WO2022204543A1 - Procédés et matériaux pour le traitement de la maladie de huntington - Google Patents

Procédés et matériaux pour le traitement de la maladie de huntington Download PDF

Info

Publication number
WO2022204543A1
WO2022204543A1 PCT/US2022/021998 US2022021998W WO2022204543A1 WO 2022204543 A1 WO2022204543 A1 WO 2022204543A1 US 2022021998 W US2022021998 W US 2022021998W WO 2022204543 A1 WO2022204543 A1 WO 2022204543A1
Authority
WO
WIPO (PCT)
Prior art keywords
endonuclease
nucleic acid
mhtt
acid sequence
gene
Prior art date
Application number
PCT/US2022/021998
Other languages
English (en)
Inventor
Jennifer DOUDNA
Jennifer SABO
Brett STAAHL
Madhu BENEKEREDDY
Original Assignee
The Regents Of The University Of California
F. Hoffmann-La Roche Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Regents Of The University Of California, F. Hoffmann-La Roche Ltd. filed Critical The Regents Of The University Of California
Publication of WO2022204543A1 publication Critical patent/WO2022204543A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification

Definitions

  • Uris document includes a Sequence Listing that has been submitted dectronically as an ASCII text file named 51229-0003W01_SL.txt
  • the ASCII text file, created on March 24, 2022, is 93,172 bytes in size.
  • the material in die ASCII text file is hereby incorporated by reference in its entirety.
  • This document relates to methods and materials for treating a mammal having Huntington's disease.
  • this document provides methods and materials for inactivating a mutant Huntingtin (mHTT) gene within a mammal.
  • ribonucleoprotein (RNP) complexes including an endonudease (e.g., a CRISPR associated proton 9 (Cas9) polypeptide) inducting one or more nudear localization sequences (NLSs) and a ribonuddc add (RNA) molecule (e.g., a guide RNA(gRNA) such as a single-guide RNA (sgRNA)) inducting a nuddc add sequence that is complementary to a target sequence within a mHTT gene and a nudeic add sequence that can bind the endonuclease can be administered to a mammal having Huntington's disease to inactivate the mHTT gene within die mammal.
  • endonudease e.g
  • Huntington’s disease is a progressive neurodegenerativ ⁇ e disease caused by a mutation (Ae., an expansion of a CAGtrinudeotide repeat) in the Huntingtin (HT7) gene such that the mHTT gene encodes a mHTT polypeptide having an extended N-terminal polyglutamine tract
  • a wildtype HTT gene typically has appraximatdy 10 to 35 CAG repeats present
  • die mHTT gene can include firm 36 to 120 CAG repeats (SEQ ID NO: 307). Individuals with 36 to 39 repeats may or may not develop the disease, while those with greater than 40 repeats almost, ahvays develop the disorder.
  • Huntington Huntington’s chorea
  • cognitive decline a progressive decline
  • mood changes a progressive decline
  • ultimately death occurring 15-20 years after symptom onset
  • the disease progression of Huntington’s disease is believed to be linked to both dominant negative gain-of-function of mHTT protein as well as loss-of-function of wild type HTT in vesicle trafficking and synaptic transmission (Zuccato etaL, Physiol Rev. 90:905-981 (2010)).
  • one or more RNP complexes including (a) an endonuclease (e.g, a Cas9 polypeptide) including one or more NLSs, and (b) a RNA molecule (e.g, a gRNA such as a sgRNA) includinag nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease can be used to inactivate one or more mHTT genes within a mammal (e.g., to inactivate one or more mHTT genes within neurons in a mammal’s brain).
  • an endonuclease e.g, a Cas9 polypeptide
  • a RNA molecule e.g, a gRNA such as a sgRNA
  • a nucleic acid sequence that can bind the endonuclease can be used to inactivate one or more mHTT genes within
  • a cell-penetrating Cas9 RNP e.g.a, Cas9 RNP including one or more NLSs
  • a mHTT gene in cells e.g., resulting ina reduced or eliminated level of expression of mHTT polypeptides
  • a single dose of Cas9 RNP can inactivate one or more mHTT genes in neurons in the striatum and motor cortex and can reduce mHTT polypeptide aggregates, a clinical manifestation of Huntington’s disease, in the genome-edited medium spiny neurons.
  • Having the ability to inactivate one or more mHTT genes within a mammal (e.g., within neurons in a mammal’s brain) using the methods and materials described herein can allow clinicians to slow; delay, or reverse Huntington’s disease progression.
  • the in vivo inactivation of a mHTT gene within a mammal can rescue motor function deficits and/or reduce levels of mHTT polypeptides (e.g, reduce mHTT polypeptide aggregates) in Huntington’s disease patients.
  • the ability to inactivate one or more mHTT genes withian mammal using the methods and materials described herein can provide an effective treatment for Huntington’s disease.
  • the methods and materials described herein can prevent or delay the onset of one or more symptoms (e.g motor function deficits) of Huntington’s disease.
  • the methods and materials described herein can reduce or eliminate one or more symptoms (e.g. motor function deficits) of Huntington’s disease.
  • the methods and materials described herein can permanent inactivate one or more mHTT genes within a mammal such that a single treatment can be effective to treat Huntington’s disease.
  • RNP complexes comprising: (a) an endonuclease comprising: 1) from 1 NLS to 7 NLSs fused to the N-terminus of said endonuclease and/or 2) from 1 NLS to 7 NLSs fused to the C -terminus of said endonuclease; and (b) a RNA molecule comprising (i) a nucleic acid sequence that is complementary to a target sequence withina mHTT gene, and (ii) a nucleic acid sequence that can bind said endonuclease.
  • the endonuclease can bea Cas polypeptide.
  • the Cas polypeptide can be a Cas9 polypeptide, a Cas 12a polypeptide, a Cas 13 polypeptide, or a Cas 12c polypeptide.
  • the endonuclease can include from 1 NLS to 7 NLSs fused to the N-terminus of the endonuclease and can include from 1 NLS to 7 NLSs fused to the C -terminus of the endonuclease.
  • the endonuclease can include 4 NLSs fused to the N-terminus of the endonuclease and can include 2 NLSs fused to the C -terminus of the endonuclease.
  • NLS can bea Simian virus 40 (SV40) NLS.
  • the endonuclease also can includedae peptide linker separating each NLS.
  • the peptide linker can include, consist of, or consist essentially of a GGS amino acid sequence.
  • the nucleic acid sequence that is complementary to the target sequence within the mHTT gene can include from 15 nucleotides to 23 nucleotides.
  • the nucleic acid sequence that is complementary to the target sequence within the mHTT gene can include from 19 nucleotides to 21 nucleotides.
  • the nucleic acid sequence that, is complementary to the target sequence within the mHTT gene can include, consist of, or consist essentially of a nucleic acid sequence set forth in any one of SEQ ID NOs:20-25 and 230-294.
  • the target sequence within the mHTT gene can include, consist of, or consist essentially of a nucleic acid sequence set forth in any one of SEQ ID NOs: 26-229.
  • the nucleic acid sequence that can bind said endonuclease can include, consist of, or consist essentially of a nucleic acid sequence set forth in SEQ ID NO:301.
  • this document features gene editing systems for treating HD.
  • the gene editing systems can comprises: (a-i) an endonuclease comprising I) from 1 NLS to 7 NLSs fused to the N-terminus of the endonuclease and/or 2) from 1 NLS to 7 NLSs fused to the C -terminus of the endonuclease; or (a-ii)a nucleic acid molecule encoding said endonuclease; and can comprise: (b) a RNA molecule comprising (i) a nucleic acid sequence that is complementary to a target sequence within a mHTT gene and (ii) a nucleic acid sequence that can bind the endonuclease or a nucleic acid molecule encoding the RNA molecule.
  • the gene editing system can include the endonuclease.
  • the gene editing system can include the nucleic acid molecule encoding the endonuclease.
  • the gene editing system can include the RNA molecule.
  • the gene editing system can include the nucleic acid sequence encoding the RNA molecule.
  • the endonuclease can be a Cas polypeptide.
  • the Cas polypeptide can be a Cas9 polypeptide, a Cas 12a polypeptide, a Cas 13 polypeptide, ora Cas 12c polypeptide.
  • the endonuclease can include from 1 NLS to 7 NLSs fused to the N- terminus of the endonuclease and can include from 1 NLS to 7 NLSs fused to the C -terminus of the endonuclease.
  • the endonuclease can include 4 NLSs fused to the N-terminus of the endonuclease and can include 2 NLSs fused to the C -terminus of the endonuclease.
  • NLS can be a SV40 NLS.
  • the endonuclease also can include a peptide linker separating each NLS.
  • the peptide linker can include, consist of, or consist essentially of a GGS amino acid sequence.
  • the nucleic acid sequence that is complementary to the target sequence within the mHTT gene can include from 15 nucleotides to 23 nucleotides.
  • the nucleic acid sequence that is complementary to the target sequence within the mHTT gene can include from 19 nucleotides to 21 nucleotides.
  • the nucleic acid sequence that, is complementary to the target sequence within the mHTT gene can include, consist of, or consist essentially of a nucleic acid sequence set forth in any one of SEQ ID NOs:20-25 and 230-294.
  • the target sequence within the mHTT gene can include, consist of, or consist essentially of a nucleic acid sequence set forth in any one of SEQ ID NOs: 26-229.
  • the nucleic acid sequence that can bind the endonuclease can include, consist of or consist essentially of a nucleic acid sequence set forth in SEQ ID NO:301.
  • this document features methods for treating HD.
  • the methods can include, or consist essentially of, administering to a mammal an RNP complex comprising: (a) an endonuclease comprising 1 ) from 1 NLS to 7 NLSs fused to the N-terminus of said endonuclease and/or 2) from 1 NLS to 7 NLSs fused to the C-terminus of said endonuclease, and (b)a RNA molecule comprising (i) a nucleic acid sequence that is complementary to a target sequence within a mHTT gene, and (ii) a nucleic acid sequence that can bind the endonuclease.
  • the mammal can be a human.
  • the administering can include administering the RNP complex to neurons within said mammal.
  • the neurons can be present in a striatum of the mammal.
  • the neurons can be present in a motor cortex of the mammal .
  • the neurons can include medium spiny neurons.
  • the endonuclease can be a Cas polypeptide.
  • the Cas polypeptide can be a Cas9 polypeptide, a Cas12a polypeptide, a Casl 13 polypeptide, or a Cas 12c polypeptide.
  • the endonuclease can include from 1 NLS to 7 NLSs fused to the N- terminus of the endonuclease and can include from 1 NLS to 7 NLSs fused to the C-terminus of the endonuclease.
  • the endonuclease can include 4 NLSs fused to the N-terminus of the endonuclease and can include 2 NLSs fused, to the C-terminus of the endonuclease.
  • NLS can bea SV40 NLS.
  • the endonuclease also can includedae peptide linker separating each NLS.
  • the peptide linker can include, consist of, or consist essentially of a GGS amino acid sequence.
  • the nucleic acid sequence that is complementary to the target sequence within the mHTT gene can include from 15 nucleotides to 23 nucleotides.
  • the nucleic acid sequence that is complementary to the target sequence within the mHTT gene can include from 19 nucleotides to 21 nucleotides.
  • the nucleic acid sequence that is complementary' to the target sequence within the mHTT gene can include, consist of, or consist essentially of a nucleic acid sequence set forth in any one of SEQ ID NOs:20-25 and 230-294.
  • the target sequence within the mHTT gene can include, consist of, or consist essentially of a nucleic acid sequence set forth in any one of SEQ ID NOs: 26-229.
  • the nucleic acid sequence that can bind the endonuclease can include, consist of, or consist essentially of a nucleic acid sequence set forth in SEQ ID NO:301.
  • the administration can include a direct injection into the striatum.
  • the administration can include a direct injection into the motor cortex.
  • the method also can include, prior to the administering step, identifying the mammal as having HD.
  • this document features methods for improving a motor function in a mammal having HD.
  • the methods can include, or consist essentially of, administering to a mammal having HD an RNP complex comprising (a) an endonuclease comprising 1) from 1 NLS to 7 NLSs fused to the N-terminus of the endonuclease and/or 2) from 1 NLS to 7 NLSs fused to the C -terminus of the endonuclease; and (b) a RNA molecule comprising (i ) a nucleic acid, sequence that is complementary to a target sequence within a mH TT gene, and (ii)a nucleic acid sequence that can bind the endonuclease.
  • the motor function can include tremors, seizures, chorea, dystonia, dyskinesia, slow or abnormal eye movements, impaired gait, impaired posture, impaired balance, difficulty with speech, difficulty with swallowing, difficulty organizing, difficulty prioritizing, difficulty focusing on tasks, lack of flexibility, lack of impul se control, outbursts, lack of awareness of one's own behaviors and/or abilities, slowness in processing thoughts, difficulty in learning new information, depression, irritability, sadness or apathy, social withdrawal, insomnia, fatigue, lack of energy, obsessive- compulsive disorder, mania, bipolar disorder, weight loss, or any combinations thereof.
  • the mammal can be a human.
  • the administering can include administering the RNP complex to neurons within the mammal.
  • the neurons can be present in a striatum of the mammal.
  • the neurons can be present in a motor cortex of the mammal.
  • the neurons can include medium spiny neurons.
  • the endonuclease can be a Cas polypeptide.
  • the Cas polypeptide can be a Cas9 polypeptide, a Cas12a polypeptide, a Cas13 polypeptide, or a Cas12c polypeptide.
  • the endonuclease can include from 1 NLS to 7 NLSs fused to the N-terminus of the endonuclease and can include from 1 NLS to 7 NLSs fused to the C -terminus of the endonuclease.
  • the endonuclease can include 4 NLSs fused to the N-terminus of the endonuclease and can include 2 NLSs fused to the C-terminus of the endonuclease.
  • NLS can be a SV40 NLS.
  • the endonuclease also can include a peptide linker separating each NLS.
  • the peptide linker can include, consist of, or consist essentially of a GGS amino acid sequence.
  • the nucleic acid sequence that is complementary to the target sequence within the mHTT gene can include from 15 nucleotides to 23 nucleotides.
  • the nucleic acid sequence that is complementary to the target sequence within the mHTT gene can include from 19 nucleotides to 21 nucleotides.
  • the nucleic acid sequence that is complementary' to the target sequence within the mHTT gene can include, consist of, or consist essentially ofa nucleic acid sequence set forth in any one of SEQ ID NOs:20-25 and 230-294.
  • the target sequence within the mHTT gene can include, consist of, or consist essentially of a nucleic acid sequence set forth in any one of SEQ ID NOs: 26-229.
  • the nucleic acid sequence that can bind the endonuclease can include, consist of, or consist essentially of a nucleic acid sequence set forth in SEQ ID NO:301.
  • the administration can includedae direct injection into the striatum.
  • the administration can include a direct injection into the motor cortex.
  • the method also can include, prior to the administering step, identifying the mammal as having
  • this document features methods for improving life expectancy of a mammal having HD.
  • the methods can include, or consist essentially of, administering to a mammal having HD an RNP complex comprising: (a) an endonuclease comprising 1) from 1 NLS to 7 NLSs fused to the N-terminus of the endonuclease and/or 2) from 1 NLS to 7 NLSs fused to the C -terminus of the endonuclease; and (b) a RNA molecule comprising (i) a nucleic acid sequence that is complementary toa target sequence withina mHTT gene, and (ii) a nucleic acid sequence that can bind the endonuclease.
  • the life expectancy of the mammal can be extended by from about 5% to about 50%.
  • the mammal can be a human.
  • the administering can include administering the RNP complex to neurons within the mammal.
  • the neurons can be present in a striatum of the mammal.
  • the neurons can be present in a motor cortex of the mammal.
  • the neurons can include medium spiny neurons.
  • the endonuclease can be a Cas polypeptide.
  • the Cas polypeptide can be a Cas9 polypeptide, a Cas12a polypeptide, a Cas13 polypeptide, or a Cas12c polypeptide.
  • the endonuclease can include from 1 NLS to 7 NLSs fused to the N-terminus of the endonuclease and. can include from 1 NLS to 7 NLSs fused to the C -terminus of the endonuclease.
  • the endonuclease can include 4 NLSs fused to the N-terminus of the endonuclease and can include 2 NLSs fused to the C -terminus of the endonuclease.
  • Each NLS can be a SV40 NLS.
  • the endonuclease also can include a peptide linker separating each NLS.
  • the peptide linker can include, consist of, or consist essentially of a GGS amino acid sequence.
  • the nucleic acid sequence that is complementary to the target sequence within the mHTT gene can include from 15 nucleotides to 23 nucleotides.
  • the nucleic acid, sequence that is complementary to said target sequence within the mHTT gene can include from 19 nucleotides to 21 nucleotides.
  • the nucleic acid sequence that is complementary to the target sequence within the mHTT gene can include, consist of, or consist essentially of a nucleic acid sequence set forth in any one of SEQ ID NOs:20-25 and 230-294.
  • the target sequence within the mHTT gene can include, consist of, or consist essentially of a nucleic acid sequence set forth in any one of SEQ ID NOs; 26-229.
  • the nucleic acid sequence that can bind the endonuclease can include, consist of, or consist essentially of a nucleic acid, sequence set forth in SEQ ID NO:301.
  • the administration can includedae direct injection into the striatum.
  • the administration can includedae direct injection into the motor cortex.
  • the method also can include, prior to the administering step, identifying the mammal as having HD.
  • this document features methods for reducing nuclear mHTT polypeptide aggregates in a mammal having EID.
  • the methods can include, or consist essentially of, administering to a mammal having HD an RNP complex comprising: (a) an endonuclease comprising 1 ) from 1 NLS to 7 NLSs fused to the N-terminus of the endonuclease and/or 2) from 1 NLS to 7 NLSs fused to the C-terminus of the endonuclease; and.
  • RNA molecule comprising (i) a nucleic acid sequence that is complementary to a target sequence within a mHTT gene, and (ii)a nucleic acid sequence that can bind the endonuclease.
  • the method can be effective reduce the number of the mHTT polypeptide aggregates.
  • the method can be effective reduce the size of the mHTT polypeptide aggregates.
  • the mammal can be a human.
  • the administering can include administering the RNP complex to neurons within the mammal .
  • the neurons can be present, in a striatum of the mammal.
  • the neurons can be present in a motor cortex of the mammal.
  • the neurons can include medium spiny neurons.
  • the endonuclease can be a Cas polypeptide.
  • the Cas polypeptide can be a Cas9 polypeptide, a Cas12a polypeptide, a Cas13 polypeptide, ora Cas12c polypeptide.
  • the endonuclease can include from 1 NLS to 7 NLSs fused to the N- terminus of the endonuclease and can include from 1 NLS to 7 NLSs fused to the C-terminus of the endonuclease.
  • the endonuclease can include 4 NLSs fused to the N-terminus of the endonuclease and can include 2 NLSs fused to the C-terminus of the endonuclease.
  • NLS can be a SV40 NLS.
  • the endonuclease also can include a peptide linker separating each NLS.
  • the peptide linker can include, consist of, or consist essentially of a GGS amino acid sequence.
  • the nucleic acid sequence that is complementary to the target sequence within the mHTT gene can include from 15 nucleotides to 23 nucleotides.
  • the nucleic acid sequence that is complementary to the target sequence within the mHTT gene can include from 19 nucleotides to 21 nucleotides.
  • the nucleic acid sequence that is complementary to the target sequence within the mHTT gene can include, consist of, or consist essentially of a nucleic acid sequence set forth in any one of SEQ ID NOs:20-25 and 230-294.
  • the target sequence within the mHTT gene can include, consist of, or consist essentially of a nucleic acid sequence set forth in any one of SEQ ID NOs: 26-229.
  • the nucleic acid sequence that can bind the endonuclease can include, consist of or consist essentially of a nucleic acid sequence set forth in SEQ ID NO:301.
  • the administration can includae direct injection into the striatum. "The administration can include a direct injection into the motor cortex. The method also can include, prior to the administering step, identifying the mammal as having HD.
  • this document features methods for targeting mHTT in a neuron.
  • the methods can include, or consist essentially of, administering to a neuron an RNP complex comprising: (a) an endonuclease comprising 1) from 1 NLS to 7 NLSs fused to the N-terminus of the endonuclease and/or 2) from 1 NLS to 7 NLSs fused to the C -terminus of the endonuclease; and (b) a RNA molecule comprising (i) a nucleic acid sequence that is complementary to a target sequence within a mHTT gene, and (ii) a nucleic acid sequence that can bind the endonuclease.
  • Figures 1 A - IF demonstrate targeted disruption of mHTT by Cas9 RNP delivery in neural progenitor cells (NPCs) and in an adult BACHD mouse model.
  • Figure 1 A depicts sgRNA designs (B1 through B10) and. where they target the mHTT gene.
  • Figure 1B depicts DNA. indel efficiency of BACHD NPCs nucleofected with RNPs assembled using different. sgRNAs.
  • Figure 1C depicts a Sanger sequencing electropherogram and indel spectrum of B3 RNP treated NPCs (SEQ ID NO:306).
  • Figure1 D depicts quantification of soluble mHTT by Meso Scale Discovery (MSD) ELISA based assays differentiated by the detection antibody used (“Assay 006” vrs. “Assay 039”). Both assays used the same capture antibody (black), while the detection antibodies (shown in pink) targeted the poly Q expansion or immediately adjacent. (***p ⁇ 0.001, ****p ⁇ 0.0001 One-way ANOVA Tukey’s multiple comparison test; n::::: 2-3 animals, striatums from each animal were pooled).
  • Figure 1 E top panel, depicts a schematic of experimental design to harvest B3 R NP injected striatum for NextGen Sequencing and western blot analysis of mHTT.
  • the bottom panel depictas scatter dot plot of mHTT protein levels measured by western blot and % indels at 1-4 months post B3 RNP treatment.
  • Figure 1 F depicts a western blot of mHTT in the striatum of animals 4 months post RNP injection. Western blot was probed with an antibody which recognizes both human and. mouse HTT aa. 181-810 (Millipore, Cat no: MAB2166). Quantification of mHTT protein levels in western blot w'hich are also depicted in Figure 1E. Mutant over HSP90 protein levels were measured and normalized to sham. (** p ⁇ 0.01 Unpaired t test: n::::2-5 animals, striatums from each animal were pooled). Data are represented as mean ⁇ SEM.
  • FIGS 2A - 2H demonstrate that RNP delivered via. convection enhanced delivery (CED) durably improves phenotype in BACHD mice that received cortical and striatal injections.
  • Figure 2A depicts a schematic of the in vivo delivery scheme. At 2 months of age, adult BACHD mice were injected with 50 pmol RNP (either B3 ora non-targeting (NT) RNP) in the motor cortex and 500 pmol in the striatum by CED. After time to recover, mice were tested on the rotarod (RR) or open-field (OF) test.
  • Figure 2B depicts baseLine weight and rotarod measurements of BACHD cohort, no significant differences found.
  • Figure 2C depicts rotarod measurements over 3 days at 2 months (baseline), 4 months, 5.5 months, 8.5 months, 10 months and 13 months.
  • Tukey’ s multipie comparisons test; n:::: 16-17 mice per group.
  • Figure 21 depicts duration in center zone in open-field test 12 months past treatment in 14 month old mice.
  • FIG. 2F depicts a scatter dot plot of mHTT protein levels measured by western biot and % indels at 15 months post B3 RNP treatment.
  • Figures 2G- Figure 2H depict western blots of mHTT in the striatum ( Figure 2G) and cortex ( Figure 2H) of animals 15 months post RNP treatment.
  • Western blots were probed with an antibody which recognizes both human and mouse HTTa a 181-810 (Millipore, Cat no: MAB2166).
  • Quantification of mHTT protein levels in western blot Mutant over HSP90 protein levels were measured and normalized to sham. (Striatum: **p ::: 0.0052 Unpaired t test, cortex: ***p ::: 0.0713 Unpaired t test.)
  • Data are represented as mean ⁇ SEM.
  • Figures 3A - 31 depict rescue of Huntington’s transcriptome and mHTT protein levels with Cas9 RNP delivery in zQ175 mouse model using an RNP (“Q2”) targeted near the CAG repeat in the mHTT knock-in gene (see e.g. Fig 3E) or a non-targeted RNP.
  • Figure 3 A depicts a schematic of the in vivo delivery scheme for 500pmol RNP CED in zQ175/WT mice.
  • Figure 3C depict western blots and. quantification of mHTT protein levels in the NT or Q2 treated striatum 5 months post. RNP injection.
  • Figure 3B the western blot was probed with antibody EPR5526 which recognizes both human and mouse HIT aa 1-100.
  • Figure 3C the western blot, was probed with antibody 1C2 which recognizes the homopolymeric polyglutamine repeat. Quantification of the ratio of mHTT and HSP90 was normalized to NT. (Unpaired t test).
  • Figure 3D depictas scatter dot plot of mHTT protein levels measured by western blot with 1C2 antibody and % indels at 5 months post Q2 RNP injection. Data are represented as mean ⁇ SEM.
  • Figure 3E sgRNA designs and where they target mHTT in Q175 mouse.
  • Figure 3F depictas schematic of the in vivo delivery scheme for nanostring analysis.
  • Figure 3G depicts that principal component analysis revealed differential clustering of the wiki type (blue triangle: No Tx; blue circle: NT RNP) and heterozygous striatal samples (red triangle: No Tx; red circle: NT RNP; gold triangle: HTT RNP).
  • Figure 3H depicts differentially expressed genes that were significantly changed greater than >1.5x in the wild type vs heterozygous striatum.
  • Figure 31 depicts that Q2 RNP treatment decreased gene transcripts that were differentially expressed between heterozygous and wild type mice, indicating a rescue in the HD transcriptome.
  • Figures 4A - 4D depict decreases in mHTT protein aggregates in genome edited medium spiny neurons.
  • Figure 4A depicts a schematic of the in vivo delivery scheme for mHTT aggregate analysis.
  • zQ175/WT;1dTomato/tdTomato female mice were co-injected with 100 pmol of either non-targeting (NT) RNP + tdTomato RNP or Q2 RNP tdTomato RNP at 2.5 months old and analyzed 8 months later at 10.5 months old.
  • NT non-targeting
  • Figure 4B depicts immunofluorescence of mHTT nuclear aggregates in the striatum of zQ175/WT;ldTomato/tdTomato treated with NT RNP + tdTomato RNP or Q2 RNP + tdTomato RNP.
  • tdTom+ medium spiny neurons were analyzed for mHTT nuclear aggregates stained with EM48 antibody (Millipore Catalogue number: MAB5374).
  • Figure 4C depicts quantification of percentage of dTomato+ cells with number of aggregates.
  • Figure 4D depicts mean integrated intensity of mHTT aggregates. n::::3-5 animals, n::::6-10 sections per animal for each group. Unpaired t-test *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001 Data are represented as mean ⁇ SEM.
  • Figure 5 depicts sgRN A sequences that target exon 1 of the BACHD mHTT gene. Sequences shown include, from top to bottom, SEQ ID NOs:3-14.
  • Figures 6A - 6D depict results demonstrating that Cas9 RNP complexes assembled with BACHD sgRNAs inactivate mHTT allele.
  • Figure 6 A depicts a cartoon illustrating predicted frameshifts and premature termination codons (PTC) following disruption of mHTT allele by Cas9 RNPs assembled with various BACHD sgRNAs.
  • Figure 6C depicts reduction of mHTT transcript, in BACHD NPCs nucleofected with Cas9 RNPs with HTT targeting sgRNAs or NT sgRNA.
  • Figure 6D depicts a western blot of lystate from BACHD NPCs 9 days after nucleofection with Cas9 RNPs with HTT targeting sgRNAs or NT sgRNA.
  • Figures 7.A - 7C depict RNP CED injections in the striatum of the tdTomato reporter mouse.
  • Figure 7 A depicts a schematic of the step needle designed for CED delivery into the mouse striatum.
  • Figure 7B depicts representative images of serial coronal sections froma 500 pmol 4xNLS-Cas9-2xNLS injected striatum presented, with approximate Bregma coordinates. With serial sectioning at the periodicity of 1 in 6, each coronal section represented here samples 300 ⁇ m of tissue making the volume of edited, cells -1.8 mmf
  • Figure 7C depicts quantification of the number of tdTomato+ cells on Y-axis and rostral- caudal position of coronal sections analyzed on X-axis.
  • X-axis units are millimeters (mm) n::: 3 animals.
  • Figures 8.A - 8F depict astrocyte and microglia response following CED RNP delivery.
  • Figures 8A-8D depicts immunofluorescence of GFAP+ astrocytes and IBA 1+ microglia in the striatum of tdTomato mice treated with increasing doses of RNP (300- 3000 pmol). The striatum was assessed at 3 weeks post injection ( Figures 8A-8B) and at 3 months post injection ( Figures 8C-8D).
  • Figures 8E-8F depict quantification of the mean integrated intensity of GFAP and IB Al immunofluorescence at 3 weeks and 3 months post RNP injection. n:::2 animals, n:::4 sections. Two-way ANOVA Sidak’s multiple comparison tests *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001, ****p ⁇ 0.0001 . Data are represented as mean ⁇ SEM.
  • Figure 9 depicts a comparison of RNP activity with Synthego or IVT sgRNA in tdT omato NPCs in vitro.
  • Figures 10A - 10C depicts optimizing RNP dose in BACHD mice.
  • Figures 10A-10B depict edits in BACHD mice were intrastriatally injected with 5 ⁇ L or 10 ⁇ L of 100 ⁇ M or 300 ⁇ M B3 RNP by CED. Whole striatums were dissected from BACHD mice at 1 month post treatment. Genomic DNA and protein were isolated simultaneously isolated to assess indel genetic edits by Next Generation Sequencing (Figure 10A) and the resulting effect on mHTT protein by western blot ( Figure 10B). Mice receiving 10 ⁇ L of the 300 ⁇ M dose had the highest percent indels (most editing). This dose reduced both mHTT and wild type HTT protein levels.
  • Figure 10C depicts tiled DA Pi brain image from an animal that received. 10 ⁇ L of 300 ⁇ M RNP. Brain was collected 3 weeks post injection and had neural damage.
  • Figures 11 A - 11D depict permanent inactivation of mHTT gene in BACHD mice by Cas9 RNP delivery durably improves motor phenotype and reduces mutant protein levels.
  • Figure 11 A depicts a schematic of the hi vivo delivery scheme. Following a baseline rotarod behavioral test, mice received one cortical and two striatal RNP injections per hemisphere for a total of six injections at two months of age. Mice received 50 pmol RNP in the cortex and 200 pmol RNP in the striatum. After time to recover, mice were tested on the rotarod at 4-6 week intervals for 10 months.
  • Figure 1 1B depicts motor performance on the rotarod at 2 months of age and after RNP injection.
  • BACHD-B3 RNP treated mice show a separation in performance from the BACHD-NT animals following injection. This improvement in performance persisted and was significant at 9.5, 10.5 and 12 months.
  • Figure 11C depicts the baseline behavioral trial of the mice was next compared with their best trial over the course of the experiment to see if there was a difference in improvement between the two BACHD groups. While the BACHD-NT animals show little improvement from baseline, the BACHD-B3 animals show a much broader distribution.
  • Figure 1 1 D depictsa western blot, of mHTT in the striatum of animals 10 months post RNP injection. Western blot was probed with an antibody which recognizes both human and mouse HTT a.a. 181-810 (Millipore, Cat no: MAB2166). Quantification of mHTT protein levels in western blot. Mutant over wild type protein levels were measured and normalized to sham. (BACHD-B3 vs BACHD-NT *p
  • Figures 12A - 12C depicts sgRNA activity in neural progenitor cells isolated from Z.Q175 mice.
  • Figure 12A depicts sgRNA sequences that target exon 1 in the zQ175 knockin mHTT gene. Sequences shown include, from top to bottom, SEQ ID NOs: 15-19.
  • Figure 12B depicts a gel of genomic DNA isolated from zQ175 NPCs after nucleofection with Cas9 RNPs with HTT targeting sgRNAs (Q2, Q3, and Q6) or non-targeting (NT) sgRN A. Q2 RNP showed deletion in mHTT locus.
  • Figure 12C depicts qPCR of mHTT transcript in zQ175 NPCs nucleofected with Cas9 RNPs with HTT targeting sgRNAs or NT sgRNA. Primer sequences are Listed in Table 3.
  • Figure 13 depicts differential clustering of RNP striatal samples in PC A of Nanostring transcriptome.
  • PCA of the heterozygous samples revealed a distinct separation of the Q2 RNP striatal samples compared to the Q3 and Q9 RNP striatal samples.
  • Figures 14A - 1.4E depict aggregate analysis in zQ175 heterozygous mice.
  • Figure 1.4A depicts images using Fij i software, wherein region of interests (ROIs) were selected for the td.Tom+ cells and overlaid, onto the DAPI channel. TdTom+ cells co-localizing with DAPI were quantified for total aggregate counts.
  • Figures 14B-14D depict Fiji analysis showing aggregate ROIs with 1 ( Figure 14B), 2 ( Figure 14C) or 3 ( Figure 14D) aggregates in a cell.
  • Figure 14E depicts micrographs from zQ175/WT;tdTomato/tdTomato female mice injected with 3000 pmol of either tdTomato RNP or Q2 RNP + tdTomato RNP at 3 months old when aggregates are already formed in the ventral striatum. Brains were analyzed 7 months later at 10 months old. Immunofluorescence of tdTomato+ medium spiny neurons with mHTT nuclear aggregates in the striatum of zQ175/WT;tdTomaio/tdTomato mice. Thin arrows indicate DARPP32+tdTomato+ cells containing EM48+ aggregates. Bold arrows indicate DARPP32+tdTomato+ cells with no aggregates.
  • Figure 15 depicts rotarod performance and percentage of indels in the zQ175 mice following Q2 RNP treatment. Scatter plot of best rotarod trial and percentage of indels measured by NGS in the zQ175 Het mice. Mice were injected with RNP at 4 months old and motor performance on the rotarod was assessed at 7 months old.
  • Figures 16A - 16C depict S. pyogenes (Sp or spy) Cas9 editing in human cells.
  • Figure 16A depicts a design of guideRNAs for RNP experiments. sgRNA target sequences were designed and then screened for genome specificity using the website at the address crispr.mit.edu. Sequences shown include, from top to bottom, 23.3+ (SEQ ID NO:20), 23.4+ (SEQ ID NO:21), 23.9- (SEQ ID NO.22). 24.5- (SEQ ID NO:23), HP Intron2 (SEQ ID NO:24), and HP Intron3 (SEQ ID NO:25).
  • Figure 16B depicts targeted editing of Htt promoter in 293T and human fibroblast cells with Cas9/guideRNA.
  • FIG. 16C depicts targeted deletion of Hit gene by dual Cas9 RNPs.
  • Combinations SpCas9 RNPs were nucelofected into HEK293T cells at 200 pmols each (23.9- and 24.5+) or 300 pmols each RNP3 (Hit intron2), RNP4 (Htt intron.3). Dual cutting generates smaller bands indicative of a deletion edit.
  • Two amounts of RNP complex, 200 or 600 pmol, were transfected into 293 T cells. PCR analysis reveals a small PCR. product (236 bp smaller) present, only in cells treated with both sgRNAs, indicative of successful deletion of Htt exon 1 or exon 3.
  • one or more RNP complexes including (a) an endonuclease (e.g., a Cas9 polypeptide) including one or more NLSs; and (b) a RNA molecule (e.g., a gRNA such as a sgRNA) includinag nucleic acid sequence that, is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease can be used to inactivate one or more mHTT genes within a mammal (e.g., to inactivate one or more mHTT genes within neurons in a mammal ’s brain).
  • an endonuclease e.g., a Cas9 polypeptide
  • a RNA molecule e.g., a gRNA such as a sgRNA
  • a nucleic acid sequence that can bind the endonuclease can be used to inactivate one or more
  • the methods and materials described herein can be used to treat a mammal having, or at risk of developing, Huntington’s disease.
  • one or more RNP complexes provided herein e.g., RNP complexes including (a) an endonuclease having one or more NLSs and (b) a RN A molecule including a nucleic acid sequence that, is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease
  • a mammal e.g., a human
  • a mammal e.g., a human in need thereof (e.g.a, human having, or at risk of developing, Huntington’s disease) to slow, delay, or prevent progression of Huntington’s disease (e.g., slow, delay, or prevent the development of Huntington’s disease and/or decrease the severity of one or more symptoms of Huntington’s disease).
  • administering one or more RNP complexes provided herein can be effective to reduce or eliminate a level of mHTT polypeptides within a mammal (e.g,, within a brain of a mammal).
  • one or more RNP complexes provided herein can be delivered to a mammal (e.g., a human) in need thereof (e.g., a human having, or at risk of developing, Huntington’s disease) to reduce or eliminate a level of mHTT polypeptides within a brain of a mammal.
  • a mammal e.g., a human
  • a human having, or at risk of developing, Huntington’s disease e.g., a human having, or at risk of developing, Huntington’s disease
  • the methods and materials described herein are effective to reduce the level of HTT polypeptides (e.g, mHTT polypeptides) present within the brain ofa mammal with Huntington’s disease by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent (e.g., as compared to the amount of HTT polypeptides in native neurons ina mammal with Huntington’s disease such as neurons in a mammal that has not been treated as described herein and/or neurons ina mammal prior to being treated as described herein). Any appropriate method can be used to evaluate the presence, absence, or amount of HTT polypeptides in a mammal with Huntington’s disease.
  • HTT polypeptides e.g, mHTT polypeptides
  • immunohistochemistry can be used to evaluate the presence, absence, or amount of HTT polypeptides present within the brain ofa mammal with Huntington’s disease.
  • ELISAs enzyme-linked immunosorbent assays
  • mass spectrometry techniques e.g., proteomics-based mass spectrometry assays or targeted quantification-based mass spectrometry assays
  • the presence, absence, or amount of HTT polypeptides in a mammal with Huntington’s disease can be determined by detecting the presence, absence, or level of mRNA encoding the HTT polypeptide.
  • PCR polymerase chain reaction
  • ISH in situ hybridization
  • FISH fluorescence in situ hybridization
  • northern blots can be used to determine the presence, absence, or level of mRNA encoding the HTT polypeptide.
  • administering one or more RNP complexes provided herein can be effective to reduce or eliminate mHTT polypeptide aggregates within a mammal (e.g., withian brain of a mammal).
  • one or more RNP complexes provided herein can be delivered to a mammal (e.g., a human) in need thereof (e.g., a human having, or at risk of developing, Huntington’s disease) to reduce or eliminate the number of mHTT polypeptide aggregates within a mammal.
  • a mammal e.g., a human
  • a mammal e.g., a human
  • one or more RNP complexes provided herein can be delivered to a mammal (e.g., a human) in need thereof (e.g., a human having, or at risk of developing. Huntington’s disease) to reduce the size of one or more mHTT polypeptide aggregates withina mammal.
  • a mammal e.g., a human
  • Huntington’s disease e.g., a human having, or at risk of developing. Huntington’s disease
  • the methods and materials described herein can be effective to reduce HTT polypeptide (e.g., mHTT polypeptide) aggregates present within the brain of a mammal with Huntington’s disease by at least 10 percent (e.g, as compared to the amount of HTT polypeptide aggregates in native neurons in a mammal with Huntington’s disease such as neurons in a mammal that has not been treated as described herein and/or neurons ina mammal prior to being treated as described herein).
  • HTT polypeptide e.g., mHTT polypeptide
  • the methods and materials described herein can be effective to reduce HTT polypeptide (e.g., mHTT polypeptide) aggregates present within the brain of a mammal with Huntington’s disease by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent (e.g., as compared to the amount of HTT polypeptide aggregates in native neurons in a mammal with Huntington’s disease such as neurons in a mammal that has not been treated as described herein and/or neurons in a mammal prior to being treated as described herein).
  • Any appropriate method can be used to evaluate the presence, absence, or amount of HTT polypeptide aggregates in a mammal with Huntington’s disease.
  • immunohistochemistry, genotyping, qPCR, and/or Meso scale Discovery can be used to evaluate the presence, absence, or amount of HTT polypeptide aggregates present within the brain ofa mammal with Huntington’s disease.
  • administering one or more RNP complexes provided herein can be effective to reduce or eliminate one or more symptoms of Huntington’s disease within a mammal.
  • one or more RNP complexes provided herein can be delivered to a mammal (e.g., a human) in need thereof (e.g., a human having, or at risk of developing, Huntington’s disease) to reduce or eliminate one or more symptoms of Huntington’s disease within the mammal.
  • a mammal e.g., a human
  • Huntington’s disease e.g., a human having, or at risk of developing, Huntington’s disease
  • the methods and materials described herein can be effective to reduce one or more symptoms of Huntington’s disease in a mammal with Huntington’s disease by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent (e.g, as compared to the severity ofa symptom of Huntington’s disease in a mammal with that has not been treated as described herein and/or in a mammal prior to being treated as described herein).
  • a symptom of Huntington’s disease can be a movement symptom (e.g., an impairment in one or more motor functions).
  • a movement symptom can be an impairment of an involuntary movement or an impairment of a voluntary movement.
  • a symptom of Huntington’s disease can be a cognitive symptom. In some cases, a symptom of Huntington’s disease can be a psychiatric symptom. Examples of symptoms of Huntington’s disease that can be reduced or eliminated using the methods and materials described herein include, without limitation, changes (e.g., reduction or loss of) fine motor skills, tremors, seizures, chorea, dystonia, dyskinesia, slow' or abnormal eye movements, impaired gait, impaired posture, impaired, balance, difficulty with speech, difficulty with swallowing, difficulty organizing, difficulty prioritizing, difficulty focusing on tasks, lack of flexibility, lack of impulse control, outbursts, lack of awareness of one's own behaviors and/or abilities, slowness in processing thoughts, difficulty in learning new information, depression, irritability, sadness or apathy, social withdrawal, insomnia, fatigue, lack of energy, obsessive-compulsive disorder, mania, bipolar disorder, and weight loss. In some cases, a symptom of Huntington’s disease
  • administering one or more RNP complexes provided herein can be effective to improve motor function within a mammal .
  • RNP complexes provided herein can be delivered to a mammal (e.g., a human) in need thereof (e.g., a human having, or at risk of developing, Huntington’s disease) to improve motor function within the mammal.
  • the methods and materials described herein can be effective to improve motor function in a mammal with Huntington’s disease by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent (e.g., as compared to the amount of motor function a mammal with Huntington’s disease that has not been treated as described herein and/or in a mammal prior to being treated as described herein).
  • Any appropriate method can be used to evaluate motor function deficits in a mammal with Huntington’s disease.
  • body weight, clasping behavior, and/or grip strength can be used to evaluate motor function deficits in a mammal with Huntington’s disease.
  • administering one or more RNP complexes provided herein can be effective to improve life expectancy of a mammal .
  • RNP complexes including (a) an endonuclease having one or more NLSs and (b) a RNA molecule includinag nucleic acid sequence that is complementary toa target sequence withina mHTT gene and a nucleic acid sequence that can bind the endonuclease
  • RNP complexes including (a) an endonuclease having one or more NLSs and (b) a RNA molecule includinag nucleic acid sequence that is complementary toa target sequence withina mHTT gene and a nucleic acid sequence that can bind the endonuclease
  • one or more RNP complexes provided herein can be delivered to a mammal (e.g., a human) in need thereof (e.g., a human having, or at risk of developing, Huntington’s disease) to improve the life expectancy of the mammal, hi some cases, the methods and materials described herein can be effective to improve the life expectancy of a mammal with Huntington’s disease by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent (e.g., as compared to the amount of motor function a mammal with Huntington’s disease that has not been treated as described herein and/or in a mammal prior to being treated as described herein).
  • a mammal e.g., a human
  • the methods and materials described herein can be effective to improve the life expectancy of a mammal with Huntington’s disease by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent (e.g.
  • the methods and materials described herein can be effective to improve the life expectancy of a mammal with Huntington’s disease by from about 5 percent to about 50 percent (e.g., from about 5 percent to about 45 percent, from about 5 percent to about 40 percent, from about 5 percent to about 35 percent, from about 5 percent to about 30 percent, from about 5 percent to about 25 percent, from about 5 percent to about 20 percent, from about 5 percent to about 15 percent, from about 5 percent to about 50 percent, from about 10 percent to about 50 percent, from about 15 percent to about 50 percent, from about 20 percent to about 50 percent, from about 25 percent to about 50 percent, from about 30 percent to about 50 percent, from about 35 percent to about 50 percent, from about 40 percent to about 50 percent, from about 10 percent, to about 40 percent, from about 20 percent, to about 30 percent, from about 15 percent to about 25 percent, from about 25 percent to about 35 percent, or from about 30 percent to about 40 percent) as compared to the life expectancy of a mammal with
  • RNP complexes including (a) an endonuclease having one or more NLSs and (b) a RNA molecule including a nucleic acid, sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease
  • RNP complexes including (a) an endonuclease having one or more NLSs and (b) a RNA molecule including a nucleic acid, sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease
  • a mammal e.g., a human
  • one or more RNP complexes provided herein can be delivered to a mammal (e.g., a human) in need thereof (e.g., a human having, or at risk of developing, Huntington’s disease) to edit the genomes of cells (e.g., neurons) within the mammal.
  • a mammal e.g., a human
  • a human having, or at risk of developing, Huntington’s disease e.g., a human having, or at risk of developing, Huntington’s disease
  • the materials described herein can be transient.
  • the methods and materials described herein can be effective to edit, the genomes of cells (e.g., neurons) within a mammal with Huntington’s disease, and then can be degraded (e.g., can be degraded by the cells the mammal).
  • the materials described herein, following administration toa mammal can exist within cells (e.g., neurons) within the mammal for less than about 10 hours (e.g, for about 10 hours, for about 9 hours, for about 8 hours, for about 7 hours, for about 6 hours, for about 5 hours, for about 4 hours, for about 3 hours, for about 2 hours, or for about 1 hour).
  • Any appropriate mammal can be treated as described herein.
  • mammals that can be treated as described herein include, without limitation, humans, non-human primates such as monkeys, mice, and rats.
  • a human having Huntington’s disease can be treated as described herein.
  • a mammal can be identified as having, or as being at risk of developing, Huntington’s disease.
  • a mammal can be identified as having, or as being at risk of developing, Huntington’s disease using any appropriate Huntington’s disease diagnostic technique.
  • a review of family medical history e.g., to examine motor symptoms such as reflexes, muscle strength, and balance and/or to examine sensory symptoms such as touch, vision, and hearing
  • neurophysiological examinations e.g., to examine memory, reasoning, mental agility, language skills, and/or spatial reasoning
  • psychiatric examinations e.g., to examiner mood and/or mental status
  • brain-imaging tests e.g, magnetic resonance imaging (MRI) and/or computerized tomography (CT) scanning
  • CT computerized tomography
  • mammal e.g;a, human having Huntington’s disease
  • RNPs provided herein (e.g, a RNP complex including (a) an endonuclease having one or more NLSs and (b) a RNA molecule includinag nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease) to the mammal (e.g., to neurons within the mammal ) such that the one or more RNPs can inactivate one or more mHTT genes within a mammal (e.g, within neurons in a mammal’s brain).
  • RNPs e.g, a RNP complex including (a) an endonuclease having one or more NLSs and (b) a RNA molecule includinag nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can
  • a RNP complex provided herein can include any appropriate endonuclease.
  • an endonuclease can bea DNA endonuclease.
  • An endonuclease can cleavea nucleic acid molecule in any manner (e.g. , can make a double-strand break in a DNA).
  • an endonuclease can exhibit protospacer adjacent motif (PAM) specificity (e.g., can cleave a target sequence having an adjacent PAM sequence such as an NGG sequence).
  • PAM protospacer adjacent motif
  • an endonuclease can exhibit altered PAM specificity (e.g., can cleave a target sequence that does not have an adjacent PAM sequence such as an NGG sequence).
  • an endonuclease can be a type II endonuclease.
  • An endonuclease can be artificial or naturally occurring.
  • an endonuclease can be derived from Streptococcus pyogenes (e.g., S. pyogenes SF370).
  • endonucleases that can be included in a RNP complex provided herein include, without limitation, Cas9 polypeptides, Cas12a polypeptides (formerly referred to as Cpfl polypeptides), Cas13 polypeptides (formerly referred to as C2c2 polypeptides), Cas12c polypeptides (formerly referred to as C2c3 polypeptides), and those set forth in the National Center for Biotechnology Information (NCBI) databases at, for example, accession no. NC 002737.
  • NCBI National Center for Biotechnology Information
  • an endonuclease that can be used in a RNP complex provided herein can be as described elsewhere (see, e.g., Staahl st al, Nat. Biotechnol ., 35:431-434 (2017); and International Patent Application Publication No. WO 2019/036185 at, for example, paragraphs [0078] - [0094], and in Table 1).
  • RNP complex provided herein (e.g.a, RNP complex including (a) an endonuclease having one or more NLSs and (b) a RNA molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease) can includedae Cas9 polypeptide.
  • a Cas9 polypeptide can have an amino acid sequence set forth in SEQ ID NO: 1 (see, e.g.. Example 2).
  • nucleic acid encoding a Cas9 polypeptide can have a nucleotide sequence set forth in SEQ ID NO:2 (see, e.g.. Example 2).
  • a variant of an endonuclease can be used in place of or in addition to an endonuclease.
  • a variant of an endonuclease can have the amino acid sequence of a naturally-occurring endonuclease with one or more (e.g., e.g., one, two, three, four, five, six, seven, eight, nine, ten, or more) amino acid deletions, additions, substitutions, or combinations thereof, provided that the variant retains the function of a naturally-occurring an endonuclease (e.g., the ability to cleave a nucleic acid sequence).
  • a variant of a Cas9 polypeptide can have the amino acid sequence of a naturally- occurring Ca.s9 polypeptide with one or more amino acid deletions, additions, substitutions, or combinations thereof, provided that the variant retains the function of a naturally- occurring Cas9 polypeptide.
  • any appropriate amino acid residue set forth in SEQ ID NO: 1 can be deleted, and any appropriate amino acid residue (e.g., any of the 20 conventional amino acid residues or any other type of amino acid such as ornithine or citrulline) can be added to or substituted within the sequence set. forth in SEQ ID NO: 1.
  • the majority of naturally occurring amino acids are L-amino acids, and naturally occurring polypeptides are largely comprised of L-amino acids.
  • D-amino acids are the enantiomers of L-amino acids.
  • a polypeptide provided herein can contain one or more D- amino acids.
  • a polypeptide can contain chemical structures such as ⁇ - aminohexanoic acid; hydroxylated amino acids such as 3-hydroxyproline, 4-hydroxyproline, (5R)-5-hydroxy-L-lysine, allo-hydroxylysine, and 5-hydroxy-L-norvaline; or glycosylated amino acids such as amino acids containing monosaccharides (e.g., D-glucose, D-galactose, D-mannose, D-glucosamine, and D-galactosamine) or combinations of monosaccharides.
  • monosaccharides e.g., D-glucose, D-galactose, D-mannose, D-glucosamine, and D-galactosamine
  • Amino acid substitutions can be made, in some cases, by selecting substitutions that do not differ significantly in their effect on maintaining (a) the structure of the peptide backbone in the area of the substitution, (b) the charge or hydrophobicity of the molecule at particular sites, or (c) the bulk of the side chain.
  • residues can be divided into groups based on side-chain properties: (1) hydrophobic amino acids (norleucine, methionine, alanine, valine, leucine, and isoleucine); (2) neutral hydrophilic amino acids (cysteine, serine, and threonine); (3) acidic amino acids (aspartic acid and glutamic acid); (4) basic amino acids (asparagine, glutamine, histidine, lysine, and arginine), (5) amino acids that influence chain orientation (glycine and proline); and (6) aromatic amino acids (tryptophan, tyrosine, and phenylalanine). Substitutions made within these groups can be considered conservative substitutions.
  • Non-limiting examples of substitutions that can be used herein for SEQ ID NO: 1 include, without limitation, substitution of valine for alanine, lysine for arginine, glutamine for asparagine, glutamic acid for aspartic acid, serine for cysteine, asparagine for glutamine, aspartic acid for glutamic acid, proline for glycine, arginine for histidine, leucine for isoleucine, isoleucine for leucine, arginine for lysine, leucine for methionine, leucine for phenyalanine, glycine for proline, threonine for serine, serine for threonine, tyrosine for tryptophan, phenylalanine for tyrosine, and/or leucine for valine.
  • a variant of a Cas9 polypeptide can be designed to include the amino acid sequence set forth in SEQ ID NO: 1 with the proviso that it includes one or more non- conservative substitutions.
  • Non-conservative substitutions typically entail exchanging a member of one of the classes described above for a member of another class. Whether an amino acid change results in a functional polypeptide can be determined by assaying the specific activity of the polypeptide using, for example, the methods described, herein.
  • a variant of a Cas9 polypeptide having an amino acid sequence with at least 85% e .g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99.0%
  • Percent sequence identity is calculated by determining the number of matched positions in aligned amino acid sequences, dividing the number of matched positions by the length of an aligned amino acid sequence, and multiplying by 100.
  • a matched position refers to a position in which identical amino acids occur at the same position in aligned amino acid sequences.
  • variant of an endonuclease e.ga, Cas9 polypeptide
  • a RNP complex including (a) an endonuclease having one or more NLSs and (b) a RNA molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease
  • RNP complex including (a) an endonuclease having one or more NLSs and (b) a RNA molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease
  • RNP complex including (a) an endonuclease having one or more NLSs and (b) a RNA molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonu
  • An endonuclease in a RNP complex can include any appropriate NLS.
  • a NLS can be any polypeptide that can facilitate (e.g., that is designed to facilitate) the RNP complex in penetrating the nucleus of a cell within in a mammal.
  • a NLS can be a naturally occurring NLS.
  • a NLS can be an artificial NLS.
  • NLSs examples include, without limitation, SV40 NLS sequences.
  • NLSs that can be included in an endonuclease in a RNP complex provided herein can be as described elsewhere (see, e.g, WO 2017/106569 at, for example, Figures 1A-1 G and SEQ ID NOs: 1090-1249).
  • the NLSs can be the same or the NLSs can be different.
  • An endonuclease in a RNP complex can include one or more NLS(s) at any location.
  • one or more NLSs can be at the N-terminus of the endonuclease.
  • one or more NLSs can be at the C -terminus of the endonuclease.
  • one or more NLSs can be at the N-terminus and the C -terminus of the endonuclease.
  • An endonuclease in a RNP complex provided herein can include any number of NLS(s).
  • an endonuclease in a RNP complex provided herein can include one or more (e.g., one, two, three, four, five, six, seven, or more) NLSs.
  • an endonuclease in a RNP complex provided herein can include from about 1 to about 7 NLSs. In cases where an endonuclease in a RNP complex provided herein includes one or more NLSs at each of its N- terminus and its C -terminus the endonuclease can include from about 1 to about 7 NLS at its
  • N-terminus and can include from about 1 to about 7 NLS at its C -terminus.
  • a linker can separate each NLS. Any appropriate linker can be used to separate each NLS.
  • linker can be a peptide linker.
  • peptide linker can include a GGS amino acid sequencae, SNAT amino acid sequence (SEQ ID NO: 308), a GIHGVPAAT amino acid sequence (SEQ ID NO: 309), a GGDGS amino acid sequence (SEQ ID NO: 310)a, ED amino acid sequence, any repeats thereof, or any combinations thereof.
  • the same linker separates each pair of NLS. In some cases, different linkers are used to separate each pair of NLS.
  • an endonuclease in a RNP complex e.g, a R NP complex including (a) an endonuclease having one or more NLSs and (b)a RNA molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind, the endonuclease
  • a R NP complex including (a) an endonuclease having one or more NLSs and (b)a RNA molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind, the endonuclease
  • a R NP complex including (a) an endonuclease having one or more NLSs and (b)a RNA molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind, the end
  • an endonuclease in a RNP complex e.g., a RNP complex including (a) an endonuclease having one or more NLSs and (b)a RNA molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease
  • a RNP complex including (a) an endonuclease having one or more NLSs and (b)a RNA molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease
  • a Cas9 polypeptide having 4 SV40 NLSs on its N-terminus.
  • a RNP complex provided herein can include a Cas9 polypeptide having -4 SV40 NLSs at its N-terminus (e.g., fused to its N-terminus) and 2 SV40 NLSs at its C-terminus (e.g., fused to its C-terminus).
  • a Cas9 polypeptide having 4 SV40 NLSs at its N-terminus (e.g., fused to its N ⁇ terminus) and 2 SV40 NLSs at its C-terminus (e.g, fused to its C-terminus) can have an amino acid sequence set forth in SEQ ID NO: 295 (see, e.g., Example 2).
  • a nucleic acid encoding a Cas9 polypeptide having 4 SV40 NLSs at its N-terminus (e.g, fused to its N-terminus) and 2 SV40 NLSs at its C-terminus (e.g., fused to its C-terminus) can have a nucleotide sequence set forth in SEQ ID NO:296 (see, e.g., Example 2).
  • a RNP complex provided herein can include any appropriate RNA molecule.
  • RNA molecules that can includedae nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease include, without limitation, sgRNAs, dual -guide RNAs (dgRNAs), trans-activating CRISPR. RNAs (tracrRNAs), and synthetic CRISPR RNAs (crRNAs).
  • RNA molecule in a RNP complex can include any appropriate nucleic acid sequence that is complementary to a target sequence within a mHTT gene.
  • An RNA molecule in a RNP complex provided herein can be any appropriate length.
  • a nucleic acid sequence that is complementary to a target sequence within a mHTT gene can include from 15 nucleotides to 23 nucleotides.
  • a nucleic acid sequence that is complementary toa target sequence within a mHTT gene can include from 19 nucleotides to 21 nucleotides.
  • a nucleic acid sequence that is complementary to a target sequence within a mHTT gene can be complementary to (e.g., can be designed to target) any target sequence within a mHTT gene.
  • a nucleic acid sequence that is complementary to a target sequence within a mHTT gene can be a single stranded nucleic acid sequence.
  • a target sequence within a mHTT gene can be in any location within a mHTT gene.
  • a target sequence within a mHTT gene can include one or more trinucleotide repeat expansions (e.g., CAG trinucleotide repeat expansions) present ina mHTT gene.
  • a target sequence within a mHTT gene can be in an intron of the mHTT gene. In some cases, a target sequence within a mHTT gene can be in an exon of the mHTT gene (e.g., exon 1). Examples of target sequences within a mHTT gene include. without limitation, those sequences shown in Table 1.
  • Table 1 Target sequences within a mHTT gene.
  • a nucleic acid sequence that can encode a sequence that is complementary to a target sequence within a mHTT gene can be a variant of a sequence shown in Table 2.
  • a nucleic acid sequence that can encode a sequence that is complementary to a target sequence withina mHTTgene can comprise or consist essentially of a sequence shown in Table 2.
  • a nucleic acid sequence that can encode a sequence that is complementary to a target sequence within a mHTT gene can have one or more (e.g., one, two, three, four, five, or more) nucleotide deletions, insertions, substitutions, or combinations thereof provided that the variant can still encodea sequence that is complementary to a target sequence within a mHTT gene.
  • RNA molecule in a RNP complex can include any appropriate nucleic acid sequence that can bind the endonuclease (e.g., can act as a scaffold for the endonuclease).
  • nucleic acid sequence that can bind an endonuclease can be a naturally occurring nucleic acid sequence that can bind an endonuclease.
  • a nucleic acid sequence that can bind an endonuclease can be an artificial nucleic acid sequence that can bind an endonuclease.
  • a nucleic acid sequence that can bind an endonuclease can be a tracrRNA.
  • a non-limiting example of a nucleic acid sequence that can bind an endonuclease is (SEQ ID NO:301 ).
  • a nucleic acid sequence that can bind an endonuclease can be as described elsewhere (see, e.g., International Patent Application Publication No. WO 2019/036185 at, for example, paragraphs [00156]; and WO 2017/106569).
  • RNP complex e.g, a RNP complex including (a) an endonuclease having one or more NLSs and (b) a RNA. molecule including a nucleic, acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease) to a mammal.
  • a RNP complex including (a) an endonuclease having one or more NLSs and (b) a RNA. molecule including a nucleic, acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease
  • a RNP complex provided herein can be administered to one or more neurons (e.g., one or more neurons in a striatum and/or one or more neurons in a motor cortex) such as medium spiny neurons withian mammal,
  • a RNP complex provided herein can be injected directly into a striatum of a mammal.
  • a RNP complex provided herein can be injected directly into a motor cortex ofa mammal.
  • mammal e.g.a, human having Huntington’s disease
  • a single administration e.g, a single injection
  • RNP complexes including (a) an endonuclease having one or more NLSs and (b) a RNA molecule including a nucleic acid sequence that is complementary to a target sequence withina mHTT gene anda nucleic acid sequence that can bind the endonuclease).
  • a mammal e.g, a human having Huntington’s disease can be administered two or more (e.g, two, three, four, or more) administrations (e.g, injections) of one or more RNP complexes provided herein (e.g., RNP complexes including (a) an endonuclease having one or more NLSs and (b) a RNA molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease).
  • each one of the two or more administrations is administered on a separate day. In some cases, more than one of the two or more administrations are administered on the same day.
  • a RNP complex provided herein e.g., a RNP complex including (a) an endonuclease having one or more NLSs and (b) a RNA. molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease
  • a RNP complex including (a) an endonuclease having one or more NLSs and (b) a RNA. molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease
  • can inactivate one or more mHTT genes within a mammal e.g, within neurons in a mammal’s brain
  • an endonuclease in a RNP complex provided herein can cause a genetic modification in one or more mHTT genes within a mammal (e.g., within neurons in a mammal’s brain) that inactivates the mHTT gene(s).
  • a mammal e.g., within neurons in a mammal’s brain
  • an endonuclease in a RNP complex provided herein can insert and/or delete one or more nucleotides at the cut site in one or more mHTT genes within a mammal that can cause an inactivating frameshift mutation in the mHTT gene(s).
  • an endonuclease in a RNP complex provided herein can insert a single nucleotide (e.g., a single adenosine) at the cut site in one or more mHTT genes withina mammal to inactivate the mHTT gene(s).
  • a single nucleotide e.g., a single adenosine
  • an endonuclease in a RNP complex provided herein can insert and/or delete one or more nucleotides at the cut site in one or more mHTT genes within a mammal that can cause an inactivating premature stop (termination) codon in the mHTT gene(s).
  • one or more RNP complexes provided herein can be formulated, into a composition (e.g., a pharmaceutical composition) for administration to a mammal (e.g, a human).
  • a composition e.g., a pharmaceutical composition
  • one or more RNP complexes provided herein can be formulated into a pharmaceutically acceptable composition for administration to a mammal (e.g, a human) having Huntington’s disease.
  • one or more RNP complexes provided herein can be formulated together with one or more pharmaceutically acceptable carriers (additives), excipients, and/or diluents.
  • pharmaceutically acceptable carriers, excipients, and. diluents that can be used, in a composition described herein include, without limitation, saline (e.g., phosphate buffered saline (PBS)), sucrose, lactose, starch (e.g, starch glycolate), cellulose, cellulose derivatives (e.g., modified celluloses such as microcrystalline cellulose and cellulose ethers like hydroxypropyl cellulose (HPC) and cellulose ether hydroxypropyl methylcellulose (HPMC)), xylitol, sorbitol, mannitol, gelatin, polymers (e.g., polyvinylpyrrolidone (PVP), polyethylene glycol (PEG), crosslinked polyvinylpyrrolidone (crospovid)
  • a composition containing one or more RNP complexes provided herein (e.g., RNP complexes including (a) an endonuclease having one or more NLSs and (b) a RNA molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene anda nucleic acid sequence that, can bind the endonuclease) can be formulated into any appropriate dosage form.
  • RNP complexes including (a) an endonuclease having one or more NLSs and (b) a RNA molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene anda nucleic acid sequence that, can bind the endonuclease
  • dosage forms include solid, or liquid forms including, without limitation, gels, liquids, suspensions, solutions (e.g, sterile solutions), sustained-release formulations, and delayed- release formulations.
  • a composition containing one or more RNP complexes provided herein (e.g., RNP complexes including (a) an endonuclease having one or more NLSs and (b) a RNA molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease)
  • RNP complexes including (a) an endonuclease having one or more NLSs and (b) a RNA molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease
  • parenteral e.g, cortical, striatal, intercerebral vesicular, intra-thecal, lumbar, intraci sternal, intraveneous, and intramuscular
  • Compositions suitable for parenteral administration include aqueous and.
  • non-aqueous sterile injection solutions that can contain anti-oxidants, buffers, bacteriostats, and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
  • the formulations can be presented in unit-dose or multi-dose containers, for example, sealed ampules and vials, and may be stored in a freeze dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use.
  • Extemporaneous injection solutions and. suspensions may be prepared from sterile powders, granules, and tablets.
  • a composition containing one or more RNP complexes provided herein (e.g., RNP complexes including (a) an endonuclease having one or more NLSs and (b) a RNA molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene anda nucleic acid sequence that, can bind the endonuclease) can be administered locally or systemically.
  • a composition containing one or more RNP complexes provided herein can be administered locally by an intrastriatal injection to a mammal (e.g., a human).
  • composition containing one or more RNP complexes provided herein can be administered locally by an intracortical injection to a mammal (e.g, a human).
  • An effective amount (e.g., effective dose) of one or more RNP complexes provided herein can vary depending on the severity of the Huntington’s disease, the route of administration, the age and general health condition of the subject, excipient usage, the possibility of co- usage with other therapeutic treatments such as use of other agents, and/or the judgment of the treating physician.
  • An effective amount of a composition containing one or more RNP complexes provided herein (e.g., RNP complexes including (a) an endonuclease having one or more NLSs and (b) a RNA molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease) can be any amount that can treat the mammal without producing significant toxicity to the mammal.
  • RNP complexes including (a) an endonuclease having one or more NLSs and (b) a RNA molecule including a nucleic acid sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease
  • RNP complexes including (a) an endonuclease having one or more NLSs and (b) a RNA molecule including a nucleic acid sequence that is complementary
  • an effective amount of one or more RNP complexes provided herein can be from about 500 pmol (0.5 nM) to about 50 ⁇ M (50000 nM) (e.g., from about 0.5 nM: to about. 5000 nM, from about.
  • 0.5 nM to about 2500 nM from about 0.5 nM to about 1000 nM, from about 0.5 nM to about 750 nM, from about 0.5 nM to about 500 nM, from about 0.5 nM to about 250 nM, from about 0.5 nM to about 100 nM, from about 0.5 nM to about 50 nM, from about 0.5 nM to about 10 nM, from about 10 nM to about 50000 nM, from about 50 nM to about 50000 nM, from about 100 nM to about.
  • 50000 nM from about 500 nM to about 50000 nM, from about 750 nM to about 50000 nM, from about 1000 nM to about 50000 nM, from about 2500 nM to about 50000 nM, from about 5000 nM to about 50000 nM, from about.
  • the effective amount can remain constant or can be adjusted as a sliding scale or variable dose depending on the mammal’s response to treatment. Various factors can influence the actual effective amount used for a particular application. For example, the frequency of administration, duration of treatment, use of multiple treatment agents, route of administration, and severity of the Huntington’s disease may require an increase or decrease in the actual effective amount administered.
  • the frequency of administration of a composition containing one or more RNP complexes provided herein (e.g., RNP complexes including (a) an endonuclease having one or more NLSs and (b) a RNA molecule including a nucleic acid sequence that is complementary toa target sequence withina mHTT gene anda nucleic acid sequence that can bind the endonuclease) can be any frequency that can treat the Huntington’s disease without, producing significant toxicity to the mammal.
  • RNP complexes including (a) an endonuclease having one or more NLSs and (b) a RNA molecule including a nucleic acid sequence that is complementary toa target sequence withina mHTT gene anda nucleic acid sequence that can bind the endonuclease
  • the frequency of administration can be from about twice a day to about once a month, from one a day to about once every 2 months, once a month to about twicea year, from about twice a year to about, oncea year, from about once a year to about once every 5 years, or once in a lifetime.
  • the frequency of administration can remain constant or can be variable during the duration of treatment.
  • various factors can influence the actual frequency of administration used for a particular application.
  • the effective amount, duration of treatment, use of multiple treatment, agents, route of administration, and severity of the Huntington’s disease may require an increase or decrease in administration frequency.
  • An effective duration for administering a composition containing one or more RNP complexes provided herein (e.g, RNP complexes including (a) an endonuclease having one or more NLSs and (b) a R.NA molecule including a nucleic acid, sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease)
  • RNP complexes including (a) an endonuclease having one or more NLSs and (b) a R.NA molecule including a nucleic acid, sequence that is complementary to a target sequence within a mHTT gene and a nucleic acid sequence that can bind the endonuclease
  • the effective duration can vary from several days to several weeks, months, or years.
  • the effective duration for the treatment of Huntington’s disease can range in duration from about one year to about 10 years. Multiple factors can influence the actual effective duration used for a particular treatment.
  • the one or more RNP complexes provided herein can be used as the sole active agent used to treat a mammal having Huntington’s disease.
  • the methods and materials described herein can include one or more (e.g, one, two, three, four, five or more) additional therapeutic agents used to treat a mammal (e.g., a human) having Huntington’s disease.
  • a therapeutic agent used to treat Huntington’s disease can control movement.
  • a therapeutic agent used to treat Huntington’s disease can be an antipsychotic.
  • a therapeutic agent used to treat Huntington’s disease can an antidepressant.
  • therapeutic agent used to treat Huntington’s disease can be a mood-stabilizer. Examples of therapeutic agents used to treat Huntington’s disease that can be administered to a mammal having Huntington’s disease together with one or more RNP complexes provided herein include, without limitation, tetrabenazine (e.g., XENAZINE.
  • deutetrabenazine e.g., AUSTEDO ®
  • haloperidol e.g., HALDOL ®
  • fluphenazine risperidone
  • olanzapine e.g., ZYPREXA.TM
  • quetiapine e.g, SEROQUEL ®
  • amantadine e.g., GOCOVRI ® ER and OSMOLEX ® ER
  • levetiracetam e.g., KEPPRATM, ELEPSIATM XR, and SPRIT AM ®
  • clonazepam e.g., KLONOPIN ®
  • citalopram e.g., Celexa
  • escitalopram e.g., LEXAPRO ®
  • fluoxetine e.g., PROZAC ® ’ and SARAFEM ®
  • the one or more additional therapeutic agents can be administered together with one or more RNP complexes provided herein (e.g., in the same composition). In some cases, the one or more additional therapeutic agents can be administered independent of the one or more RNP complexes provided herein. When the one or more additional therapeutic agents are administered independent of the one or more RNP complexes provided, herein, the one or more RNP complexes provided herein can be administered first, and the one or more additional therapeutic agents administered second, or vice versa.
  • the methods and materials described herein can include subjecting a mammal having Huntington’s disease to one or more (e.g, one, two, three, four, five or more) additional treatments (e.g., therapeutic interventions) that are effective to treat Huntington’s disease.
  • additional treatments e.g., therapeutic interventions
  • additional treatments include, without limitation, psychotherapy, speech therapy, physical therapy, and/or occupational therapy.
  • the one or more additional treatments that are effective to treat Huntington’s disease can be performed at the same time as the administration of the one or more RNP complexes provided herein.
  • the one or more additional treatments that are effective to treat Huntington’s disease can be performed before and/or after the administration of the one or more RNP complexes provided herein.
  • This Example describes the programming of a cell penetrating Cas9 ribonucleoprotein, 4xNLS-RNP, to inactivate the mHTT gene.
  • Targeted surgical delivery of 4xNLS-RNP into the cortico-striatal neural circuits affected in HD created a sufficient number of genetically rescued ceils such that HD progression can be slowed or halted.
  • sgRNA activity in RNPs delivered to neural progenitor cells isolated from BACHD mice was screened ( Figure 1A and. Figure 5).
  • BACHD NPCs were nucleofected. with the Cas9 RNPs and genomic DNA was isolated. Sanger sequencing and TIDE analysis were performed to analyze the indei spectrum of the RNP treated BACHD NPC cells ( Figure 1B). These sgRNA target the human mHTT gene and not the mouse gene and are therefore mHTT specific in the mouse.
  • B3 sgRNA targeted 5’ of the expanded polyglutamine sequence in exon1.
  • TIDE analysis confirmed the presence of a consistent +1 Adenosine insertion that generates a frameshift and premature termination codon downstream of the cut site in the HTT gene ( Figure 1C and 1D).
  • Figure 6B & 6C A 75% reduction in both human mHTT mRNA and mHTT protein levels was observed ( Figure 6B & 6C).
  • the B3 RNP was used for all subsequent BACHD experiments.
  • the guide RNA was stabilized, by introducing 2’-O methyl modifications and phosphorothioate endcaps at the 5’ and 3’ ends (Synthego).
  • This sgRNA modification when tested in a RNP targeting tdTomato, showed increased, editing efficiencies in NPCs in vitro relative to IVT sgRNAs ( Figure 9). Based on these data., the modified sgRNA was used in in vivo experiments with BACHD mice.
  • BACHD mice were intrastriatally injected with B3 RNP.
  • the dose was optimized in BACHD mice with the B3 RNP ( Figure 10).
  • the 100 ⁇ M dose at 5 ⁇ L was well tolerated, and did not lower levels of wild type mouse htt protein levels.
  • soluble mHTT protein following RNP CED was assessed at one month post treatment by the meso-scale discovery (MSD) detection platform.
  • MSD meso-scale discovery
  • BACHD animals already exhibit impaired motor coordination compared to wild type mice (before treatment the latency to fall of all BACHD mice is 183.3 ⁇ 6.1 s and wild type animals is 108.5 ⁇ 0.0 s, p ⁇ 0.0001). Following injection, there was a significant motor coordination improvement on the rotarod. test in BACHD-B3 RNP treated animals compared to BACHD-NT RNP treated animals which persisted ( Figure 2C).
  • BACHD mice have significant weight gain compared to wild type mice due to overexpression of mHTT and wild type htt (Van Raamsdonk et al., Hum. Mol. Genet., 15: 1513-23 (2006)). No significant differences in weight between BACHD-NT and BACHD-B3 animals were found, suggesting the improvement in motor phenotype was not the result of a change in weight.
  • mice were sacrificed, and the motor cortex and striatum were harvested for NGS and western blot analysis of mHTT.
  • Decreased levels of mHTT were found in the striatum of BACHD-B3 animals which correlated with percentage of indels (Figure 2F).
  • the Q175 mouse has robust and well characterized HD transcriptional changes and mHTT nuclear aggregates in medium spiny neurons in the striatum but a modest motor phenotype.
  • the effect of the RNP administration on these functional readouts that are linked to the pathogenesis of HD was assayed.
  • Nanostring analysis of the 200 most changed genes in the striatum was performed.
  • mHTT nuclear aggregates that robustly form in the striatum medium spiny neurons (MSNs) of zQ175 mice by 6 months old can be visualized by EM48 immunolabeling. mHTT nuclear aggregates area hallmark of HI) in human neurons.
  • an RNP complex including (a) a Cas9 polypeptide including one or more NLSs, and (b) a sgRNA including a nucleic acid sequence that is complementary toa target sequence withina mHTT gene and a nucleic acid sequence that can bind the endonuclease can be used to permanently lower levels of mHTT polypeptides present within a mammal to slow' or prevent HD progression in the mammal.
  • BACHD Stock No: 008197
  • zQ175 Stock No: 027410 mice
  • mice were obtained from The Jackson Laboratory.
  • zQ 175/W T; tdTOM/tdTOM mice were bred in house at the University of California, Berkeley. All mice were maintained on a 12 hour light/dark cycle with food and water available ad libitum. Mice were gender matched for all experiments except for experiments using BACHD mice, where only females were used.
  • All animals were group-housed and experiments were conducted in strict adherence to the University of California, Berkeley’s Animal Care and Use Committee (ACUC) ethical regulations. All animals were group-housed. and experiments were conducted in strict adherence to the Swiss federal ordinance on animal protection and welfare as well as according to the rules of the Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC), and with the explicit, approval of the local veterinary authorities.
  • AAA Animal Care and Use Committee
  • NPC Neural progenitor cell
  • NPCs were isolated from the cortices of embryonic day 13.5 BACHD hemizygous and. zQ175 heterozygous mouse embryos. Cells were cultured as described elsewhere (see, e.g., Staahl el al., Nat. BiotechnoL, 35:431-434 (2017)).
  • sgRNA target site prediction sgRNA. target site prediction.
  • sgRNA target sequences were selected using the website crispr.mit.edu.
  • the DNA template encoding: T7 promoter, a 20-nt target sequence and an optimized sgRNA scaffold28 was assembled from synthetic oligonucleotides (Integrated DNA Technologies, San Diego, CA) by overlapping PCR.
  • Target sequences for sgRNA-BACHD and sgRNA-Q175 are listed in Figure 5 and Figure 9, sgRNA-non-targeting aka sgRNA339 (targets Gal4 sequence that is not present in mouse genome), 5'- AACGACTAGTTAGGCGTGTA-3' (SEQ ID NO: 297), sgRNA-tdTom aka.
  • sgRNA298 targets STOP cassette in tdTomato locus), 5 -AAGTAAAACCTCTACAAATG-3' (SEQ ID NO:298).
  • the in vitro T7 transcription of sgRNA was as described elsewhere (see, e.g., Staahl et al., Nat. Biotechnol., 35:431-434 (2017)).
  • Chemical iy modified synthetic sgRNAs were obtained from Synthego for the following target sequences: sgRNA-BACHD-B3, sgRNA-BACHD-B10, sgRNA-Q175-Q2, sgRNA-non-targeting aka sgRNA339, sgRNA- tdTom aka sgRNA298.
  • NPC neurospheres were dissociated by the MACS Neural Dissociation Kit (Papain) cat# 130-092-628, spun down by centrifugation at 80xg for 3 minutes, and washed once in 5 mL dPBS-Ca,-Mg. The cells were suspended in P3 buffer at 1 x 10 6 cells/20 ⁇ L. 4 ⁇ NLS- Cas9-2 ⁇ NLS RNPs were prepared as described elsewhere (see, e.g, Staahl et al, Nat. Biotechnol., 35:431-434 (2017)).
  • Nucleofection of NPCs with 4 ⁇ NLS-Cas9-2 ⁇ NLS RNPs was performed using Lonza (Allendale, NJ) P3 cell kits and program EH-100 in an Amaxa 96-well Shuttle system. Each nucleofection reaction consisted of 20 ⁇ L of cells mixed with 10 ⁇ L, RNP. After nucleofection, 70 ⁇ L of growth medium was added to the well to transfer the cells to 10 cm tissue culture plates. For genomic DNA analysis the media was removed by aspiration, and 100 ⁇ L of Quick Extraction solution (Epicentre, Madison, WI) was added to lyse the cells (65° C for 20 minutes and then 95° C for 20 minutes) and extract the genomic DNA. The concentration of genomic DNA was determined, by NanoDrop. The cell ly sate was stored at -20° C.
  • TIDE provides a means to analyze the indels that occur as the result of cleavage by Cas9 througah comparison of individual Sanger Sequencing electropherogram reads.
  • DNA to be analyzed was amplified by PCR, then submitted for PCR clean-up and Sanger Sequencing. The control, test sequences, and target sequence were inputted and analyzed using the default settings. Data from the +1 insertion site was used for the analysis.
  • TIDE Tracking of Indels by Decomposition tide.deskgen.com/.
  • 4 ⁇ NLS-Cas9-2 ⁇ NLS RNPs were prepared.
  • Adult BACHD, zQ175/WT or zQ175/WT; tdTOM/tdTOM mice were anesthetized using isoflurane. The anesthetized mouse was aligned on an Angle two stereotactic frame (Leica, Germany) and craniotomies were performed with minimal damage to brain tissue. All stereotaxic coordinates are relative to bregma.
  • Mouse stereotaxic surgery targets anterior striatum ( +0.14 mm anteroposterior, ⁇ 2.4 mm mediolateraL -4, -3.5 mm dorsoventral), striatum (+0.74 mm anteroposterior, ⁇ 1 .74 mm mediolateraL -3.37 mm dorsoventral), posterior striatum (-.58 mm anteroposterior, ⁇ 2.9 mm mediolateraL -2.94 mm dorsoventral) and cortex M2 (+2.44 mm anteroposterior, ⁇ 1 .4 mm mediolateraL -1.4 mm dorsoventral).
  • mice received 0.5 ⁇ L bilateral injection in the motor cortex and 1 ⁇ L bilateral multi point striatal injections as detailed above of 100 ⁇ M RNP using a 10 ⁇ L or 25 ⁇ L Hamilton syringe with a 30-gauge stainless steel blunt ended needle.
  • a step cannula was prepared as described elsewhere (see, e.g., Nash et al. , Methods Mol. Biol., 1382:285-295 (2016)).
  • Mice received 5 ⁇ L of 100 ⁇ M RNP into the striatum and 0.5 ⁇ L of 100 ⁇ M RNP into the motor cortex at a flow rate of 0.5 ⁇ L/minutes.
  • the injector was left at the injection site for 2 minutes and then slowly withdrawn. After the injections, the operation field was cleaned with sterile 0.9% NaCl and closed with suture (BIOSYN SYNTHETIC ABSORBABLE SUTURE (SM791) / 4-0 / C-13 / 30 IN) and surgical glue (3M Vetbond Tissue Adhesive). The mouse was kept warm at 37° C during the surgical procedure and also post-surgery. To avoid dryring of the eyes during surgery, an ointment was applied outside of the eyes of the mouse. Analgesics were administered subcutaneously at the time of isoflurane induction and 24 hours after injection. Mice were monitored for up to one week post-operatively.
  • mice were tested over 3 consecutive days at 4-6 week intervals. Each daily session included a single training run of 5 minutes at 5 rpm on the rotarod. apparatus (Ugo Basile). One hour later, the animals were tested for 3 consecutive accelerating (5-40 rpm over 5 minutes) trials, with an inter-trial interval of at least 30 minutes. The latency to fall from the rod was recorded for each trial, with mice remaining on the rod for more than 300 seconds removed and scored at 300 seconds. Mice that underwent two consecutive 360 degree passive rotations about the rod in the period of 10 seconds were removed from the rod and their time at first passive rotation recorded. An individual mouse’s performance each testing interval consisted of the average of all 9 trials. Researcher was blinded to the treatment group of individual mouse during testing.
  • Protein samples (20 ⁇ g) were denatured and separated by 4-15% Tris-HCl SDS-PAGE Criterion gels for 20 minutes at 110V and 1 hour 40 minutes at 200V. After electrophoresis, the protein was transferred from the gel onto Immobilon PVDF membrane (Merck, Cat # IPFL00010, pore size 0.45 um) at 30 V, 4° C overnight. After blocking in 0.5% casein in PBS-T for 1 hour, RT, primary antibodies were incubated O/N at 4° C onto the western blot membrane. The following primary antibodies were used: Anti-Huntingtin Protein Antibody aa 181-810 (Millipore MAB2166; 1.1000), Anti-Polyglutamine Expansion.
  • Striatum tissue was dissected and after RIP .A lysis, genomic DNA was extracted from the chromatin pellet.
  • the genomic region flanking the CRISPR target site was amplified by two-step PCR method using primers listed in Table 3.
  • the resulting amplicons were purified by AMPure beads to remove primers and subjected to five cycles of PCR to attach Illumina P5 adapters as well as unique sample-specific barcodes followed by bead purification. Berkeley Sequencing facility performed the AMPure bead cleanup.
  • the 300 bp reads were trimmed to first 70 bp from the 3' end (the length from the 5' primer to the start of the poly-Q). This leaves the B3 cut site 17 bp from the 3‘ end of the read. Reads are aligned to a 70 bp reference sequence and are required to match 65% of the read and have less than 6 point mutations. If an indel is seen within 3 bp 5' of the cut site or 14 bp 3‘ of the cut site, it is classified as an NHEJ read. The extended window to the 3' side allows for misalignment caused by indels extending into the poly-Q region. Total NHEJ reads are then divided by the total number of aligned reads to get percent NHEJ .
  • Genomic DNA sample was first treated with phosphatase to remove 5 ’-end phosphorylation and reduce the number of background sequencing templates being produced at the adapter ligation step.
  • Dephosphorylated genomic DNA was then digested with CRISPR-Cas9 nuclease complexed with a pair of guide RNA to excise the target region (crRNA sequences CTTATTAACAGCAGAGAACT (SEQ ID NO:299) and TAAACTTTGAAGACGAGACA (SEQ ID NO:300)).
  • hairpin adapters are Ligated to the digested DNA fragments to form the SMRTbell sequencing templates.
  • Final sequencing library was treated with a nuclease cocktail to remove non-circular background DNA molecules. Details of the No- Amp targeted sequencing library preparation could, be found on the PacBio website (pacb.com/NoAmp). Sequencing data, was generated using Sequel instrument and SMRTlink software.
  • MSD assay buffer 1 Tris lysis buffer (Meso Scale Discovery), Phosphatase inhibitor II 1006 stock (Sigma), Phosphatase inhibitor III 1006stock (Sigma), PMSF 2 mM, protease inhibitors (Complete, EDTA-free; Roche Diagnostics), 10 mM NaF) as described elsewhere (see, e.g., Macdonald et al., PLoS One 9:e96854 (2014)).
  • mice were perfused with ice-cold PBS. Brains were harvested and cut into 1 mm sections using a brain slicer matrix around the injection site. The slices were transferred to ice-cold PBS and then onto frozen glass slides. The dorsal injected striatum (1 mm thick x 1-1.25 mm wide x 2 mm long) was cut out and frozen on dry ice. One milliliter of TRIzol reagent (Invitrogen) was added to 5 mg tissue triturated to dissociate tissue and isolate 100 ng RNA far NanoString.
  • TRIzol reagent Invitrogen
  • the NanoString analysis was performed at Center for Advanced Technology (CAT) at UCSF using a custom CodeSet designed to interrogate 200 transcripts previously implicated in transcriptional changes in the striatum zQ175 mice (William Yang, UCLA.).
  • the signal intensity of individual genes was normalized by adjusting to internal positive standards within each sample.
  • Eight housekeeping genes were included in the CodeSet: B2m, Gapdh, Gush, Ldha, Tfrc, and Tuftn.
  • the expression levels for each probe withina sample were scaled using the geometric mean of the six housekeeping genes for each sample. Each mouse was an individual sample as tissue did not need to be pooled.
  • mice were perfused with 4% paraformaldehyde and brains were post-fixed, overnight. Brains were sectioned (coronal plane sections) on a vibratome and 50 ⁇ m thick sections were used to detect tdTomato fluorescence. Sections were first treated with blocking solution (0.3% Triton X-100, 5% goat serum, 2%BSA in 1 x PBS) and incubated with the with the following primary antibodies: Anti-Huntingtin Protein Antibody mEM48 (Millipore MAB5374; 1 :400) and DARPP-32 (Ceil Signalling 2306; 1 :400).
  • blocking solution 0.3% Triton X-100, 5% goat serum, 2%BSA in 1 x PBS
  • GFAP GFAP
  • IBA-1 Wako 019-19741 , 1 : 1000
  • Primary antibodies were incubated in 50% blacking solution in IxPBS overnight at 4° C. Sections were washed with 3 ⁇ PBS and incubated with the following secondary antibodies at room temperature for 1 hour: goat anti-rabbit Alexa Fluor 488 and goat anti-mouse Alexa Fluor 647. Finally, sections were washed three times in lx PBS, stained with the DNA binding fluorescence probe DAPI (1 ⁇ g/mi, Roche Life Science, Switzerland), and mounted onto Superfrost plus slides with Fluoromount-G mounting medium. Confocal fluorescent images at 20x were acquired usinag Zeiss LSM 880 with Airyscan.
  • Fiji image analysis software was used to perform the aggregate analysis.
  • Segmentation of tdTom+ cells was done by performing maximum intensity projections on the z stacks and an adaptive local threshold to the tdTom channel. Regions of interest (ROIs) were generated for each dataset using Fiji’s analyze particle function on the processed data. ROIs were generated for the tdTom+ cells and overlaid onto the DAPI channel for ROI selection. TdTom + cells colocalizing with DAPI were quantified for total aggregate counts and fluorescence intensity.
  • ROIs Regions of interest
  • segmentation of aggregates colocalizing with tdTom+ cells was done by overlaying the tdTom + ROIs on the maximum intensity projections of the EM48 z stacks and applying a global threshold within each tdTom+ ROI. Aggregate ROIs were generated and counted for each tdTom+ cell. To get total aggregate fluorescence, aggregate ROIs were overlaid onto sum projections of the EM48 z stacks and measured using Fiji's measure tool.
  • total aggregate fluorescence integrated density - (area, of aggregate * background)
  • the average total aggregate fluorescence intensity was averaged across each dataset and then across each animal.
  • a custom Fiji script was written to automate this protocol and manual quality control was performed to ensure quality of the analysis. The experimenter was blinded to the treatment, conditions while performing quantitation.
  • An exemplary nucleic acid sequence that can encode a Cas9 polypeptide having 4 NLSs fused to itsN -terminus and having 2 NLSs fused to its C -terminus
  • Example 3 Exemplary Embodiments
  • Embodiment 1 A ribonucleoprotein (RNP) complex comprising:
  • RNA ribonucleic acid
  • Embodiment 2 The RNP complex of claim 1, wherein said endonuclease is a CRISPR associated protein (Cas) polypeptide.
  • Cas CRISPR associated protein
  • Embodiment 3 The RNP complex of claim 2, wherein said Cas polypeptide is selected from the group consisting of a Cas9 polypeptide, a Cas12a polypeptide, a Cas 13 polypeptide, and a Cas12c polypeptide.
  • Embodiment 4 The RNP complex of any one of claims 1-3, wherein said endonuclease comprises from 1 NLS to 7 NLSs fused to the N-terminus of said endonuclease and comprises from 1 NLS to 7 NLSs fused to the C -terminus of said endonuclease.
  • Embodiment 5 The RNP complex of claim 4, wherein said endonuclease comprises 4
  • Embodiment 6 The RNP complex of claim 5, wherein each NLS is a Simian virus 40
  • Embodiment 7 The RNP complex of claim 6, wherein said endonuclease further comprises a peptide linker separating each NLS.
  • Embodiment 8 The RNP complex of claim 7, wherein said peptide linker comprises a GGS amino acid sequence.
  • Embodiment 10 The RNP complex of claim 9, wherein said nucleic acid sequence that is complementary to said target sequence within said mHTT gene comprises from 19 nucleotides to 21 nucleotides.
  • Embodiment 11 The RNP complex of any one of claims 1-10, wherein said nucleic acid sequence that is complementary to said target sequence within said mHTT gene comprises a nucleic acid sequence set forth in any one of SEQ ID NOs:20-25 and 230-294.
  • Embodiment 12 The RNP complex of any one of claims 1-11, wherein said target, sequence within said mHTT gene comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 26-229.
  • Embodiment 13 The RNP complex of any one of claims 1-12, wherein said nucleic acid sequence that can bind said endonuclease compriseas nucleic acid sequence set forth in SEQ ID NO:301.
  • Embodiment 14 A gene editing system for treating Huntington’s disease (HD), wherein said gene editing system comprises:
  • RNA molecule comprising (i) a nucleic acid sequence that is complementary to a target sequence within a mHI' 'T gene, and (ii)a nucleic acid sequence that can bind said endonuclease or a nucleic acid molecule encoding said RNA molecule.
  • RNA molecule comprising (i) a nucleic acid sequence that is complementary to a target sequence within a mHI' 'T gene, and (ii)a nucleic acid sequence that can bind said endonuclease or a nucleic acid molecule encoding said RNA molecule.
  • Embodiment 15 The gene editing system of claim 14, wherein said gene editing system comprises said endonuclease.
  • Embodiment 16 The gene editing system of claim 14, wherein said gene editing system comprises said nucleic acid molecule encoding said endonuclease.
  • Embodiment 17 The gene editing system of any one of claims 14-16, wherein said gene editing system comprises said RNA molecule.
  • Embodiment 18 The gene editing system of any one of claims 14-16, wherein said gene editing system comprises said nucleic acid sequence encoding said RNA molecule.
  • Embodiment 19 The gene editing system of any one of claims 14-18, wherein said endonuclease is a Cas polypeptide.
  • Embodiment 20 The gene editing system of claim 19, wherein said.
  • Cas polypeptide is selected from the group consisting of a Cas9 polypeptide, a Cas12a polypeptide, a Cas13 polypeptide, and a Cas12c polypeptide.
  • Embodiment 21 The gene editing system of any one of claims 14-20, wherein said endonuclease comprises from 1 NLS to 7 NLSs fused to the N-terminus of said endonuclease and comprises from 1 NLS to 7 NLSs fused to the C-terminus of said endonuclease.
  • Embodiment 22 The gene editing system of claim 21, wherein said endonuclease comprises 4 NLSs fused to the N-terminus of said endonuclease and comprises 2 NLSs fused to the C-terminus of said endonuclease.
  • Embodiment 23 The gene editing system of claim 22, wherein each NLS is a SV40
  • Embodiment 24 The gene editing system of claim 23, wherein said endonuclease further comprises a peptide linker separating each NLS.
  • Embodiment 25 The gene editing system of claim 24, w'herein said peptide linker comprises a GGS amino acid sequence.
  • Embodiment 26 The gene editing system of any one of claims 14-25, wherein said nucleic acid sequence that is complementary to said target sequence within said mHTT gene comprises from 15 nucleotides to 23 nucleotides.
  • Embodiment 27 The gene editing system of claim 26, wherein said nucleic acid sequence that is complementary to said target sequence within said mHTT gene comprises from 19 nucleotides to 21 nucleotides.
  • Embodiment 28 The gene editing system of any one of claims 14-27, wherein said nucleic acid, sequence that is complementary to said target sequence within said.
  • mHTT gene comprisaes nucleic acid sequence set forth in any one of SEQ ID NOs:20-25 and 230-294.
  • Embodiment 29 The gene editing system of any one of claims 14-28, wherein said target sequence within said mHTT gene comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 26-229.
  • Embodiment 30 The gene editing system of any one of claims 14-29, wherein said nucleic acid sequence that can bind said endonuclease compriseas nucleic acid sequence set forth in SEQ ID NO:301.
  • Embodiment 31 A method for treating HD, wherein said method comprises: administering to a mammal an R.NP complex comprising:
  • an endonuclease comprising: 1) from 1 NLS to 7 NLSs fused to the N-terminus of said endonuclease, and/or
  • RNA molecule comprising (i) a nucleic acid sequence that is complementary' to a target sequence within a mHTT gene, and (ii)a nucleic acid sequence that can bind said endonuclease.
  • Embodiment 32 The method of claim 31, wherein said mammal is a human.
  • Embodiment 33 The method of any one of claims 31-32, wherein said administering comprises administering said RNP complex to neurons within said mammal.
  • Embodiment 34 The method of claim 33, wherein said neurons are present in a striatum of said mammal.
  • Embodiment 35 The method of claim 33, wherein said neurons are present in a motor cortex of said mammal.
  • Embodiment 36 The method of claim 33, wherein said neurons comprise medium spiny neurons.
  • Embodiment 37 The method of any one of claims 31-36, wherein said endonuclease is a Cas polypeptide.
  • Embodiment 38 The method of any one of claims 31-37, wherein said Cas polypeptide is selected from the group consisting of a Cas9 polypeptidae, Cas12a polypeptidae, Cas13 polypeptide, and a Cas12c polypeptide.
  • Embodiment 39 The method of any one of claims 31-38, wherein said endonuclease comprises from 1 NLS to 7 NLSs fused to the N-terminus of said endonuclease and comprises from 1 NLS to 7 NLSs fused to the C-terminus of said endonuclease.
  • Embodiment 40 The method of claim 39, wherein said endonuclease comprises 4 NLSs fused to the N-terminus of said endonuclease and comprises 2 NLSs fused to the C-terminus of said endonuclease.
  • Embodiment 41 The method of claim 40, wherein each NLS is a SV40 NLS.
  • Embodiment. 42 The method of claim 41, wherein said endonuclease further comprises a peptide linker separating each NLS.
  • Embodiment 43 The method of claim 42, wherein said peptide linker comprises a GGS amino acid sequence.
  • Embodiment 44 The method of any one of claims 31-43, wherein said nucleic acid sequence that is complementary to said target sequence within said mHTTgene comprises from 15 nucleotides to 23 nucleotides.
  • Embodiment 45 The method of claim 44, wherein said nucleic acid sequence that is complementary to said target sequence within said mHTT gene comprises from 19 nucleotides to 21 nucleotides.
  • Embodiment. 46 The method of any one of claims 31-45, wherein said nucleic acid sequence that is complementary to said, target sequence within said mllTT gene comprises a nucleic acid sequence set forth in any one of SEQ ID NOs:20-25 and 230-294.
  • Embodiment 47 The method of any one of claims 31-46, wherein said target sequence within said mHTT gene comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 26-229.
  • Embodiment 48 The method of any one of claims 31-47, wherein said nucleic acid sequence that can bind said endonuclease comprises a nucleic acid sequence set forth in SEQ ID NO:301.
  • Embodiment 49 The method of any one of claims 31-48, wherein said administration comprises a direct injection into said striatum.
  • Embodiment 50 The method of any one of claims 31-48, wherein said administration comprises a direct injection into said motor cortex.
  • Embodiment 51 The method of any one of claims 31-50, wherein said method comprises, prior to said administering step, identifying said mammal as having HD.
  • Embodiment 52 A method for improvinga motor function in a mammal having HD, wherein said method comprises: administering to a mammal an R.NP complex comprising:
  • RNA molecule comprising (i) a nucleic acid sequence that is complementary to a target sequence within a mHTT gene, and (ii) a nucleic acid sequence that can bind said endonuclease.
  • RNA molecule comprising (i) a nucleic acid sequence that is complementary to a target sequence within a mHTT gene, and (ii) a nucleic acid sequence that can bind said endonuclease.
  • said motor function is selected, from the group consisting of tremors, seizures, chorea, dystonia, dyskinesia, slow or abnormal eye movements, impaired gait, impaired posture, impaired balance, difficulty with speech, difficulty with swallowing, difficulty organizing, difficulty prioritizing, difficulty focusing on tasks, lack of flexibility, lack of impulse control outbursts, lack of awareness of one's own behaviors and/or abilities, slowness in processing thoughts, difficulty in learning new information, depression, irritability, sadness or apathy, social withdrawal insomnia, fatigue, lack of energy, obsessive-compulsive disorder, mania, bipolar disorder, and weight loss.
  • Embodiment 54 The method of any one of claims 52-53, wherein said mammal is a human.
  • Embodiment 55 The method of any one of claims 52-54, wherein said administering comprises administering said RNP complex to neurons within said mammal.
  • Embodiment 56 The method of claim 55, wherein said neurons are present in a striatum of said mammal.
  • Embodiment 57 The method of claim 55, wherein said neurons are present in a motor cortex of said mammal.
  • Embodiment 58 The method of claim 55, wherein said neurons comprise medium spiny neurons.
  • Embodiment 59 The method of any one of claims 52-58, wherein said endonuclease is a Cas polypeptide.
  • Embodiment 60 The method of any one of claims 52-59, wherein said Cas polypeptide is selected from the group consisting of a Cas9 polypeptide, a Cas12a polypeptide, a Cas13 polypeptide, and a Cas12c polypeptide.
  • Embodiment 61 The method of any one of claims 52-60, wherein said endonuclease comprises from 1 NLS to 7 NLSs fused to the N-terminus of said endonuclease and comprises from 1 NLS to 7 NLSs fused to the C-terminus of said endonuclease.
  • Embodiment 62 The method of claim 61, wherein said endonuclease comprises 4 NLSs fused to the N-terminus of said endonuclease and comprises 2 NLSs fused to the C-terminus of said endonuclease.
  • Embodiment 63 The method of claim 62, wherein each NLS is a SV40 NLS.
  • Embodiment 64 The method of claim 63, wherein said endonuclease further comprises a peptide linker separating each NLS.
  • Embodiment 65 The method of claim 64, wherein said peptide linker comprises a GGS amino acid sequence.
  • Embodiment 66 The method of any one of claims 52-65, wherein said nucleic acid sequence that is complementary to said target sequence within said. mHTT gene comprises from 15 nucleotides to 23 nucleotides.
  • Embodiment 67 The method of claim 66, wherein said nucleic acid sequence that is complementary to said target sequence within said mHTT gene comprises from 19 nucleotides to 21 nucleotides.
  • Embodiment 68 The method of any one of claims 52-67, wherein said nucleic acid sequence that is complementary to said target sequence within said mHTT gene comprises a nucleic acid sequence set forth in any one of SEQ ID NOs:20-25 and 230-294.
  • Embodiment 69 The method of any one of claims 52-68, wherein said target sequence within said mHTT gene comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 26-229.
  • Embodiment 70 The method of any one of claims 52-69, wherein said nucleic acid sequence that can bind said endonuclease comprises a nucleic acid sequence set forth in SEQ ID NO:301.
  • Embodiment 71 The method of any one of claims 52-70, wherein said administration comprises a direct injection into said striatum.
  • Embodiment 72 The method of any one of claims 52-70, wherein said administration comprises a direct injection into said motor cortex.
  • Embodiment 73 The method of any one of claims 52-72, wherein said method comprises, prior to said administering step, identifying said mammal as having HD.
  • Embodiment 74 A method for improving life expectancy of a mammal having HI), wherein said method comprises: administering to a mammal an R.NP complex comprising:
  • RNA molecule comprising (i) a nucleic acid sequence that is complementary to a target sequence within a mHTT gene, and (ii) a nucleic acid sequence that can bind said endonuclease.
  • RNA molecule comprising (i) a nucleic acid sequence that is complementary to a target sequence within a mHTT gene, and (ii) a nucleic acid sequence that can bind said endonuclease.
  • Embodiment 76 The method of any one of claims 74-75, wherein said mammal is a human.
  • Embodiment /7 The method of any one of claims 74-32, wherein said administering comprises administering said RNP complex to neurons within said mammal.
  • Embodiment 78 The method of claim 77, wherein said neurons are present in a striatum of said mammal.
  • Embodiment 79 The method of claim 77, wherein said neurons are present in a motor cortex of said mammal.
  • Embodiment 80 The method of claim 77, wherein said neurons comprise medium spiny neurons.
  • Embodiment 81 The method of any one of claims 74-80, wherein said endonuclease is a Cas polypeptide.
  • Embodiment 82 The method of any one of claims 74-81, wherein said Cas polypeptide is selected from the group consisting of a Cas9 polypeptide, a Cas12a polypeptide, a Cas13 polypeptide, and a Cas12c polypeptide.
  • Embodiment 83 The method of any one of claims 74-82, wherein said endonuclease comprises from 1 NLS to 7 NLSs fused to the N -terminus of said endonuclease and comprises from 1 NLS to 7 NLSs fused to the C -terminus of said endonuclease.
  • Embodiment 84 The method of claim 83, wherein said endonuclease comprises 4 NLSs fused to the N-terminus of said endonuclease and comprises 2 NLSs fused to the C -terminus of said endonuclease.
  • Embodiment 85 The method of claim 84, wherein each NLS is a SV40 NLS.
  • Embodiment 86 The method of claim 85, wherein said endonuclease further comprises a peptide linker separating each NLS.
  • Embodiment 87 The method of claim 862, wherein said peptide linker comprises a GGS amino acid sequence.
  • Embodiment 88 The method of any one of claims 74-87, wherein said nucleic acid sequence that is complementary to said target sequence within said mHTT gene comprises from 15 nucleotides to 23 nucleotides.
  • Embodiment 89 The method of claim 88, wherein said nucleic acid sequence that is complementary to said target sequence within said mHTT gene comprises from 19 nucleotides to 21 nucleotides.
  • Embodiment 90 The method of any one of claims 74-89, wherein said nucleic acid sequence that is complementary to said target sequence within said mHTT gene comprises a nucleic acid sequence set forth in any one of SEQ ID NOs:20-25 and 230-294.
  • Embodiment 91 The method of any one of claims 74-90, wherein said target sequence within said mHTT gene comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 26-229.
  • Embodiment 92 The method of any one of claims 74-91, wherein said nucleic acid. sequence that can bind said endonuclease comprises a nucleic acid sequence set forth in SEQ ID NO:301.
  • Embodiment 93 The method of any one of claims 74-92, wherein said administration comprises a direct injection into said striatum.
  • Embodiment 94 The method of any one of claims 74-92, wherein said administration comprisesa direct injection into said motor cortex.
  • Embodiment 95 The method of any one of claims 74-94, wherein said method comprises, prior to said administering step, identifying said mammal as having HD.
  • Embodiment 96 A method for reducing nuclear mHTT polypeptide aggregates in a mammal having HD, wherein said method comprises: administering to a mammal an RNP complex comprising:
  • RNA molecule comprising (i) a nucleic acid sequence that is complementary to a target sequence within a mHTT gene, and (ii ) a nucleic acid sequence that can bind said endonuclease.
  • Embodiment 97 The method of claim 96, wherein said method is effective reduce the number of said mHTT polypeptide aggregates.
  • Embodiment 98 The method of claim 96, wherein said method is effective reduce the size of said mHTT polypeptide aggregates.
  • Embodiment 99 The method of any one of claims 96-98, wherein said mammal is a human.
  • Embodiment 100 The method of any one of claims 96-99, wherein said administering comprises administering said RNP complex to neurons within said mammal.
  • Embodiment 101 The method of claim 100, wherein said neurons are present in a striatum of said mammal.
  • Embodiment 102 The method of claim 100, wherein said neurons are present ina motor cortex of said mammal
  • Embodiment 103 The method of claim 100, wherein said neurons comprise medium spiny neurons.
  • Embodiment 104 The method of any one of claims 96-103, wherein said, endonuclease isa Cas polypeptide.
  • Embodiment 105 The method of any one of claims 96-104, wherein said Cas polypeptide is selected from the group consisting of a Cas9 polypeptide, a Cas12a polypeptide, a Cas13 polypeptide, and a Cas12c polypeptide.
  • Embodiment 106 The method of any one of claims 96-105, wherein said endonuclease comprises from 1 NLS to 7 NLSs fused to the N-terminus of said endonuclease and comprises from 1 NLS to 7 NLSs fused, to the C -terminus of said endonuclease.
  • Embodiment 107 The method of claim 106, wherein said endonuclease comprises 4
  • Embodiment 109 The method of claim 108, wherein said endonuclease further comprises a peptide linker separating each NLS.
  • Embodiment 1 10. The method of claim 109, wherein said peptide linker comprises a GGS amino acid sequence.
  • Embodiment 111 The method of any one of claims 96-110, wherein said nucleic acid sequence that is complementary to said target sequence within said mHTT gene comprises from 15 nucleotides to 23 nucleotides.
  • Embodiment 112. The method of claim 111 , wherein said nucleic acid sequence that is complementary to said target sequence within said mHTT gene comprises from 19 nucleotides to 21 nucleotides.
  • Embodiment 113 The method of any one of claims 96-112, wherein said nucleic acid sequence that is complementary to said target sequence within said.
  • mHTT gene comprises a nucleic acid sequence set forth in any one of SEQ ID NOs:20-25 and 230-294.
  • Embodiment 114 The method of any one of claims 96-113, wherein said target sequence within said mHTT gene comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 26-229.
  • Embodiment 115 The method of any one of claims 96-1148, wherein said nucleic acid sequence that can bind said endonuclease comprises a nucleic acid sequence set forth in SEQ ID NO:301.
  • Embodiment 116 The method of any one of claims 96-115, wherein said administration comprises a direct injection into said striatum.
  • Embodiment 117 The method of any one of claims 96-116, wherein said administration comprises a direct injection into said motor cortex.
  • Embodiment 1 18. The method of any one of claims 96-1 17, wherein said method comprises, prior to said administering step, identifying said mammal as having HD.
  • Embodiment 119 A method for targeting mHTT in a neuron, wherein said method comprises: administering to said neuron an RNP complex comprising:
  • RNA molecule comprising (i) a nucleic acid sequence that is complementary to a target sequence within a mHTT gene, and (ii) a nucleic acid sequence that can bind said endonuclease.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Ce document concerne des procédés et des matériaux pour traiter un mammifère atteint de la maladie de Huntington. Dans certains cas, le document concerne des procédés et des matériaux pour inactiver un gène de la huntingtine mutante (mHTT) chez un mammifère. Par exemple, l'invention concerne des complexes de ribonucléoprotéines (RNP) comprenant une endonucléase (par exemple, un polypeptide de la protéine 9 associée à CRISPR (Cas9)) comprenant une ou plusieurs séquences de localisation nucléaire (NLS) et une molécule d'acide ribonucléique (ARN) (par exemple, un ARN guide (ARNg) tel qu'un ARN simple guide (ARNsg)) comprenant une séquence d'acide nucléique qui est complémentaire d'une séquence cible dans un gène de la mHTT et une séquence d'acide nucléique qui peut se lier à l'endonucléase, ainsi des procédés d'utilisation de tels complexes de RNP pour inactiver un gène de la mHTT chez un mammifère.
PCT/US2022/021998 2021-03-25 2022-03-25 Procédés et matériaux pour le traitement de la maladie de huntington WO2022204543A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163166095P 2021-03-25 2021-03-25
US63/166,095 2021-03-25

Publications (1)

Publication Number Publication Date
WO2022204543A1 true WO2022204543A1 (fr) 2022-09-29

Family

ID=83397952

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/021998 WO2022204543A1 (fr) 2021-03-25 2022-03-25 Procédés et matériaux pour le traitement de la maladie de huntington

Country Status (1)

Country Link
WO (1) WO2022204543A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117343153A (zh) * 2023-04-18 2024-01-05 上海本导基因技术有限公司 一种用于治疗亨廷顿疾病的慢病毒样颗粒
WO2024077267A1 (fr) * 2022-10-07 2024-04-11 The Broad Institute, Inc. Méthodes et compositions d'édition d'amorce pour traiter des troubles de répétition de triplet
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
WO2024129743A3 (fr) * 2022-12-13 2024-07-18 Bluerock Therapeutics Lp Endonucléases de type v modifiées programmables par arn et leurs utilisations

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140179770A1 (en) * 2012-12-12 2014-06-26 Massachusetts Institute Of Technology Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications
US20150071906A1 (en) * 2013-09-06 2015-03-12 President And Fellows Of Harvard College Delivery system for functional nucleases
WO2015089354A1 (fr) * 2013-12-12 2015-06-18 The Broad Institute Inc. Compositions et procédés d'utilisation de systèmes crispr-cas dans les maladies dues à une répétition de nucléotides
US20180363009A1 (en) * 2015-12-18 2018-12-20 The Regents Of The University Of California Modified site-directed modifying polypeptides and methods of use thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140179770A1 (en) * 2012-12-12 2014-06-26 Massachusetts Institute Of Technology Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications
US20150071906A1 (en) * 2013-09-06 2015-03-12 President And Fellows Of Harvard College Delivery system for functional nucleases
WO2015089354A1 (fr) * 2013-12-12 2015-06-18 The Broad Institute Inc. Compositions et procédés d'utilisation de systèmes crispr-cas dans les maladies dues à une répétition de nucléotides
US20180363009A1 (en) * 2015-12-18 2018-12-20 The Regents Of The University Of California Modified site-directed modifying polypeptides and methods of use thereof

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
WO2024077267A1 (fr) * 2022-10-07 2024-04-11 The Broad Institute, Inc. Méthodes et compositions d'édition d'amorce pour traiter des troubles de répétition de triplet
WO2024129743A3 (fr) * 2022-12-13 2024-07-18 Bluerock Therapeutics Lp Endonucléases de type v modifiées programmables par arn et leurs utilisations
CN117343153A (zh) * 2023-04-18 2024-01-05 上海本导基因技术有限公司 一种用于治疗亨廷顿疾病的慢病毒样颗粒

Similar Documents

Publication Publication Date Title
WO2022204543A1 (fr) Procédés et matériaux pour le traitement de la maladie de huntington
JP6794409B2 (ja) シータデフェンシンによる炎症性プロテアーゼの遮断
Qin et al. Vision rescue via unconstrained in vivo prime editing in degenerating neural retinas
US20200046853A1 (en) Compositions and methods specifically targeting the apolipoprotein e4 (apoe4) and uses thereof in apoe4 associated conditions
US11746370B2 (en) Methods and compositions for assessing and treating intraocular diseases and disorders
EP2906719A2 (fr) Marqueurs biologiques prédictifs de la réponse clinique à l'acétate de glatiramer
EP3583117B1 (fr) Procédé in vitro de fusion de deux cellules ou plus, procédé in vitro d'administration d'un gène d'intérêt, et composition pharmaceutique destinée à être utilisée dans le traitement d'une maladie
Zhang et al. Choroideremia is a systemic disease with lymphocyte crystals and plasma lipid and RBC membrane abnormalities
US10548942B2 (en) CXCR antagonistic peptides and uses thereof
US20240124869A1 (en) Curing disease by transcription regulatory gene editing
CN107137710B (zh) Kindlin-2蛋白作为靶点在制备治疗肾炎的药物中的应用
US20240131075A1 (en) Use of mbv for treating autoimmune disease
CN117919451B (zh) 与桥粒芯糖蛋白2相关的生物材料的应用及抑制骨再生病理性亢进的药物
WO2018185756A1 (fr) Compositions d'alpha-1-antitrypsine mutantes et leur utilisation
US20210214699A1 (en) Methods and compositions for modulating myeloperoxidase (mpo) expression
Shammas Mitochondrial Dysfunction and Stress Responses in CHCHD10 Myopathy and Neurodegeneration
Singhal et al. Mitochondrial diseases: an overview of genetics, pathogenesis, clinical features and an approach to diagnosis and treatment
CN112390855B (zh) Pretide-146a在制备缓解或治疗自身免疫性疾病的药物中的应用
US20210121539A1 (en) Methods and compositions for modulating myeloperoxidase (mpo) expression
DE69737660T2 (de) Tumorsupressorgen aus basalzellkarzinom
CN117866988A (zh) 核酸片段及其作为标志物在制备回旋状视网膜脉络膜萎缩的诊断试剂中的应用
KR20230124418A (ko) 알파-1 안티 트립신 결핍증 z 타입 돌연변이의 교정을 위한 프라임에디팅 가이드 rna를 포함하는 프라임에딩팅용 조성물
CN114540361A (zh) Best1基因新突变及在遗传性视网膜变性疾病中的应用
CN118750580A (zh) Cryab在治疗sting相关疾病和衰老中的应用
DE102004031116A1 (de) Verfahren zum Auffinden schmerzrelevanter Substanzen unter Verwendung schmerzrelevanter Proteine

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22776745

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22776745

Country of ref document: EP

Kind code of ref document: A1