WO2022184676A1 - Anti-cd38 antibodies for use in the treatment of antibody-mediated transplant rejection - Google Patents

Anti-cd38 antibodies for use in the treatment of antibody-mediated transplant rejection Download PDF

Info

Publication number
WO2022184676A1
WO2022184676A1 PCT/EP2022/055080 EP2022055080W WO2022184676A1 WO 2022184676 A1 WO2022184676 A1 WO 2022184676A1 EP 2022055080 W EP2022055080 W EP 2022055080W WO 2022184676 A1 WO2022184676 A1 WO 2022184676A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
antibody fragment
fragment
use according
abmr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2022/055080
Other languages
English (en)
French (fr)
Inventor
Stefan Steidl
Stefan HÄRTLE
Rainer Boxhammer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Morphosys GmbH
Original Assignee
Morphosys GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP22708941.4A priority Critical patent/EP4301779A1/en
Priority to JP2023552183A priority patent/JP2024507986A/ja
Priority to MX2023009868A priority patent/MX2023009868A/es
Priority to US18/548,477 priority patent/US20240228654A9/en
Priority to CN202280016846.7A priority patent/CN116997570A/zh
Priority to AU2022230717A priority patent/AU2022230717A1/en
Priority to KR1020237033840A priority patent/KR20230154239A/ko
Priority to CA3209172A priority patent/CA3209172A1/en
Priority to BR112023016352A priority patent/BR112023016352A2/pt
Application filed by Morphosys GmbH filed Critical Morphosys GmbH
Publication of WO2022184676A1 publication Critical patent/WO2022184676A1/en
Priority to IL304692A priority patent/IL304692A/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2896Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against molecules with a "CD"-designation, not provided for elsewhere
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/545Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52Constant or Fc region; Isotype
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]

Definitions

  • the present disclosure relates to the field of organ transplantation (e.g. kidney transplantation).
  • the present disclosure relates to anti-CD38 antibodies for use in the treatment of patients with antibody-mediated transplant rejection (ABMR).
  • ABMR antibody-mediated transplant rejection
  • the disclosure provides methods for the reduction of antibody-secreting cells and for the decrease of antibody levels with specificities directed against one or more antigen(s) present on the transplanted organ, using an anti-CD38 antibody.
  • an anti-CD38 antibody alone or in combination with one or more immunosuppressive drugs, can be effective in the treatment and/or prophylaxis of ABMR.
  • An anti-CD38 antibody for use according to the present invention includes felzartamab (MOR202).
  • Organ transplantation is a medical procedure in which an organ is removed from the body of one subject (donor) and placed in the body of a recipient (host), to replace a damaged or missing organ. Transplantation is the treatment of choice for patients developing end stage organ failure. Primarily transplants between two subjects of the same species are performed (so-called allografts) to reduce organ rejection by the immune system of the host. However, the host immune system recognizes even well matched transplants and eventually may destroy the transplant.
  • alloreactive T cells to be solely responsible for graft injury by T cell mediated rejection (TCMR).
  • TCMR T cell mediated rejection
  • ABMR antibody-mediated rejection
  • DSA Anti-donor-specific antibodies
  • HLA anti-human leukocyte antigen
  • GFR glomerular filtration rate
  • CD38 primarily expressed on immune and hematopoietic cells, with particularly high expression levels on antibody-producing plasma cells.
  • ABMR critical role of alloantibody-producing plasma cells in ABMR (when DSA are the cause of injury)
  • effective plasma cell depletion via CD38 may be useful in transplantation medicine to achieve sustained DSA reduction.
  • MOR202-induced lysis of plasma cells is ADCC and ADCP, but not CDC.
  • CDC is believed to be a major contributor to infusion-related reactions. Therefore, a major advantage, compared to other CD38 antibodies, is a lower risk of infusion-related reactions.
  • MOR202 depletes mainly high CD38 cells and thereby sparing specific cell population with low CD38 levels in vitro. Certain regulatory cell subsets may be preserved after treatment with MOR202 resulting in an improved graft survival.
  • the present disclosure provides the anti-CD38 antibody felzartamab for use in an efficient, safe, sustainable and well-tolerated strategy in managing ABMR, in particular late and/or chronic ABMR.
  • felzartamab is able to counteract tissue inflammation (i.e. the increase of CD4+ and CD8+ T cell numbers) and graft injury in ongoing ABMR, in particular, inflammation in the microcirculation, B cell responses to HLA antigen and, as a consequence, alloantibody/NK cell-triggered chronic graft injury.
  • the present invention provides the anti-CD38 antibody felzartamab for use in the treatment and/or prevention of antibody-mediated rejection of an organ transplant. Furthermore, methods of reducing or removing donor specific antibodies (e.g. anti-HLA), and/or treating or reducing the severity of ABMR in a subject who received a kidney transplant are provided. The methods include administering to the patient an effective amount of the anti-CD38 antibody felzartamab. In some aspects, the methods further include selecting a patient experiencing or having experienced ABMR of an organ transplant. In other aspects, the methods further include selecting a patient with anti-HLA antibodies in the serum that are specific to the donors HLA.
  • donor specific antibodies e.g. anti-HLA
  • Figure 1 Specific killing in vitro of a CD38 high expressing MM plasma cell line by MOR202 while sparing CD38 low expressing NK cells compared to daratumumab (Dara) and isatuximab.
  • CD38 refers to a protein known as CD38, having the following synonyms: ADP-ribosyl cyclase 1, cADPr hydrolase 1, Cyclic ADP-ribose hydrolase 1, T10.
  • Human CD38 (UniProt P28907) has the following amino acid sequence:
  • CD38 is a type II transmembrane glycoprotein and an example of an antigen that is highly expressed on antibody-secreting cells (e.g.: plasmablasts and plasma cells). Functions ascribed to CD38 include both receptor-mediated adhesion and signaling events and (ecto-) enzymatic activity. As an ectoenzyme, CD38 uses NAD+ as substrate for the formation of cyclic ADP-ribose (cADPR) and ADPR, but also of nicotinamide and nicotinic acid-adenine dinucleotide phosphate (NAADP). cADPR and NAADP have been shown to act as second messengers for Ca2+ mobilization.
  • cADPR cyclic ADP-ribose
  • NAADP nicotinamide and nicotinic acid-adenine dinucleotide phosphate
  • CD38 By converting NAD+ to cADPR, CD38 regulates the extracellular NAD+ concentration and hence cell survival by modulation of NAD-induced cell death (NCID).
  • NAD-induced cell death NAD-induced cell death
  • CD38 signaling occurs via cross-talk with antigen-receptor complexes on T and B cells or other types of receptor complexes, e.g. MHC molecules, and is in this way involved in several cellular responses, but also in switching and secretion of IgG antibodies.
  • anti-CD38 antibody includes anti-CD38 binding molecules in its broadest sense; any molecule which specifically binds to CD38 or inhibits the activity or function of CD38, or which by any other way exerts a therapeutic effect on CD38 is included. Any molecule that interferes or inhibits CD38 functionality is included.
  • anti-CD38 antibody includes, but is not limited to, antibodies specifically binding to CD38, alternative protein scaffolds binding to CD38, nucleic acids (including aptamers) specific for CD38 or small organic molecules specific for CD38.
  • Antibodies specific for CD38 are described for example in W0199962526 (Mayo Foundation); W0200206347 (Crucell Holland); US2002164788 (Jonathan Ellis); W02005103083, W02006125640, W02007042309 (MorphoSys), W02006099875 (Genmab), and
  • W02008047242 (Sanofi-Aventis). Combinations of antibodies specific for CD38 and other agents are described for example in W0200040265 (Research Development Foundation); W02006099875 and W02008037257 (Genmab); and WO2010061360, WO2010061359, WO2010061358 and W02010061357 (Sanofi Aventis). CD38-targeting antibodies are broadly used in multiple myeloma (reviewed in Frerichs KA et al. 2018, Expert Rev Clin lmmunol;14(3):197-206).
  • anti-CD38 antibodies are described for example in WO2015130732, W02016089960, WO2016210223 (Janssen), W02018002181 (UMC Utrecht), WO2019020643 (ENCEFA), W02020185672 (Cedars-Sinai) and WO2020187718 (MorphoSys) which are all incorporated by reference in their entireties.
  • an anti-CD38 antibody for the use as described herein is an antibody specific for CD38. More preferably, an anti-CD38 antibody is an antibody or antibody fragment, such as a monoclonal antibody, specifically binding to CD38 and deleting specific CD38 positive B cells, plasma cells, plasmablasts and any other CD38 positive antibody-secreting cells. Such an antibody may be of any type, such as a murine, a rat, a chimeric, a humanized or a human antibody.
  • a “human antibody” or “human antibody fragment”, as used herein, is an antibody or antibody fragment having variable regions in which the framework and CDR regions are from sequences of human origin. If the antibody contains a constant region, the constant region also is from such sequences.
  • Human origin includes, but is not limited to human germline sequences, or mutated versions of human germline sequences or antibody containing consensus framework sequences derived from human framework sequences analysis, for example, as described in Knappik et al., (2000) J Mol Biol 296:57-86).
  • Human antibodies can be isolated e.g. from synthetic libraries or from transgenic mice (e.g. Xenomouse). An antibody or antibody fragment is human if its sequence is human, irrespective of the species from which the antibody is physically derived, isolated, or manufactured.
  • immunoglobulin variable domains e.g., CDRs
  • CDRs may be defined using well known numbering schemes, e.g., the Kabat numbering scheme, the Chothia numbering scheme, or a combination of Kabat and Chothia (see, e.g. Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services (1991), eds. Kabat et al.; Lazikani et al., (1997) J. Mol. Bio. 273:927-948); Kabat et al., (1991) Sequences of Proteins of Immunological Interest, 5th edit., NIH Publication no. 91-3242 U.S.
  • a “humanized antibody” or “humanized antibody fragment” is defined herein as an antibody molecule, which has constant antibody regions derived from sequences of human origin and the variable antibody regions or parts thereof or only the CDRs are derived from another species.
  • a humanized antibody can be CDR-grafted, wherein the CDRs of the variable domain are from a non-human origin, while one or more frameworks of the variable domain are of human origin and the constant domain (if any) is of human origin.
  • chimeric antibody or “chimeric antibody fragment” is defined herein as an antibody molecule, which has constant antibody regions derived from, or corresponding to, sequences found in one species and variable antibody regions derived from another species.
  • the constant antibody regions are derived from, or corresponding to, sequences found in humans
  • the variable antibody regions are derived from sequences found in a non-human animal, e.g. a mouse, rat, rabbit or hamster.
  • isolated antibody refers to an antibody or antibody fragment that is substantially free of other antibodies or antibody fragments having different antigenic specificities. Moreover, an isolated antibody or antibody fragment may be substantially free of other cellular material and/or chemicals. Thus, in some aspects, antibodies provided are isolated antibodies, which have been separated from antibodies with a different specificity. An isolated antibody may be a monoclonal antibody. An isolated antibody may be a recombinant monoclonal antibody. An isolated antibody that specifically binds to an epitope, isoform or variant of a target may, however, have cross reactivity to other related antigens, e.g., from other species (e.g., species homologs).
  • monoclonal antibody refers to a preparation of antibody molecules of single molecular composition.
  • a monoclonal antibody composition displays a unique binding site having a unique binding specificity and affinity for particular epitopes.
  • an “immunoglobulin” hereby is defined as a protein belonging to the class IgG, IgM, IgE, IgA, or IgD (or any subclass thereof), and includes all conventionally known antibodies and functional fragments thereof.
  • antibody fragment refers to one or more portions of an antibody that retain the ability to specifically interact with (e.g., by binding, steric hindrance, stabilizing spatial distribution) an antigen.
  • binding fragments include, but are not limited to, a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CH1 domains; a F(ab)2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; a Fd fragment consisting of the VH and CH1 domains; a Fv fragment consisting of the VL and VH domains of a single arm of an antibody; a dAb fragment, which consists of a VH domain; and an isolated complementarity determining region (CDR).
  • CDR complementarity determining region
  • the two domains of the Fv fragment, VL and VH are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as “single chain Fragment (scFv)”).
  • single chain Fragment Single chain Fragment
  • Antibody fragments can also be incorporated into single domain antibodies, maxibodies, minibodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv.
  • Antibody fragments can be grafted into scaffolds based on polypeptides such as Fibronectin type III (Fn3). Antibody fragments can be incorporated into single chain molecules comprising a pair of tandem Fv segments (VH-CH1-VH-CH1) which, together with complementary light chain polypeptides, form a pair of antigen-binding sites).
  • Fn3 Fibronectin type III
  • the present disclosure provides therapeutic methods comprising the administration of a therapeutically effective amount of an anti-CD38 antibody as disclosed to a subject in need of such treatment.
  • a "therapeutically effective amount” or ..effective amount”, as used herein, refers to the amount of an antibody specific for CD38, necessary to elicit the desired biological response.
  • the therapeutic effective amount is the amount of an antibody specific for CD38 necessary to treat and/or prevent immune complex mediated diseases and symptoms associated with said diseases.
  • An effective amount for a particular individual may vary, depending on factors such as the condition being treated, the overall health of the patient, the method route and dose of administration and the severity of side effects (Maynard, et al. (1996) A Handbook of SOPs for Good Clinical Practice, Interpharm Press, Boca Raton, Fla.; Dent (2001) Good Laboratory and Good Clinical Practice, London, UK).
  • the terms “treat”, “treating”, treatment” or the like mean to alleviate symptoms, eliminate the causation of symptoms either on a temporary or permanent basis, or to prevent or slow the appearance of symptoms of the named disorder or condition. They refer to both therapeutic treatment and prophylactic or preventative measures. Objectives of a treatment are to prevent or slow down (lessen) an undesired physiological change or disorder or to cure the disease to be treated. Beneficial or desired clinical results include alleviation of symptoms, diminishment of extent of disease, stabilized (i.e. , not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
  • Treatment can also mean prolonging survival as compared to expected survival if a subject was not receiving treatment.
  • Those in need of treatment include those already with the condition or disorder as well as those prone to have the condition or disorder or those in which the condition or disorder is to be prevented.
  • Preventing refers to a reduction in risk of acquiring or developing a disease or disorder (i.e. causing at least one of the clinical symptoms of the disease not to develop in a subject that may be exposed to a disease-causing agent, or predisposed to the disease in advance of disease onset. “Prevention” refers to methods which aim to prevent the onset of a disease or its symptoms or which delay the onset of a disease or its symptoms.
  • administering includes but is not limited to delivery of a drug by an injectable form, such as, for example, an intravenous, intramuscular, intradermal or subcutaneous route or mucosal route, for example, as a nasal spray or aerosol for inhalation or as an ingestible solution, capsule or tablet.
  • an injectable form such as, for example, an intravenous, intramuscular, intradermal or subcutaneous route or mucosal route, for example, as a nasal spray or aerosol for inhalation or as an ingestible solution, capsule or tablet.
  • the administration is by an injectable form.
  • any means of delivering two or more therapeutic agents to the patient as part of the same treatment regimen is included any means of delivering two or more therapeutic agents to the patient as part of the same treatment regimen, as will be apparent to the skilled person.
  • the two or more agents may be administered simultaneously in a single formulation, i.e. as a single pharmaceutical composition, this is not essential.
  • the agents may be administered in different formulations and at different times.
  • the therapies (e.g., prophylactic or therapeutic agents) of the combination therapies can be administered concomitantly (concurrently) or sequentially to a subject.
  • the therapy (e.g., prophylactic or therapeutic agents) of the combination therapies can also be cyclically administered.
  • Cycling therapy involves the administration of a first therapy (e.g., a first prophylactic or therapeutic agent) for a period of time, followed by the administration of a second therapy (e.g., a second prophylactic or therapeutic agent) for a period of time and repeating this sequential administration, i.e., the cycle. This is to reduce the development of resistance to one of the therapies to avoid or reduce the side effects of one of the therapies, and/or to improve, the efficacy of the therapies.
  • a first therapy e.g., a first prophylactic or therapeutic agent
  • a second therapy e.g., a second prophylactic or therapeutic agent
  • compositions comprising antibodies or antibody fragments of the disclosure are administered to a subject in a sequence and within a time interval such that the antibodies of the disclosure can act together with the other therapy(ies) to provide an increased benefit than if they were administered otherwise.
  • Subject refers to any mammal, including rodents, such as mouse or rat, and primates, such as cynomolgus monkey (Macaca fascicularis), rhesus monkey (Macaca mulatta) or humans (Homo sapiens).
  • rodents such as mouse or rat
  • primates such as cynomolgus monkey (Macaca fascicularis), rhesus monkey (Macaca mulatta) or humans (Homo sapiens).
  • the subject is a primate, most preferably a human.
  • a subject in need thereof mean a human or a non-human animal patient that exhibits one or more symptoms or indicia of antibody-mediated rejection of an organ transplantation).
  • the subject is a primate, most preferably a human patient who has been diagnosed with antibody-mediated rejection after kidney transplantation.
  • ABMR antibody-mediated rejection
  • Tx frequently occurring after organ transplantation
  • DSA donor-specific antibodies
  • DSA can be (i) antibodies against HLA of the donor and/or (ii) non-HLA antibodies, which may be classified into at least two main categories: alloantibodies directed against polymorphic antigens that differ between the recipient and donor and antibodies that recognize self-antigens or autoantibodies.
  • the term "about” when used in reference to a particular recited numerical value means that the value may vary from the recited value by no more than 1 %.
  • the expression “about 100” includes 99 and 101 and all values in between (e.g., 99.1 , 99.2, 99.3, 99.4, etc.).
  • “Pharmaceutically acceptable” means approved or approvable by a regulatory agency of the Federal or a state government or the corresponding agency in countries other than the United States, or that is listed in the US Pharmacopoeia or other generally recognized pharmacopoeia for use in animals, and more particularly, in humans.
  • “Pharmaceutically acceptable vehicle” refers to a diluent, adjuvant, excipient or carrier with which an antibody or antibody fragment is administered.
  • Frizartamab is an anti-CD38 antibody, also known as “MOR202”, “MOR03087” or “MOR3087”. The terms are used interchangeable in the present disclosure.
  • MOR202 has an lgG1 Fc region.
  • amino acid sequence of the MOR202 HCDR1 according to Kabat is:
  • the amino acid sequence of the MOR202 HCDR2 according to Kabat is: GISGDPSNTYYADSVKG (SEQ ID NO: 2)
  • the amino acid sequence of the MOR202 HCDR3 according to Kabat is: DLPLVYTGFAY (SEQ ID NO: 3)
  • the amino acid sequence of the MOR202 LCDR1 according to Kabat is: SGDNLRHYYVY (SEQ ID NO: 4)
  • the amino acid sequence of the MOR202 LCDR2 according to Kabat is: GDSKRPS (SEQ ID NO: 5)
  • the amino acid sequence of the MOR202 LCDR3 is: QTYTGGASL (SEQ ID NO: 6)
  • the amino acid sequence of the MOR202 Variable Heavy Domain is:
  • the amino acid sequence of the MOR202 Variable Light Domain is:
  • the DNA sequence encoding the MOR202 Variable Heavy Domain is: CAGGTGCAATTGGTGGAAAGCGGCGGCGGCCTGGTGCAACCGGGCGGCAGCCTGCGTC TGAGCTGCGCGCGGCCTCCGGATTTACCTTTTCTTCTTATTATATGAATTGGGTGCGCCAAGC CCCTGGGAAGGGTCTCGAGTGGGTGAGCGGTATCTCTGGTGATCCTAGCAATACCTATTA T GCGG AT AGCGT GAAAGGCCGTTTT ACCATTT CACGT GAT AATTCG AAAAACACCCT GTAT CTGCAAAT GAACAGCCTGCGTGCGGAAGATACGGCCGT GT ATT ATT GCGCGCGTGAT CTT CCTCTTGTTTATACTGGTTTTGCTTATTGGGGCCAAGGCACCCTGGTGACGGTTAGCTCA (SEQ ID NO: 10).
  • the DNA sequence encoding the MOR202 Variable Light Domain is:
  • the antibody or antibody fragment specific for CD38 for the use according to the present disclosure comprises a variable heavy chain variable region, a variable light chain region, heavy chain, light chain and/or CDRs comprising any of the amino acid sequences of the CD38 specific antibodies as set forth in W02007042309.
  • said antibody or antibody fragment specific for CD38 for the use according to the present disclosure comprises a HCDR1 region comprising the amino acid sequence of SEQ ID NO: 1, a HCDR2 region comprising the amino acid sequence of SEQ ID NO: 2, a HCDR3 region comprising the amino acid sequence of SEQ ID NO: 3, a LCDR1 region comprising the amino acid sequence of SEQ ID NO: 4, a LCDR2 region comprising the amino acid sequence of SEQ ID NO: 5 and a LCDR3 region comprising the amino acid sequence of SEQ ID NO: 6.
  • said antibody or antibody fragment specific for CD38 for the use according to the present disclosure comprises the HCDR1 region of SEQ ID NO: 1, the HCDR2 region of SEQ ID NO: 2, the HCDR3 region of SEQ ID NO: 3, the LCDR1 region of SEQ ID NO: 4, the LCDR2 region of SEQ ID NO: 5 and the LCDR3 region of SEQ ID NO: 6.
  • said antibody or antibody fragment specific for CD38 for the use according to the present disclosure comprises a variable heavy chain region of SEQ ID NO: 7 and a variable light chain region of SEQ ID NO: 8.
  • the anti-CD38 antibody or antibody fragment for the use according to the present disclosure comprises a variable heavy chain region of SEQ ID NO: 7 and a variable light chain region of SEQ ID NO: 8 or a variable heavy chain region and a variable light chain region that has at least 60%, at least 70 %, at least 80%, at least 90% or at least 95% identity to the a variable heavy chain region of SEQ ID NO: 7 and to the variable light chain region of SEQ ID NO: 8.
  • variable heavy chain region comprising the amino acid sequence of SEQ ID NO: 7
  • variable light chain region comprising the amino acid sequence of SEQ ID NO: 8
  • MOR202 felzartamab
  • the present disclosure refers to a nucleic acid composition
  • a nucleic acid composition comprising a nucleic acid sequence or a plurality of nucleic acid sequences encoding said antibody or antibody fragment specific for CD38 for the use according to the present disclosure, wherein said antibody or antibody fragment comprises the HCDR1 region of SEQ ID NO: 1, the HCDR2 region of SEQ ID NO: 2, the HCDR3 region of SEQ ID NO: 3, the LCDR1 region of SEQ ID NO: 4, the LCDR2 region of SEQ ID NO: 5 and the LCDR3 region of SEQ ID NO: 6.
  • the disclosure refers to a nucleic acid encoding an isolated monoclonal antibody or fragment thereof for the use according to the present disclosure wherein the nucleic acid comprises a VH of SEQ ID NO: 10 and a VL of SEQ ID NO: 11.
  • the disclosed antibody or antibody fragment specific for CD38 for the use according to the present disclosure is a monoclonal antibody or antibody fragment.
  • the disclosed antibody or antibody fragment specific for CD38 for the use according to the present disclosure is a human, humanized or chimeric antibody.
  • said antibody or antibody fragment specific for CD38 for the use according to the present disclosure is an isolated antibody or antibody fragment.
  • said antibody or antibody fragment for the use according to the present disclosure is a recombinant antibody or antibody fragment.
  • said antibody or antibody fragment for the use according to the present disclosure is a recombinant human antibody or antibody fragment.
  • said recombinant human antibody or antibody fragment for the use according to the present disclosure is an isolated recombinant human antibody or antibody fragment.
  • said recombinant human antibody or antibody fragment or isolated recombinant human antibody or antibody fragment for the use according to the present disclosure is monoclonal.
  • the disclosed antibody or antibody fragment for the use according to the present disclosure is of the IgG isotype.
  • said antibody is an lgG1.
  • the anti-CD38 antibody for the use according to the present disclosure is MOR202 (felzartamab).
  • the present disclosure refers to a pharmaceutical composition comprising felzartamab (MOR202) or fragment thereof specific for CD38 and a pharmaceutically acceptable carrier or excipient for the use according to the present disclosure.
  • said antibody or antibody fragment specific for CD38 is an isolated monoclonal antibody or antibody fragment that specifically binds to human CD38.
  • compositions of the present disclosure are preferably pharmaceutical compositions comprising felzartamab (MOR202) and a pharmaceutically acceptable carrier, diluent or excipient, for the use in treating, inhibiting and/or reducing the severity of an antibody-mediated rejection (ABMR) response of an organ transplant in a subject in need thereof.
  • MOR202 felzartamab
  • ABMR antibody-mediated rejection
  • the pharmaceutically acceptable carrier should be suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion).
  • Pharmaceutically carriers enhance or stabilize the composition, or facilitate the preparation of the composition.
  • Pharmaceutically acceptable carriers include solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
  • isotonic agents for example, sugars, polyalcohols such as mannitol or sorbitol, and sodium chloride in the composition.
  • a pharmaceutical composition of the present disclosure can be administered by a variety of routes known in the art.
  • Selected routes of administration for antibodies or antibody fragments of the disclosure include intravenous, intramuscular, intradermal, intraperitoneal, subcutaneous, spinal or other parenteral routes of administration, for example by injection or infusion.
  • the antibody, or antibody fragment, specific for CD38 is preferably formulated as injectable composition.
  • the anti-CD38 antibody of the present disclosure is administered intravenously.
  • the anti-CD38 antibody of the present disclosure is administered, subcutaneously, intraarticularly or intra-spinally.
  • An important aspect of the present disclosure is a pharmaceutical composition that is able to mediate killing of CD38-expressing antibody-secreting cells (e g. plasmablasts, plasma cells) by ADCC and ADCP.
  • the present disclosure provides an anti-CD38 antibody or antibody fragment, or a pharmaceutical composition comprising an anti-CD38 antibody or antibody fragment, for use in treating, inhibiting and/or reducing the severity of antibody-mediated rejection (ABMR) response of an organ transplant in a subject in need thereof.
  • ABMR antibody-mediated rejection
  • the organ transplant is one or more of kidney, heart, liver, lung, pancreas, stomach, skin and intestines.
  • an anti-CD38 antibody or antibody fragment or a pharmaceutical composition comprising an anti-CD38 antibody or antibody fragment, for use in treating, inhibiting and/or reducing the severity of antibody-mediated rejection (ABMR) response of a kidney transplant in a subject in need thereof is provided.
  • ABMR antibody-mediated rejection
  • the present disclosure provides an anti-CD38 antibody or antibody fragment comprising the HCDR1 region of SEQ ID NO: 1, the HCDR2 region of SEQ ID NO: 2, the HCDR3 region of SEQ ID NO: 3, the LCDR1 region of SEQ ID NO: 4, the LCDR2 region of SEQ ID NO: 5 and the LCDR3 region of SEQ ID NO: 6 for use in treating, inhibiting and/or reducing the severity of antibody-mediated rejection (ABMR) response of an organ transplant.
  • ABMR antibody-mediated rejection
  • the present disclosure provides an anti-CD38 antibody or antibody fragment comprising a variable heavy chain region of SEQ ID NO: 7 and a variable light chain region of SEQ ID NO: 8 for use in treating, inhibiting and/or reducing the severity of antibody-mediated rejection (ABMR) response of an organ transplant in a subject in need thereof.
  • ABMR antibody-mediated rejection
  • the present disclosure provides MOR202 (felzartamab) for use in treating, inhibiting and/or reducing the severity of antibody-mediated rejection (ABMR) response of an organ transplant in a subject in need thereof.
  • MOR202 felzartamab
  • ABMR antibody-mediated rejection
  • the present disclosure provides an anti-CD38 antibody or antibody fragment for use in depleting CD38 expressing antibody secreting cells (preferably plasma cells), in subjects with an antibody-mediated rejection (ABMR) response after having received an organ transplantation.
  • the disclosure provides an anti-CD38 antibody (e.g. MOR202) for use in reducing circulating anti-HLA antibodies and/or anti-non-HLA antibodies in subjects with an antibody-mediated rejection (ABMR) response after having received an organ transplantation.
  • the disclosure provides an anti-CD38 antibody (e.g. MOR202) for use in reducing deposited anti-HLA antibodies and/or anti-non-HLA antibodies in the graft organ in subjects with an antibody-mediated rejection (ABMR) response after having received an organ transplantation.
  • an anti-CD38 antibody e.g. MOR202
  • ABMR antibody-mediated rejection
  • the disclosure provides a therapeutic agent comprising an anti-CD38 antibody (e.g. MOR 202) as an active ingredient for use in reducing the symptoms of ABMR in a subject after having received a kidney transplantation, wherein the symptom is selected from: (i) aggravation of kidney function measured by serum creatinine and estimated glomerular filtration rate (eGFR); (ii) presence of donor specific antibodies; and/or (iii) capillaritis, inflammation and complement (C4d) deposition in the kidney.
  • an anti-CD38 antibody e.g. MOR 202
  • the symptom is selected from: (i) aggravation of kidney function measured by serum creatinine and estimated glomerular filtration rate (eGFR); (ii) presence of donor specific antibodies; and/or (iii) capillaritis, inflammation and complement (C4d) deposition in the kidney.
  • the disclosure provides a preventive and/or therapeutic agent comprising an anti-CD38 antibody (e.g. MOR202) for use in restoring, ameliorating or normalizing kidney function indicated by glomerular filtration rate (eGFR) based on the CKD-epi equation in subjects with an antibody-mediated rejection (ABMR) response after having received a kidney transplantation.
  • an anti-CD38 antibody e.g. MOR202
  • eGFR glomerular filtration rate
  • ABMR antibody-mediated rejection
  • the disclosure provides an anti-CD38 antibody (e.g. MOR202) for use in the treatment of ABMR response of an organ transplant in a subject in need thereof, whereby the anti-CD38 antibody (e.g. MOR202) will be dosed in at least 2 doses, at least 5 doses, at least 7 doses or at least 9 doses.
  • an anti-CD38 antibody e.g. MOR202
  • the disclosure provides an anti-CD38 antibody (e.g. MOR202) for use in the treatment of ABMR response of an organ transplant in a subject in need thereof, whereby the anti-CD38 antibody (e.g. MOR202) will be dosed in 2 doses, in 5 doses, in 7 doses or in 9 doses.
  • the anti-CD38 antibody e.g. MOR202
  • dosing will be at 8 mg/kg or more. In a particular embodiment, dosing will be at 16 mg/kg.
  • the disclosure provides an anti-CD38 antibody for use in the treatment of ABMR of an organ transplant in a subject in need thereof, wherein said antibody is administered every two weeks in cycle 1 (C1) and every four weeks in cycles 2-6 (administration of felzartamab/placebo at day 0 and 14 (cycle 1), and thereafter in 4-weekly intervals at weeks 4, 8, 12, 16, and 20 (cycles 2-6).
  • the disclosure provides an anti-CD38 antibody for use in the treatment of ABMR, wherein said anti-CD38 antibody is administered intravenously.
  • the disclosure provides an anti-CD38 antibody for use in the treatment of ABMR, wherein said antibody is administered intravenously over a period of two hours.
  • the anti-CD38 antibody (e.g. MOR202) is administered before, concurrently with, and/or after the organ transplantation.
  • methods for treating an individual in need of transplantation by administering to the individual an effective amount of felzartamab before, concurrently with, and/or after the transplantation.
  • the present disclosure provides the use of an anti-CD38 antibody or antibody fragment in the preparation of a medicament for the treatment and/or prophylaxis of an antibody- mediated rejection (ABMR) response of an organ transplant in a subject in need thereof.
  • ABMR antibody- mediated rejection
  • the present disclosure provides the use of an anti-CD38 antibody or antibody fragment comprising the HCDR1 region of SEQ ID NO: 1, the HCDR2 region of SEQ ID NO: 2, the HCDR3 region of SEQ ID NO: 3, the LCDR1 region of SEQ ID NO: 4, the LCDR2 region of SEQ ID NO: 5 and the LCDR3 region of SEQ ID NO: 6 in the preparation of a medicament for the treatment and/or prophylaxis of an antibody-mediated rejection (ABMR) response of an organ transplant in a subject in need thereof.
  • ABMR antibody-mediated rejection
  • the present disclosure provides the use of an anti-CD38 antibody or antibody fragment comprising a variable heavy chain region of SEQ ID NO: 7 and a variable light chain region of SEQ ID NO: 8 in the preparation of a medicament for the treatment and/or prophylaxis of an antibody-mediated rejection (ABMR) response of an organ transplant in a subject in need thereof.
  • ABMR antibody-mediated rejection
  • the present disclosure provides the use of MOR202 (felzartamab) in the preparation of a medicament for the treatment and/or prophylaxis of an antibody-mediated rejection (ABMR) response of a kidney transplant in a subject in need thereof.
  • MOR202 felzartamab
  • pharmaceutical compositions comprising MOR202 (felzartamab) in combination with another therapeutic agent, in the preparation of a medicament for the treatment and/or prophylaxis of an antibody-mediated rejection (ABMR) response of an organ transplant in a subject in need thereof.
  • MOR202 in combination with a steroid for the treatment and/or prophylaxis of ABMR in a subject in need thereof is provided.
  • MOR202 is administered in combination with a proteasome inhibitor, (e.g. bortezomib or carfilzomib) for use in the treatment and/or prophylaxis of ABMR.
  • a proteasome inhibitor e.g. bortezomib or carfilzomib
  • the present disclosure provides a method for the treatment and/or prophylaxis of an antibody-mediated rejection (ABMR) response of an organ transplant in a subject in need thereof, comprising administering to said subject an anti-CD38 antibody.
  • ABMR antibody-mediated rejection
  • the antibody-mediated rejection (ABMR) response is directed against a kidney graft.
  • the present disclosure provides methods of prophylaxis and/or treatment of subjects suffering from an antibody-mediated rejection (ABMR) response of an organ transplant, wherein said subject is resistant to treatment by other immunosuppressant therapies, comprising corticosteroids or calcineurin inhibitors or B cell depleting therapies (e.g. with Rituximab or any other anti-CD20 antibody, or anti-BAFF antibody), which methods comprise the administration of an effective amount of an anti-CD38 antibody or antibody fragment.
  • ABMR antibody-mediated rejection
  • the disclosure provides methods of using an anti-CD38 antibody or antibody fragment to achieve a prophylactic or therapeutic benefit in patients susceptible or vulnerable to an antibody-mediated rejection (ABMR) response after receiving an organ transplant.
  • ABMR antibody-mediated rejection
  • the disclosure provides a method for reducing the incidence of an antibody- mediated rejection (ABMR) response, ameliorating an antibody-mediated rejection (ABMR) response, suppressing an antibody-mediated rejection (ABMR) response, palliating an antibody- mediated rejection (ABMR) response, and/or delaying the onset, development, or progression of an antibody-mediated rejection (ABMR) response, and/or its symptoms in a subject, said method comprising administering an effective amount of an anti-CD38 antibody to the subject.
  • the antibody-mediated rejection (ABMR) response is after a kidney transplantation.
  • the disclosure provides methods for treating patients with elevated levels of DSA associated with the antibody-mediated rejection (ABMR) response.
  • the present disclosure provides a method for the treatment and/or prevention of a disease caused by the presence of donor-specific antibodies.
  • the present disclosure provides a method for the treatment and/or prevention of symptoms associated with the presence of anti-donor HLA antibodies.
  • the present disclosure provides a method for the treatment and/or prevention of symptoms associated with the presence of antidonor antibodies that are not directed against HLA.
  • the disclosure provides methods to reduce inflammation and C4d complement deposition in subjects suffering from an antibody-mediated rejection (ABMR), which methods comprise the administration of an effective amount of an anti-CD38 antibody or antibody fragment or one or more of the pharmaceutical compositions herein described.
  • the methods provided herein comprise administering an anti-CD38 antibody to patients with elevated levels of anti-HLA antibodies.
  • the methods provided herein comprise administering an anti-CD38 antibody to patients with elevated levels of C4d complement deposits in the transplanted organ.
  • the reduction (change) of anti-HLA levels in serum of subjects suffering from antibody-mediated rejection is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% compared to baseline after administering an anti-CD38 antibody or antibody fragment, or one or more of the pharmaceutical compositions herein described.
  • the disclosure provides methods for preventing the decline of renal function in an individual with antibody-mediated rejection (ABMR), which methods comprise the administration of an effective amount of an anti-CD38 antibody, or antibody fragment, or one or more of the pharmaceutical compositions herein described.
  • ABMR antibody-mediated rejection
  • the present disclosure refers to a method for the treatment of antibody- mediated rejection (ABMR), in a subject, comprising administering to the subject a pharmaceutical composition comprising an anti-CD38 antibody or antibody fragment that binds to a CD38 expressing cell and leads to the depletion of such CD38 expressing cell.
  • ABMR antibody- mediated rejection
  • the present disclosure refers to a method for the treatment of ABMR in a subject, comprising administering to the subject a pharmaceutical composition comprising an anti-CD38 antibody or antibody fragment that binds to a CD38 expressing antibody-secreting cell and leads to the depletion of said antibody-secreting cell, while sparing regulatory T cell and/or B cell populations.
  • the present disclosure refers to a method for the treatment of ABMR in a subject, comprising administering to the subject a pharmaceutical composition comprising an anti-CD38 antibody or antibody fragment that binds to a CD38 expressing antibody-secreting cell and leads to the depletion of said antibody-secreting cell, but does not lead to a significant depletion of regulatory T cells.
  • the present disclosure refers to a method for the treatment of antibody-mediated rejection (ABMR) in a subject, comprising administering to the subject a pharmaceutical composition comprising an anti-CD38 antibody or antibody fragment that binds to a CD38 expressing antibody-secreting cell and leads to the depletion of such CD38 expressing antibody-secreting cell, wherein the antibody shows a significant higher specific cell killing on antibody-secreting cells than on NK cells.
  • ABMR antibody-mediated rejection
  • the present disclosure refers to a method for the treatment of antibody- mediated rejection (ABMR) in a subject, comprising administering to the subject a pharmaceutical composition comprising an anti-CD38 antibody or antibody fragment that binds to a CD38 expressing antibody-secreting cell and leads to the depletion of such CD38 expressing antibody- secreting cell, wherein the specific cell killing of the antibody-secreting cell is at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40% and wherein the specific cell killing of antibody-non-secreting NK cells is less than 30%, less than 25%, less than 20%, or less than 15% as determined in a standard ADCC assay.
  • ABMR antibody- mediated rejection
  • the present disclosure refers to a method for the treatment of antibody- mediated rejection (ABMR) in a subject, comprising administering to the subject a pharmaceutical composition comprising an anti-CD38 antibody or antibody fragment, wherein the subject has undergone standard-of-care treatment comprising one or more of immunoglobulin administration (IVIG), rituximab administration and plasma exchange (PLEX), and the subject’s response to the standard- of-care treatment is ineffective.
  • IVIG immunoglobulin administration
  • PLEX rituximab administration and plasma exchange
  • the subject to be treated is further resistant or has acquired resistance to immunosuppressive treatment with one or more of eculizumab, thymoglobulin, bortezomib, carfilzomib, basiliximab, mycophenolate mofetil, tacrolimus and corticosteroids.
  • the present disclosure refers to a method for the treatment of antibody- mediated rejection (ABMR) in a subject, comprising administering to the subject a pharmaceutical composition comprising an anti-CD38 antibody or antibody fragment, wherein the subject has not undergone any prior standard-of-care treatment.
  • the present disclosure refers to a method for the treatment of ABMR in a subject, comprising administering to the subject a pharmaceutical composition comprising an anti-CD38 antibody or antibody fragment, wherein administration of the anti-CD38 antibody does not result in a significant change the absolute number of regulatory CD4+, CD25+, CD127- T cells.
  • the present disclosure refers to a method for the treatment of ABMR in a subject, comprising administering to the subject a pharmaceutical composition comprising an anti-CD38 antibody or antibody fragment, wherein the CD8+T cell/Treg ratio does not increase significantly after antibody administration.
  • the present disclosure refers to a method for the treatment of ABMR in a subject, comprising administering to the subject a pharmaceutical composition comprising an anti-CD38 antibody or antibody fragment, wherein administration of said anti-CD38 antibody or antibody fragment leads to a reduction of class I and/or class II anti-HLA antibody levels.
  • Anti- HLA class I antibodies comprise anti-HLA-A, -B, and -C.
  • Anti-HLA class II antibodies comprise anti-HLA-DR, -DQ (e.g. anti-DQ5), and -DP.
  • the method for the treatment of ABMR is in a human subject and comprises administration of a pharmaceutical composition comprising MOR202 (felzartamab), wherein said administration leads to a reduction of class II anti-HLA antibody levels, preferably anti-DQ5 antibody levels.
  • MOR202 felzartamab
  • 9 doses of MOR202 are administered.
  • Example 1 Felzartamab in Late Antibody-Mediated Renal Allograft Rejection
  • This study is an investigator-driven pilot trial designed to assess safety, tolerability, pharmacokinetics, pharmacodynamics and efficacy of the fully human anti-CD38 monoclonal antibody felzartamab in kidney transplant recipients with late active or chronic-active ABMR.
  • the trial is designed as a randomized, controlled, double-blind phase 2 pilot trial.
  • the primary endpoint will be safety and tolerability.
  • a simplified flow chart of the trial is shown in Figure 2.
  • Table 1 Inclusion and exclusion criteria.
  • Subjects will be randomized 1:1 using a web-based randomization platform (www.meduniwien.ac.at/randomizer) to receive either felzartamab (16 mg/kg, i.v. administration) or placebo.
  • felzartamab (16 mg/kg, i.v. administration) or placebo.
  • a PK modelling for an ongoing phase Ib/lla trial in autoimmune disease (membranous nephropathy, ClinicalTrials.gov, NCT04145440)
  • patients will be dosed with felzartamab for a period of 6 months, administered as an intravenous infusion.
  • subjects will be randomized to receive either felzartamab (16 mg/kg, intravenous administration) or placebo (0.9% saline) (1 : 1 randomization) for a period of 6 months (administration of felzartamab/placebo at day 0, 7, 14, 21 (cycle 1), and thereafter in 4-weekly intervals at weeks 4, 8, 12, 16, and 20 (cycles 2-6). After six (week 24) and twelve months (week 52), study participants will be subjected to follow-up allograft biopsies. Primary goals of the trial are to assess the safety, pharmacokinetics and pharmacodynamics (peripheral blood PC and NK cell depletion) of a 6-month course of treatment over a period of 12 months.
  • Felzartamab will be supplied at 65 mg/mL in 10 mM Histidine, 260 mM Sucrose, 0.1% Tween 20, pH 6.0 after reconstitution with 4.8 ml. water for injection (One vial contains 325 mg MOR202). Felzartamab will be administered after dilution with 250 ml. 0.9% sodium chloride solution (final concentration should be between 1 and 20 mg/mL). Placebo (0.9% sodium chloride) will be administered with 250 mL normal saline for infusion. Prepared infusions may be stored for up to 24 hours at 2°C to 8°C, and up to 4 hours of the 24 hours at room temperature, 15°C to 25°C.
  • felzartamab/placebo infusion Prior to administration, felzartamab/placebo infusion must reach room temperature by storing un refrigerated for 30 to 60 minutes before use. The first two infusions of felzartamab will be slow (approximately 90 min), and, if no infusion reactions occur, infusion times may be shortened to 1 hour or shorter (minimum 30 min) in subsequent infusions.
  • patients allocated to the felzartamab arm will receive i.v. premedication prior to the first two felzartamab infusions (day 0 and day 14). Patients in the placebo arm will receive placebo (0.9% NaCI solution). Premedication will be administered 30 min before the infusion of felzartamab, and will consist of Diphenhydramine (30 mg), Paracetamol (1000 mg), and Prednisolon (100 mg), respectively (each in 100 mL Volume). In the placebo arm, patients will receive 3x100 mL NaCI 0.9%.
  • Rituximab eculizumab, proteasome inhibitors, IVIG, plasma exchange or immunoadsorption, other investigational drugs/treatments including commercially available CD38 or anti-IL-6/sl L-6R monoclonal antibody drugs such as daratumumab (Darcalex®) or tocilizumab (RoActemra® /Actemra®).
  • Calcineurin inhibitors CNI, tacrolimus or cyclosporine A
  • mTOR mammalian target of rapamycin
  • MMF Mycophenolate mofetil
  • prednisolone 5mg/day long-term treatment with low dose corticosteroids
  • Baseline immunosuppression Upon diagnosis of late ABMR, all recipients on therapy with a calcineurin inhibitor [tacrolimus or cyclosporine A (CyA)] or a mTOR inhibitor (everolimus or rapamycin), without azathioprine or mycophenolic acid (MPA), will receive mycophenolate mofetil (or, alternatively, enteric-coated mycophenolic acid (EC-MPA), initially at a dose of 2 x 500 mg (or 2 x 360 mg, respectively) per day; stepwise increase to 2 x 1000 mg (or 2 x 720 mg) per day if tolerated) to avoid under-immunosuppression.
  • a calcineurin inhibitor [tacrolimus or cyclosporine A (CyA)] or a mTOR inhibitor (everolimus or rapamycin), without azathioprine or mycophenolic acid (MPA)
  • mycophenolate mofetil or, alternatively, enteric-co
  • Tacrolimus will be adjusted to achieve target trough levels between 5 and 10 ng/mL, CyA to 80-120 ng/mL. Recipients weaned off steroids will receive low dose prednisolone (5 mg/day). 1.4 Efficacy assessment
  • Major endpoints include safety and tolerability, the course of DSA (and in parallel total Ig and IgG subclass levels), the dynamics of peripheral blood counts of PC, NK cells, and T and B cell subpopulations (assessed by FACS), as well as biomarkers of rejection (CXCL9 and CXCL10 in blood and urine) and overall immunosuppression (Torque Teno viral load).
  • 6- and 12-month renal allograft biopsies will be assessed for morphological (Banff criteria of rejection and chronic injury; immunohistochemistry for detection of complement activation/deposition and characterization of cellular infiltrates including NK cells) and molecular rejection criteria (molecular ABMR score; microarray analysis using the Molecular Microscope® Diagnostic System), including pathogenesis-based transcripts (PBT) scores (cytotoxic T cell infiltration, y-interferon effects, natural killer cell burden, epithelial cell damage) in 6- and 12 month biopsies.
  • Clinical endpoints will be proteinuria as well as the slope of eGFR and the iBox clinical prediction score, both validated surrogate endpoints that accurately predict long-term allograft survival.
  • HLA antibody levels serum samples will be evaluated after completion of the study according to published protocols (Doberer, K et al.; J Am Soc Nephrol). In brief, LABscreen single-antigen flow-bead assays (One Lambda) will be applied for antibody detection. Serum samples will be incubated with 10 mM EDTA to prevent complement interference. Data acquisition will be performed via a LABScanTM 200 flow analyzer (Luminex Corporation). For longitudinal analysis of DSA/HLA antibody levels, bead assays will be performed retrospectively to avoid influences of day-by-day variations in test results.
  • Donor-specificity will be defined according to serological and/or low- or high-resolution donor/recipient HLA typing (HLA-A, -B, - Cw, -DR, -DQ, -DP). Test results will be documented as mean fluorescence intensity (MFI) of the immunodominant DSA. An MFI threshold >1,000 will be considered as positive. Impact of felzartamab treatment on DSA levels, will be estimated by the percent change in MFI. To quantify changes in DSA levels more accurately, additional dilution experiments will be performed following the methods as described in Doberer K et al. 2020, Transplantation.
  • MFI mean fluorescence intensity
  • nonlinear standard curves based on raw DSA MFI levels will be obtained by serial dilution of individual patient sera collected prior to start of treatment (all samples were incubated with EDTA) and at week 24. According to computed standard curves, the fold change of antibody levels will then be calculated from DSA MFI levels detected in the same experiment for undiluted week-12, -24 and week- 52 samples.
  • IgG, IgM and IgG subclasses will be assessed in serum applying immunonephelometry on a BNTM II analyzer (Siemens Healthineers).
  • Biopsies will also be evaluated by electron microscopy for detection of multilayering of peritubular capillary basement membranes (MLPTC). In addition, all biopsies will be analyzed using microarrays as also proposed by the Banff scheme, using the internationally validated Molecular Microscope® Diagnostic System MMDx platform.
  • ABMR will be defined based on both morphological (histomorphology, immunohistochemistry, electron microscopy) and thoroughly validated molecular criteria: (i) evidence of acute or chronic tissue injury, (ii) evidence of current/recent antibody interaction with the vascular endothelium, and (iii) serological evidence of DSA.
  • Kidney function eGFR will be assessed using the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) equation (ml_/min/1.73m 2 ). Protein excretion will be documented as protein/creatinine ratio in spot urine (mg/g).
  • CKD-EPI Chronic Kidney Disease Epidemiology Collaboration
  • chemokine detection a Luminex-based protocol as described by Muhlbacher, J, et al. (2020, Front Med, 7: 114) will be used.
  • CXCL C-X-C motif ligand
  • serum samples will be adjusted to 10 mM EDTA to prevent complement interference.
  • Undiluted samples will be measured in duplicates using multiplexed Human ProcartaPlex Simplex Immunoassays (Thermo Fisher Scientific) according to the manufacturer’s instructions. Immunoassays will be performed on a Luminex 200 instrument (Luminex Corp.).
  • Urinary results will be normalized to creatinine excretion and presented as pg (chemokine)/mg (creatinine).
  • Levels of dd-cf DNA in recipient plasma samples reflecting the extent of ongoing allograft injury will be detected using standard technology, based on the detection of a defined set of single nucleotide polymorphisms detected by next-generation sequencing on an lllumina MiSeq sequencer (lllumina Inc).
  • cells from blood, lymph nodes, bone marrow, spleen, and graft are stained with the LIVE/DEAD Fixable Aqua Dead Cell Stain Kit (Life Technologies). Then cells will be stained with one or more of the following mAbs against human: CD3, CD4, CD8, CD14, CD20, CD25, CD27, CD28, CD38, CD56, CD95, CD127, CD159a, CD278 (ICOS), CD279 (PD-1), IgM, IgG, CXCR5, and — after fixation — Ki67 and FoxP3. Samples are collected by a flow cytometer and analyzed using a standard software (e.g. FlowJo v9.6.) for percentages of CD38+ B cells and plasma cells, CD8+ T cells and/or CD4+, CD25+, CD127- T cells.
  • a standard software e.g. FlowJo v9.6.
  • RNA tubes For gene expression analysis, 5 mL of blood will be collected in PAXgene Blood RNA tubes and stored at -80°C until retrospective analysis. These tubes are designed for stabilization of RNA in blood during long-term storage at ultra-low temperature. Gene expression pattern analyses (microarray analysis) will be performed from peripheral blood to evaluate the impact of felzartamab on antibody-producing cells, analyzing genes annotated as part of the B-cell receptor signalling pathway.
  • TTV DNA is extracted from plasma samples using the NucliSENS easyMAG platform (bioMerieux) and eluted in 50 pl_ of elution buffer.
  • TTV DNA will be quantitated by TaqMan real time PCR, as described e.g. by Schiemann, M et al. (2017, Transplantation, 101: 360-367). Quantitative PCRs will be performed in a volume of 25 mI_ using 2 c TaqMan Universal PCR Master Mix, containing 5 mI_ of extracted DNA, 400 nM of each primer, and 80 nM of the probe.
  • Serum IgG titers specific for mumps, measles and rubella will be analyzed by standard ELISA technique.
  • Example 3 Safety and efficacy of MOR202 to prevent and treat ABMR in nonhuman primates undergoing kidney transplantation
  • CD38 expression levels on plasma cells from BM, spleen, lymph nodes, and blood of recipient animals and cross-reactivity with MOR202 will be analyzed. CD38 expression levels on red blood cells will be checked to estimate risk of anemia. 3.1.2 Desensitization with MOR202
  • CMV titers will be measured before and after completing drug treatment.
  • immune cells cells from blood, lymph nodes, bone marrow, spleen, and graft will be assessed by flow cytometry.
  • Renal transplants will be performed basically as described by Burghuber CK, et al (Am J Transplant. 2016;16(6):1726-1738). For depletion of plasma cell populations, sensitized rhesus monkeys will be treated weekly with MOR202. Control animals received no treatment prior to kidney transplantation. Because CD38 is expressed in hematopoietic and nonhematopoietic cells, including activated B cell and T cell populations, circulating B and T cell populations will be evaluated by FACS.
  • circulating B cells include circulating B cells, lgG+ B cells, and memory B cells (lgG+CD27+CD20+), as well as naive (CD28+CD95-), central memory (CD28+CD95+), and effector memory (CD28-CD95int) subsets of CD4 and CD8 T cells.
  • Kidneys biopsies will be collected at 1 month, 3 months, 6 months and at sacrifice and analyzed by (Immuno)Histology and scored according to the Banff criteria. Donor specific antibodies (DSA) after transplantation will be measured weekly thereafter. Animals with rebound DSA showing elevated serum creatinine will also be treated with MOR202 for one month. Cellular and humoral immune responses will be analyzed including follicular help T cells, plasma cells (BM, LN, and blood), and plasmablasts (blood and LNs). Additional kidney graft biopsies will be collected as needed. H&E, PAS and C4d staining will be performed to monitor for subclinical rejection and C4d deposition.
  • DSA levels will be continuously measured weekly via flow crossmatch using donor lymphocytes and recipient serum as described by Burghuber CK et al. (Am J Transplant 19: 724-736). Briefly, donor PBMC or splenocytes will be incubated with recipient serum, washed, and stained with FITC-labeled anti-monkey IgG, anti-CD20 mAb and anti-CD3 mAb. Mean fluorescence intensity (MFI) of anti-monkey IgG on T cells or B cells will be measured and expressed as MFI change from presensitized time point. NHP serum alloantibody may also be measured using a human solid phase Luminex assay that uses single HLA antigen beads (LABScreen Single Antigen; One Lambda) to detect crossreactive antibodies.

Landscapes

  • Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Transplantation (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
PCT/EP2022/055080 2021-03-01 2022-03-01 Anti-cd38 antibodies for use in the treatment of antibody-mediated transplant rejection Ceased WO2022184676A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
CA3209172A CA3209172A1 (en) 2021-03-01 2022-03-01 Anti-cd38 antibodies for use in the treatment of antibody-mediated transplant rejection
JP2023552183A JP2024507986A (ja) 2021-03-01 2022-03-01 抗体関連型移植拒絶反応の治療に使用するための抗cd38抗体
MX2023009868A MX2023009868A (es) 2021-03-01 2022-03-01 Anticuerpos anti-cd38 para su uso en el tratamiento del rechazo de trasplante mediado por anticuerpos.
US18/548,477 US20240228654A9 (en) 2021-03-01 2022-03-01 Anti-cd38 antibodies for use in the treatment of antibody-mediated transplant rejection
CN202280016846.7A CN116997570A (zh) 2021-03-01 2022-03-01 用于治疗抗体介导的移植排斥的抗cd38抗体
EP22708941.4A EP4301779A1 (en) 2021-03-01 2022-03-01 Anti-cd38 antibodies for use in the treatment of antibody-mediated transplant rejection
KR1020237033840A KR20230154239A (ko) 2021-03-01 2022-03-01 항체-매개 이식 거부의 치료에 사용하기 위한 항-cd38 항체
AU2022230717A AU2022230717A1 (en) 2021-03-01 2022-03-01 Anti-cd38 antibodies for use in the treatment of antibody-mediated transplant rejection
BR112023016352A BR112023016352A2 (pt) 2021-03-01 2022-03-01 Anticorpo anti-cd38 ou fragmento de anticorpo para uso
IL304692A IL304692A (en) 2021-03-01 2023-07-24 Anti-cd38 antibodies for use in the treatment of antibody-mediated transplant rejection

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP21159860 2021-03-01
EP21159860.2 2021-03-01

Publications (1)

Publication Number Publication Date
WO2022184676A1 true WO2022184676A1 (en) 2022-09-09

Family

ID=74844778

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2022/055080 Ceased WO2022184676A1 (en) 2021-03-01 2022-03-01 Anti-cd38 antibodies for use in the treatment of antibody-mediated transplant rejection

Country Status (12)

Country Link
US (1) US20240228654A9 (https=)
EP (1) EP4301779A1 (https=)
JP (1) JP2024507986A (https=)
KR (1) KR20230154239A (https=)
AU (1) AU2022230717A1 (https=)
BR (1) BR112023016352A2 (https=)
CA (1) CA3209172A1 (https=)
CL (1) CL2023002495A1 (https=)
IL (1) IL304692A (https=)
MX (1) MX2023009868A (https=)
TW (1) TW202302642A (https=)
WO (1) WO2022184676A1 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025153973A1 (en) * 2024-01-16 2025-07-24 MorphoSys GmbH Highly concentrated liquid formulations for antibodies

Citations (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999062526A2 (en) 1998-06-05 1999-12-09 Mayo Foundation For Medical Education And Research Use of genetically engineered antibodies to cd38 to treat multiple myeloma
WO2000040265A1 (en) 1999-01-07 2000-07-13 Research Development Foundation Potentiation of anti-cd38-immunotoxin cytotoxicity
WO2002006347A1 (en) 2000-07-19 2002-01-24 Crucell Holland B.V. A selectively-expressed epitope on the human cd38 molecule detected by a phage display library-derived human scfv antibody fragment
US20020164788A1 (en) 1994-12-02 2002-11-07 The Wellcome Foundation Limited Humanized antibodies to CD38
WO2005103083A2 (en) 2004-02-06 2005-11-03 Morphosys Ag Anti-cd38 human antibodies and uses therefor
WO2006099875A1 (en) 2005-03-23 2006-09-28 Genmab A/S Antibodies against cd38 for treatment of multiple myeloma
WO2006125640A2 (en) 2005-05-24 2006-11-30 Morphosys Ag Generation and profiling of fully human hucal gold®-derived therapeutic antibodies specific for human cd38
WO2007042309A2 (en) 2005-10-12 2007-04-19 Morphosys Ag Generation and profiling of fully human hucal gold-derived therapeutic antibodies specific for human cd38
WO2008037257A2 (en) 2006-09-26 2008-04-03 Genmab A/S Anti-cd38 plus corticosteroids plus a non-corticosteroid chemotherapeutic for treating tumors
WO2008047242A2 (en) 2006-10-19 2008-04-24 Sanofi-Aventis Novel anti-cd38 antibodies for the treatment of cancer
WO2010061357A1 (en) 2008-11-28 2010-06-03 Sanofi-Aventis Antitumor combinations containing antibodies recognizing specifically cd38 and melphalan
WO2010061360A1 (en) 2008-11-28 2010-06-03 Sanofi-Aventis Antitumor combinations containing antibodies recognizing specifically cd38 and cylophosphamide
WO2010061358A1 (en) 2008-11-28 2010-06-03 Sanofi-Aventis Antitumor combinations containing antibodies recognizing specifically cd38 and vincristine
WO2010061359A1 (en) 2008-11-28 2010-06-03 Sanofi-Aventis Antitumor combinations containing antibodies recognizing specifically cd38 and cytarabine
WO2015130732A2 (en) 2014-02-28 2015-09-03 Janssen Biotech, Inc. Anti-cd38 antibodies for treatment of acute lymphoblastic leukemia
WO2016089960A1 (en) 2014-12-04 2016-06-09 Janssen Biotech, Inc. Anti-cd38 antibodies for treatment of acute myeloid leukemia
WO2016210223A1 (en) 2015-06-24 2016-12-29 Janssen Biotech, Inc. Immune modulation and treatment of solid tumors with antibodies that specifically bind cd38
WO2018002181A1 (en) 2016-06-28 2018-01-04 Umc Utrecht Holding B.V. TREATMENT OF IgE-MEDIATED DISEASES WITH ANTIBODIES THAT SPECIFICALLY BIND CD38
WO2019020643A1 (en) 2017-07-24 2019-01-31 Encefa COMPOUND BINDING SPECIFICALLY TO CD38 FOR USE IN THE TREATMENT OF NEURODEGENERATIVE AND INFLAMMATORY DISEASES
WO2020185672A1 (en) 2019-03-08 2020-09-17 Cedars-Sinai Medical Center Anti-cd38 agents for desensitization and treatment of antibody-mediated rejection of organ transplants
WO2020187718A1 (en) 2019-03-15 2020-09-24 Morphosys Ag Anti-cd38 antibodies and pharmaceutical compositions thereof for the treatment of autoantibody-mediated autoimmune disease

Patent Citations (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020164788A1 (en) 1994-12-02 2002-11-07 The Wellcome Foundation Limited Humanized antibodies to CD38
WO1999062526A2 (en) 1998-06-05 1999-12-09 Mayo Foundation For Medical Education And Research Use of genetically engineered antibodies to cd38 to treat multiple myeloma
WO2000040265A1 (en) 1999-01-07 2000-07-13 Research Development Foundation Potentiation of anti-cd38-immunotoxin cytotoxicity
WO2002006347A1 (en) 2000-07-19 2002-01-24 Crucell Holland B.V. A selectively-expressed epitope on the human cd38 molecule detected by a phage display library-derived human scfv antibody fragment
WO2005103083A2 (en) 2004-02-06 2005-11-03 Morphosys Ag Anti-cd38 human antibodies and uses therefor
WO2006099875A1 (en) 2005-03-23 2006-09-28 Genmab A/S Antibodies against cd38 for treatment of multiple myeloma
WO2006125640A2 (en) 2005-05-24 2006-11-30 Morphosys Ag Generation and profiling of fully human hucal gold®-derived therapeutic antibodies specific for human cd38
WO2007042309A2 (en) 2005-10-12 2007-04-19 Morphosys Ag Generation and profiling of fully human hucal gold-derived therapeutic antibodies specific for human cd38
WO2008037257A2 (en) 2006-09-26 2008-04-03 Genmab A/S Anti-cd38 plus corticosteroids plus a non-corticosteroid chemotherapeutic for treating tumors
WO2008047242A2 (en) 2006-10-19 2008-04-24 Sanofi-Aventis Novel anti-cd38 antibodies for the treatment of cancer
WO2010061357A1 (en) 2008-11-28 2010-06-03 Sanofi-Aventis Antitumor combinations containing antibodies recognizing specifically cd38 and melphalan
WO2010061360A1 (en) 2008-11-28 2010-06-03 Sanofi-Aventis Antitumor combinations containing antibodies recognizing specifically cd38 and cylophosphamide
WO2010061358A1 (en) 2008-11-28 2010-06-03 Sanofi-Aventis Antitumor combinations containing antibodies recognizing specifically cd38 and vincristine
WO2010061359A1 (en) 2008-11-28 2010-06-03 Sanofi-Aventis Antitumor combinations containing antibodies recognizing specifically cd38 and cytarabine
WO2015130732A2 (en) 2014-02-28 2015-09-03 Janssen Biotech, Inc. Anti-cd38 antibodies for treatment of acute lymphoblastic leukemia
WO2016089960A1 (en) 2014-12-04 2016-06-09 Janssen Biotech, Inc. Anti-cd38 antibodies for treatment of acute myeloid leukemia
WO2016210223A1 (en) 2015-06-24 2016-12-29 Janssen Biotech, Inc. Immune modulation and treatment of solid tumors with antibodies that specifically bind cd38
WO2018002181A1 (en) 2016-06-28 2018-01-04 Umc Utrecht Holding B.V. TREATMENT OF IgE-MEDIATED DISEASES WITH ANTIBODIES THAT SPECIFICALLY BIND CD38
WO2019020643A1 (en) 2017-07-24 2019-01-31 Encefa COMPOUND BINDING SPECIFICALLY TO CD38 FOR USE IN THE TREATMENT OF NEURODEGENERATIVE AND INFLAMMATORY DISEASES
WO2020185672A1 (en) 2019-03-08 2020-09-17 Cedars-Sinai Medical Center Anti-cd38 agents for desensitization and treatment of antibody-mediated rejection of organ transplants
WO2020187718A1 (en) 2019-03-15 2020-09-24 Morphosys Ag Anti-cd38 antibodies and pharmaceutical compositions thereof for the treatment of autoantibody-mediated autoimmune disease

Non-Patent Citations (21)

* Cited by examiner, † Cited by third party
Title
AI-LAZIKANI ET AL., J. MOL. BIOL., vol. 273, 1997, pages 927 - 948
BURGHUBER CK ET AL., AM J TRANSPLANT, vol. 16, no. 6, 2016, pages 1726 - 1738
CHOTHIA ET AL., J. MOL. BIOL., vol. 196, 1987, pages 901 - 917
CHOTHIA ET AL., NATURE, vol. 342, 1989, pages 877 - 883
ESKANDARY, F ET AL., AM J TRANSPLANT, vol. 18, 2017, pages 916 - 926
FEHR, T ET AL., TRANSPLANTATION, vol. 87, 2009, pages 1837 - 1841
FRERICHS KA ET AL., EXPERT REV CLIN IMMUNOL, vol. 14, no. 3, 2018, pages 197 - 206
KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, U.S. DEPARTMENT OF, pages: 3242
KNAPPIK ET AL., J MOL BIOL, vol. 296, 2000, pages 57 - 86
KWUN J ET AL., BLOOD ADV, vol. 1, no. 24, 14 November 2017 (2017-11-14), pages 2115 - 2119
KWUN J ET AL., J AM SOC NEPHROL., vol. 30, no. 7, July 2019 (2019-07-01), pages 1206 - 1219
KWUN, J ET AL., JOURNAL OF THE AMERICAN SOCIETY OF NEPHROLOGY, vol. 30, 2019, pages 1206 - 1219
LAZIKANI ET AL., J. MOL. BIO., vol. 273, 1997, pages 927 - 948
LOUPY, A ET AL., AMERICAN JOURNAL OF TRANSPLANTATION, 2020
MAYNARD ET AL.: "A Handbook of SOPs for Good Clinical Practice", 1996, INTERPHARM PRESS, BOCA RATON, FLA.
MUHLBACHER, J ET AL., FRONT MED, vol. 7, 2020, pages 114
SCHIEMANN, M ET AL., TRANSPLANTATION, vol. 101, 2017, pages 360 - 367
SCHWARZ, C ET AL., TRANSPLANT INTERNATIONAL, vol. 28, 2015, pages 820 - 827
SPICA DAVIDE ET AL: "Daratumumab for Treatment of Antibody-Mediated Rejection after ABO-Incompatible Kidney Transplantation", vol. 9, no. 3, 1 January 2019 (2019-01-01), pages 149 - 157, XP055824465, Retrieved from the Internet <URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6902247/pdf/cnd-0009-0149.pdf> DOI: 10.1159/000503951 *
THERUVATH, TP ET AL., TRANSPLANTATION, vol. 72, 2001, pages 77 - 83
WALSH, RC ET AL., KIDNEY INT, vol. 81, 2012, pages 1067 - 1074

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025153973A1 (en) * 2024-01-16 2025-07-24 MorphoSys GmbH Highly concentrated liquid formulations for antibodies

Also Published As

Publication number Publication date
TW202302642A (zh) 2023-01-16
JP2024507986A (ja) 2024-02-21
BR112023016352A2 (pt) 2023-10-03
MX2023009868A (es) 2023-08-29
US20240132618A1 (en) 2024-04-25
CA3209172A1 (en) 2022-09-09
IL304692A (en) 2023-09-01
CL2023002495A1 (es) 2023-12-29
KR20230154239A (ko) 2023-11-07
EP4301779A1 (en) 2024-01-10
AU2022230717A1 (en) 2023-09-14
US20240228654A9 (en) 2024-07-11

Similar Documents

Publication Publication Date Title
JP5782132B2 (ja) 抗CD40抗体のサイレントFc変異体
KR102291971B1 (ko) 종양 성장 및 전이를 억제하기 위한 면역 조절 요법과 병용되는 세마포린-4d 억제성 분자의 용도
HK1254289A1 (zh) 调控免疫反应的方法及抗体
JP7687956B2 (ja) 自己抗体介在性自己免疫疾患の処置のための、抗cd38抗体及びその医薬組成物
US20240109977A1 (en) Anti-cd38 antibodies and their uses
US20240228654A9 (en) Anti-cd38 antibodies for use in the treatment of antibody-mediated transplant rejection
CN116997570A (zh) 用于治疗抗体介导的移植排斥的抗cd38抗体
CN116635422A (zh) 抗cd38抗体及其用途
SK12212003A3 (sk) CD25 väzbová molekula na použitie na prevenciu alebo liečenie niektorých ochorení u pacientov rezistentných na liečbu steroidmi
RU2809565C2 (ru) Антитела к CD38 и фармацевтические композиции на их основе для лечения аутоиммунного заболевания, опосредованного аутоантителами
HK40099176A (zh) 抗cd38抗体及其用途
WO2026080575A1 (en) Anti-cd38 antibodies and their uses
HK40061358B (zh) 用於治疗自身抗体介导的自身免疫疾病的抗-cd38抗体及其药物组合物
HK40061358A (en) Anti-cd38 antibodies and pharmaceutical compositions thereof for the treatment of autoantibody-mediated autoimmune disease
EA050337B1 (ru) Применение мат против ccr7 для предотвращения или лечения реакции &#34;трансплантат против хозяина&#34; (ртпх)

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22708941

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 3209172

Country of ref document: CA

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023016352

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: MX/A/2023/009868

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 202280016846.7

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 202317057627

Country of ref document: IN

Ref document number: 2023552183

Country of ref document: JP

Ref document number: 2022230717

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 11202305653U

Country of ref document: SG

ENP Entry into the national phase

Ref document number: 2022230717

Country of ref document: AU

Date of ref document: 20220301

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2022708941

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 112023016352

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230815

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 20237033840

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020237033840

Country of ref document: KR

ENP Entry into the national phase

Ref document number: 2022708941

Country of ref document: EP

Effective date: 20231002