WO2022195355A1 - Benzisoxazole derivatives and uses thereof - Google Patents

Benzisoxazole derivatives and uses thereof Download PDF

Info

Publication number
WO2022195355A1
WO2022195355A1 PCT/IB2022/000134 IB2022000134W WO2022195355A1 WO 2022195355 A1 WO2022195355 A1 WO 2022195355A1 IB 2022000134 W IB2022000134 W IB 2022000134W WO 2022195355 A1 WO2022195355 A1 WO 2022195355A1
Authority
WO
WIPO (PCT)
Prior art keywords
alkyl
pharmaceutically acceptable
acceptable salt
compound according
cycloalkyl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2022/000134
Other languages
English (en)
French (fr)
Inventor
Rohan Eric John BECKWITH
Simone BONAZZI
Artiom CERNIJENKO
Jennifer Stroka Cobb
Natalie Alysia DALES
Janetta DEWHURST
Aleem FAZAL
Matthew James HESSE
Rama Jain
John Ryan Kerrigan
Hasnain Ahmed MALIK
James R. MANNING
Gary O'brien
Andrew W. Patterson
Noel Marie-France THOMSEN
Pamela Yf TING
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis AG
Original Assignee
Novartis AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis AG filed Critical Novartis AG
Priority to EP22720755.2A priority Critical patent/EP4308559A1/en
Priority to JP2023556473A priority patent/JP2024509625A/ja
Priority to CN202280017295.6A priority patent/CN116940571A/zh
Priority to US18/550,806 priority patent/US20250276964A1/en
Publication of WO2022195355A1 publication Critical patent/WO2022195355A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D413/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/14Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing three or more hetero rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/513Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim having oxo groups directly attached to the heterocyclic ring, e.g. cytosine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/53751,4-Oxazines, e.g. morpholine
    • A61K31/53831,4-Oxazines, e.g. morpholine ortho- or peri-condensed with heterocyclic ring systems
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A61K31/551Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole having two nitrogen atoms, e.g. dilazep
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06Antianaemics
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D451/00Heterocyclic compounds containing 8-azabicyclo [3.2.1] octane, 9-azabicyclo [3.3.1] nonane, or 3-oxa-9-azatricyclo [3.3.1.0<2,4>] nonane ring systems, e.g. tropane or granatane alkaloids, scopolamine; Cyclic acetals thereof
    • C07D451/02Heterocyclic compounds containing 8-azabicyclo [3.2.1] octane, 9-azabicyclo [3.3.1] nonane, or 3-oxa-9-azatricyclo [3.3.1.0<2,4>] nonane ring systems, e.g. tropane or granatane alkaloids, scopolamine; Cyclic acetals thereof containing not further condensed 8-azabicyclo [3.2.1] octane or 3-oxa-9-azatricyclo [3.3.1.0<2,4>] nonane ring systems, e.g. tropane; Cyclic acetals thereof
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D471/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/08Bridged systems
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D487/00Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
    • C07D487/02Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
    • C07D487/08Bridged systems
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D498/00Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D498/02Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and oxygen atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
    • C07D498/04Ortho-condensed systems
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D513/00Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups C07D463/00, C07D477/00 or C07D499/00 - C07D507/00
    • C07D513/02Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups C07D463/00, C07D477/00 or C07D499/00 - C07D507/00 in which the condensed system contains two hetero rings
    • C07D513/04Ortho-condensed systems

Definitions

  • the present disclosure relates to benzisoxazole derivatives compounds and pharmaceutical compositions and their use in reducing Widely Interspaced Zinc Finger Motifs (WIZ) protein expression levels and/or inducing fetal hemoglobin (HbF) protein expression levels, and in the treatment of inherited blood disorders (hemoglobinopathies, e.g., beta- hemoglobinopathies), such as sickle cell disease and beta-thalassemia.
  • WIZ Widely Interspaced Zinc Finger Motifs
  • HbF fetal hemoglobin
  • Sickle cell disease is a group of severe inherited blood disorders that cause red blood cells to contort into a sickle shape. These cells can cause blockages in blood flow, leading to intense pain, organ damage and premature death.
  • Beta thalassemias are a group of inherited blood disorders that are caused by reduced or absent synthesis of beta globin, causing anemia.
  • HbF Fetal hemoglobin
  • HDAC1/2 Shearstone et al., 2016, PLoS One, 11(4), e0153767
  • LSD1 Livers et al, 2018, Experimental Hematology, 67, 60-64
  • DNMT1 DNMT1
  • PDE9a MalArthur et al., 2019, Haematologica.
  • WIZ is ubiquitously expressed and plays a role in targeting the G9a/GLP histone methyltransferases to genomic loci to regulate chromatin structure and transcription (Bian, Chen, et al. (2015), eLife 2015;4:e05606. Summary of the Disclosure
  • the disclosure relates to a therapeutic agent, which is effective in reducing WIZ protein expression levels and/or inducing fetal hemoglobin (HbF) expression.
  • the disclosure further relates to benzisoxazole compounds, which are effective in reducing WIZ protein expression levels and/or inducing fetal hemoglobin (HbF) expression, pharmaceutically acceptable salts thereof, compositions thereof, and their use in therapies for the conditions and purposes detailed above.
  • a compound of formula (I’’) or a pharmaceutically acceptable salt thereof wherein: is a single bond or a double bond; X is selected from CH, CF, and N; Y is selected from CH 2 , CR Y R 2 and N-R 3 ; Z is selected from CH 2 , CR Y R 2 and N-R 3 , wherein at least one of Y and Z is N-R 3 such that when Y is N-R 3 , Z is selected from CH 2 , and CR Y R 2 , and when Z is N-R 3 , Y is selected from CH 2 , and CR Y R 2 , and wherein when R 2 of CR Y R 2 of Y or Z is oxo, R Y is absent; R x is selected from hydrogen, C1-C6alkyl, halo (e.g., F, Cl), C1-C6alkoxyl, and C3- C 8 cycloalkyl; R
  • R’ is selected from hydrogen and C 1 -C 6 alkyl
  • R 1 is selected from hydrogen and C 1 -C 6 alkyl
  • each R 2 is independently selected from C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halo, and oxo, wherein the C 1 -C 6 alkyl is substituted with 0-1 occurrence of R 2a ; or 2 R 2 on non-adjacent carbon atoms together with the non-adjacent carbon atoms to which they are attached form a bridging ring
  • R 2a is selected from C1-C6alkoxyl and hydroxyl
  • a compound of formula (I) or a pharmaceutically acceptable salt thereof wherein: X is selected from CH, CF, and N; R’ is selected from hydrogen and C 1 -C 6 alkyl; R 1 is selected from hydrogen and C 1 -C 6 alkyl; each R 2 is independently selected from C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halo, and oxo, wherein the C 1 -C 6 alkyl is substituted with 0-1 occurrence of R 2a ; or 2 R 2 on non-adjacent carbon atoms together with the non-adjacent carbon atoms to which they are attached form a bridging ring; R 2a is selected from C 1 -C 6 alkoxyl and hydroxyl; R 3 is selected from hydrogen, C 1 -C 8 alkyl, C 2 -C 6 alkenyl, –SO 2 R 4 , C 1 -C 6 haloalkyl
  • the disclosure provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, and a pharmaceutically acceptable carrier or excipient.
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof, for use as a medicament.
  • the disclosure provides a method of treating or preventing a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof.
  • the disclosure provides a method of treating or preventing a disorder that is affected by the reduction or modulation of WIZ protein levels, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
  • the disclosure provides a method of inhibiting WIZ protein expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof.
  • the disclosure provides a method of degrading WIZ protein in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof.
  • the disclosure provides a method of inhibiting, reducing, or eliminating the activity of WIZ protein or WIZ protein expression, the method comprising administering to the subject a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof.
  • the disclosure provides a method of inducing or promoting fetal hemoglobin in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof.
  • the disclosure provides a method of reactivating fetal hemoglobin production or expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof.
  • the disclosure provides a method of increasing fetal hemoglobin expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof.
  • the disclosure provides a method of treating a hemoglobinopathy, e.g., a beta-hemoglobinopathy, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
  • a hemoglobinopathy e.g., a beta-hemoglobinopathy
  • the disclosure provides a method of treating a sickle cell disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof.
  • the disclosure provides a method of treating beta-thalassemia in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof.
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof, for use in the treatment of a disease or disorder.
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof, for use in the treatment of a disease or disorder selected from sickle cell disease and beta-thalassemia.
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof, for use in the treatment or prevention of a disease or disorder that is affected by the reduction of WIZ protein levels.
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof, for use in the treatment or prevention of a disease or disorder that is affected by the inhibition or reduction of WIZ protein expression.
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof, for use in the treatment or prevention of a disease or disorder that is affected by the degradation of WIZ protein.
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof, for use in inhibiting, reducing, or eliminating the activity of WIZ protein or WIZ protein expression.
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof, for use in inducing or promoting fetal hemoglobin.
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof, for use in reactivating fetal hemoglobin production or expression.
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof, for use in increasing fetal hemoglobin expression.
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof, for use in the treatment of a hemoglobinopathy.
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof, for use in the treatment of a sickle cell disease.
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof, for use in the treatment of beta-thalassemia.
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof, for use in the treatment of a disease or disorder affected by an increase in fetal hemoglobin expression.
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof, for use in the treatment of a disease or disorder affected by the inhibition, reduction, or elimination of the activity of WIZ protein or WIZ protein expression.
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof, for use in the treatment of a disease or disorder affected by the induction or promotion of fetal hemoglobin.
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof, for use in the treatment of a disease or disorder affected by the reactivation of fetal hemoglobin production or expression.
  • a pharmaceutically acceptable salt thereof for use in the treatment of a disease or disorder affected by the reactivation of fetal hemoglobin production or expression.
  • FIG.1A depicts a volcano plot of differentially expressed genes from WIZ KO cells as compared to a scrambled gRNA control. Each dot represents a gene. HBG1/2 genes are differentially upregulated with WIZ_6 and WIZ_18 gRNA targeting WIZ KO.
  • FIG.1B depicts a bar graph showing the frequency of HbF+ cells due to shRNA- mediated loss of WIZ in human mobilized peripheral blood CD34+ derived erythroid cells.
  • FIG.1C depicts a bar graph showing the frequency of HbF+ cells due to CRISPR/Cas9-mediated loss of WIZ in human mobilized peripheral blood CD34+ derived erythroid cells.
  • the compounds disclosed herein are effective in reducing WIZ protein expression levels, or inducing fetal hemoglobin (HbF) expression. Without wishing to be bound by any theory, it is believed that the disclosed compounds may treat blood disorders, such as inherited blood disorders, e.g., sickle cell disease, and beta-thalassemia by inducing fetal hemoglobin HbF expression.
  • blood disorders such as inherited blood disorders, e.g., sickle cell disease, and beta-thalassemia by inducing fetal hemoglobin HbF expression.
  • the terms “compounds of the present disclosure,” “compounds of the disclosure,” or “compound of the disclosure” refer to compounds of formulae (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), exemplified compounds, salts thereof, particularly pharmaceutically acceptable salts thereof, hydrates, solvates, prodrugs, as well as all stereoisomers (including diastereoisomers and enantiomers), rotamers, tautomers, and isotopically labeled compounds (including deuterium substitutions), as well as inherently formed moieties.
  • C 1 -C 8 alkyl means an alkyl group or radical having 1 to 8 carbon atoms.
  • the last named group is the radical attachment point, for example, “alkylaryl” means a monovalent radical of the formula alkyl-aryl–, while “arylalkyl” means a monovalent radical of the formula aryl-alkyl–.
  • alkylaryl means a monovalent radical of the formula alkyl-aryl–
  • arylalkyl means a monovalent radical of the formula aryl-alkyl–.
  • designating a monovalent radical where a divalent radical is appropriate shall be construed to designate the respective divalent radical and vice versa.
  • an aryl substituted with a cycloalkyl may indicate that the cycloalkyl connects to one atom of the aryl with a bond or by fusing with the aryl and sharing two or more common atoms.
  • C 1 -C 8 alkyl refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms, containing no unsaturation, having from one to eight carbon atoms, and which is attached to the rest of the molecule by a single bond.
  • the terms “C 1 -C 3 alkyl”, “C 1 -C 4 alkyl”, “C 1 -C 6 alkyl”, are to be construed accordingly.
  • C 1 -C 8 alkyl examples include, but are not limited to, methyl, ethyl, n-propyl, 1-methylethyl (iso-propyl), n- butyl, 1-methylpropyl (sec-butyl), 2-methylpropyl (iso-butyl or i-butyl), 1,1-dimethylethyl (t-butyl), n-pentyl, 3-pentyl, n-hexyl, n-heptyl, 4-heptyl, n-octyl, 2-isopropyl-3-methylbutyl.
  • C 1 -C 6 alkoxyl refers to a radical of the formula –OR a where R a is a C 1- C 6 alkyl radical as generally defined above.
  • Examples of C 1 -C 6 alkoxyl include, but are not limited to, methoxy, ethoxy, propoxy, iso-propoxy, butoxy, iso-butoxy, tert-butoxy, sec-butoxy, pentoxy, and hexoxy.
  • C 1 -C 6 haloalkyl refers to C 1 -C 6 alkyl radical, as defined above, substituted by one or more halo radicals, as defined herein.
  • C 1 -C 6 haloalkyl examples include, but are not limited to, trifluoromethyl, difluoromethyl, fluoromethyl, trichloromethyl, 1,1- difluoroethyl, 2,2-difluoroethyl, 2,2,2-trifluoroethyl, 2-fluoropropyl, 1,1,1-trifluoropropyl, 2,2- difluoropropyl, 3,3-difluoropropyl and 1-fluoromethyl-2-fluoroethyl, 1,3-dibromopropan-2-yl, 3- bromo-2-fluoropropyl, 1,1,2,2-tetrafluoropropyl, and 1,4,4-trifluorobutan-2-yl.
  • C 1 -C 6 haloalkoxyl means a C 1 -C 6 alkoxyl group as defined herein substituted with one or more halo radicals.
  • Examples of C 1 -C 6 haloalkoxyl groups include, but are not limited to, trifluoromethoxy, difluoromethoxy, fluoromethoxy, trichloromethoxy, 1,1- difluoroethoxy, 2,2-difluoroethoxy, 2,2,2-trifluoroethoxy, 1-fluoromethyl-2-fluoroethoxy, pentafluoroethoxy, 2-fluoropropoxy, 3,3-difluoropropoxy and 3-dibromopropoxy.
  • the one or more halo radicals of C 1 -C 6 haloalkoxyl is fluoro.
  • C 1 -C 6 haloalkoxyl is selected from trifluoromethoxy, difluoromethoxy, fluoromethoxy, 1,1-difluoroethoxy, 2,2-difluoroethoxy, 2,2,2-trifluoroethoxy, 1-fluoromethyl-2-fluoroethoxy, and pentafluoroethoxy.
  • halogen or “halo” means fluoro, chloro,bromo or iodo.
  • cycloalkyl means a monocyclic or polycyclic saturated or partially unsaturated carbon ring containing 3-18 carbon atoms wherein there are no delocalized pi electrons (aromaticity) shared among the ring carbon.
  • C 3 -C 10 cycloalkyl means a monocyclic or polycyclic saturated or partially unsaturated carbon ring containing 3-18 carbon atoms wherein there are no delocalized pi electrons (aromaticity) shared among the ring carbon.
  • C 3 -C 10 cycloalkyl C 3 - C8cycloalkyl
  • C4-C10cycloalkyl C4-C7cycloalkyl
  • polycyclic encompasses bridged (e.g., norbonane), fused (e.g., decalin) and spirocyclic cycloalkyl.
  • cycloalkyl e.g., C 3 -C 10 cycloalkyl
  • cycloalkyl groups include, without limitations, cyclopropenyl, cyclopropyl cyclobutyl, cyclobutenyl, cyclopentyl, cyclohexyl, cycloheptanyl, cyclooctanyl, norboranyl, norborenyl, spiro[3.3]heptanyl (e.g., spiro[3.3]heptan-6-yl), bicyclo[2.2.2]octanyl, bicyclo[2.2.2]octenyl, adamantyl and derivatives thereof.
  • the cycloalkyl group is saturated.
  • C 3 -C 10 cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, spiro[3.3]heptanyl (e.g., spiro[3.3]heptan-6-yl), bicyclo[1.1.1]pentyl, bicyclo[2.1.1]hexyl, bicyclo[2.1.1]heptyl, bicyclo[2.2.2]octyl and adamantyl.
  • Heterocyclyl means a saturated or partially saturated monocyclic or polycyclic ring containing carbon and at least one heteroatom selected from oxygen, nitrogen, and sulfur (O, N, and S) and wherein there are no delocalized pi electrons (aromaticity) shared among the ring carbon or heteroatoms.
  • the terms "4- to 10-membered heterocyclyl”, “4- to 6-membered heterocyclyl” and “5- or 6-membered heterocyclyl” are to be construed accordingly.
  • the heterocyclyl ring structure may be substituted by one or more substituents. The substituents can themselves be optionally substituted.
  • the heterocyclyl may be bonded via a carbon atom or heteroatom.
  • polycyclic encompasses bridged, fused and spirocyclic heterocyclyl.
  • heterocyclyl rings include, but are not limited to, oxetanyl, azetidinyl, tetrahydrofuranyl, tetrahydropyranyl, pyrrolidinyl, oxazolinyl, isoxazolinyl, oxazolidinyl, thiazolidinyl, pyranyl, thiopyranyl, tetrahydropyranyl, dioxalinyl, piperidinyl, morpholinyl, thiomorpholinyl, thiomorpholinyl S-oxide, thiomorpholinyl S-dioxide, piperazinyl, azepinyl, oxepinyl, diazepinyl, tropanyl, oxazolidinonyl, 1,4-dioxanyl, dihydrofuranyl,
  • heterocyclyl examples include, without limitations, oxetanyl, azetidinyl, pyrrolidinyl, tetrahydrofuranyl, tetrahydrothienyl, piperidinyl, piperazinyl, dihydroisoxazolinyl, tetrahydropyranyl, morpholinyl, dihydropyranyl (e.g., 3,6-dihydro-2H-pyranyl), 2- azaspiro[3.3]heptanyl (e.g., 2-azaspiro[3.3]heptan-6-yl), and oxaspiroheptanyl (e.g., 2- oxaspiro[3.3]heptan-6-yl).
  • dihydropyranyl e.g., 3,6-dihydro-2H-pyranyl
  • 2- azaspiro[3.3]heptanyl e.g., 2-azaspiro[3.3]heptan-6
  • aryl as used herein means monocyclic, bicyclic or polycyclic carbocyclic aromatic rings.
  • aryl include, but are not limited to, phenyl, naphthyl (e.g., naphth-1-yl, naphth-2-yl), anthryl (e.g., anthr-1-yl, anthr-9-yl), phenanthryl (e.g., phenanthr-1-yl, phenanthr-9-yl), and the like.
  • Aryl is also intended to include monocyclic, bicyclic or polycyclic carbocyclic aromatic rings substituted with carbocyclic aromatic rings.
  • biphenyl e.g., biphenyl-2-yl, biphenyl-3-yl, biphenyl-4-yl
  • phenylnaphthyl e.g., 1- phenylnaphth-2-yl, 2-phenylnaphth-1-yl
  • Aryl is also intended to include partially saturated bicyclic or polycyclic carbocyclic rings with at least one unsaturated moiety (e.g., a benzo moiety).
  • indanyl e.g., indan-1-yl, indan-5-yl
  • indenyl e.g., inden-1-yl, inden-5-yl
  • 1,2,3,4-tetrahydronaphthyl e.g., 1,2,3,4-tetrahydronaphth-1-yl, 1,2,3,4- tetrahydronaphth-2-yl, 1,2,3,4-tetrahydronaphth-6-yl
  • 1,2-dihydronaphthyl e.g., 1,2- dihydronaphth-1-yl, 1,2-dihydronaphth-4-yl, 1,2-dihydronaphth-6-yl
  • fluorenyl e.g., fluoren-1-yl, fluoren-4-yl, fluoren-9-yl
  • fluorenyl e.g., fluoren-1-yl, fluoren-4-
  • Aryl is also intended to include partially saturated bicyclic or polycyclic carbocyclic aromatic rings containing one or two bridges.
  • Representative examples are, benzonorbornyl (e.g., benzonorborn-3-yl, benzonorborn-6-yl), 1,4-ethano-1,2,3,4- tetrahydronapthyl (e.g., 1,4-ethano-1,2,3,4-tetrahydronapth-2-yl, 1,4-ethano-1,2,3,4- tetrahydronapth-10-yl), and the like.
  • the term "C 6 -C 10 aryl" is to be construed accordingly.
  • aryl examples include, but are not limited to, indenyl, (e.g., inden-1-yl, inden- 5-yl) phenyl (C 6 H 5 ), naphthyl (C 10 H 7 ) (e.g., naphth-1-yl, naphth-2-yl), indanyl (e.g., indan-1-yl, indan-5-yl), and tetrahydronaphthalenyl (e.g., 1,2,3,4-tetrahydronaphthalenyl).
  • C 6 -C 10 aryl refers to a monocyclic or bicyclic carbocyclic aromatic ring.
  • C 6 -C 10 aryl examples include, but are not limited to, phenyl and naphthyl.
  • C 6 -C 10 aryl is phenyl.
  • heteroaryl as used herein is intended to include monocyclic heterocyclic aromatic rings containing one or more heteroatoms selected from oxygen, nitrogen, and sulfur (O, N, and S).
  • pyrrolyl furanyl, thienyl, oxazolyl, thiazolyl, imidazolyl, pyrazolyl, isothiazolyl, isooxazolyl, triazolyl, (e.g., 1,2,4-triazolyl), oxadiazolyl, (e.g., 1,2,3-oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,3,4-oxadiazolyl), thiadiazolyl (e.g., 1,2,3- thiadiazolyl, 1,2,4-thiadiazolyl, 1,2,5-thiadiazolyl, 1,3,4-thiadiazolyl), tetrazolyl, pyranyl, pyridinyl, pyridazinyl, pyrimidinyl, pyrazinyl, 1,2,3-triazinyl, 1,2,4-triazinyl, 1,3,
  • Heteroaryl is also intended to include bicyclic heterocyclic aromatic rings containing one or more heteroatoms selected from oxygen, nitrogen, and sulfur (O, N, and S).
  • Representative examples are indolyl, isoindolyl, benzofuranyl, benzothiophenyl, indazolyl, benzopyranyl, benzimidazolyl, benzothiazolyl, benzisothiazolyl, benzoxazolyl, benzisoxazolyl, benzoxazinyl, benzotriazolyl, naphthyridinyl, phthalazinyl, pteridinyl, purinyl, quinazolinyl, cinnolinyl, quinolinyl, isoquinolinyl, quinoxalinyl, oxazolopyridinyl, isooxazolopyridinyl, pyrrolopyridinyl, furopyridinyl, thienopyr
  • Heteroaryl is also intended to include polycyclic heterocyclic aromatic rings containing one or more heteroatoms selected from oxygen, nitrogen, and sulfur (O, N, and S). Representative examples are carbazolyl, phenoxazinyl, phenazinyl, acridinyl, phenothiazinyl, carbolinyl, phenanthrolinyl, and the like. Heteroaryl is also intended to include partially saturated monocyclic, bicyclic or polycyclic heterocyclyls containing one or more heteroatoms selected oxygen, nitrogen, and sulfur (O, N, and S).
  • Representative examples are imidazolinyl, indolinyl, dihydrobenzofuranyl, dihydrobenzothienyl, dihydrobenzopyranyl, dihydropyridooxazinyl, dihydrobenzodioxinyl (e.g., 2,3-dihydrobenzo[b][1,4]dioxinyl), benzodioxolyl (e.g., benzo[d][1,3]dioxole), dihydrobenzooxazinyl (e.g., 3,4-dihydro-2H-benzo[b][1,4]oxazine), tetrahydroindazolyl, tetrahydrobenzimidazolyl, tetrahydroimidazo[4,5-c]pyridyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, tetrahydroquinoxaliny
  • the heteroaryl ring structure may be substituted by one or more substituents.
  • the substituents can themselves be optionally substituted.
  • the heteroaryl ring may be bonded via a carbon atom or heteroatom.
  • the term “5-10 membered heteroaryl” is to be construed accordingly.
  • Examples of 5-10 membered heteroaryl include, but are not limited to, indolyl, imidazopyridyl, isoquinolinyl, benzooxazolonyl, pyridinyl, pyrimidinyl, pyridinonyl, benzotriazolyl, pyridazinyl, pyrazolotriazinyl, indazolyl, benzimidazolyl, quinolinyl, triazolyl, (e.g., 1,2,4-triazolyl), pyrazolyl, thiazolyl, oxazolyl, isooxazolyl, pyrrolyl, oxadiazolyl, (e.g., 1,2,3-oxadiazolyl, 1,2,4- oxadiazolyl, 1,2,5-oxadiazolyl, 1,3,4-oxadiazolyl), imidazolyl, pyrrolopyridinyl, tetrahydro
  • Cyano or “–CN” means a substituent having a carbon atom joined to a nitrogen atom by a triple bond, e.g., C ⁇ N.
  • C 2 -C 6 alkenyl as used herein represents a branched or straight hydrocarbon group having from 2 to 6 carbon atoms and at least one double bond.
  • ethenyl or vinyl
  • propenyl e.g., prop-1-enyl, prop-2-enyl
  • 2-methylprop-1-enyl 2- methylprop-2-enyl, 1,1-(dimethyl)prop-2-enyl, butadienyl (e.g., buta-1,3-dienyl), butenyl (e.g., but-1-en-1-yl, but-2-en-1-yl), 2-methylbut-1-enyl
  • pentenyl e.g., pent-1-enyl, pent-2-enyl
  • hexenyl e.g., hex-1-enyl, hex-2-enyl, hex-3-enyl
  • 2-methylpent-3-enyl and the like.
  • the term “bridging ring” refers to a ring formed at two non-adjacent carbon atoms of the heterocycloalkyl moiety of formula (I), linked to form a C 1 -C 3 alkylene linker, wherein one of the carbon atoms of said linker is optionally replaced by a heteroatom selected from nitrogen, oxygen and sulfur.
  • the alkylene linker comprises carbon atoms only.
  • C 1 -C 3 alkylene refers to a straight hydrocarbon chain bivalent radical consisting solely of carbon and hydrogen atoms, containing no unsaturation, having from one to two carbon atoms.
  • the term “optionally substituted” includes unsubstituted or substituted.
  • “ ” denotes the point of attachment to the other part of the molecule.
  • nitrogen protecting group (PG) in a compound of Formula (X) or any intermediates in any of the general schemes 1 to 4 and subformulae thereof refers to a group that should protect the functional groups concerned against unwanted secondary reactions, such as acylations, etherifications, esterifications, oxidations, solvolysis and similar reactions. It may be removed under deprotection conditions. Depending on the protecting group employed, the skilled person would know how to remove the protecting group to obtain the free amine NH 2 group by reference to known procedures.
  • Preferred nitrogen protecting groups generally comprise: C 1 -C 6 alkyl (e.g., tert-butyl), preferably C 1 -C 4 alkyl, more preferably C 1 -C 2 alkyl, most preferably C 1 alkyl which is mono-, di- or tri-substituted by trialkylsilyl-C 1 -C 7 alkoxy (e.g., trimethylsilyethoxy), aryl, preferably phenyl, or a heterocyclic group (e.g., benzyl, cumyl, benzhydryl, pyrrolidinyl, trityl, pyrrolidinylmethyl, 1-methyl- 1,1-dimethylbenzyl, (phenyl)methylbenzene) wherein the aryl ring or the heterocyclic group is unsubstituted or substituted by one or more, e.g., two or three, residues, e.g., selected from the group consisting of C 1 -
  • the preferred nitrogen protecting group (PG) can be selected from the group comprising tert-butyloxycarbonyl (Boc), benzyloxycarbonyl (Cbz), para-methoxy benzyl (PMB), 2,4-dimethoxybenzyl (DMB), methyloxycarbonyl, trimethylsilylethoxymethyl (SEM) and benzyl.
  • the nitrogen protecting group (PG) is preferably an acid labile protecting group, e.g., tert-butyloxycarbonyl (Boc), 2,4-dimethoxybenzyl (DMB).
  • the compounds of the disclosure are selective over other proteins.
  • the term “therapeutic agent” in connection with methods of reducing WIZ protein expression levels and/or inducing fetal hemoglobin (HbF) expression refers to a substance that results in a detectably lower expression of WIZ gene or WIZ protein or lower activity level of WIZ proteins as compared to those levels without such substance.
  • “modulator” or “degrader” means, for example, a compound of the disclosure, that effectively modulates, decreases, or reduces the levels of a specific protein (e.g., WIZ) or degrades a specific protein (e.g., WIZ).
  • the amount of a specific protein (e.g., WIZ) degraded can be measured by comparing the amount of the specific protein (e.g., WIZ) remaining after treatment with a compound of the disclosure as compared to the initial amount or level of the specific protein (e.g., WIZ) present as measured prior to treatment with a compound of the disclosure.
  • selective modulator means, for example, a compound of the disclosure, that effectively modulates, decreases, or reduces the levels of a specific protein (e.g., WIZ) or degrades a specific protein (e.g., WIZ) to a greater extent than any other protein.
  • a “selective modulator”, “selective degrader”, or “selective compound” can be identified, for example, by comparing the ability of a compound to modulate, decrease, or reduce the levels of or to degrade a specific protein (e.g., WIZ) to its ability to modulate, decrease, or reduce the levels of or to degrade other proteins.
  • the selectivity can be identified by measuring the EC 50 or IC 50 of the compounds. Degradation may be achieved through mediation of an E3 ligase, e.g., E3-ligase complexes comprising the protein Cereblon.
  • the specific protein degraded is WIZ protein.
  • At least about 30% of WIZ is degraded compared to initial levels. In an embodiment, at least about 40% of WIZ is degraded compared to initial levels. In an embodiment, at least about 50% of WIZ is degraded compared to initial levels. In an embodiment, at least about 60% of WIZ is degraded compared to initial levels. In an embodiment, at least about 70% of WIZ is degraded compared to initial levels. In an embodiment, at least about 75% of WIZ is degraded compared to initial levels. In an embodiment, at least about 80% of WIZ is degraded compared to initial levels. In an embodiment, at least about 85% of WIZ is degraded compared to initial levels. In an embodiment, at least about 90% of WIZ is degraded compared to initial levels.
  • WIZ is degraded compared to initial levels. In an embodiment, over 95% of WIZ is degraded compared to initial levels. In an embodiment, at least about 99% of WIZ is degraded compared to initial levels. In an embodiment, the WIZ is degraded in an amount of from about 30% to about 99% compared to initial levels. In an embodiment, the WIZ is degraded in an amount of from about 40% to about 99% compared to initial levels. In an embodiment, the WIZ is degraded in an amount of from about 50% to about 99% compared to initial levels. In an embodiment, the WIZ is degraded in an amount of from about 60% to about 99% compared to initial levels.
  • the WIZ is degraded in an amount of from about 70% to about 99% compared to initial levels. In an embodiment, the WIZ is degraded in an amount of from about 80% to about 99% compared to initial levels. In an embodiment, the WIZ is degraded in an amount of from about 90% to about 99% compared to initial levels. In an embodiment, the WIZ is degraded in an amount of from about 95% to about 99% compared to initial levels. In an embodiment, the WIZ is degraded in an amount of from about 90% to about 95% compared to initial levels.
  • the terms “inducing fetal hemoglobin”, “fetal hemoglobin induction”, or “increasing fetal hemoglobin expression” refer to increasing the percentage of HbF in the blood of a subject. In an embodiment, the amount of total HbF in the blood of the subject increases. In an embodiment, the amount of total hemoglobin in the blood of the subject increases.
  • the amount of HbF is increased by at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 100%, or more than 100%, for example, at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 6-fold, or at least about 7-fold, or at least about 8-fold, or at least about 9-fold, or at least about 10-fold, or more than 10-fold as compared to either in the absence of a compound disclosed herein.
  • the total hemoglobin in the blood is increased by at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 100%, or more than 100%, for example, at least about 2- fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 6- fold, or at least about 7-fold, or at least about 8-fold, or at least about 9-fold, or at least about 10- fold, or more than 10-fold as compared to either in the absence of a compound disclosed herein.
  • a therapeutically effective amount of a compound of the disclosure refers to an amount of the compound of the disclosure that will elicit the biological or medical response of a subject, for example, reduction or inhibition of an enzyme or a protein activity, or ameliorate symptoms, alleviate conditions, slow or delay disease progression, or prevent a disease, etc.
  • a therapeutically effective amount refers to the amount of the compound of the disclosure that, when administered to a subject, is effective to (1) at least partially alleviate, prevent and/or ameliorate a condition, or a disorder or a disease (i) mediated by WIZ, or (ii) associated with WIZ activity, or (iii) characterized by activity (normal or abnormal) of WIZ: (2) reduce or inhibit the activity of WIZ; or (3) reduce or inhibit the expression of WIZ.
  • a therapeutically effective amount refers to the amount of the compound of the disclosure that, when administered to a cell, or a tissue, or a non-cellular biological material, or a medium, is effective to at least partially reducing or inhibiting the activity of WIZ; or at least partially reducing or inhibiting the expression of WIZ.
  • HbF-dependent disease or disorder means any disease or disorder which is directly or indirectly affected by the modulation of HbF protein levels.
  • the term “subject” refers to primates (e.g., humans, male or female), dogs, rabbits, guinea pigs, pigs, rats and mice. In certain embodiments, the subject is a primate. In yet other embodiments, the subject is a human.
  • the term “inhibit”, “inhibition” or “inhibiting” refers to the reduction or suppression of a given condition, symptom, or disorder, or disease, or a significant decrease in the baseline activity of a biological activity or process.
  • the term “treat”, “treating” or “treatment” of any disease or disorder refers to alleviating or ameliorating the disease or disorder (i.e., slowing or arresting the development of the disease or at least one of the clinical symptoms thereof); or alleviating or ameliorating at least one physical parameter or biomarker associated with the disease or disorder, including those which may not be discernible to the patient.
  • the term “prevent”, “preventing” or “prevention” of any disease or disorder refers to the prophylactic treatment of the disease or disorder; or delaying the onset or progression of the disease or disorder
  • a subject is “in need of” a treatment if such subject would benefit biologically, medically or in quality of life from such treatment.
  • the term “a,” “an,” “the” and similar terms used in the context of the disclosure are to be construed to cover both the singular and plural unless otherwise indicated herein or clearly contradicted by the context.
  • Various enumerated embodiments of the disclosure are described herein.
  • Embodiment 1 A compound of formula (I’’) or a pharmaceutically acceptable salt thereof, wherein: is a single bond or a double bond; X is selected from CH, CF, and N; Y is selected from CH 2 , CR Y R 2 and N-R 3 ; Z is selected from CH 2 , CR Y R 2 and N-R 3 , wherein at least one of Y and Z is N-R 3 such that when Y is N-R 3 , Z is selected from CH 2 , and CR Y R 2 , and when Z is N-R 3 , Y is selected from CH 2 , and CR Y R 2 , and wherein when R 2 of CR Y R 2 of Y or Z is oxo, R Y is absent; R x is selected from hydrogen, C 1 -C 6 alkyl, halo (e.g.
  • Embodiment 2 A compound according to Embodiment 1, or a pharmaceutically acceptable salt thereof, having Formula (I’), wherein: is a single bond or a double bond; X is selected from CH, CF, and N; R’ is selected from hydrogen and C1-C6alkyl; R 1 is selected from hydrogen and C 1 -C 6 alkyl; each R 2 is independently selected from C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halo, and oxo, wherein the C 1 -C 6 alkyl is substituted with 0-1 occurrence of R 2a ; or 2 R 2 on non-adjacent carbon atoms together with the non-adjacent carbon atoms to which they are attached form a bridging ring; R 2a is selected from C 1 -C 6 alkoxyl and hydroxyl; R 3 is selected from hydrogen, C 1 -C 8 alkyl, C 2 -C 6 alkenyl, –SO 2 R 4
  • X is selected from CH, CF, and N;
  • R’ is selected from hydrogen and C 1 -C 6 alkyl;
  • R 1 is selected from hydrogen and C 1 -C 6 alkyl;
  • each R 2 is independently selected from C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halo, and oxo, wherein the C 1 -C 6 alkyl is substituted with 0-1 occurrence of R 2a ; or 2 R 2 on non-adjacent carbon atoms together with the non-adjacent carbon atoms to which they are attached form a bridging ring;
  • R 2a is selected from C 1 -C 6 alkoxyl and hydroxyl;
  • Embodiment 6 The compound according to any one of the preceding Embodiments, or a pharmaceutically acceptable salt thereof, wherein X is selected from CH and N; R’ is hydrogen; R 1 is hydrogen; each R 2 is independently selected from unsubstituted C 1 -C 6 alkyl and fluoro; R 3 is selected from C 1 -C 8 alkyl, –SO 2 R 4 and C 1 -C 6 haloalkyl, wherein the C 1 -C 8 alkyl is substituted with 0-2 occurrences of R 3a and the C 1 -C 6 haloalkyl is substituted with 0-1 occurrence of R 3a ; each R 3a is independently selected from C 3 -C 8 cycloalkyl, a 4- to 6-membered heterocyclyl comprising 1-2 heteroatoms independently selected from N and O, a 5- to 6- membered heteroaryl comprising 1-3 heteroatoms independently selected from N, O, and S, and phenyl, wherein the C 3
  • Embodiment 7 The compound according to any one of the preceding Embodiments, or a pharmaceutically acceptable salt thereof, wherein X is selected from CH and N; R’ is hydrogen; R 1 is hydrogen; each R 2 is independently C 1 -C 6 alkyl; R 3 is selected from C 1 -C 8 alkyl, –SO 2 R 4 and unsubstituted C 1 -C 6 haloalkyl, wherein the C 1 -C 8 alkyl is substituted with 0-2 occurrences of R 3a ; each R 3a is independently selected from C 3 -C 6 cycloalkyl, a 4- to 6-membered heterocyclyl comprising 1 O heteroatom, a 5- to 6-membered heteroaryl comprising 1-3 heteroatoms independently selected from N, O, and S, and phenyl, wherein the C 3 -C 6 cycloalkyl, 4- to 6-membered heterocyclyl, 5- to 6-membered heteroaryl and phenyl are substituted with
  • Embodiment 8 The compound according to any one of the preceding Embodiments, or a pharmaceutically acceptable salt thereof, wherein X is selected from CH and N; R’ is hydrogen; R 1 is hydrogen; each R 2 is independently selected from unsubstituted C 1 -C 3 alkyl; R 3 is selected from C 1 -C 6 alkyl, –SO 2 R 4 and unsubstituted C 1 -C 6 haloalkyl, wherein the C 1 -C 6 alkyl is substituted with 0-2 occurrences of R 3a ; each R 3a is independently selected from C 3 -C 6 cycloalkyl, a 4- to 6-membered heterocyclyl comprising 1 O heteroatom, a 6-membered heteroaryl comprising 1-2 N heteroatoms, and phenyl, wherein the C 4 -C 6 cycloalkyl, 4- to 6-membered heterocyclyl, 6- membered heteroaryl and phenyl are substituted with 0-2 occurrence
  • Embodiment 10 The compound according to any one of the preceding Embodiments, or a pharmaceutically acceptable salt thereof, of Formula (Ia’): Embodiment 11.
  • Embodiment 16 The compound according to any one of Embodiments 1 to 10, 12, 13 and 15, or a pharmaceutically acceptable salt thereof, of Formula (Ic’), wherein: is a single bond or a double bond; X is selected from CH, C-F and N; R 2b is selected from hydrogen, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, and halo, wherein the C 1 - C 6 alkyl is substituted with 0-1 occurrence of R 2a ; R 2c is selected from hydrogen and C 1 -C 6 alkyl, wherein the C 1 -C 6 alkyl is substituted with 0-1 occurrence of R 2a ; or R 2b and R 2c together with the carbon atoms to which they are attached form an oxo group; each of R 2d and R 2e is independently selected from hydrogen, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halo, and oxo, wherein the C
  • Embodiment 17 The compound according to any one of the preceding Embodiments, or a pharmaceutically acceptable salt thereof, of Formula (Ic), wherein: X is selected from CH, C-F and N; R 2b is selected from hydrogen, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, and halo, wherein the C 1 - C 6 alkyl is substituted with 0-1 occurrence of R 2a ; R 2c is selected from hydrogen and C 1 -C 6 alkyl, wherein the C 1 -C 6 alkyl is substituted with 0-1 occurrence of R 2a ; or R 2b and R 2c together with the carbon atoms to which they are attached form an oxo group; each of R 2d and R 2e is independently selected from hydrogen, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halo, and oxo, wherein the C 1 -C 6 alkyl is substituted with 0-1
  • Embodiment 19 The compound according to any one of Embodiments 15 to 18, or a pharmaceutically acceptable salt thereof, wherein X is selected from CH and N; each of R 2b , R 2c , R 2d and R 2e is independently selected from hydrogen and unsubstituted C 1 -C 3 alkyl; R 2f is hydrogen; R 3 is selected from C 1 -C 8 alkyl, –SO 2 R 4 , and C 1 -C 6 haloalkyl, wherein the C 1 -C 8 alkyl and C 1 -C 6 haloalkyl are independently substituted with 0-3 occurrences of R 3a ; each R 3a is independently selected from C 3 -C 10 cycloalkyl, a 4- to 6-membered heterocyclyl comprising 1-2 heteroatoms independently selected from N, O and S, a 5- to 10- membered heteroaryl comprising 1-4 heteroatoms independently selected from N, O, and S, and phenyl, wherein the C 3
  • Embodiment 20 The compound according to any one of Embodiments 15 to 19, or a pharmaceutically acceptable salt thereof, wherein X is selected from CH and N; each of R 2b , R 2d and R 2e is independently selected from hydrogen and unsubstituted C 1 - C 3 alkyl; R 2c is hydrogen; R 2f is hydrogen; R 3 is selected from C 1 -C 8 alkyl,–SO 2 R 4 , and C 1 -C 6 haloalkyl, wherein the C 1 -C 8 alkyl is substituted with 0-2 occurrences of R 3a and the C 1 -C 6 haloalkyl is substituted with 0-1 occurrence of R 3a ; each R 3a is independently selected from C 3 -C 8 cycloalkyl, a 4- to 6-membered heterocyclyl comprising 1-2 heteroatoms independently selected from N, O and S, a 5- to 10- membered heteroaryl comprising 1-3 heteroatoms independently selected from N, O, and S
  • R 2b , R 2c and R 2e are defined according to any one of Embodiments 15 to 20.
  • Embodiment 22 The compound according to any one of the Embodiments 1, 2, 4 to 10, 15, 16 and 18 to 21, or a pharmaceutically acceptable salt thereof, of Formula (Id’), wherein: 2 b R 2 R , c and R 2e are defined according to any one of Embodiments 15 to 20.
  • Embodiment 23 The compound according to any one of the Embodiments 1 to 11 and 15 to 22, or a pharmaceutically acceptable salt thereof, of Formula (Id), wherein: R 2b , R 2c and R 2e are defined according to any one of Embodiments 15 to 20.
  • Embodiment 24 The compound according to any one of Embodiments 1, 4 to 9, 12, 15 and 18 to 21, or a pharmaceutically acceptable salt thereof, of Formula (Ie’’), wherein:
  • R 2b , R 2c and R 2e are defined according to any one of Embodiments 15 to 20.
  • Embodiment 25 The compound according to any one of Embodiments 1, 2, 4 to 10, 12, 13, 15, 16, 18 to 22 and 24, or a pharmaceutically acceptable salt thereof, of Formula (Ie’), wherein: 2 b 2c 2 R , R and R e are defined according to any one of Embodiments 15 to 20.
  • Embodiment 26 The compound according to any one of the preceding Embodiments, or a pharmaceutically acceptable salt thereof, of Formula (Ie), wherein: R 2b , R 2c and R 2e are defined according to any one of Embodiments 15 to 20.
  • Embodiment 27 The compound according to any one of the preceding Embodiments, or a pharmaceutically acceptable salt thereof, of Formula (Ie), wherein: R 2b , R 2c and R 2e are defined according to any one of Embodiments 15 to 20.
  • Embodiment 28 The compound according to any one of the preceding Embodiments, or a pharmaceutically acceptable salt thereof, wherein X is CH.
  • Embodiment 29 The compound according to any one of Embodiments 1 to 14, or a pharmaceutically acceptable salt thereof, wherein R 2 is unsubstituted C 1 -C 6 alkyl and n is 1.
  • Embodiment 30 The compound according to any one of the preceding Embodiments, wherein m is 1. Embodiment 31.
  • Embodiment 32 The compound according to any one of Embodiments 1 to 11, 15 to 23 and 27 to 30, or a pharmaceutically acceptable salt thereof, wherein R 3 is C 1 -C 6 alkyl, wherein the C 1 -C 6 alkyl is substituted with 1 occurrence of R 3a .
  • Embodiment 32 The compound according to any one of Embodiments 1 to 11, 15 to 23 and 27 to 30, or a pharmaceutically acceptable salt thereof, wherein R 3 is selected from methyl, ethyl, n-propyl, i-propyl, and –CH 2 -(CH 2 ) 0-1 -R 3a .
  • Embodiment 33 Embodiment 33.
  • Embodiment 37 The compound according to any one of Embodiments 15 to 28 and 30 to 36, or a pharmaceutically acceptable salt thereof, wherein each of R 2b and R 2e is independently selected from hydrogen and methyl; and R 2c is hydrogen.
  • Embodiment 38 The compound according to any one of Embodiments 15 to 28 and 30 to 35, or a pharmaceutically acceptable salt thereof, wherein each of R 2b and R 2e is independently selected from hydrogen and methyl; and R 2c is hydrogen.
  • Embodiment 41 The compound according to any one of Embodiments 1, 2, 4 to 10, 12, 13, 15, 16, 18 to 22, 24, 25 and 27 to 40, wherein is a double bond.
  • Embodiment 42 The compound according to any one of the preceding Embodiments, wherein is a single bond.
  • Embodiment 43 The compound according to Embodiment 1 or a pharmaceutically acceptable salt thereof, selected from:
  • Embodiment 44 The compound according to any one of the preceding Embodiments, or a pharmaceutically acceptable salt thereof, wherein the pharmaceutically acceptable salt is an acid addition salt.
  • Embodiment 45 A pharmaceutical composition comprising a therapeutically effective amount of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or excipient.
  • Embodiment 46 A compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, for use as a medicament.
  • Embodiment 47 is
  • a method of treating or preventing a disease or disorder in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt, thereof.
  • Embodiment 48 A method of treating or preventing a disorder that is affected by the reduction of WIZ protein levels, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof.
  • Embodiment 49 A method of treating or preventing a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof.
  • a method of treating a disease or disorder that is affected by the modulation of WIZ protein levels comprising administering to the patient in need thereof a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof.
  • Embodiment 50 A method of inhibiting WIZ protein expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof.
  • Embodiment 51 A method of degrading WIZ protein in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt, thereof.
  • Embodiment 52 A method of treating a disease or disorder that is affected by the modulation of WIZ protein levels comprising administering to the patient in need thereof a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof.
  • a method of inhibiting, reducing, or eliminating the activity of WIZ protein or WIZ protein expression comprising administering to the subject a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof.
  • Embodiment 53 A method of inducing or promoting fetal hemoglobin in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof.
  • a method of reactivating fetal hemoglobin production or expression in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof.
  • Embodiment 55 A method of increasing fetal hemoglobin expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof.
  • Embodiment 57. A method of treating a sickle cell disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof.
  • a method of treating beta-thalassemia in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof.
  • Embodiment 59 A method for reducing WIZ protein levels in a subject comprising the step of administering to a subject in need thereof a therapeutically effective amount of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof.
  • Embodiment 60 A compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, for use in treating or preventing a disease or disorder in a subject in need thereof.
  • Embodiment 61 A method of treating beta-thalassemia in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof.
  • Embodiment 62. A compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, for use in treating or preventing a disorder that is affected by the inhibition of WIZ protein levels, in a subject in need thereof.
  • Embodiment 65. A compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, for use in inhibiting, reducing, or eliminating the activity of WIZ protein or WIZ protein expression in a subject in need thereof.
  • Embodiment 66. A compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, for use in inducing or promoting fetal hemoglobin in a subject in need thereof.
  • Embodiment 70 is
  • Embodiment 71 A compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, for use in treating a sickle cell disease in a subject in need thereof.
  • Embodiment 71 A compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, for use in treating beta-thalassemia in a subject in need thereof.
  • Embodiment 72 A compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, for use in the treatment of a disease or disorder affected by an increase in fetal hemoglobin expression.
  • Embodiment 73 A compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, for use in the treatment of a disease or disorder affected by an increase in fetal hemoglobin expression.
  • Embodiment 74. A compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, for use in the treatment of a disease or disorder affected by the induction or promotion of fetal hemoglobin.
  • Embodiment 75 A compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, for use in the treatment of a disease or disorder affected by the reactivation of fetal hemoglobin production or expression.
  • Embodiment 77. A compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, for use in degrading WIZ protein in a subject in need thereof.
  • Embodiment 78. Use of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by the reduction of WIZ protein levels, inhibition of WIZ protein expression or degradation of WIZ protein.
  • Embodiment 80 Use of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by inducing or promoting fetal hemoglobin.
  • Embodiment 80 Use of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by reactivating fetal hemoglobin production or expression.
  • Embodiment 81 Use of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by increasing fetal hemoglobin expression.
  • Embodiment 82 Use of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for treating a disease or disorder that is affected by increasing fetal hemoglobin expression.
  • Embodiment 84 Use of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, in the treatment of a disease or disorder that is affected by the reduction of WIZ protein levels, inhibition of WIZ protein expression or degradation of WIZ protein.
  • Embodiment 84 Use of a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, in the treatment of a disease or disorder that is affected by inducing fetal hemoglobin, reactivating fetal hemoglobin production or expression, or increasing fetal hemoglobin expression.
  • Embodiment 85 The use according to Embodiment 83 or 84, wherein the disease or disorder is selected from sickle cell disease and beta-thalassemia.
  • Embodiment 86 A pharmaceutical combination comprising a compound according to any one of Embodiments 1 to 44, or a pharmaceutically acceptable salt thereof, and one or more additional therapeutic agent(s).
  • the compounds can be present in the form of one of the possible isomers or as mixtures thereof, for example as pure optical isomers, or as isomer mixtures, such as racemates and diastereomeric mixtures, depending on the number of asymmetric centres.
  • Optically active (R)- and (S)- isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques. If the compound contains a disubstituted or trisubstituted cycloalkyl, the cycloalkyl substituent(s) may have a cis- or trans-configuration.
  • the disclosure includes cis and trans configurations of substituted cycloalkyl groups as well as mixtures thereof. All tautomeric forms are also intended to be included.
  • salts refers to an acid addition or base addition salt of a compound of the disclosure. “Salts” include in particular “pharmaceutically acceptable salts”.
  • pharmaceutically acceptable salts refers to salts that retain the biological effectiveness and properties of the compounds of this disclosure and, which typically are not biologically or otherwise undesirable.
  • the compounds of the disclosure may be capable of forming acid and/or base salts by virtue of the presence of amino and/or carboxyl groups or groups similar thereto.
  • Pharmaceutically acceptable acid addition salts can be formed with inorganic acids and organic acids.
  • Inorganic acids from which salts can be derived include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like.
  • Organic acids from which salts can be derived include, for example, acetic acid, propionic acid, glycolic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, toluenesulfonic acid, sulfosalicylic acid, formic acid, trifluoroacetic acid, and the like.
  • Pharmaceutically acceptable base addition salts can be formed with inorganic and organic bases.
  • Inorganic bases from which salts can be derived include, for example, ammonium salts and metals from columns I to XII of the periodic table.
  • the salts are derived from sodium, potassium, ammonium, calcium, magnesium, iron, silver, zinc, and copper; particularly suitable salts include ammonium, potassium, sodium, calcium and magnesium salts.
  • Organic bases from which salts can be derived include, for example, primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, basic ion exchange resins, and the like. Certain organic amines include isopropylamine, benzathine, cholinate, diethanolamine, diethylamine, lysine, meglumine, piperazine and tromethamine.
  • the disclosure provides compounds in acetate, ascorbate, adipate, aspartate, benzoate, besylate, bromide/hydrobromide, bicarbonate/carbonate, bisulfate/sulfate, camphorsulfonate, caprate, chloride/hydrochloride, chlortheophyllonate, citrate, ethandisulfonate, formate, fumarate, gluceptate, gluconate, glucuronate, glutamate, glutarate, glycolate, hippurate, hydroiodide/iodide, isethionate, lactate, lactobionate, laurylsulfate, malate, maleate, malonate, mandelate, mesylate, methylsulphate, mucate, naphthoate, napsylate, nicotinate, nitrate, octadecanoate, oleate, oxalate, palmitate, pamoate,
  • the disclosure provides compounds in sodium, potassium, ammonium, calcium, magnesium, iron, silver, zinc, copper, isopropylamine, benzathine, cholinate, diethanolamine, diethylamine, lysine, meglumine, piperazine or tromethamine salt form.
  • pharmaceutically acceptable salts of compounds of formulae (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), and (Ie) are acid addition salts.
  • Isotopically Labelled Compounds Any formula given herein is also intended to represent unlabeled forms as well as isotopically labeled forms of the compounds. lsotopically labeled compounds have structures depicted by the formulas given herein except that one or more atoms are replaced by an atom having a selected atomic mass or mass number.
  • isotopes that can be incorporated into compounds of the disclosure include isotopes of hydrogen, carbon, nitrogen, oxygen, sulfur, fluorine, chlorine and iodine, such as 2 H, 3 H, 11 C, 13 C, 14 C, 18 O, 15 N, 18 F, 17 O, 18 O, 35 S, 36 Cl, 123 I, 1 24 I, 125 I respectively.
  • the disclosure includes various isotopically labeled compounds as defined herein, for example those into which radioactive isotopes, such as 3 H and 14 C, or those into which non-radioactive isotopes, such as 2 H and 13 C are present.
  • isotopically labelled compounds are useful in metabolic studies (with 14 C), reaction kinetic studies (with, for example 2 H or 3 H), detection or imaging techniques, such as positron emission tomography (PET) or single-photon emission computed tomography (SPECT) including drug or substrate tissue distribution assays, or in radioactive treatment of patients.
  • PET positron emission tomography
  • SPECT single-photon emission computed tomography
  • an 18 F compound may be particularly desirable for PET or SPECT studies.
  • Isotopically-labeled compounds of formulae (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ib), (Ic’’), (Ic’), (Ic), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), and (Ie) can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described in the accompanying Examples and General Schemes (e.g., General Schemes 1 to 5) using an appropriate isotopically-labeled reagent in place of the non-labeled reagent previously employed.
  • the hydrogens in the compound of Formula (I’’), Formula (I) or Formula (I’) are present in their normal isotopic abundances.
  • the hydrogens are isotopically enriched in deuterium (D)
  • the hydrogen(s) of the dihydrouracil (DHU) or the uracil portion in compounds of Formula (I) or Formula (I’) are enriched in D, for example, Deuterated dihydrouracil and uracil moities can be prepared as described in Hill, R. K. et al., Journal of Labelled Compounds and Radiopharmaceuticals, Vol. XXII, No.2, p.143-148.
  • deuterium in this context is regarded as a substituent of a compound of the formulae (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), and (Ie).
  • the concentration of such a heavier isotope, specifically deuterium, may be defined by the isotopic enrichment factor.
  • isotopic enrichment factor means the ratio between the isotopic abundance and the natural abundance of a specified isotope.
  • a substituent in a compound of this disclosure is denoted deuterium, such compound has an isotopic enrichment factor for each designated deuterium atom of at least 3500 (52.5% deuterium incorporation at each designated deuterium atom), at least 4000 (60% deuterium incorporation), at least 4500 (67.5% deuterium incorporation), at least 5000 (75% deuterium incorporation), at least 5500 (82.5% deuterium incorporation), at least 6000 (90% deuterium incorporation), at least 6333.3 (95% deuterium incorporation), at least 6466.7 (97% deuterium incorporation), at least 6600 (99% deuterium incorporation), or at least 6633.3 (99.5% deuterium incorporation).
  • solvates in accordance with the disclosure include those wherein the solvent of crystallization may be isotopically substituted, e.g., D 2 O, d 6 -acetone, d 6 - DMSO.
  • the solvent of crystallization may be isotopically substituted, e.g., D 2 O, d 6 -acetone, d 6 - DMSO.
  • co-crystals may be prepared from compounds of formulae (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), and (Ie) by known co-crystal forming procedures.
  • Such procedures include grinding, heating, co-subliming, co- melting, or contacting in solution compounds of formulae (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), and (Ie) with the co-crystal former under crystallization conditions and isolating co-crystals thereby formed.
  • Suitable co-crystal formers include those described in WO 2004/078163. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context.
  • any and all examples, or exemplary language (e.g., “such as”) provided herein is intended merely to better illuminate the disclosure and does not pose a limitation on the scope of the disclosure otherwise claimed.
  • Any asymmetric center (e.g., carbon or the like) of the compound(s) of the disclosure can be present in racemic or enantiomerically enriched, for example the (R)-, (S)- or (R,S)- configuration.
  • each asymmetric center is present in at least 10 % enantiomeric excess, at least 20 % enantiomeric excess, at least 30 % enantiomeric excess, at least 40 % enantiomeric excess, at least 50 % enantiomeric excess, at least 60 % enantiomeric excess, at least 70 % enantiomeric excess, at least 80 % enantiomeric excess, at least 90 % enantiomeric excess, at least 95 % enantiomeric excess, or at least 99 % enantiomeric excess.
  • each asymmetric center is present in at least 50 % enantiomeric excess, at least 60 % enantiomeric excess, at least 70 % enantiomeric excess, at least 80 % enantiomeric excess, at least 90 % enantiomeric excess, at least 95 % enantiomeric excess, or at least 99 % enantiomeric excess.
  • compounds of the disclosure can be present in a racemic mixture or in enantiomerically enriched form or in an enantiopure form or as a mixture of diastereoisomers.
  • the term " on a C-sp 3 indicates the absolute stereochemistry, either (R) or (S).
  • the term “ on a C-sp 3 indicates the absolute stereochemistry, either (R) or (S).
  • the term “ on a C-sp 3 represents a covalent bond wherein the stereochemistry of the bond is not defined. This means that the term “ " on a C-sp 3 comprises an (S) configuration or an (R) configuration of the respective chiral centre. Furthermore, mixtures may also be present.
  • mixtures of stereoisomers e.g., mixtures of enantiomers, such as racemates, and/or mixtures of diastereoisomers are encompassed by the present disclosure.
  • R 2 in formula (I’’), (I’) or (I), as represented by a bond ( ) this means the asymmetric center has either a (R)- or (S)- configuration, or exists as a mixture thereof and stated as such.
  • a compound of the disclosure can be in the form of one of the possible stereoisomers, rotamers, atropisomers, tautomers or mixtures thereof, for example, as substantially pure geometric (cis or trans) stereoisomers, diastereomers, optical isomers, racemates or mixtures thereof. Any resulting mixtures of stereoisomers can be separated on the basis of the physicochemical differences of the constituents, into the pure or substantially pure geometric or optical isomers, diastereomers, racemates, for example, by chromatography and/or fractional crystallization.
  • Any resulting racemates of compounds of the disclosure or of intermediates can be resolved into the optical isomers (enantiomers) by known methods, e.g., by separation of the diastereomeric salts thereof, obtained with an optically active acid or base, and liberating the optically active acidic or basic compound.
  • a basic moiety may thus be employed to resolve the compounds of the disclosure into their optical antipodes, e.g., by fractional crystallization of a salt formed with an optically active acid, e.g., tartaric acid, dibenzoyl tartaric acid, diacetyl tartaric acid, di-O,O'-p-toluoyl tartaric acid, mandelic acid, malic acid or camphor- 10-sulfonic acid.
  • Racemic compounds of the disclosure or racemic intermediates can also be resolved by chiral chromatography, e.g., high pressure liquid chromatography (HPLC) using a chiral adsorbent.
  • the compounds of the disclosure can also be obtained in the form of their hydrates, or include other solvents used for their crystallization.
  • the compounds of the disclosure may inherently or by design form solvates with pharmaceutically acceptable solvents (including water); therefore, it is intended that the disclosure embrace both solvated and unsolvated forms.
  • solvate refers to a molecular complex of a compound of the disclosure (including pharmaceutically acceptable salts thereof) with one or more solvent molecules.
  • solvent molecules are those commonly used in the pharmaceutical art, which are known to be innocuous to the recipient, e.g., water, ethanol, and the like.
  • hydrate refers to the complex where the solvent molecule is water.
  • solvates can be identified by a person of skill in the art with tools such as NMR.
  • the compounds of the disclosure, including salts, hydrates and solvates thereof, may inherently or by design form polymorphs.
  • Methods of Making The compounds of the disclosure can be prepared in a number of ways well known to those skilled in the art of organic synthesis. By way of example, compounds of the present disclosure can be synthesized using the methods described below, together with synthetic methods known in the art of synthetic organic chemistry, or variations thereon as appreciated by those skilled in the art. Generally, the compounds of formulae (I’’), (I’) and (I) can be prepared according to the Schemes provided infra.
  • a cross-coupling reaction such as a palladium (Pd)-catalysed coupling of I-1 with a boraneyl coupling partner of formula I-2A (prepared by hydroboration of an appropriate alkene with 9-BBN, for example) in the presence of a polar solvent, such as N,N-dimethylformamide (DMF), a suitable ligand such as dppf, and a base such as potassium carbonate (K 2 CO 3 ) can provide the cross-coupled product I-3 in Step 1, where X is CH.
  • a polar solvent such as N,N-dimethylformamide (DMF)
  • a suitable ligand such as dppf
  • K 2 CO 3 potassium carbonate
  • Cyclization of the primary amide and amino groups of I-3, with a carbonyl equivalent, such as 1,1’-carbonyldiimidazole (CDI) in the presence of an amine or carbonate base, such as diisopropylethylamine (DIPEA) or cesium carbonate (Cs 2 CO 3 ), and a polar solvent, such as acetonitrile to form a dihydrouracil moiety can give I-4 (step 2). Removal of the protecting group (e.g., Boc) under acidic conditions at room temperature can provide the free amine I-5 (step 3).
  • a carbonyl equivalent such as 1,1’-carbonyldiimidazole (CDI) in the presence of an amine or carbonate base, such as diisopropylethylamine (DIPEA) or cesium carbonate (Cs 2 CO 3 )
  • DIPEA diisopropylethylamine
  • Cs 2 CO 3 cesium carbonate
  • I-5 can then be converted to I-6 via a reductive amination (Step 4-i) with an appropriate aldehyde in the presence of a borohydride reagent, such as sodium borohydride acetate; alternatively, by an alkylation reaction (Step 4-ii) with an appropriate alkyl halide, mesylate, tosylate or triflate in the presence of an amine or carbonate base and polar solvent, such as diisopropylethylamine (DIPEA) or potassium carbonate (K 2 CO 3 ) and dimethylformamide (DMF); alternatively, by an amide coupling reaction (Step 4-iii) of the compound with an appropriate carboxylic acid, an activating agent, such as HATU, and a base such as DIPEA, when R 3 forms an amide with the nitrogen to which it is attached; or alternatively, by an acylation or sulfonylation reaction (Step 4-iv) with an appropriate acyl chloride or sulf
  • a suitable nitrogen protecting group represented by Z
  • an acid labile protecting group e.g., DMB
  • X, Y, Z, R 2 , R 3 , n, m and p are as defined herein, in particular according to any one of Embodiments 1 to 43.
  • a compound of Formula (X-1) or a salt thereof, 65 wherein: X is selected from CH, CF, and N; Y is selected from CH 2 , CR Y R 2 and N-R N ; Z is selected from CH 2 , CR Y R 2 and N-R N ; wherein at least one of Y and Z is N-R N such that when Y is N-R N , Z is selected from CH 2 , and CR Y R 2 , and when Z is N-R N , Y is selected from CH 2 , and CR Y R 2 , and wherein when R 2 of CR Y R 2 of Y or Z is oxo, R Y is absent; R Y is selected from hydrogen and C 1 -C 6 alkyl;
  • R Y is hydrogen.
  • the nitrogen protecting group PG is an acid labile protecting group.
  • the nitrogen protecting group PG is the Boc protecting group (tert- butyloxycarbonyl).
  • a compound of Formula (X) or a salt thereof wherein: X is selected from CH, CF, and N; R N is selected from hydrogen and a nitrogen protecting group (PG) (e.g., tert- butyloxycarbonyl (Boc)); each R 2 is independently selected from C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, halo, and oxo, wherein the C 1 -C 6 alkyl is substituted with 0-1 occurrence of R 2a ; or 2 R 2 on non-adjacent carbon atoms together with the non-adjacent carbon atoms to which they are attached form a bridging ring; R 2a is selected from C 1 -C 6 alkyl, C 1 -C 6 haloalkyl
  • the nitrogen protecting group PG is an acid labile protecting group. In an embodiment, the nitrogen protecting group PG is the Boc protecting group (tert- butyloxycarbonyl).
  • the salt of a compound of formula (X-1) or (X) is selected from a HCl and TFA salt. In a further embodiment, there is provided 3-((5-bromobenzo[d]isoxazol-3- yl)amino)propanamide or a salt thereof.
  • the disclosure provides to a process for the preparation of a compound of formula (I’’), (I’) or (I), in free form or in pharmaceutically acceptable salt form, comprising the step of: 1) coupling an aryl bromide of formula I-1 with a boraneyl coupling partner of formula I- 2A, V-2A or II-2B under cross coupling conditions, to give a compound of formula I-3) or V-3 as defined herein.
  • the boraneyl coupling partner of step 1 may optionally be prepared by hydroboration of a precursor alkene, e.g., with 9-BBN.
  • Cross coupling reaction conditions for any of the aforementioned process steps or hereinafter involve the use of a Pd catalyst in the presence of a phosphine ligand, such as Pd(OAc) 2 and RuPhos or Xphos, and a base such as cesium carbonate (Cs 2 CO 3 ), in the presence of a suitable sovent such as toluene, water, or a mixture thereof.
  • a phosphine ligand such as Pd(OAc) 2 and RuPhos or Xphos
  • a base such as cesium carbonate (Cs 2 CO 3 )
  • a suitable sovent such as toluene, water, or a mixture thereof.
  • Cyclization conditions for any of the aforementioned process steps or hereinafter involve the use of an organic coupling reagent, such as 1,1’-carbonyldiimidazole (CDI), in the presence of an amine or carbonate base, such as diisopropylethylamine (DIPEA) or cesium carbonate (Cs 2 CO 3 ), and a polar solvent, such as acetonitrile.
  • Reductive amination conditions for any of the aforementioned process steps or hereinafter involve the use of a corresponding aldehyde, a suitable hydride reagent, such as NaBH(OAc) 3 , a suitable solvent, such as DMF, the reaction conducted at room temperature (r.t.).
  • Alkylation reaction conditions for any of the aforementioned process steps or hereinafter involve the use of a corresponding alkyl halide, mesylate, tosylate or triflate in the presence of a suitable base, such as DIPEA, or a carbonate base such as K 2 CO 3 , a polar solvent, such as DMF, the reaction conducted at a suitable temperature, such as r.t. to 100 o C, e.g., 80 o C, optionally, under microwave.
  • a suitable base such as DIPEA, or a carbonate base such as K 2 CO 3
  • a polar solvent such as DMF
  • Amide coupling reaction conditions for any of the aforementioned process steps or hereinafter involve the use of a corresponding carboxylic acid, an activating agent, such as HATU, a suitable base, such as DIPEA or NMM, a suitable solvent, such as DMF, the reaction conducted at a suitable temperature, such as r.t., for a suitable amount of time, for example 12 hours.
  • Acylation or sulfonylation reaction conditions for any of the aforementioned process steps or hereinafter involve the use of a corresponding acyl chloride or sulfonyl chloride and a base such as DIPEA or TEA, in the presence of a suitable solvent such as DCM, the reaction conducted at a suitable temperature, such as r.t..
  • the disclosure relates to a compound of formula (I)-1, (X-1) or (X), or a salt thereof.
  • the disclosure relates to the use of a compound of formula (I)-1, (X-1) or (X), or a salt thereof, in the manufacture of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie).
  • compositions in another aspect, the disclosure provides a pharmaceutical composition comprising one or more compounds of described herein or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, and one or more pharmaceutically acceptable carriers.
  • pharmaceutical composition refers to a compound of the disclosure, or a pharmaceutically acceptable salt thereof, together with at least one pharmaceutically acceptable carrier, in a form suitable for oral or parenteral administration.
  • the term "pharmaceutically acceptable carrier” refers to a substance useful in the preparation or use of a pharmaceutical composition and includes, for example, suitable diluents, solvents, dispersion media, surfactants, antioxidants, preservatives, isotonic agents, buffering agents, emulsifiers, absorption delaying agents, salts, drug stabilizers, binders, excipients, disintegration agents, lubricants, wetting agents, sweetening agents, flavoring agents, dyes, and combinations thereof, as would be known to those skilled in the art (see, for example, Remington The Science and Practice of Pharmacy, 22 nd Ed. Pharmaceutical Press, 2013, pp.1049-1070).
  • the disclosure provides a pharmaceutical composition
  • a pharmaceutical composition comprising a compound of the disclosure, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
  • the composition comprises at least two pharmaceutically acceptable carriers, such as those described herein.
  • solvates and hydrates are generally considered compositions.
  • pharmaceutically acceptable carriers are sterile.
  • the pharmaceutical composition can be formulated for particular routes of administration such as oral administration, parenteral administration, and rectal administration, etc.
  • compositions of the disclosure can be made up in a solid form (including without limitation capsules, tablets, pills, granules, powders or suppositories), or in a liquid form (including without limitation solutions, suspensions or emulsions).
  • the pharmaceutical compositions can be subjected to conventional pharmaceutical operations such as sterilization and/or can contain conventional inert diluents, lubricating agents, or buffering agents, as well as adjuvants, such as preservatives, stabilizers, wetting agents, emulsifiers and buffers, etc.
  • the pharmaceutical compositions are tablets or gelatin capsules comprising the active ingredient together with one or more of: a) diluents, e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine; b) lubricants, e.g., silica, talcum, stearic acid, its magnesium or calcium salt and/or polyethyleneglycol; c) binders, e.g., magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidone; d) disintegrants, e.g., starches, agar, alginic acid or its sodium salt, or effervescent mixtures; and e) absorbents, colorants, flavors and sweeteners.
  • diluents e.g., lactose, dextrose, sucrose, mann
  • the pharmaceutical compositions are capsules comprising the active ingredient only. Tablets may be either film coated or enteric coated according to methods known in the art.
  • suitable compositions for oral administration include an effective amount of a compound of the disclosure in the form of tablets, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs, solutions or solid dispersion.
  • Compositions intended for oral use are prepared according to any method known in the art for the manufacture of pharmaceutical compositions and such compositions can contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations.
  • Tablets may contain the active ingredient in admixture with nontoxic pharmaceutically acceptable excipients, which are suitable for the manufacture of tablets.
  • excipients are, for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example, starch, gelatin or acacia; and lubricating agents, for example magnesium stearate, stearic acid or talc.
  • the tablets are uncoated or coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
  • a time delay material such as glyceryl monostearate or glyceryl distearate can be employed.
  • Formulations for oral use can be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example, peanut oil, liquid paraffin or olive oil.
  • Certain injectable compositions are aqueous isotonic solutions or suspensions, and suppositories are advantageously prepared from fatty emulsions or suspensions.
  • compositions may be sterilized and/or contain adjuvants, such as preserving, stabilizing, wetting or emulsifying agents, solution promoters, salts for regulating the osmotic pressure and/or buffers. In addition, they may also contain other therapeutically valuable substances.
  • Said compositions are prepared according to conventional mixing, granulating or coating methods, respectively, and contain about 0.1-75%, or contain about 1-50%, of the active ingredient.
  • Suitable compositions for transdermal application include an effective amount of a compound of the disclosure with a suitable carrier.
  • Carriers suitable for transdermal delivery include absorbable pharmacologically acceptable solvents to assist passage through the skin of the host.
  • transdermal devices are in the form of a bandage comprising a backing member, a reservoir containing the compound optionally with carriers, optionally a rate controlling barrier to deliver the compound of the skin of the host at a controlled and predetermined rate over a prolonged period of time, and means to secure the device to the skin.
  • Suitable compositions for topical application e.g., to the skin and eyes, include aqueous solutions, suspensions, ointments, creams, gels or sprayable formulations, e.g., for delivery by aerosol or the like.
  • topical delivery systems will in particular be appropriate for dermal application, e.g., for the treatment of skin cancer, e.g., for prophylactic use in sun creams, lotions, sprays and the like. They are thus particularly suited for use in topical, including cosmetic, formulations well-known in the art. Such may contain solubilizers, stabilizers, tonicity enhancing agents, buffers and preservatives. As used herein a topical application may also pertain to an inhalation or to an intranasal application.
  • a dry powder either alone, as a mixture, for example a dry blend with lactose, or a mixed component particle, for example with phospholipids
  • a dry powder inhaler or an aerosol spray presentation from a pressurised container, pump, spray, atomizer or nebuliser, with or without the use of a suitable propellant.
  • WIZ modulating properties or WIZ degrading properties or HbF inducing properties e.g., as indicated in the in vitro tests as provided in the examples, and are therefore indicated for therapy or for use as research chemicals, e.g., as tool compounds.
  • Additional properties of the disclosed compounds include having good potency in the biological assays described herein, favorable safety profile, and possess favorable pharmacokinetic properties.
  • Diseases and Disorders In an embodiment of the present disclosure, there is provided a compound of the disclosure, or a pharmaceutically acceptable salt thereof, which is effective in reducing WIZ protein expression levels and/or inducing fetal hemoglobin (HbF) expression.
  • the compounds of the disclosure can be used to treat one or more of the diseases or disorders described herein below.
  • the disease or disorder is affected by the reduction of WIZ protein expression levels and/or induction of fetal hemoglobin protein expression levels.
  • the disease or disorder is a hemoglobinopathy, e.g., beta hemoglobinopathy, including sickle cell disease (SCD) and beta-thalassemia.
  • a hemoglobinopathy e.g., beta hemoglobinopathy, including sickle cell disease (SCD) and beta-thalassemia.
  • SCD sickle cell disease
  • HbF fetal hemoglobin
  • compounds of formulae (I’’), (I’), (I), (Ia’’), (Ia’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), and (Ie), in free or pharmaceutically acceptable salt form are useful in the treatment of conditions which may be treated by modulation of WIZ protein expression levels, reduction of WIZ protein expression levels, or induction of fetal hemoglobin (HbF), such as in a blood disorder, for example an inherited blood disorder, e.g., sickle cell disease, or beta-thalassemia.
  • HbF fetal hemoglobin
  • the disclosure provides a method of treating or preventing a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
  • the disclosure provides a method of treating or preventing a disorder that is affected by the reduction of WIZ protein levels, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
  • the disclosure provides a method of inhibiting WIZ protein expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
  • the disclosure provides a method of degrading WIZ protein in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
  • the disclosure provides a method of inhibiting, reducing, or eliminating the activity of WIZ protein or WIZ protein expression, the method comprising administering to the subject a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
  • the disclosure provides a method of inducing or promoting fetal hemoglobin in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
  • the disclosure provides a method of reactivating fetal hemoglobin production or expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
  • the disclosure provides a method of increasing fetal hemoglobin expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
  • the disclosure provides a method of treating a hemoglobinopathy, e.g., a beta-hemoglobinopathy, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
  • a hemoglobinopathy e.g., a beta-hemoglobinopathy
  • the disclosure provides a method of treating a sickle cell disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
  • the disclosure provides a method of treating beta-thalassemia in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.
  • the beta-thalassemia major or intermedia is the result of homozygous null or compound heterozygous mutations resulting with beta-globin deficiency and the phenotypic complications of beta-thalassemia, whether transfusion-dependent or not.
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of treating or preventing a disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of treating or preventing a disorder that is affected by the reduction of WIZ protein levels, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of inhibiting WIZ protein expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’),
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of degrading WIZ protein in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’),
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of inhibiting, reducing, or eliminating the activity of WIZ protein or WIZ protein expression, the method comprising administering to the subject a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of inducing or promoting fetal hemoglobin in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of reactivating fetal hemoglobin production or expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id),
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of increasing fetal hemoglobin expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of treating a hemoglobinopathy, e.g., a beta-hemoglobinopathy, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of treating a sickle cell disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’
  • the disclosure provides a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof for use in a method of treating beta-thalassemia in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’
  • the beta-thalassemia major or intermedia is the result of homozygous null or compound heterozygous mutations resulting with beta-globin deficiency and the phenotypic complications of beta-thalassemia, whether transfusion-dependent or not.
  • Dosage The pharmaceutical composition or combination of the disclosure can be in unit dosage of about 1-1000 mg of active ingredient(s) for a subject of about 50-70 kg, or about 1-500 mg or about 1-250 mg or about 1-150 mg or about 0.5-100 mg, or about 1-50 mg of active ingredients.
  • the therapeutically effective dosage of a compound, the pharmaceutical composition, or the combinations thereof is dependent on the species of the subject, the body weight, age and individual condition, the disorder or disease or the severity thereof being treated.
  • the above-cited dosage properties are demonstrable in vitro and in vivo tests using advantageously mammals, e.g., mice, rats, dogs, monkeys or isolated organs, tissues and preparations thereof.
  • the compounds of the disclosure can be applied in vitro in the form of solutions, e.g., aqueous solutions, and in vivo either enterally, parenterally, advantageously intravenously, e.g., as a suspension or in aqueous solution.
  • the dosage in vitro may range between about 10 -3 molar and 10 -9 molar concentrations.
  • a therapeutically effective amount in vivo may range depending on the route of administration, between about 0.1-500 mg/kg, or between about 1-100 mg/kg.
  • the disclosure provides a pharmaceutical combination comprising a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof, and one or more additional therapeutic agent(s) for simultaneous, separate or sequential use in therapy.
  • the additional therapeutic agent is a myelosuppressive agent, such as hydroxyurea.
  • Combination therapy includes the administration of the subject compounds in further combination with other biologically active ingredients (such as, but not limited to, a second and different antineoplastic agent or a therapeutic agent that targets HbF or another cancer target) and non-drug therapies (such as, but not limited to, surgery or radiation treatment).
  • the compounds of the application can be used in combination with other pharmaceutically active compounds, preferably compounds that are able to enhance the effect of the compounds of the application.
  • the compound of the disclosure may be administered either simultaneously with, or before or after, one or more other therapeutic agents.
  • the compound of the disclosure may be administered separately, by the same or different route of administration, or together in the same pharmaceutical composition as the other agents.
  • a therapeutic agent is, for example, a chemical compound, peptide, antibody, antibody fragment or nucleic acid, which is therapeutically active or enhances the therapeutic activity when administered to a patient in combination with a compound of the disclosure.
  • the disclosure provides a combination comprising a therapeutically effective amount of a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), or a pharmaceutically acceptable salt thereof and one or more additional therapeutically active agents.
  • the disclosure provides a product comprising a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), and at least one other therapeutic agent as a combined preparation for simultaneous, separate or sequential use in therapy.
  • the therapy is the treatment of a disease or condition modulated by WIZ.
  • Products provided as a combined preparation include a composition comprising the compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), and the other therapeutic agent(s) together in the same pharmaceutical composition, or the compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ib’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), and the other therapeutic agent(s) in separate form, e.g., in the form of a kit.
  • the disclosure provides a pharmaceutical composition
  • a pharmaceutical composition comprising a compound of formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie), and another therapeutic agent(s).
  • the pharmaceutical composition may comprise a pharmaceutically acceptable carrier, as described above.
  • the disclosure provides a kit comprising two or more separate pharmaceutical compositions, at least one of which contains a formula (I’’), (I’), (I), (Ia’’), (Ia’), (Ia), (Ia), (Ib’’), (Ib’), (Ib), (Ic’’), (Ic’), (Ic), (Id’’), (Id’), (Id), (Ie’’), (Ie’), or (Ie).
  • the kit comprises means for separately retaining said compositions, such as a container, divided bottle, or divided foil packet.
  • An example of such a kit is a blister pack, as typically used for the packaging of tablets, capsules and the like.
  • the kit of the disclosure may be used for administering different dosage forms, for example, oral and parenteral, for administering the separate compositions at different dosage intervals, or for titrating the separate compositions against one another.
  • the kit of the disclosure typically comprises directions for administration.
  • the compound of the disclosure and the other therapeutic agent may be manufactured and/or formulated by the same or different manufacturers.
  • the compound of the disclosure and the other therapeutic may be brought together into a combination therapy: (i) prior to release of the combination product to physicians (e.g., in the case of a kit comprising the compound of the disclosure and the other therapeutic agent); (ii) by the physician themselves (or under the guidance of the physician) shortly before administration; (iii) in the patient themselves, e.g., during sequential administration of the compound of the disclosure and the other therapeutic agent.
  • physicians e.g., in the case of a kit comprising the compound of the disclosure and the other therapeutic agent
  • physician e.g., in the case of a kit comprising the compound of the disclosure and the other therapeutic agent
  • by the physician themselves or under the guidance of the physician
  • in the patient themselves e.g., during sequential administration of the compound of the disclosure and the other therapeutic agent.
  • Such functional groups include hydroxy, phenol, amino and carboxylic acid.
  • Suitable protecting groups for hydroxy or phenol include trialkylsilyl or diarylalkylsilyl (e.g., t- butyldimethylsilyl, t-butyldiphenylsilyl or trimethylsilyl), tetrahydropyranyl, benzyl, substituted benzyl, methyl, and the like.
  • Suitable protecting groups for amino, amidino and guanidino include t-butoxycarbonyl, benzyloxycarbonyl, and the like.
  • Suitable protecting groups for carboxylic acid include alkyl, aryl or arylalkyl esters.
  • Protecting groups may be added or removed in accordance with standard techniques, which are well-known to those skilled in the art and as described herein. The use of protecting groups is described in detail in J. F. W. McOmie, “Protective Groups in Organic Chemistry", Plenum Press, London and New York 1973; T. W. Greene and P. G. M. Wuts, “Greene's Protective Groups in Organic Synthesis", Fourth Edition, Wiley, New York 2007; P. J.
  • the protecting group may also be a polymer resin, such as a Wang resin or a 2-chlorotrityl- chloride resin.
  • starting components and reagents may be obtained from sources such as Sigma Aldrich, Lancaster Synthesis, Inc., Maybridge, Matrix Scientific, TCI, and Fluorochem USA, Strem, other commercial vendors, or synthesized according to sources known to those skilled in the art, or prepared as described in this disclosure.
  • Analytical Methods, Materials, and Instrumentation Unless otherwise noted, reagents and solvents were used as received from commercial suppliers.
  • Proton nuclear magnetic resonance (NMR) spectra were obtained on either Bruker Avance spectrometer or Varian Oxford 400 MHz spectrometer unless otherwise noted. Spectra are given in ppm ( ⁇ ) and coupling constants, J, are reported in Hertz.
  • Tetramethylsilane was used as an internal standard. Chemical shifts are reported in ppm relative to dimethyl sulfoxide ( ⁇ 2.50), methanol ( ⁇ 3.31), chloroform ( ⁇ 7.26) or other solvent as indicated in NMR spectral data. A small amount of the dry sample (2-5 mg) is dissolved in an appropriate deuterated solvent (1 mL). The chemical names were generated using ChemBioDraw Ultra v12 from CambridgeSoft. Mass spectra (ESI-MS) were collected using a Waters System (Acquity UPLC and a Micromass ZQ mass spectrometer) or Agilent-1260 Infinity (6120 Quadrupole); all masses reported are the m/z of the protonated parent ions unless recorded otherwise.
  • ESI-MS Mass spectra
  • the sample was dissolved in a suitable solvent such as MeCN, DMSO, or MeOH and was injected directly into the column using an automated sample handler.
  • a suitable solvent such as MeCN, DMSO, or MeOH
  • the analysis is performed on Waters Acquity UPLC system (Column: Waters Acquity UPLC BEH C181.7 ⁇ m, 2.1 x 30mm; Flow rate: 1 mL/min; 55°C (column temperature); Solvent A: 0.05% formic acid in water, Solvent B: 0.04% formic acid in MeOH; gradient 95% Solvent A from 0 to 0.10 min; 95% Solvent A to 20% Solvent A from 0.10 to 0.50 min; 20% Solvent A to 5% Solvent A from 0.50 to 0.60 min; hold at 5% Solvent A from 0.6 min to 0.8 min; 5% Solvent A to 95% Solvent A from 0.80 to 0.90 min; and hold 95% Solvent A from 0.90 to 1.15 min.
  • Step 1 (((3R)-4-(tert-butoxycarbonyl)-3-methylpiperazin-1-ium-1-yl)methyl)trifluoroborate
  • tert-butyl (R)-2-methylpiperazine-1-carboxylate (2.09 g, 15.7 mmol). The reaction mixture was stirred at 80 °C for 16 h.
  • reaction mixture was stirred for 90 min at rt.
  • Sodium triacetoxy borohydride (5.88 g, 27.8 mmol) was then added slowly at 0 oC.
  • the reaction mixture was stirred at rt for 16 h. After completion, the reaction was diluted with DCM and water and the organic layer was dried over Na 2 SO 4 , filtered and and concentrated.
  • reaction mixture was stirred at -78 oC for 15 min and then a solution of tert-butyl (R)-3-(hydroxymethyl)-4-((tetrahydro- 2H-pyran-4-yl)methyl)piperazine-1-carboxylate (2.0 g, 6.4 mmol) in DCM (10 mL) was added dropwise at -78 oC.
  • the reaction mixture was stirred at -78 oC for 1 h and Et 3 N (8.93 mL, 63.6 mmol) was added slowly.
  • the reaction mixture was stirred at -78 oC for 1 h and allowed to warm to rt.
  • tert-butyl (R)-3-(difluoromethyl)-4-((tetrahydro-2H-pyran-4-yl)methyl)piperazine-1- carboxylate To a stirred solution of tert-butyl (R)-4-(cyclohexylmethyl)-3-formylpiperazine-1-carboxylate (2.4 g, 7.68 mmol) in DCM (30 mL) at 0 oC was added DAST (2.0 mL, 15.4 mmol) under an inert atmosphere. The reaction mixture was stirred at 0 oC for 2 h. After completion, the reaction was quenched with saturated aqueous NaHCO 3 solution and diluted with DCM.
  • tert-butyl (R)-3-(difluoromethyl)-4-methylpiperazine-1-carboxylate To a stirred solution of tert-butyl (R)-3-(difluoromethyl)piperazine-1-carboxylate [see US2019/144444, 2019, A1] (0.35 g, 1.48 mmol) and paraformaldehyde (0.089 g , 2.96 mmol) in DCM (20 mL) was added Et 3 N (0.41 mL, 2.96 mmol). The reaction mixture was stirred for 1 h at rt. Sodium triacetoxy borohydride (0.627 g, 2.96 mmol) was then added slowly at 0 oC.
  • Example 1 Preparation of 1-(5-((1-(cyclohexylmethyl)piperidin-4- yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione Step 1: 3-((5-bromobenzo[d]isoxazol-3-yl)amino)propanenitrile Cesium carbonate (2.39 g, 7.32 mmol) was added to a solution of 5-bromobenzo[d]isoxazol-3- amine (1.20 g, 5.63 mmol) and acrylonitrile (0.378 mL, 5.75 mmol) in MeCN (20 mL) at rt.
  • Step 2 3- bromobenzo[d]isoxazol-3-yl)amino)propanamide
  • Sulfuric acid (4 mL, 75 mmol) was added dropwise to a solution of 3-((5-bromobenzo[d]isoxazol- 3-yl)amino)propanenitrile (1.3 g, 4.9 mmol) in TFA (20 mL, 260 mmol) at rt.
  • the mixture was stirred overnight at rt.
  • the reaction mixture was then poured into ice water and stirred for 10 min.
  • the precipitate that formed was collected by filtration and washed with water followed by diethyl ether three times.
  • Step 3 tert-butyl 4-((3-((3-amino-3-oxopropyl)amino)benzo[d]isoxazol-5-yl)methyl)piperidine-1- carboxylate a) A vial containing tert-butyl 4-methylenepiperidine-1-carboxylate (400 mg, 2.03 mmol) was purged with nitrogen for 15 min and then a solution of 9-BBN (0.5M in THF, 4.07 mL, 2.03 mmol) was added. The vial was capped and the mixture was heated at 80 o C for 3.5 h and then cooled to rt.
  • 9-BBN 0.5M in THF, 4.07 mL, 2.03 mmol
  • Step 4 tert-butyl 4-((3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)benzo[d]isoxazol-5- yl)methyl)piperidine-1-carboxylate
  • Cesium carbonate (607 mg, 1.86 mmol) was added to a suspension of tert-butyl 4-((3-((3-amino- 3-oxopropyl)amino)benzo[d]isoxazol-5-yl)methyl)piperidine-1-carboxylate (500 mg, 1.24 mmol) and CDI (504 mg, 3.11 mmol) in acetonitrile (10 mL) at rt.
  • reaction mixture was then heated in a capped vial at 90 °C for 24 h.
  • the reaction was cooled to rt and diluted with ethyl acetate and washed sequentially with water and brine.
  • the organic layer was dried over Na 2 SO 4 , filtered and concentrated.
  • Step 5 1-(5-(piperidin-4-ylmethyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione hydrochloride (Example 1b)
  • a solution of HCl (4.0 M in dioxane, 4 mL, 16 mmol) was added to tert-butyl 4-((3-(2,4- dioxotetrahydropyrimidin-1(2H)-yl)benzo[d]isoxazol-5-yl)methyl)piperidine-1-carboxylate (250 mg, 0.583 mmol) and the mixture was stirred for 2 h at rt.
  • reaction mixture was stirred at rt for 5 min and then sodium triacetoxyborohydride (48.8 mg, 0.230 mmol) was added.
  • the reaction was stirred at rt for 60 min and then quenched with a solution of saturated aqueous NaHCO 3 .
  • the mixture was extracted twice with DCM and the combined organic layers were washed with brine, dried over Na 2 SO 4 , filtered and concentrated. The residue was dissolved in DMSO, filtered through a 1 micron filter and purified by reverse-phase HPLC using ACN / Water / 0.1% TFA.
  • Example 13 Preparation of 1-(5-((1-(2,2,2-trifluoroethyl)piperidin-4- yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione Step 1.
  • Step 1 tert-butyl (S)-2-methyl-4-methylenepiperidine-1-carboxylate.
  • methyltriphenylphosphonium bromide 5.02 g, 14.07 mmol
  • the mixture was stirred at rt for 2 h.
  • the mixture was cooled to 0 °C and a solution of tert-butyl (S)-2-methyl-4-oxopiperidine-1-carboxylate (2 g, 9.38 mmol) in THF (5 mL) was added slowly.
  • the reaction mixture was stirred at rt for 14 h.
  • the reaction mixture was quenched with a solution of saturated aqueous NH 4 Cl (50 mL) and extracted twice with EtOAc. The combined organic layers were concentrated to give the crude product.
  • the crude product was purified by flash silica gel chromatography (eluted with 0-10% EtOAc/petroleum ether) to give tert-butyl (S)-2-methyl-4-methylenepiperidine-1-carboxylate (1.7 g, 8.1 mmol, 86 % yield) as a yellow oil.
  • CDI (1.39 g, 8.62 mmol) and DIPEA (1.5 mL, 8.62 mmol) were added to a solution of tert-butyl (2S)-4-((3-((3-amino-3-oxopropyl)amino)benzo[d]isoxazol-5-yl)methyl)-2-methylpiperidine-1- carboxylate (900 mg, 2.15 mmol) in acetonitrile (20 mL) at rt.
  • Example 17 tert-butyl 3-((3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)benzo[d]isoxazol-5- yl)methyl)azetidine-1-carboxylate Prepared from tert-butyl 3-methyleneazetidine-1-carboxylate by the method of Example 1, steps 3-4. LCMS [M+H] + : 401.0.
  • Example 20 1-(5-((1-methylazetidin-3-yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine- 2,4(1H,3H)-dione Prepared from Example 18 by the method of Example 1, step 6 using acetaldehyde. LCMS [M+H] + : 315.4.
  • reaction mixture was stirred at rt for 10 min and then sodium triacetoxyborohydride (347 mg, 1.63 mmol) was added.
  • the reaction was stirred at rt for 2 h and then diluted with DCM and water.
  • the organic layer was dried over Na 2 SO 4 , filtered and concentrated.
  • the residue was dissolved in DMSO, filtered through a 1 micron filter and purified by reverse-phase HPLC using ACN / Water / 0.1% formic acid.
  • the compounds in the following table were prepared by the method of Example 21, using the appropriate commercially available aldehyde in step 4.
  • the compounds in the following table were prepared by the method of Example 21, using potassium (S)-((4-(tert-butoxycarbonyl)-3-methylpiperazin-1-yl)methyl)trifluoroborate [see ChemMedChem, 2016, 11, 2640-2648] in step 1 and the appropriate commercially available aldehyde in step 4.
  • Example 33 (R)-1-(5-((4-isobutyl-2-methylpiperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, using potassium (R)-((4-(tert-butoxycarbonyl)-2- methylpiperazin-1-yl)methyl)trifluoroborate [see J. Med. Chem. 2012, 55, 7796-7816] in step 1 and isobutyraldehyde in step 4. LCMS [M+H] + : 400.2.
  • Example 35 (S)-1-(5-((3-ethyl-4-methylpiperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, using potassium (S)-((4-(tert-butoxycarbonyl)-3- ethylpiperazin-1-yl)methyl)trifluoroborate in step 1 and acetaldehyde in step 4.
  • LCMS [M+H] + 372.3.
  • Example 36 (S)-1-(5-((3-ethyl-4-((tetrahydro-2H-pyran-4-yl)methyl)piperazin-1- yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione
  • (S)-(5-((3-ethyl-4-((tetrahydro-2H-pyran-4-yl)methyl)piperazin-1- yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, using potassium (S)-((4-(tert-butoxycarbonyl)-3- ethylpiperazin-1-yl)methyl)trifluoroborate in step 1 and tetrahydro-2H-pyran-4-carbaldehyde in step 4.
  • Example 37 (S)-1-(5-((3-isopropyl-4-methylpiperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, using potassium (S)-((4-(tert-butoxycarbonyl)-3- isopropylpiperazin-1-yl)methyl)trifluoroborate in step 1 and acetaldehyde in step 4.
  • LCMS [M+H] + 386.3.
  • Example 39 tert-butyl 4-((3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)benzo[d]isoxazol-5- yl)methyl)-1,4-diazepane-1-carboxylate Prepared by the method of Example 21, steps 1-2 using potassium ((4-(tert-butoxycarbonyl)-1,4- diazepan-1-yl)methyl)trifluoroborate in step 1.
  • LCMS [M+H] + 444.0.
  • Example 44 Preparation of 1-(5-((1-(cyclohexylmethyl)piperidin-3-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared using the method of Example 1 wherein tert-butyl 3-methylenepiperidine-1-carboxylate was used in place of tert-butyl 4-methylenepiperidine-1-carboxylate in step 3a. LCMS [M+H] + : 425.3.
  • Example 46 Preparation of 1-(5-((1-isobutylpiperidin-3-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared using the method of Example 1 wherein tert-butyl 3-methylenepiperidine-1-carboxylate was used in place of tert-butyl 4-methylenepiperidine-1-carboxylate in step 3a and isobutyraldehyde was used in place of cyclohexanecarbaldehyde in step 6. LCMS [M+H] + : 384.9.
  • Example 50 Preparation of 1-(5-((1-methylpyrrolidin-3-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared using the method of Example 1 wherein tert-butyl 3-methylenepyrrolidine-1-carboxylate was used in place of tert-butyl 4-methylenepiperidine-1-carboxylate in step 3a and paraformaldehyde was used in place of cyclohexanecarbaldehyde in step 6. LCMS [M+H] + : 329.2.
  • Example 52 Preparation of 1-(5-(azepan-4-ylmethyl)benzo[d]isoxazol-3-yl)dihydropyrimidine- 2,4(1H,3H)-dione Prepared using the method of Example 1b wherein tert-butyl 4-methyleneazepane-1-carboxylate was used in place of tert-butyl 4-methylenepiperidine-1-carboxylate in step 3a. LCMS [M+H] + : 343.2.
  • Example 53 Preparation of 1-(5-((1-methylazepan-4-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared using the method of Example 1 wherein tert-butyl 4-methyleneazepane-1-carboxylate was used in place of tert-butyl 4-methylenepiperidine-1-carboxylate in step 3a and paraformaldehyde was used in place of cyclohexanecarbaldehyde in step 6. LCMS [M+H] + : 357.2.
  • Example 54 (major product): tert-butyl (1R,5S)-3-((3-(2,4-dioxotetrahydropyrimidin-1(2H)- yl)benzo[d]isoxazol-5-yl)methyl)-8-azabicyclo[3.2.1]octane-8-carboxylate (20 mg, 0.044 mmol); LCMS [M+H] + : 455.2; chiral HPLC: (12.5 min).
  • Example 55 (minor product): tert-butyl (1R,5S)-3-((3-(2,4-dioxotetrahydropyrimidin-1(2H)- yl)benzo[d]isoxazol-5-yl)methyl)-8-azabicyclo[3.2.1]octane-8-carboxylate (10 mg, 0.022 mmol); LCMS [M+H-Boc] + : 355.2; chiral HPLC: (14.1 min).
  • Example 57 Preparation of 1-(5-(((1R,5S)-8-azabicyclo[3.2.1]octan-3- yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared from Example 55 using the method of Example 1b, step 5 wherein tert-butyl (1R,5S)-3- ((3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)benzo[d]isoxazol-5-yl)methyl)-8- azabicyclo[3.2.1]octane-8-carboxylate was used in place of tert-butyl 4-((3-(2,4- dioxotetrahydropyrimidin-1(2H)-yl)benzo[d]isoxazol-5-yl)methyl)piperidine-1-
  • Acetyl chloride (40 mg, 0.52 mmol) was added and the mixture was stirred at -20 °C for 20 min. The reaction was quenched with water and then extracted with EtOAc. The organic layer was dried over Na 2 SO 4 , filtered and concentrated. The residue was dissolved in DMSO, filtered through a 1 micron filter and purified by reverse-phase HPLC using ACN / Water / 0.1% formic acid.
  • Example 65 (R)-1-(5-((2,4-dimethylpiperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, step 4 wherein (R)-1-(5-((2-methylpiperazin-1- yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione hydrochloride was used in place of 1-(5-(piperazin-1-ylmethyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione hydrochloride and paraformaldehyde was used in place of cyclohexanecarbaldehyde.
  • Example 66 (R)-1-(5-((4-ethyl-2-methylpiperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, step 4 wherein (R)-1-(5-((2-methylpiperazin-1- yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione hydrochloride was used in place of 1-(5-(piperazin-1-ylmethyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione hydrochloride and acetaldehyde was used in place of cyclohexanecarbaldehyde.
  • Example 68 (R)-1-(5-((2-methyl-4-(oxetan-3-ylmethyl)piperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, step 4 wherein (R)-1-(5-((2-methylpiperazin-1- yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione hydrochloride was used in place of 1-(5-(piperazin-1-ylmethyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione hydrochloride and oxetane-3-carbaldehyde was used in place of cyclohexanecarbaldehyde.
  • Example 69 (R)-1-(5-((4-isopropyl-2-methylpiperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Potassium carbonate (120 mg, 0.872 mmol) and isopropyl iodide (75 mg, 0.44 mmol) were added to a solution of (R)-1-(5-((2-methylpiperazin-1-yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine- 2,4(1H,3H)-dione hydrochloride (150 mg, 0.436 mmol) in MeCN (5 mL) at rt.
  • Example 71 (R)-1-(5-((2-methyl-4-(methylsulfonyl)piperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 64 wherein methanesulfonyl chloride was used in place of acetyl chloride in step 4.
  • LCMS [M+H] + 422.2.
  • Example 72 (R)-1-(5-((4-(ethylsulfonyl)-2-methylpiperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 64 wherein ethanesulfonyl chloride was used in place of acetyl chloride in step 4. LCMS [M+H] + : 436.2.
  • Example 74 (R)-1-(5-((2-methyl-4-(pyrrolidin-1-ylsulfonyl)piperazin-1- yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 64 wherein pyrrolidine-1-sulfonyl chloride was used in place of acetyl chloride in step 4 and step 4 was carried out at rt. LCMS [M+H] + : 477.3.
  • Example 75 (R)-1-(5-((2-methyl-4-(pyrrolidine-1-carbonyl)piperazin-1- yl)methyl)benzo[d]isoxazol-3- H,3H)-dione Prepared by the method of Example 64 wherein pyrrolidine-1-carbonyl chloride was used in place of acetyl chloride in step 4 and step 4 was carried out at rt.
  • Example 76 (R)-N-cyclopentyl-4-((3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)benzo[d]isoxazol-5- yl)methyl)-3-methylpiperazine-1-carboxamide
  • isocyanatocyclopentane was used in place of acetyl chloride in step 4 and step 4 was carried out at rt.
  • LCMS [M+H] + 455.1.
  • the mixture was stirred at 80 °C for 3 h and then cooled to 0 °C and phenylsilane (68 mg, 0.63 mmol) was added.
  • the reaction was stirred in a capped vial at 80 °C for 3 h.
  • the reaction was cooled to rt, diluted with DCM and washed sequentially with water and brine.
  • the organic layer was dried over Na 2 SO 4 , filtered and concentrated.
  • the crude material was purified by reverse phase HPLC using ACN / water / 0.1% formic acid.
  • Example 78 (R)-1-(5-((2-methyl-4-(tetrahydro-2H-pyran-4-yl)piperazin-1- yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 77 wherein tetrahydro-4H-pyran-4-one was used in place of cyclobutanone. LCMS [M+H] + : 428.1.
  • Example 79 1-(5-((4-isopropylpiperazin-1-yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine- 2,4(1H,3H)-dione Prepared by the method of Example 77 wherein 1-(5-(piperazin-1-ylmethyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione hydrochloride was used in place of (R)-1-(5-((2- methylpiperazin-1-yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione hydrochloride and acetone was used in place of cyclobutanone.
  • Example 81 1-(5-((4-(tetrahydro-2H-pyran-4-yl)piperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 77 wherein 1-(5-(piperazin-1-ylmethyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione hydrochloride was used in place of (R)-1-(5-((2- methylpiperazin-1-yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione hydrochloride and tetrahydro-4H-pyran-4-one was used in place of cyclobutanone.
  • Example 82 (S)-1-(5-((3-methyl-4-(oxetan-3-yl)piperazin-1-yl) benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione
  • (S)-1-(5-((3-methylpiperazin-1- yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione hydrochloride was used in place of (R)-1-(5-((2-methylpiperazin-1-yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine- 2,4(1H,3H)-dione hydrochloride and oxetan-3-one was used in place of cyclobutanone.
  • Example 83 1-(5-((4-(methylsulfonyl)piperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 64, step 4 wherein 1-(5-(piperazin-1- ylmethyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione hydrochloride was used in place of (R)-1-(5-((2-methylpiperazin-1-yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine- 2,4(1H,3H)-dione hydrochloride and methanesulfonyl chloride was used in place of acetyl chloride.
  • Example 87 (R)-1-(5-((2-ethyl-4-methylpiperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, using potassium (R)-((4-(tert-butoxycarbonyl)-2- ethylpiperazin-1-yl)methyl)trifluoroborate in step 1 and paraformaldehyde in step 4.
  • LCMS [M+H] + 372.2.
  • Example 88 (R)-1-(5-((2-ethyl-4-isobutylpiperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, using potassium (R)-((4-(tert-butoxycarbonyl)-2- ethylpiperazin-1-yl)methyl)trifluoroborate in step 1 and isobutyraldehyde in step 4.
  • Example 90 (R)-1-(5-((4-isobutyl-2-isopropylpiperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, using potassium (R)-((4-(tert-butoxycarbonyl)-2- isopropylpiperazin-1-yl)methyl)trifluoroborate in step 1 and isobutyraldehyde in step 4.
  • LCMS [M+H] + 428.1.
  • Example 94 1-(5-((3,3,4-trimethylpiperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, using potassium (((1S,4S)-5-(tert-butoxycarbonyl)-2,5- diazabicyclo[2.2.1]heptan-2-yl)methyl)trifluoroborate in step 1 and paraformaldehyde in step 4.
  • LCMS [M+H] + 356.2.
  • Example 96 tert-butyl (1R,4R)-5-((3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)benzo[d]isoxazol-5- yl)methyl)-2,5-diazabicyclo[2.2.1]heptane-2-carboxylate
  • steps 1-2 using potassium (((1R,4R)-5-(tert- butoxycarbonyl)-2,5-diazabicyclo[2.2.1]heptan-2-yl)methyl)trifluoroborate in step 1.
  • Example 97 1-(5-(((1R,4R)-5-methyl-2,5-diazabicyclo[2.2.1]heptan-2- yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, using potassium (((1R,4R)-5-(tert-butoxycarbonyl)-2,5- diazabicyclo[2.2.1]heptan-2-yl)methyl)trifluoroborate in step 1 and paraformaldehyde in step 4.
  • LCMS [M+H] + 356.2.
  • Example 99 tert-butyl (1R,5S)-3-((3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)benzo[d]isoxazol-5- yl)methyl)-3,8-diazabicyclo[3.2.1]octane-8-carboxylate
  • steps 1-2 using potassium (((1R,5S)-8-(tert- butoxycarbonyl)-3,8-diazabicyclo[3.2.1]octan-3-yl)methyl)trifluoroborate in step 1.
  • LCMS [M+H] + 456.1.
  • Example 104 1-(5-(((1R,5S)-3-(methylsulfonyl)-3,8-diazabicyclo[3.2.1]octan-8- yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 64, step 4 wherein 1-(5-(((1R,5S)-3,8- diazabicyclo[3.2.1]octan-8-yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione hydrochloride was used in place of (R)-1-(5-((2-methylpiperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione hydrochloride and methanesulf
  • Example 106 1-(5-(((2S,5S)-2,4,5-trimethylpiperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, wherein potassium (((2S,5S)-4-(tert-butoxycarbonyl)-2,5- dimethylpiperazin-1-yl)methyl)trifluoroborate was used in place of potassium ((4-(tert- butoxycarbonyl)piperazin-1-yl)methyl)trifluoroborate in step 1 and paraformaldehyde was used in place of cyclohexanecarbaldehyde in step 4.
  • Example 107 1-(5-(((2S,5S)-2,5-dimethyl-4-((tetrahydro-2H-pyran-4-yl)methyl)piperazin-1- yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, wherein potassium (((2S,5S)-4-(tert-butoxycarbonyl)-2,5- dimethylpiperazin-1-yl)methyl)trifluoroborate was used in place of potassium ((4-(tert- butoxycarbonyl)piperazin-1-yl)methyl)trifluoroborate in step 1 and tetrahydro-2H-pyran-4- carbaldehyde was used in place of cyclohexanecarbaldehyde in step 4.
  • Example 108 1-(5-(((2R,6S)-2,4,6-trimethylpiperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, wherein potassium (((2S,6R)-4-(tert-butoxycarbonyl)- 2,6-dimethylpiperazin-1-yl)methyl)trifluoroborate was used in place of potassium ((4-(tert- butoxycarbonyl)piperazin-1-yl)methyl)trifluoroborate in step 1 and paraformaldehyde was used in place of cyclohexanecarbaldehyde in step 4.
  • Example 110 (R)-1-(5-((hexahydropyrazino[2,1-c][1,4]oxazin-8(1H)-yl)methyl)benzo[d]isoxazol- 3-yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, steps 1-2 wherein potassium (R)- trifluoro((hexahydropyrazino[2,1-c][1,4]oxazin-8(1H)-yl)methyl)borate was used in place of potassium ⁇ [4-(tert-butoxycarbonyl)-1-piperazinyl]methyl ⁇ (trifluoro)borate in step 1.
  • Example 111 (S)-1-(5-((hexahydropyrazino[2,1-c][1,4]oxazin-8(1H)-yl)methyl)benzo[d]isoxazol- 3-yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, steps 1-2 wherein potassium (S)- trifluoro((hexahydropyrazino[2,1-c][1,4]oxazin-8(1H)-yl)methyl)borate was used in place of potassium ⁇ [4-(tert-butoxycarbonyl)-1-piperazinyl]methyl ⁇ (trifluoro)borate in step 1.
  • Example 112 (S)-1-(5-((1,1-dioxidohexahydro-5H-isothiazolo[2,3-a]pyrazin-5- yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, steps 1-2 wherein potassium (S)-((1,1-dioxidohexahydro- 5H-isothiazolo[2,3-a]pyrazin-5-yl)methyl)trifluoroborate was used in place of potassium ⁇ [4-(tert- butoxycarbonyl)-1-piperazinyl]methyl ⁇ (trifluoro)borate in step 1.
  • Example 113 1-(5-((4-isobutyl-3-oxopiperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, steps 1-2 wherein potassium trifluoro((4-isobutyl-3- oxopiperazin-1-yl)methyl)borate was used in place of potassium ⁇ [4-(tert-butoxycarbonyl)-1- piperazinyl]methyl ⁇ (trifluoro)borate in step 1.
  • LCMS [M+H] + 400.3.
  • Example 114 (R)-1-(5-((4-isobutyl-3-(methoxymethyl)piperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 21, steps 1-2 wherein potassium (R)-trifluoro((4-isobutyl-3- (methoxymethyl)piperazin-1-yl)methyl)borate was used in place of potassium ⁇ [4-(tert- butoxycarbonyl)-1-piperazinyl]methyl ⁇ (trifluoro)borate in step 1.
  • LCMS [M+H] + 430.3.
  • cataCXium-A-Pd-G3 (20 mg, 0.028 mmol) was added the mixture degassed with argon for another minute. The mixture was stirred at 90 °C for 16 h, then cooled to rt and partitioned between EtOAc and water. The organic layer was separated, washed with brine, dried over sodium sulfate, filtered and concentrated.
  • reaction mixture was then heated at 90 °C for 24 h.
  • the reaction was cooled to rt and diluted with EtOAc and washed with water.
  • the organic layer was separated, dried over sodium sulfate, filtered and concentrated.
  • the residue was dissolved in DMSO, filtered through a 1 micron filter and purified by reverse-phase HPLC using ACN / Water / 0.1% formic acid.
  • Cesium carbonate (5.7 g, 17.2 mmol) and CDI (2.7 g, 17.2 mmol) were added to a solution of 3- ((5-vinylbenzo[d]isoxazol-3-yl)amino)propanamide (1.0 g, 4.3 mmol) in acetonitrile (50 mL) at rt.
  • the reaction mixture was then heated at 95 °C for 6 h.
  • the reaction was cooled to rt and diluted with EtOAc and washed with water.
  • Step 3.3-(4-methoxybenzyl)-1-(5-vinylbenzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione Cesium carbonate (2.5 g, 7.8 mmol) and PMBCl (1.1 mL, 7.8 mmol) were added to a solution of 1-(5-vinylbenzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione (1.0 g, 3.9 mmol) in acetonitrile (20 mL) at rt. The reaction mixture was stirred at rt for 4 h.
  • Example 117 (R)-1-(5-((3-(methoxymethyl)-4-methylpiperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 116, steps 5-6 wherein (R)-2-(methoxymethyl)-1- methylpiperazine [see US2014/323463, 2014, A1] was used in place of (R)- hexahydropyrazino[2,1-c][1,4]oxazin-4(3H)-one in step 5. LCMS [M+H] + : 388.0.
  • Example 119 1-(5-((4-cyclopropylpiperazin-1-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Step 1.
  • Cesium carbonate (0.303 g, 0.93 mmol) and PMBCl (83 mg, 0.53 mmol) were added to a solution of tert-butyl 4-((3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)benzo[d]isoxazol-5- yl)methyl)piperazine-1-carboxylate (0.3 g, 0.46 mmol) in acetonitrile (5 mL) at rt.
  • HCl 4.0 M in dioxane, 2 mL
  • 4-((3-(3-(4-methoxybenzyl)- 2,4-dioxotetrahydropyrimidin-1(2H)-yl)benzo[d]isoxazol-5-yl)methyl)piperazine-1-carboxylate 100 mg, 0.21 mmol
  • reaction mixture was stirred at rt for 1 h and then sodium triacetoxyborohydride (444 mg, 2.1 mmol) was added.
  • the reaction was stirred at rt for 14 h and then quenched with a solution of saturated aqueous NaHCO 3 .
  • the mixture was extracted twice with DCM and the combined organic layers were washed with brine, dried over Na 2 SO 4 , filtered and concentrated.
  • reaction mixture was stirred at rt for 1 h and then sodium triacetoxyborohydride (42 mg, 0.20 mmol) was added.
  • the reaction was stirred at rt for 4 h and then quenched with a solution of saturated aqueous NaHCO 3 .
  • Example 122 1-(5-((5-((tetrahydro-2H-pyran-4-yl)methyl)-2,5-diazabicyclo[2.2.2]octan-2- yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 121, from chiral Peak 2 in step 1. LCMS [M+H] + : 454.1.
  • Example 123 1-(5-((5-methyl-2,5-diazabicyclo[2.2.2]octan-2-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 121, from chiral Peak 1 in step 1 wherein paraformaldehyde was used in place of tetrahydro-2H-pyran-4-carbaldehyde in step 3. LCMS [M+H] + : 370.2.
  • Example 124 1-(5-((5-methyl-2,5-diazabicyclo[2.2.2]octan-2-yl)methyl)benzo[d]isoxazol-3- yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 121, from chiral Peak 2 in step 1 wherein paraformaldehyde was used in place of tetrahydro-2H-pyran-4-carbaldehyde in step 3. LCMS [M+H] + : 370.1.
  • Example 126 1-(5-((5-(methylsulfonyl)-2,5-diazabicyclo[2.2.2]octan-2- yl)methyl)benzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione Prepared by the method of Example 125, from chiral Peak 2 (Example 121, step 1) in step 1. LCMS [M+H] + : 434.1.
  • Example 127 1-(5-(1-(4-methylpiperazin-1-yl)ethyl)benzo[d]isoxazol-3-yl)dihydropyrimidine- 2,4(1H,3H)-dione Step 1.1-(5-bromobenzo[d]isoxazol-3-yl)dihydropyrimidine-2,4(1H,3H)-dione Cesium carbonate (4.59 g, 14.1 mmol) and CDI (2.28 g, 14.1 mmol) were added to a solution of 3-((5-bromobenzo[d]isoxazol-3-yl)amino)propanamide (1.0 g, 3.5 mmol) in acetonitrile (43 mL) at rt.
  • the mixture was stirred at 80 °C for 1 h and phenylsilane (0.2) was added.
  • the reaction was stirred at 80 °C for 12 h.
  • the reaction was cooled to rt, diluted with water and extracted with EtOAc. The organic layer was dried over Na 2 SO 4 , filtered and concentrated.
  • Step 1 5-bromo-4-methylbenzo[d]isoxazol-3-amine Potassium carbonate (0.77 g, 5.6 mmol) and acetohydroxamic acid (0.42 g, 5.6 mmol) were added to a solution of 3-bromo-6-fluoro-2-methylbenzonitrile (0.40 g, 1.9 mmol) in DMF (4 mL) at rt. The mixture was stirred at rt overnight. The reaction mixture was partitioned between EtOAc and water and the layers were separated.
  • Step 2 3-((5-bromo-4-methylbenzo[d]isoxazol-3-yl)amino)propanenitrile
  • Cesium carbonate (0.75 g, 2.3 mmol) was added to a solution of 5-bromo-4- methylbenzo[d]isoxazol-3-amine (0.40 g, 1.8 mmol) and acrylonitrile (0.12 mL, 1.8 mmol) in MeCN (8 mL) at rt.
  • MeCN 8 mL
  • the mixture was heated at 80 °C for 3 h.
  • the reaction mixture was cooled to rt and the orange suspension was filtered through celite, washing through with EtOAc.
  • Step 3 3-((5-bromo-4-methylbenzo[d]isoxazol-3-yl)amino)propanamide Sulfuric acid (1 mL) was added dropwise to a solution of 3-((5-bromo-4-methylbenzo[d]isoxazol- 3-yl)amino)propanenitrile (0.48 g, 1.7 mmol) in TFA (5 mL) at rt. The mixture was stirred overnight at rt. The reaction mixture was then poured into ice water and stirred for 10 min. The precipitate that formed was collected by filtration and washed with water followed by diethyl ether three times.
  • tert-butyl (S)-4-((3-(2,4-dioxotetrahydropyrimidin-1(2H)-yl)-4-methylbenzo[d]isoxazol-5- yl)methyl)-2-methylpiperazine-1-carboxylate Cesium carbonate (82 mg, 0.25 mmol) and CDI (68 mg, 0.42 mmol) was added to a solution of tert-butyl (S)-4-((3-((3-amino-3-oxopropyl)amino)-4-methylbenzo[d]isoxazol-5-yl)methyl)-2- methylpiperazine-1-carboxylate (90 mg, 0.21 mmol) in acetonitrile (2 mL) at rt.
  • reaction mixture was stirred at rt for 10 min and then sodium triacetoxyborohydride (43 mg, 0.20 mmol) was added.
  • the reaction was stirred at rt for 2 h and then diluted with DCM and water.
  • the organic layer was dried over Na 2 SO 4 , filtered and concentrated.
  • the residue was dissolved in DMSO, filtered through a 1 micron filter and purified by reverse-phase HPLC using ACN / Water / 0.1% formic acid.
  • the HiBit tag was derived from a split Nanoluciferase and has the following protein sequence: VSGWRLFKKIS (SEQ ID NO: 1).
  • the complementary fragment of Nanoluciferase (known as LgBit, from Promega), was added to the HiBit tag to form an active Nanoluciferase enzyme whose activity can be precisely measured.
  • LgBit the complementary fragment of Nanoluciferase
  • LgBit from Promega
  • Lentiviral vectors based on the InvitrogenTM pLenti6.2/V5 DEST backbone were constructed that places the HiBit tag upstream of WIZ and expressed the fusion protein from an HSVTK promotor.
  • HiBit-WIZ fusion protein To ensure moderate and consistent expression of the HiBit-WIZ fusion protein across all cells in the population, stable cell lines were constructed from cells harboring a single copy of the construct. Lentivirus packaged with the constructs were made using the ViraPowerTMkit from InvitrogenTM.293T cells from ATCC (Catalog number: CRL-3216), were infected with the virus at low multiplicity of infection and selected by 5 ⁇ g/mL blasticidin in culture media for 2 weeks. The levels of HiBit-WIZ tagged fusion proteins in compound-treated cell lines were measured as follows: On day 1, cells were diluted to 1.0 x 10 6 cells/ml in normal growth medium.20 ⁇ L of cell suspension were plated in each well of a solid white 384-well plate.
  • Table 1 Example 132: Small Molecule HbF Induction Assay Cryopreserved primary human CD34 + hematopoietic stem and progenitor cells were obtained from AllCells, LLC. The CD34 + cells were isolated from the peripheral blood of healthy donors after mobilization by administration of granulocyte colony-stimulating factor.
  • Cells were differentiated ex vivo toward the erythroid lineage using a 2-phase culture method.
  • SFEM StemSpanTM Serum-Free Expansion Media
  • rhSCF 50 ng/mL, Peprotech®, Inc.
  • rhIL-6 50 ng/mL, Peprotech®, Inc.
  • rhIL-3 50 ng/mL, Peprotech®, Inc.
  • rhFlt3L 50 ng/mL, Peprotech®, Inc.
  • 1X antibiotic-antimycotic Life Technologies, Thermo Fisher Scientific
  • Erythroid Differentiation Media is comprised of IMDM (Life Technologies) supplemented with insulin (10 ⁇ g/mL, Sigma Aldrich), heparin (2 U/mL Sigma Aldrich), holo-transferrin (330 ⁇ g/mL, Sigma Aldrich), human serum AB (5%, Sigma Aldrich), hydrocortisone (1 ⁇ M, STEMCELL Technologies), rhSCF (100 ng/mL, Peprotech®, Inc.), rhIL-3 (5 ng/mL, Peprotech®, Inc.), rhEPO (3 U/mL, Peprotech®, Inc.), and 1X antibiotic- antimycotic.
  • HbF-specific antibody 1:10-1:25, InvitrogenTM, MHFH04-4.
  • Stained cells were washed with phosphate-buffered saline before analysis on the FACSCantoTM II flow cytometer or LSRFortessaTM (BD Biosciences). Data analysis was performed with FlowJoTM Software (BD Biosciences).
  • HbF induction activity of compounds Table 2
  • mPB CD34+ cells were expanded for 6 days, then erythroid differentiated in the presence of compound for 7 days. Cells were fixed, stained and analyzed by flow cytometry.
  • the baseline %HbF+ cells for DMSO-treated cells is approximately 30-40%.
  • mPB CD34+ cells (AllCells, LLC) were maintained in StemSpanTM serum-free expansion media (SFEM) ( STEMCELL Technologies Inc.) supplemented with 50 ng/mL each of rhTPO, rhIL-6, rhFLT3L, rhSCF for 2-3 days prior to shRNA transduction or targeted ribonucleoprotein (RNP) electroporation targeting WIZ. All cytokines were obtained from Peprotech®, Inc. Cell cultures were maintained at 37°C and 5%CO 2 in a humidified tissue culture incubator.
  • SFEM StemSpanTM serum-free expansion media
  • Annealed double-stranded DNA oligonucleotides were ligated into pHAGE lentiviral backbone digested with PmeI/AscI using T4 DNA ligase kit (New England Biolabs). Ligation reactions were transformed into chemically competent Stbl3 cells (InvitrogenTM) according to the manufacturer’s protocol. Positive clones were verified using the sequencing primer (5’-ctacattttacatgatagg-3’; SEQ ID NO: 2) and plasmids were purified by Alta Biotech LLC.
  • Lentivirus particles for the respective shRNA constructs were generated by co-transfection of HEK293T cells with pCMV-dR8.91 and pCMV-VSV-G expressing envelope plasmid using Lipofectamine 3000 reagent in 150mm tissue culture dish format as per manufacturer’s instructions (InvitrogenTM). Lentivirus supernatant was harvested 48 hours after co-transfection, filtered through a 0.45 ⁇ m filter (Millipore) and concentrated using Amicon Ultra 15 with Ultracel- 100 membrane (Millipore). Infectious units of each of the lentivirus particle was determined by flow cytometry using eGFP expression as marker of transduction after serial dilution and infection of HEK293T cells.
  • shRNA sequences are as follows: shWIZ_#15’-AGCCCACAATGCCACGGAAAT-3’ (SEQ ID NO: 3); shWIZ_#25’-GCAACATCTACACCCTCAAAT-3’ (SEQ ID NO: 4); shWIZ_#45’-TGACCGAGTGGTACGTCAATG-3’ (SEQ ID NO: 5); shWIZ_#55’-AGCGGCAGAACATCAACAAAT-3’ (SEQ ID NO: 6). Lentiviral shRNA transduction and FACS of mPB CD34+ cells mPB CD34+ transduction was performed on retronectin coated non-tissue culture treated 96 well-flat bottom plates (Corning, Inc.).
  • RetroNectin® (1 ⁇ g/mL) (TAKARABIO, Inc.), sealed and incubated at 4°C overnight. RetroNectin®was then removed and plates were incubated with BSA (bovine serum albumin) (1%) in PBS for 30 minutes at room temperature. Subsequently, BSA (bovine serum albumin) was aspirated and replaced with 100 ⁇ L of lentiviral concentrate and centrifuged at 2000xg for 2 hours at room temperature. Next, residual supernatant was gently pipetted out and ready for transductions of mPB CD34+ cells.
  • BSA bovine serum albumin
  • Sorted eGFP-positive cells were used for the erythroid differentiation assay.
  • Targeting CRISPR knockout of WIZ Alt-R CRISPR-Cas9 crRNA and tracrRNA (5’- AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUC GGUGCUUU -3’; SEQ ID NO: 7) were purchased from Integrated DNA Technologies, Inc..
  • Equimolar tracrRNA was annealed with WIZ targeting crRNA (Table 3) in Tris buffer (10 mM, pH 7.5) by heating at 95°C for 5 minutes using a polymerase chain reaction (PCR) machine (Bio- Rad) followed by cooling to room temperature on the benchtop.
  • PCR polymerase chain reaction
  • a ribonucleoprotein (RNP) complex was generated by mixing annealed tracrRNA:crRNA with 6 ug of Cas9 at 37°C for 5 minutes in 1x buffer containing HEPES (100 mM), KCl (50 mM), MgCl 2 (2.5 mM), glycerol (0.03%), DTT (1 mM) and Tris pH 7.5 (2 mM). Electroporation of the RNP complex was performed on a 4D-NucleofectorTM (Lonza) as per manufacturer’s recommendation.
  • Base differentiation media consists of IMDM (Iscove's Modified Dulbecco's Medium), human AB serum (5%), transferrin (330 ⁇ g/mL), Insulin (10 ⁇ g/mL) and Heparin (2 IU/mL).
  • rhSCF 100 ng/mL
  • rhIL-3 10 ng/mL
  • rhEPO 2.5 U/mL
  • hydrocortisone 1 ⁇ M
  • rhSCF 100 ng/mL
  • rhIL-3 10 ng/mL
  • rhEPO 2.5 U/mL
  • hydrocortisone 1 ⁇ M
  • RNA-seq Two independent, targeted CRISPR/Cas9 knockout (KO) of WIZ was done using WIZ_6 and WIZ_18 gRNAs or a non-targeting scrambled gRNA negative control in mPB CD34+ HSCs.
  • RNA sequencing libraries were prepared using the Illumina TruSeq Stranded mRNA Sample Prep protocol and sequenced using the Illumina NovaSeq6000 platform (Illumina). Samples were sequenced to a length of 2x76 base-pairs. For each sample, salmon version 0.8.2 (Patro et al.
  • HbF intracellular staining One hundred thousand cells were aliquoted into U-bottom 96-well plate and stained for 20 min in the dark with diluted LIVE/DEAD fixable violet viability dye as per manufacturer’s recommendation (Invitrogen). Cells were washed with FACS staining buffer and subsequently stained with anti- CD71-BV711 (BD Biosciences) and anti-CD235a-APC (BD Biosciences) for 20 mins in the dark.
  • WIZ KO upregulates HBG1/2 expression upon erythroid differentiation
  • Targeted KO of WIZ using two independent gRNAs demonstrated upregulation of fetal hemoglobin genes (HBG1/2), as presented in Figure 1A.
  • Loss of WIZ induces fetal hemoglobin expression in mPB CD34 + derived erythroid cells
  • shRNA and CRISPR-Cas9-mediated knockdown and knockout functional genetics approaches were employed.
  • mPB CD34 + cells were treated with shRNA or CRISPR-Cas9 reagents and erythroid differentiated for 7 days prior to flow cytometry analysis.
  • WIZ is a regulator of fetal hemoglobin expression and represents a novel target for the treatment of sickle cell disease and beta-thalassemia.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Nitrogen Condensed Heterocyclic Rings (AREA)
  • Plural Heterocyclic Compounds (AREA)
  • Nitrogen And Oxygen Or Sulfur-Condensed Heterocyclic Ring Systems (AREA)
PCT/IB2022/000134 2021-03-15 2022-03-14 Benzisoxazole derivatives and uses thereof Ceased WO2022195355A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP22720755.2A EP4308559A1 (en) 2021-03-15 2022-03-14 Benzisoxazole derivatives and uses thereof
JP2023556473A JP2024509625A (ja) 2021-03-15 2022-03-14 ベンゾイソオキサゾール誘導体及びその使用
CN202280017295.6A CN116940571A (zh) 2021-03-15 2022-03-14 苯并异噁唑衍生物及其用途
US18/550,806 US20250276964A1 (en) 2021-03-15 2022-03-14 Benzisoxazole Derivatives and Uses thereof

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202163161141P 2021-03-15 2021-03-15
US63/161,141 2021-03-15
US202163164125P 2021-03-22 2021-03-22
US63/164,125 2021-03-22

Publications (1)

Publication Number Publication Date
WO2022195355A1 true WO2022195355A1 (en) 2022-09-22

Family

ID=81579856

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2022/000134 Ceased WO2022195355A1 (en) 2021-03-15 2022-03-14 Benzisoxazole derivatives and uses thereof

Country Status (4)

Country Link
US (1) US20250276964A1 (https=)
EP (1) EP4308559A1 (https=)
JP (1) JP2024509625A (https=)
WO (1) WO2022195355A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024255810A1 (en) * 2023-06-15 2024-12-19 Hangzhou Glubio Pharmaceutical Co., Ltd Dihydropyrimidine-2, 4 (1h, 3h) -dione-containing polycyclic derivatives and pharmaceutical composition thereof, preparation method thereof and use thereof
US12441711B2 (en) 2022-11-04 2025-10-14 Bristol-Myers Squibb Company Compounds and their use for treatment of hemoglobinopathies

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004078163A2 (en) 2003-02-28 2004-09-16 Transform Pharmaceuticals, Inc. Pharmaceutical co-crystal compositions of drugs such as carbamazepine, celecoxib, olanzapine, itraconazole, topiramate, modafinil, 5-fluorouracil, hydrochlorothiazide, acetaminophen, aspirin, flurbiprofen, phenytoin and ibuprofen
US20140323463A1 (en) 2012-01-17 2014-10-30 Astellas Pharma Inc. Pyrazinecarboxamide compound
WO2018144649A1 (en) * 2017-01-31 2018-08-09 Arvinas, Inc. Cereblon ligands and bifunctional compounds comprising the same
US20190144444A1 (en) 2017-11-15 2019-05-16 Mirati Therapeutics, Inc. Kras g12c inhibitors
WO2020132561A1 (en) * 2018-12-20 2020-06-25 C4 Therapeutics, Inc. Targeted protein degradation

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP7209897B2 (ja) * 2019-09-12 2023-01-20 メッドシャイン ディスカバリー インコーポレイテッド Crbnタンパク質モジュレーターとしての二環式化合物
PY2217419A (es) * 2021-03-15 2022-09-27 Novartis Ag Derivados de pirazolopiridina y sus usos

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004078163A2 (en) 2003-02-28 2004-09-16 Transform Pharmaceuticals, Inc. Pharmaceutical co-crystal compositions of drugs such as carbamazepine, celecoxib, olanzapine, itraconazole, topiramate, modafinil, 5-fluorouracil, hydrochlorothiazide, acetaminophen, aspirin, flurbiprofen, phenytoin and ibuprofen
US20140323463A1 (en) 2012-01-17 2014-10-30 Astellas Pharma Inc. Pyrazinecarboxamide compound
WO2018144649A1 (en) * 2017-01-31 2018-08-09 Arvinas, Inc. Cereblon ligands and bifunctional compounds comprising the same
US20190144444A1 (en) 2017-11-15 2019-05-16 Mirati Therapeutics, Inc. Kras g12c inhibitors
WO2020132561A1 (en) * 2018-12-20 2020-06-25 C4 Therapeutics, Inc. Targeted protein degradation

Non-Patent Citations (19)

* Cited by examiner, † Cited by third party
Title
"Methoden der organischen Chemie", vol. 15, 1974, GEORG THIEME VERLAG
"Remington The Science and Practice of Pharmacy", 2013, PHARMACEUTICAL PRESS, pages: 1049 - 1070
"The Peptides", vol. 3, 1981, ACADEMIC PRESS
BIAN, CHEN ET AL., ELIFE, vol. 4, 2015, pages e05606
CHEMMEDCHEM, vol. 11, 2016, pages 2640 - 2648
GREVET, SCIENCE, vol. 361, no. 6399, 2018, pages 285 - 290
HILL, R. K. ET AL., JOURNAL OF LABELLED COMPOUNDS AND RADIOPHARMACEUTICALS, vol. XXII, no. 2, pages 143 - 148
J. F. W. MCOMIE: "Protective Groups in Organic Chemistry", 1973, PLENUM PRESS
J. MED. CHEM., vol. 55, 2012, pages 7796 - 7816
MCARTHUR ET AL., HAEMATOLOGICA, 2019
MEILER, S. E. ET AL., BLOOD, vol. 118, no. 4, 2011, pages 1109 - 1112
MOUTOUH-DE PARSEVAL, L. A. ET AL., THE JOURNAL OF CLINICAL INVESTIGATION, vol. 118, no. 1, 2008, pages 248 - 258
P. J. KOCIENSKI: "Protecting Groups", 2005, GEORG THIEME VERLAG
RENNEVILLE ET AL., BLOOD, vol. 126, no. 16, 2015, pages 1930 - 1939
RIVERS ET AL., EXPERIMENTAL HEMATOLOGY, vol. 67, 2018, pages 60 - 64
SHEARSTONE ET AL., PLOS ONE, vol. 11, no. 4, 2016, pages e0153767
T. W. GREENEP. G. M. WUTS: "Greene's Protective Groups in Organic Synthesis", 2007, WILEY
THE BRITISH JOURNAL OF HAEMATOLOGY, vol. 180, no. 5, 2018, pages 630 - 643
WICKHAM H: "Elegant Graphics for Data Analysis", 2016, SPRINGER-VERLAG

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12441711B2 (en) 2022-11-04 2025-10-14 Bristol-Myers Squibb Company Compounds and their use for treatment of hemoglobinopathies
WO2024255810A1 (en) * 2023-06-15 2024-12-19 Hangzhou Glubio Pharmaceutical Co., Ltd Dihydropyrimidine-2, 4 (1h, 3h) -dione-containing polycyclic derivatives and pharmaceutical composition thereof, preparation method thereof and use thereof

Also Published As

Publication number Publication date
US20250276964A1 (en) 2025-09-04
EP4308559A1 (en) 2024-01-24
JP2024509625A (ja) 2024-03-04

Similar Documents

Publication Publication Date Title
EP4076650B1 (en) 3-(5-methoxy-1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof
KR102902295B1 (ko) 피라졸로피리딘 유도체 및 이의 용도
US12103919B2 (en) 3-(5-oxy)-1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof
US20250276964A1 (en) Benzisoxazole Derivatives and Uses thereof
CN116940571A (zh) 苯并异噁唑衍生物及其用途
CN116802182A (zh) 吡唑并吡啶衍生物及其用途
BR112023018542B1 (pt) Derivados de pirazolopiridina, e composição e combinação farmacêuticas
BR122025004894A2 (pt) Derivados de pirazolopiridina, seus usos, composição e combinação farmacêuticas, e kit
EA051403B1 (ru) Производные пиразолопиридина и пути их применения

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22720755

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 202280017295.6

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 2023556473

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2022720755

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022720755

Country of ref document: EP

Effective date: 20231016

WWP Wipo information: published in national office

Ref document number: 18550806

Country of ref document: US