LNA and 1 or 2 2'-O-MCE nucleoside, more preferably 2 LNA and one 2'-O-MCE nucleoside, or one LNA and two 2'-O-MCE nucleosides. It may have two LNAs and two 2'-O-MCE nucleosides. Particularly preferred are two LNAs and one 2'-O-MCE nucleoside.
- the first oligonucleotide having a nucleobase sequence comprising at least 8 contiguous nucleobases of any one of the nucleobase sequences of the nucleobase sequence group D2 preferably has at least one LNA and at least It has one 2'-O-MCE nucleoside, preferably 1 or 2 LNA and 1 or 2 2'-O-MCE nucleoside, particularly preferably 2 LNA and two 2'-O-MCE nucleosides.
- the first oligonucleotide having a nucleobase sequence comprising at least 8 contiguous nucleobases of any one of the nucleobase sequences of nucleobase sequence group D3 preferably has at least one LNA in each wing segment. However, it preferably has 1 to 3 LNAs, particularly preferably 3 LNAs.
- a first oligonucleotide having a nucleobase sequence comprising at least 8 contiguous nucleobases of any one of the nucleobase sequences of nucleobase sequence group E is attached to each wing segment, particularly preferably at least one 2′- O-MOE nucleosides or at least one 2'-O-MCE nucleoside, preferably 5 2'-O-MOE nucleosides or 5 2'-O-MCE nucleosides, more particularly It preferably has five 2'-O-MOE nucleosides.
- the second oligonucleotide consists of 8-30 nucleosides independently selected from deoxyribonucleosides, ribonucleosides and sugar-modified nucleosides. It includes a sequence that allows it to hybridize with at least a portion of the first oligonucleotide.
- the number of nucleosides contained in the second oligonucleotide is 8 to 30, preferably 8 to 25, more preferably 13 to 23, still more preferably 15 to 21, and further More preferably 16 to 20, particularly preferably 16 or 20.
- the number of nucleosides contained in the second oligonucleotide may be the same as or different from the number of nucleosides contained in the first oligonucleotide. The difference is preferably 3 or less, more preferably 1 or less, and particularly preferably the same.
- the second oligonucleotide hybridizes intramolecularly or intermolecularly with at least a portion of the first oligonucleotide.
- the first and second oligonucleotides in the single-stranded oligonucleotide may hybridize intramolecularly or intermolecularly, but preferably hybridize intramolecularly.
- the first oligonucleotide and the second oligonucleotide in the single-stranded oligonucleotide are preferably intramolecularly hybridized.
- the first and second oligonucleotides in the double-stranded oligonucleotide complex are intermolecularly hybridized.
- the complementarity is preferably 70% or more, more preferably 80% or more, and even more preferably. is 90% or more (eg, 95%, 96%, 97%, 98%, 99% or more).
- the first oligonucleotide and the second oligonucleotide may be fully complementary.
- nucleic acid base sequence of the second oligonucleotide is highly complementary to the nucleic acid base sequence of the first oligonucleotide, it can be designed based on the nucleic acid base sequence of the first oligonucleotide.
- the nucleic acid base sequence of the second oligonucleotide is preferably complementary to the nucleic acid base sequence of any one of SEQ ID NOs: 3-716 and 718-770, more preferably a nucleic acid selected from nucleic acid base sequence group A Complementary to the base sequence, more preferably complementary to a nucleobase sequence selected from nucleobase sequence group B, still more preferably complementary to a nucleobase sequence selected from nucleobase sequence group C is.
- the nucleobase sequence of the second oligonucleotide may be complementary to a nucleobase sequence selected from nucleobase sequence group D (preferably D1), or a nucleobase sequence selected from nucleobase sequence group E may be complementary
- nucleobase sequences possessed by the second oligonucleotide are listed below, and a nucleobase sequence complementary to the nucleobase sequence possessed by the first oligonucleotide is selected.
- CCUCGGUGCACCCUCUCA SEQ ID NO: 782
- CUCGGUGCACCCUCUC SEQ ID NO: 783
- UCGGUGCACCCUCUCA SEQ ID NO: 784
- UGCACCCUCUCAUUGACCCC SEQ ID NO: 785
- GCACCCUCUCAUUGACCCCCC SEQ ID NO: 786
- CACCCUCUCAUUGACC SEQ ID NO: 787
- CACCCUCUCAUUGACCCC SEQ ID NO: 788
- ACCCUCUCAUUGACCC SEQ ID NO: 789
- CCCUCUCAUUGACCCC SEQ ID NO: 790
- CUCAUUGACCCCCUGGCCUC SEQ ID NO: 791
- GGUCUCACCUUACCCG SEQ ID NO: 7
- GGAUAUUUUGAGUCUU SEQ ID NO: 811
- UGGUACAUCUGUGUUG SEQ ID NO: 812
- GAACUCUCCCUAACCC SEQ ID NO: 813
- CCAGCCUCUGCCCUCGG SEQ ID NO: 814
- GGUUACAAUGUCCCCGG SEQ ID NO: 815
- CCGAUCUGGAAUAGCUU SEQ ID NO: 816
- GACUCAUCUUCUGGCC SEQ ID NO: 817
- CAGUGAAUAUGCCCCG SEQ ID NO: 818
- CGACCCUAGGGAUUC SEQ ID NO: 819
- CCUACCCAUGUUCACA SEQ ID NO: 820
- AUGUAUGCCCCUUGCC SEQ ID NO: 821
- CUAGUAGUAGCUCUGC SEQ ID NO: 822).
- the second oligonucleotide is preferably cleaved by RNase H and thus preferably contains at least one ribonucleoside, more preferably at least 4 contiguous ribonucleosides, more preferably 4 to 25 contiguous ribonucleosides. More preferably it contains a nucleoside.
- the number of nucleosides in the continuous ribonucleoside is preferably 13 to 23, more preferably 15 to 21, even more preferably 16 to 20, particularly preferably 16 or 20. be. Each consecutive nucleoside may be the same or different.
- the second oligonucleotide is preferably an oligoribonucleotide, more preferably RNA.
- the nucleobase of the ribonucleoside contained in the oligoribonucleotide in the second oligonucleotide is preferably at least one selected from the group consisting of adenine, guanine, thymine, cytosine and uracil, more preferably adenine and guanine , cytosine and uracil.
- the ribonucleosides contained in the oligoribonucleotides in the second oligonucleotide are preferably linked by phosphodiester bonds.
- the second oligonucleotide preferably contains at least one deoxyribonucleoside, more preferably contains at least 4 consecutive deoxyribonucleosides, and preferably contains 4 to 25 consecutive deoxyribonucleosides. more preferred. Each consecutive nucleoside may be the same or different.
- the second oligonucleotide is preferably an oligodeoxyribonucleotide, more preferably DNA.
- the deoxyribonucleoside nucleobase contained in the oligodeoxyribonucleotide in the second oligonucleotide is preferably at least one selected from the group consisting of adenine, guanine, thymine, cytosine and uracil, more preferably adenine and guanine , thymine and cytosine.
- the deoxyribonucleosides contained in the oligodeoxyribonucleotides in the second oligonucleotide are preferably linked by phosphodiester bonds.
- the second oligonucleotide preferably contains one or more sugar-modified nucleosides on at least one of the 5′-terminal side and the 3′-terminal side of the second oligonucleotide, and the 5′-terminal side and 3′-terminal side of the second oligonucleotide. More preferably, at least one of the 'terminal side contains 1 to 7 sugar-modified nucleosides, and at least one of the 5'-terminal and 3'-terminal sides further preferably contains 2 to 5 sugar-modified nucleosides, Even more preferably, at least one of the 5'-end and 3'-end contains 2 to 3 sugar-modified nucleosides.
- the nucleoside at the 5'-terminal of the second oligonucleotide is a sugar-modified nucleoside.
- the nucleosides at the 3'-end of the second oligonucleotide are sugar-modified nucleosides.
- the second oligonucleotide When the 5' end of the second oligonucleotide is attached to the third oligonucleotide, the second oligonucleotide preferably contains one or more sugar-modified nucleosides at the 3' end of the second oligonucleotide. When the 3' end of the second oligonucleotide is attached to the third oligonucleotide, the second oligonucleotide preferably contains one or more sugar-modified nucleosides at the 5' end of the second oligonucleotide.
- the second oligonucleotide may or may not contain one or more deoxyribonucleosides or ribonucleosides or both between the plurality of sugar-modified nucleosides on at least one of the 5'-terminal side and the 3'-terminal side. may be included, but preferably not. That is, one or more nucleosides counted from the 5'-end and/or 3'-end of the second oligonucleotide are preferably sugar-modified nucleosides.
- the internucleoside linkages included in the second oligonucleotide are preferably at least one independently selected from phosphodiester linkages and modified phosphodiester linkages, more preferably independently from phosphodiester linkages and phosphorothioate linkages. At least one selected.
- the internucleoside linkage contained in the second oligonucleotide preferably contains at least one phosphodiester bond, more preferably 50% or more is a phosphodiester bond, and 75% or more is a phosphodiester bond. More preferably, 80% or more are phosphodiester bonds, even more preferably 90% or more are phosphodiester bonds, and most preferably all are phosphodiester bonds.
- the second oligonucleotide preferably contains one or more phosphorothioate bonds on at least one of the 5' end side and the 3' end side of the second oligonucleotide, and 1 to 7 phosphorothioate More preferably it contains linkages, more preferably 2-5 phosphorothioate linkages, even more preferably 2-3 phosphorothioate linkages.
- the second oligonucleotide preferably contains one or more phosphorothioate linkages at the 3' end.
- the second oligonucleotide When the 3' end of the second oligonucleotide is attached to the third oligonucleotide, the second oligonucleotide preferably contains one or more phosphorothioate linkages at the 5' end.
- the internucleoside linkage at the 5' end of the second oligonucleotide is a phosphorothioate linkage when the second oligonucleotide contains one or more phosphorothioate linkages at the 5' end of the second oligonucleotide.
- one or more internucleoside linkages counted from the 5' end of the second oligonucleotide are preferably phosphorothioate linkages.
- the internucleoside linkage at the 3' end of the second oligonucleotide is a phosphorothioate linkage when the second oligonucleotide contains one or more phosphorothioate linkages at the 3' end of the second oligonucleotide. Furthermore, one or more internucleoside linkages counted from the 3' end of the second oligonucleotide are preferably phosphorothioate linkages.
- the first and second oligonucleotides may or may not be linked by a third oligonucleotide consisting of 1 to 20 nucleosides independently selected from deoxyribonucleosides, ribonucleosides and sugar-modified nucleosides. , preferably linked.
- the third oligonucleotide is a linker that connects the above-mentioned first and second oligonucleotides.
- the third oligonucleotide links the above-mentioned first oligonucleotide and second oligonucleotide in the order of first oligonucleotide - third oligonucleotide - second oligonucleotide.
- the third oligonucleotide and the first oligonucleotide are linked by a covalent bond, for example, the terminal nucleosides of the third oligonucleotide and the first oligonucleotide are preferably linked by a phosphodiester bond.
- the third oligonucleotide and the second oligonucleotide are linked by a covalent bond, for example, the terminal nucleosides of each of the third oligonucleotide and the second oligonucleotide are linked by a phosphodiester bond.
- the 3'-terminal nucleoside of the oligonucleotide and the 5'-terminal nucleoside of the third oligonucleotide are linked, and the 5'-terminal nucleoside of the second oligonucleotide and the 3'-terminal nucleoside of the third oligonucleotide are linked.
- the 5'-terminal nucleoside of the first oligonucleotide and the 3'-terminal nucleoside of the third oligonucleotide are linked, and the 3'-terminal nucleoside of the second oligonucleotide and the 5'-terminal nucleoside of the third oligonucleotide are linked.
- the third oligonucleotide consists of 1-20 nucleosides independently selected from deoxyribonucleosides, ribonucleosides and sugar-modified nucleosides.
- the nucleosides comprised in the third oligonucleotide are preferably independently selected from deoxyribonucleosides and ribonucleosides, more preferably independently selected from ribonucleosides.
- the number of nucleosides contained in the third oligonucleotide is 1 to 20, preferably 2 to 15, more preferably 3 to 10, still more preferably 3 to 7, and further The number is more preferably 4 or 5, and particularly preferably 4.
- the third oligonucleotide is preferably an oligonucleotide linked by phosphodiester bonds.
- the third oligonucleotide is, for example, an oligodeoxyribonucleotide or oligoribonucleotide, more preferably DNA or RNA, even more preferably RNA.
- the deoxyribonucleoside nucleobase contained in the oligodeoxyribonucleotide in the third oligonucleotide is preferably at least one selected from the group consisting of adenine, guanine, thymine, cytosine and uracil, more preferably adenine, At least one selected from the group consisting of guanine, thymine and cytosine.
- the deoxyribonucleosides contained in the oligodeoxyribonucleotides in the third oligonucleotide are preferably linked by phosphodiester bonds.
- the nucleobase of the ribonucleoside contained in the oligoribonucleotide in the third oligonucleotide is preferably at least one selected from the group consisting of adenine, guanine, thymine, cytosine and uracil, more preferably adenine, At least one selected from the group consisting of guanine, cytosine and uracil.
- the ribonucleosides contained in the oligodeoxyribonucleotides in the third oligonucleotide are preferably linked by phosphodiester bonds.
- the third oligonucleotide may or may not contain a partially self-complementary sequence within the third oligonucleotide, but the third oligonucleotide contains It preferably does not contain partially self-complementary sequences.
- examples of such oligonucleotides include (N)n (where N is independently adenosine, uridine, cytidine, guanosine, 2'-deoxyadenosine, thymidine, 2'-deoxycytidine, or 2′-deoxyguanosine, and n is an integer (repeating number) of 1 to 20.).
- n is preferably 2 to 15, more preferably 3 to 10, still more preferably 3 to 7, still more preferably 4 or 5, particularly preferably 4 is.
- N is more preferably each independently adenosine, uridine, cytidine or guanosine, particularly preferably adenosine.
- the single-stranded oligonucleotides of the invention wherein the first and second oligonucleotides are linked by a third oligonucleotide, are preferably , 779, 780, 781.
- Single-stranded oligonucleotides of the invention more preferably comprise at least 30 contiguous nucleobases of any one nucleobase sequence selected from the group consisting of SEQ ID NOs: 772, 773, 774, 775, 776. has an array.
- the single-stranded oligonucleotide of the present invention more preferably has a nucleobase sequence containing any one nucleobase sequence selected from the group consisting of 772, 773, 774, 775, and 776, and even more preferably , 772, 773, 774, 775, and 776.
- Single-stranded oligonucleotides of the present invention particularly preferably have any one nucleobase sequence selected from the group consisting of SEQ ID NOs:772, 773, 774, 775, and 776.
- nucleobase sequence represented by any of SEQ ID NOs: 771 to 775 the 1st to 16th nucleobases counted from the 5′ end side correspond to the nucleobases of the second oligonucleotide, and the 17th to 20th nucleobases
- the nucleobases correspond to the nucleobases of the third oligonucleotide, of which nucleobases 21-36 correspond to the nucleobases of the first oligonucleotide.
- nucleobase sequence represented by SEQ ID NO: 776 or 777 the 1st to 18th nucleobases counted from the 5' end side correspond to the nucleobases of the second oligonucleotide, and the 19th to 22nd nucleobases are , correspond to the nucleobases of the third oligonucleotide, and nucleobases 23-40 thereof correspond to the nucleobases of the first oligonucleotide.
- nucleobase sequences represented by SEQ ID NOS: 778-781 the 1st to 20th nucleobases counted from the 5' end side correspond to the nucleobases of the second oligonucleotide, and the 21st to 24th nucleobases are , correspond to the nucleobases of the third oligonucleotide, and nucleobases 25-44 thereof correspond to the nucleobases of the first oligonucleotide.
- a functional molecule may be bound directly or indirectly to the first oligonucleotide or second oligonucleotide that constitutes the ASO derivative of the present invention.
- the binding between the functional molecule and the first oligonucleotide or the second oligonucleotide may be direct or indirect via another substance. is preferably bound. From the viewpoint of high stability of the bond, it is more preferable to bond directly by covalent bond or to bond by covalent bond via a linker (linking group).
- the functional molecule When the functional molecule is covalently bound to the first oligonucleotide or the second oligonucleotide, the functional molecule is attached directly to the 3′ end or 5′ end of the first oligonucleotide or the second oligonucleotide. or indirectly, more preferably directly or indirectly to the 3' or 5' end of the second oligonucleotide.
- the binding between the linker or functional molecule and the terminal nucleoside of the first oligonucleotide or the second oligonucleotide is selected according to the functional molecule.
- the linker or functional molecule and the terminal nucleoside of the first oligonucleotide or the second oligonucleotide are preferably linked by a phosphodiester bond or a modified phosphodiester bond, and are linked by a phosphodiester bond. is more preferable.
- the linker or functional molecule is directly linked to the 3′-position oxygen atom of the 3′-terminal nucleoside of the first oligonucleotide or the second oligonucleotide or the 5′-position oxygen atom of the 5′-terminal nucleoside.
- the structure of the "functional molecule” is not particularly limited, and by binding it to the oligonucleotide, the ASO derivative can have the desired function. Desired functions include labeling functions, purification functions and delivery functions to target sites. Examples of molecules that impart a labeling function include compounds such as fluorescent proteins and luciferase. Examples of molecules that confer a purification function include compounds such as biotin, avidin, His-tag peptides, GST-tag peptides, FLAG-tag peptides.
- functional molecules include: It is preferred that a molecule having the function of delivering the ASO derivative to the target site is bound. Molecules having the delivery function are described, for example, in European Journal of Pharmaceutics and Biopharmaceutics, 2016, 107, pp 321-340, Advanced Drug Delivery Reviews, 2016, 104, pp 78-92, Expert Opinion on Drug Delivery, 2014, 11, See pp 791-822, etc. For example, functional molecules that can efficiently deliver the ASO derivative of the present invention to the brain, spinal cord, etc.
- Lipids include cholesterol; fat-soluble vitamins such as vitamin E (tocopherols and tocotrienols), vitamin A, vitamin D, and vitamin K; fatty acids; intermediate metabolites such as acylcarnitine and acyl CoA; derivatives and the like.
- a sugar derivative that interacts with an asialoglycoprotein receptor may be used as a functional molecule capable of delivering an ASO derivative to the liver with high specificity.
- the "asialoglycoprotein receptor” exists on the surface of liver cells, and has the action of recognizing the galactose residue of asialoglycoprotein and taking that molecule into the cell and degrading it.
- the "sugar derivative that interacts with the asialoglycoprotein receptor” is preferably a compound that has a structure similar to that of a galactose residue and is taken up into cells by interacting with the asialoglycoprotein receptor. acetylgalactosamine) derivatives, galactose derivatives and lactose derivatives.
- Functional molecules capable of highly specific and efficient delivery of ASO derivatives to the organ by interacting with various proteins on the cell surface of each organ include receptor ligands, antibodies, and peptides or proteins of fragments thereof. is mentioned. Even if the ASO derivative is partially degraded before the functional molecule-bound ASO derivative is delivered to an organ such as the liver or to the target site, the oligonucleotide or oligonucleotide complex containing the first oligonucleotide is It is sufficient if the expression of the ATN1 gene can be effectively controlled by delivering it to an organ such as the liver or a target site.
- the linker via the bond between the functional molecule and the oligonucleotide that constitutes the ASO derivative is sufficient if the ASO and the functional molecule contained in the oligonucleotide can exhibit their respective functions. is not particularly limited as long as it is a linker that stably binds.
- the linker include a group derived from an oligonucleotide having 1 to 20 nucleosides, a group derived from a polypeptide having 1 to 20 amino acids, a C 1-20 alkylene group, a C 2-20 alkenylene group, and the like. mentioned.
- the group derived from an oligonucleotide having 1 to 20 nucleosides is a hydrogen atom from the 3' end and 5' end of an oligonucleotide having 1 to 20 nucleosides (a nucleoside when the number of nucleosides is 1), It is a divalent group from which a hydroxy group or the like has been removed.
- groups derived from oligonucleotides having 1 to 20 nucleosides see, for example, International Publication No. 2017/053995.
- International Publication No. 2017/053995 describes, for example, a 3-base linker with a TCA motif, a 1-5 base linker without a TCA motif, and the like.
- the group derived from a polypeptide having 1 to 20 amino acids is selected from polypeptides having 1 to 20 amino acids (amino acids when the number of amino acids is 1), hydroxy, hydrogen atoms, amino, etc. 2 It is a divalent group with one group removed.
- the ASO derivatives of the invention may have a prodrug moiety.
- a prodrug is a derivative of a pharmaceutical compound having groups that are chemically or metabolically degradable, and which, upon solvolysis or in vivo degradation under physiological conditions, render the pharmacologically active pharmaceutical compound is a compound that induces Methods for selecting and manufacturing suitable prodrug derivatives are described, for example, in Design of Prodrugs (Elsevier, Amsterdam, 1985).
- a prodrug moiety such as an acyloxy derivative prepared by reacting the hydroxy group of ASO (or a compound containing ASO) with a suitable acyl halide, a suitable acid anhydride or a suitable halogenated alkyloxycarbonyl compound.
- the ASO derivatives of the present invention in addition to existing via their tautomerism and geometric isomerism, also include those existing as mixtures thereof or mixtures of their respective isomers.
- an asymmetric center exists, or when an asymmetric center is generated as a result of isomerization, it also includes those existing as respective optical isomers and mixtures of arbitrary ratios.
- diastereomers due to each optical isomerism also exist.
- the present invention also includes all these types in any proportion. Optically active forms can also be obtained by well-known methods for this purpose.
- the ASO derivative of the present invention contains a modified phosphodiester bond (e.g., a phosphorothioate bond) and the phosphorus atom becomes an asymmetric atom, then the stereochemistry of the oligonucleotide and the stereochemistry of the phosphorus atom can be controlled. Any form of oligonucleotide in which the is not controlled is included within the scope of the invention.
- the ASO derivative of the present invention or a medically acceptable salt thereof can exist as any crystal form depending on the production conditions, and can exist as any hydrate. and mixtures thereof are also included within the scope of the present invention. It may also exist as solvates with organic solvents such as acetone, ethanol, 1-propanol, 2-propanol, etc., and all of these forms are included within the scope of the present invention.
- the ASO derivatives of the present invention can be converted into pharmaceutically acceptable salts or liberated from salts formed, if desired.
- pharmacologically acceptable salts of compounds containing the ASO derivative of the present invention include alkali metals (lithium, sodium, potassium, etc.), alkaline earth metals (calcium, etc.), magnesium, ammonium, organic bases (triethylamine, trimethylamine, etc.), amino acids (glycine, lysine, glutamic acid, etc.), inorganic acids (hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, etc.), or organic acids (acetic acid, citric acid, maleic acid, fumaric acid, tartaric acid, benzenesulfonic acid , methanesulfonic acid, p-toluenesulfonic acid, etc.).
- a particularly preferred pharmaceutically acceptable salt is the sodium salt.
- the ASO derivative of the present invention can be prepared by a person skilled in the art by appropriately selecting a known method.
- a person skilled in the art can design the nucleoside sequence of ASO based on the nucleoside sequence information of the target RNA, and use a commercially available automatic nucleic acid synthesizer (manufactured by Applied Biosystems, Beckman, Genedesign, etc.). can be synthesized by Alternatively, it can be synthesized by a reaction using an enzyme.
- the enzymes include, but are not limited to, polymerases, ligases, restriction enzymes, and the like.
- the method for producing a single-stranded oligonucleotide or a double-stranded oligonucleotide complex can include a step of extending the nucleoside chain at the 3' end or the 5' end.
- the ASO derivative of the present invention can be prepared by purifying the obtained oligonucleotide by reversed-phase column chromatography or the like.
- the double-stranded oligonucleotide complex of the present invention can be prepared by synthesizing the first oligonucleotide and the second oligonucleotide separately according to the above, mixing equal amounts, and intermolecularly hybridizing. Intermolecular hybridization of the double-stranded oligonucleotide complex can be performed by adjusting the concentration, heating and/or cooling, and/or adding salt, as necessary.
- the single-stranded oligonucleotide of the present invention can be prepared by spontaneous intramolecular hybridization when synthesized according to the above.
- Single-stranded oligonucleotides of the present invention can hybridize intramolecularly or intermolecularly by adjusting the concentration, heating and/or cooling, and/or adding salt as necessary.
- the ASO derivatives (single-stranded oligonucleotides and double-stranded oligonucleotide complexes) of the present invention or medically acceptable salts thereof can effectively inhibit the expression of the ATN1 gene.
- Diseases that can be treated, prevented, or ameliorated by nucleic acid pharmaceuticals using the ASO derivative of the present invention or a medically acceptable salt thereof are not particularly limited as long as the ATN1 gene expression inhibitory action is effective. dentate nucleus pallidus louis body atrophy.
- the present invention can provide a composition containing the ASO derivative as an active ingredient, for example, for inhibiting ATN1 gene expression by antisense effect.
- the ASO derivative (single-stranded oligonucleotide and double-stranded oligonucleotide complex) of the present invention is effective for inhibiting ATN1 gene expression in dentate nucleus pallidus Louis body atrophy, which contains the ASO derivative (single-stranded oligonucleotide and double-stranded oligonucleotide complex) as an active ingredient.
- Pharmaceutical compositions for treating, preventing, and/or ameliorating disease can also be provided.
- a pharmaceutical composition containing the ASO derivative of the present invention or a medically acceptable salt thereof can be formulated by a known pharmaceutical method.
- Turbidities, elixirs, emulsions, liniments, ointments, plasters, poultices, transdermal preparations, lotions, inhalants, aerosols, suppositories, etc. can be administered enterally (orally, etc.) or non- It can be used enterally.
- pharmacologically acceptable carriers specifically sterile water, physiological saline, vegetable oils, solvents, bases, emulsifiers, suspending agents, surfactants, pH adjusters , stabilizers, flavoring agents, fragrances, excipients, vehicles, preservatives, binders, diluents, tonicity agents, soothing agents, bulking agents, disintegrants, buffers, coating agents, lubricants, Coloring agents, sweetening agents, thickening agents, flavoring agents, solubilizing agents, other additives, and the like can be appropriately combined.
- the dosage form of the composition containing the ASO derivative of the present invention or a medically acceptable salt thereof is not particularly limited, and includes enteral (oral, etc.) or parenteral administration. More preferably, intravenous administration, intraarterial administration, intraperitoneal administration, subcutaneous administration, intradermal administration, intratracheal administration, rectal administration, intramuscular administration, intrathecal administration, intracerebroventricular administration, intranasal administration and intravitreal administration. Intrathecal administration, intracerebroventricular administration, and intranasal administration are more preferred, and intrathecal administration is particularly preferred.
- a formulation that contains the ASO derivative of the present invention or a medically acceptable salt thereof and enables intrathecal administration can be produced by a known conventional method.
- the ASO derivative of the present invention or a pharmacologically acceptable salt thereof and additives such as a buffer and a tonicity agent are completely dissolved in water for injection, and then filtered and sterilized.
- a pre-filled syringe formulation is obtained by filling a sterilized syringe with the preparation solution, a preparation for injection is obtained by filling a sterilized vial, and a ready-to-use preparation is obtained by filling a sterilized vial and freeze-drying it. can be manufactured.
- Final sterilization such as autoclaving or gamma irradiation may be performed instead of filtration sterilization.
- compositions containing the ASO derivatives of the present invention or pharmaceutically acceptable salts thereof can be treated, prevented and/or ameliorated by compositions containing the ASO derivatives of the present invention or pharmaceutically acceptable salts thereof.
- ASO derivatives of the present invention or pharmaceutically acceptable salts thereof.
- mammals for example, but not limited to, humans, cows, sheep, goats, horses, dogs, cats, guinea pigs, rats, rabbits, chimpanzees or other bovines.
- ovine, equine, canine, feline, mouse and other rodent species is particularly preferably human.
- the dosage or ingestion is preferably an effective amount.
- Effective amount means an amount of a compound sufficient to produce the desired pharmacological effect in an individual in need of the drug, and to treat, prevent and/or ameliorate the disease, age, weight, symptoms, health status of the individual. , varies depending on the formulation of the composition, etc., and is selected as appropriate.
- the dosage or intake is preferably 0.0001 mg/kg/day to 100 mg/kg/day in terms of ASO.
- a method for regulating ATN1 gene expression comprising the step of contacting a cell with the ASO derivative of the present invention or a pharmaceutically acceptable salt thereof.
- a method for regulating ATN1 gene expression in a mammal comprising the step of administering to said mammal a pharmaceutical composition comprising the ASO derivative of the present invention or a pharmaceutically acceptable salt thereof.
- Antisense oligonucleotides (compounds represented by chemical structures corresponding to compound numbers) listed in Tables 1 to 19 were synthesized using an automatic nucleic acid synthesizer nS-8II (manufactured by Genedesign) or 3900 DNA Synthesizer (manufactured by Applied Biosystems). ) was prepared using Note that the title lines of Tables 2 to 19 are the same as those of Table 1, so they may be omitted.
- SEQ1 START means "SEQ ID NO: 1 start site"
- SEQ ID NO: 1 start site the most 5' site targeted by an antisense oligonucleotide in the human ATN1 mRNA sequence (SEQ ID NO: 1).
- the position numbers of the side nucleosides are indicated.
- SEQ1 END means "SEQ ID NO: 1 end site” and indicates the position number of the 3'-most nucleoside targeted by the antisense oligonucleotide in the human ATN1 mRNA sequence (SEQ ID NO: 1).
- SEQ2 START means "SEQ ID NO: 2 start site", the position number of the 5'-most nucleoside targeted by the antisense oligonucleotide in the sequence of human ATN1 pre-mRNA (SEQ ID NO: 2) indicates "SEQ2 END” means "SEQ ID NO: 2 termination site” and indicates the position number of the 3'-most nucleoside targeted by the antisense oligonucleotide in the human ATN1 pre-mRNA sequence (SEQ ID NO: 2). show.
- Each antisense oligonucleotide targets either the human ATN1 mRNA, designated herein as SEQ ID NO:1, and/or the human ATN1 pre-mRNA, designated herein as SEQ ID NO:2 or SEQ ID NO:717.
- a "-" indicates that the antisense oligonucleotide does not target that mRNA or pre-mRNA sequence with 100% complementarity.
- SEQ No indicates the sequence number
- BASE SEQUENCE indicates the nucleic acid base sequence of the antisense oligonucleotide. Note that the title lines of Tables 21 to 38 are the same as those of Table 20, so they may be omitted.
- SEQ717 START means “SEQ ID NO: 717 start site”
- SEQ ID NO: 717 indicates
- SEQ717 END means "SEQ ID NO: 717 end site” and refers to the position number of the 3'-most nucleoside targeted by the antisense oligonucleotide in the human ATN1 pre-mRNA sequence (SEQ ID NO: 717).
- SEQ ID NO:2 corresponds to position numbers 4451 to 18401 of the nucleobase of SEQ ID NO:717.
- Antisense Suppression of Human ATN1 in GM13716 Cells [DRPLA Patient-Derived Cells] The effect of antisense oligonucleotides targeting the ATN1 nucleic acid, which is the causative gene of DRPLA, on ATN1 RNA transcripts was tested in vitro. .
- Antisense oligonucleotides (ASO Production Example 1) were added to GM13716 cells cultured at a density of 7,500 cells/well using Lipofectamin (registered trademark) RNAiMAX Transfection Reagent (Thermo Fisher Scientific) to a final concentration of 100 nM. ) was added.
- ASO derivative production example 1 Single-stranded oligonucleotides (compounds represented by chemical structures corresponding to compound numbers) listed in Table 50 were prepared using an automatic nucleic acid synthesizer nS-8II (manufactured by Genedesign). Intramolecular hybridization of each single-stranded oligonucleotide was also confirmed by non-denaturing polyacridamide gel electrophoresis.
- a single-stranded DNA size marker (manufactured by Gene Design) containing single-stranded DNA having 15, 20, 30, 40, 50, 60 and 80 nucleotides as a marker , 17, 21, 25 and 29 base pairs of double-stranded RNA size markers (Genedesign) were used to confirm a single band for each single-stranded oligonucleotide.
- each single-stranded oligonucleotide shown in Table 50 the compound number of the antisense oligonucleotide contained in the first oligonucleotide, and the first oligonucleotide, the second oligonucleotide and the third that constitute the single-stranded oligonucleotide
- the nucleoside positions of the oligonucleotides are shown in Table 51.
- Table 52 shows the sequence number and nucleic acid base sequence corresponding to each single-stranded oligonucleotide shown in Table 50.
- DRPLA model (Q129 transgenic) mouse (4 weeks old, Sato T, et al. Human Molecular Genetics, 2009, 18, 723-736, Niigata University Brain Research Institute, Department of Molecular Neurological Disease Resource Analysis Taisuke Kato The fertilized eggs were obtained from Associate Professor Nim).
- the Q129 transgenic mouse has integrated the human ATN1 gene, which carries 129 CAG repeats.
- Results are presented in Table 53 as percent expression of human ATN1 relative to saline (vehicle)-treated animals.
- dose indicates dosage
- Cerebrum indicates dosage
- Cerebellum indicates dosage
- Pons indicates Medulla
- Spinal cord indicates cerebrum, cerebellum, pons, medulla oblongata and spinal cord, respectively.
- administration tests of L-0561 in Table 53 8-week-old Q129 transgenic mice were used.
- ASO derivative production example 2 Single-stranded oligonucleotides (compounds represented by chemical structures corresponding to compound numbers) listed in Table 54 were prepared using an automatic nucleic acid synthesizer nS-8II (manufactured by Genedesign). Intramolecular hybridization of each single-stranded oligonucleotide was also confirmed by non-denaturing polyacridamide gel electrophoresis.
- a single-stranded DNA size marker (manufactured by Gene Design) containing single-stranded DNA having 15, 20, 30, 40, 50, 60 and 80 nucleotides as a marker , 17, 21, 25 and 29 base pairs of double-stranded RNA size markers (Genedesign) were used to confirm a single band for each single-stranded oligonucleotide.
- each single-stranded oligonucleotide shown in Table 54 the compound number of the antisense oligonucleotide contained in the first oligonucleotide, and the first oligonucleotide, the second oligonucleotide and the third that constitute the single-stranded oligonucleotide
- the nucleoside positions of the oligonucleotides are shown in Table 55.
- Table 56 shows the sequence number and nucleic acid base sequence corresponding to each single-stranded oligonucleotide shown in Table 54.
- Antisense oligonucleotides (compounds represented by chemical structures corresponding to compound numbers) listed in Table 57 were prepared using an automatic nucleic acid synthesizer nS-8II (manufactured by Genedesign) or 3900 DNA Synthesizer (manufactured by Applied Biosystems). prepared using
- Table 58 shows the position targeted by each antisense oligonucleotide shown in Table 57 in the sequence of human ATN1 mRNA or pre-mRNA, and the SEQ ID NO and nucleobase sequence corresponding to each antisense oligonucleotide.
- the meaning of each column in the sequence notation of Table 58 is the same as in Tables 20-38.
- a single-stranded DNA size marker (manufactured by Gene Design) containing single-stranded DNA having 15, 20, 30, 40, 50, 60 and 80 nucleotides as a marker , 17, 21, 25 and 29 base pairs of double-stranded RNA size markers (Genedesign) were used to confirm a single band for each single-stranded oligonucleotide.
- each single-stranded oligonucleotide shown in Table 60 the compound number of the antisense oligonucleotide contained in the first oligonucleotide, and the first oligonucleotide, the second oligonucleotide and the third that constitute the single-stranded oligonucleotide
- the nucleoside positions of the oligonucleotides are shown in Table 61.
- Table 62 shows the sequence number and nucleic acid base sequence corresponding to each single-stranded oligonucleotide shown in Table 60.
- ASO derivative production example 4 The single-stranded oligonucleotides (compounds represented by the chemical structures corresponding to the compound numbers) listed in Table 64 were prepared using an automatic nucleic acid synthesizer nS-8II (Gene Design Inc.) in the same manner as in ASO Derivative Production Examples 1-3. can be prepared using Moreover, intramolecular hybridization of each single-stranded oligonucleotide can be confirmed by non-denaturing polyacridamide gel electrophoresis.
- a single-stranded DNA size marker (manufactured by Gene Design) containing single-stranded DNA having 15, 20, 30, 40, 50, 60 and 80 nucleotides as a marker
- double-stranded RNA size markers with 17, 21, 25 and 29 base pairs (manufactured by Genedesign)
- each single-stranded oligonucleotide shown in Table 64 the compound number of the antisense oligonucleotide contained in the first oligonucleotide, and the first oligonucleotide, the second oligonucleotide and the third that constitute the single-stranded oligonucleotide
- the nucleoside positions of the oligonucleotides are shown in Table 65.
- Table 66 shows the sequence number and nucleic acid base sequence corresponding to each single-stranded oligonucleotide shown in Table 64.
- ASO derivatives of the present invention are preferred.
- the ASO derivative of the present invention was intracerebroventricularly administered once at a dose of 10 to 63 ⁇ g/body to 2-day-old male DRPLA model (Q129 transgenic) mice.
- the mice were trained from the day before the measurement start date (3 weeks old) in order to acclimatize the mice to the test.
- the rotation speed of Rota-Rod is accelerated from 3.5 rpm to 35 rpm over 300 seconds, and the time (seconds) until the mouse falls off the Rota-Rod or hangs on the Rota-Rod and completely rotates is measured. did.
- a cutoff of 600 seconds was used, and the longest walking time among the three times was evaluated. The walking stick recorded the time required to reach the goal.
- the cut-off time was set to 90 seconds, and the fastest time to reach the goal among the three times was evaluated.
- the results are presented in Figures 1-5.
- “Latency to fall” means the time measured using the Rota-Rod
- “Time to traverse” is the earliest time to reach the goal evaluated using a walking stick.
- the safety of the ASO derivative of the present invention can be evaluated by the methods of Evaluation Examples 10 and 11. ASO derivatives with high safety are preferred.
- a microarray was performed at this concentration, and genes whose expression was suppressed by a factor of two or more in the ASO derivative of the present invention were extracted. From the obtained in silico analysis results and comprehensive gene expression analysis results, off-target genes were extracted and risk assessment was performed. ASO derivatives with a small number of off-target genes extracted in this test and which did not alter toxicity-related genes can be evaluated as highly safe.
- the ASO derivative of the present invention inhibits the expression of the ATN1 gene, it is useful for the treatment, prevention, and/or amelioration of diseases for which inhibition of the ATN1 gene expression is effective, particularly dentate nucleus pallidus louis body atrophy. is.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Biochemistry (AREA)
- Epidemiology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- General Chemical & Material Sciences (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Hospice & Palliative Care (AREA)
- Psychiatry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2023511763A JPWO2022211129A1 (https=) | 2021-04-01 | 2022-04-01 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2021-063170 | 2021-04-01 | ||
| JP2021063170 | 2021-04-01 | ||
| JP2021125763 | 2021-07-30 | ||
| JP2021-125763 | 2021-07-30 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2022211129A1 true WO2022211129A1 (ja) | 2022-10-06 |
Family
ID=83459141
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/JP2022/017009 Ceased WO2022211129A1 (ja) | 2021-04-01 | 2022-04-01 | Atn1のアンチセンスオリゴヌクレオチド誘導体 |
Country Status (2)
| Country | Link |
|---|---|
| JP (1) | JPWO2022211129A1 (https=) |
| WO (1) | WO2022211129A1 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12291710B2 (en) | 2021-12-13 | 2025-05-06 | Nippon Shinyaku Co., Ltd. | Antisense oligonucleotide targeting ATN1 mRNA or pre-mRNA |
| WO2025143262A1 (ja) * | 2023-12-28 | 2025-07-03 | 日産化学株式会社 | カルバモイルエチル修飾を含有する二本鎖rna |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130198877A1 (en) * | 2010-08-05 | 2013-08-01 | Academisch Ziekenhuis Leiden H.O.D.N. Lumc | Antisense oligonucleotide directed removal of proteolytic cleavage sites from proteins |
| WO2017131124A1 (ja) * | 2016-01-26 | 2017-08-03 | 日産化学工業株式会社 | 一本鎖オリゴヌクレオチド |
-
2022
- 2022-04-01 JP JP2023511763A patent/JPWO2022211129A1/ja active Pending
- 2022-04-01 WO PCT/JP2022/017009 patent/WO2022211129A1/ja not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130198877A1 (en) * | 2010-08-05 | 2013-08-01 | Academisch Ziekenhuis Leiden H.O.D.N. Lumc | Antisense oligonucleotide directed removal of proteolytic cleavage sites from proteins |
| WO2017131124A1 (ja) * | 2016-01-26 | 2017-08-03 | 日産化学工業株式会社 | 一本鎖オリゴヌクレオチド |
Non-Patent Citations (2)
| Title |
|---|
| JIAXIN HU, JING LIU, K JAYAPRAKASH NARAYANANNAIR, JEREMY G LACKEY, SATYA KUCHIMANCHI, KALLANTHOTTATHIL G RAJEEV, MUTHIAH MANOHARAN: "Allele-Selective Inhibition of Mutant Atrophin-1 Expression by Duplex and Single-Stranded RNAs", BIOCHEMISTRY, AMERICAN CHEMICAL SOCIETY, vol. 53, no. 28, 22 July 2014 (2014-07-22), pages 4510 - 4518, XP055166764, ISSN: 00062960, DOI: 10.1021/bi500610r * |
| MELVIN M. EVERS, PEPERS BARRY A., VAN DEUTEKOM JUDITH C. T., MULDERS SUSAN A. M., DEN DUNNEN JOHAN T., AARTSMA-RUS ANNEMIEKE, VAN : "Targeting Several CAG Expansion Diseases by a Single Antisense Oligonucleotide", PLOS ONE, PUBLIC LIBRARY OF SCIENCE, vol. 6, no. 9, 1 January 2011 (2011-01-01), pages e24308 - e24308, XP055007055, ISSN: 19326203, DOI: 10.1371/journal.pone.0024308 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12291710B2 (en) | 2021-12-13 | 2025-05-06 | Nippon Shinyaku Co., Ltd. | Antisense oligonucleotide targeting ATN1 mRNA or pre-mRNA |
| WO2025143262A1 (ja) * | 2023-12-28 | 2025-07-03 | 日産化学株式会社 | カルバモイルエチル修飾を含有する二本鎖rna |
Also Published As
| Publication number | Publication date |
|---|---|
| JPWO2022211129A1 (https=) | 2022-10-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7554488B2 (ja) | 血液脳関門通過型ヘテロ2本鎖核酸 | |
| JP7753106B2 (ja) | Atn1のアンチセンスオリゴヌクレオチド | |
| JP7690979B2 (ja) | 一本鎖オリゴヌクレオチド | |
| JP2024543214A (ja) | Unc13a遺伝子転写物のモジュレーターを使用する神経疾患の処置 | |
| JP2024545052A (ja) | 修飾骨格化学を有するスプライススイッチャーアンチセンスオリゴヌクレオチド | |
| JP2026052054A (ja) | Calm2のアンチセンスオリゴヌクレオチド | |
| KR20240049349A (ko) | Scn1a 발현을 조절하기 위한 화합물 및 방법 | |
| WO2022211129A1 (ja) | Atn1のアンチセンスオリゴヌクレオチド誘導体 | |
| JP7737667B2 (ja) | 核酸複合体 | |
| WO2022211095A1 (ja) | Fgfr3のアンチセンスオリゴヌクレオチド | |
| WO2021157730A1 (ja) | 核酸医薬とその使用 | |
| US20240336920A1 (en) | Threose nucleic acid antisense oligonucleotides and methods thereof | |
| JP6934695B2 (ja) | 核酸医薬とその使用 | |
| HK40074825A (en) | Antisense oligonucleotide of atn1 | |
| WO2025047953A1 (ja) | RasGRP4のアンチセンスオリゴヌクレオチド | |
| JP7776420B2 (ja) | Ataxin 3発現を調節するための化合物、方法及び医薬組成物 | |
| WO2026018824A1 (ja) | 核酸医薬とその使用 | |
| HK40121031A (zh) | 具有经修饰的主链化学的剪接转换器反义寡核苷酸 | |
| WO2024257848A1 (ja) | 遅発性中枢毒性が低減されているアンチセンスオリゴヌクレオチドの設計方法、及びその製造方法 | |
| WO2026009916A1 (ja) | 2本鎖オリゴヌクレオチド | |
| HK40097883A (zh) | 使用基因转录物调控剂治疗神经学疾病 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22781336 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2023511763 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 22781336 Country of ref document: EP Kind code of ref document: A1 |