WO2022177316A1 - 뎅기열 예방 또는 치료용 약학 조성물 - Google Patents

뎅기열 예방 또는 치료용 약학 조성물 Download PDF

Info

Publication number
WO2022177316A1
WO2022177316A1 PCT/KR2022/002339 KR2022002339W WO2022177316A1 WO 2022177316 A1 WO2022177316 A1 WO 2022177316A1 KR 2022002339 W KR2022002339 W KR 2022002339W WO 2022177316 A1 WO2022177316 A1 WO 2022177316A1
Authority
WO
WIPO (PCT)
Prior art keywords
denv
ulipristal
cells
drgon
fluorescence
Prior art date
Application number
PCT/KR2022/002339
Other languages
English (en)
French (fr)
Inventor
민달희
신호정
Original Assignee
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 서울대학교산학협력단 filed Critical 서울대학교산학협력단
Priority to KR1020237027552A priority Critical patent/KR20230131257A/ko
Priority to US18/277,653 priority patent/US20240139209A1/en
Publication of WO2022177316A1 publication Critical patent/WO2022177316A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/57—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
    • A61K31/573—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone substituted in position 21, e.g. cortisone, dexamethasone, prednisone or aldosterone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/57—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of two carbon atoms, e.g. pregnane or progesterone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/56—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids
    • A61K31/575—Compounds containing cyclopenta[a]hydrophenanthrene ring systems; Derivatives thereof, e.g. steroids substituted in position 17 beta by a chain of three or more carbon atoms, e.g. cholane, cholestane, ergosterol, sitosterol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating dengue fever and may be used in the medical field.
  • Flaviviruses are positive-stranded RNA viruses, including dengue virus, yellow fever virus, West Nile virus, and Japanese encephalitis virus. Among them, dengue virus is transmitted to humans by mosquitoes and is considered a cause of serious public health problems worldwide, with about 50 out of 100 million people infected each year, and a high infection rate of nearly 6% in some regions. Dengue infections, particularly seriously fatal (dengue hemorrhagic fever, dengue shock syndrome), can be life-threatening and have resulted in large numbers of deaths. When looking at the trend of countries with dengue virus infection, it tends to appear mainly in tropical or subtropical regions. The situation in the country is not safe.
  • a widely used dengue virus infection assay method includes a method for analyzing viral infectivity, a method for analyzing viral genomes and proteins, and a method using a genetically engineered virus.
  • these methods have disadvantages such as low reproducibility, labor intensive use, and the use of expensive samples.
  • Dengue virus has a single-stranded RNA genome of about 11 kb in length, and the genome encodes an open reading frame (ORF), with a 5' untranslated region (UTR) and a 3' UTR on both sides of the ORF.
  • ORFs encode three structural proteins (capsid, membrane, envelope proteins) and seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5).
  • RdRp RNA-dependent RNA Polymerase
  • an antiviral drug against dengue virus was screened using GOViRA (Graphene Oxide-based Viral RNA Analysis system) and the effect was confirmed to complete the present invention.
  • GOViRA Graphene Oxide-based Viral RNA Analysis system
  • An object of the present invention is to provide a pharmaceutical composition capable of preventing or treating dengue fever.
  • a pharmaceutical composition for preventing or treating dengue fever comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof:
  • R 1 to R 4 are each independently an alkyl group having 1 to 5 carbon atoms
  • R 5 is hydrogen or an acetyl group
  • A AFM image with height profile.
  • B FT-IR spectrum.
  • C UV-Vis spectrum.
  • D PL spectrum.
  • E XRD pattern.
  • F Raman spectrum.
  • G DLS analysis.
  • H TEM image of DRGON. Scale bar: 100 nm.
  • I EDS analysis of DRGON.
  • FIG. 3 is a schematic diagram showing a strategy for real-time DENV genome monitoring GOViRA platform.
  • FIG. 4 shows the selectivity of the GOViRA nanosensor.
  • A Schematic image of PNA-DRGON complex formation.
  • B Relative fluorescence intensity of Cy5-labeled PNA probes with increasing amount of DRGON.
  • C Fluorescence emission spectrum of Cy5. The fluorescence was quenched by the formation of the PNA-DRGON complex.
  • D Fluorescence was restored by addition of target RNA in a sequence-specific manner.
  • E The quenched fluorescence remained stable for 24 h in the presence of serum.
  • F Fluorescence was restored upon addition of target RNA in a sequence-specific manner in the presence of serum.
  • FIG. 5 shows the qualitative and quantitative detection of intracellular DENV genomes by the GOViRA system in uninfected and DENV-infected Vero E6 cells.
  • A Fluorescence images of uninfected and DENV-infected Vero E6 cells were taken 5 hours after PNA-DRGON complex treatment. The PNA-DRGON complex was introduced at 48 h p.i. Cy5 labeled vPNA or scPNA. Scale bar: 25 ⁇ m. (Red, Cy5 signal of PNA probe; blue, Hoechst signal of nucleus)
  • B Quantitative analysis of Cy5 signal of treated PNA-DRGON complex in uninfected and DENV-infected Vero E6 cells.
  • FIG. 6 shows the quantitative detection of intracellular ⁇ -actin via the GOViRA system in uninfected and DENV infected Vero E6 cells.
  • Vero E6 cells were infected with DENV serotypes 1, 2, 3, 4 and other flaviviruses (ZIKV and JEV).
  • PNA-DRGON complexes were simultaneously treated at 72 h p.i. Scale bar: 25 ⁇ m. (red, Cy5 signal from the PNA probe, blue from the nucleus, Hoechst signal)
  • FIG. 8 shows an increase in fluorescence signal over time in Vero E6 cells infected with DENV.
  • A PNA-DRGON complexes were treated at each indicated time point. Fluorescence images were taken 5 hours after PNA-DRGON complex treatment. Scale bar: 25 ⁇ m.
  • B Relative quantification of the fluorescence signal corresponding to viral RNA.
  • FIG. 9 shows the application of the GOViRA platform to high-throughput DENV inhibitor screening.
  • A Schematic diagram of the GOViRA system-based high-throughput screening timeline.
  • C Z'-factors were calculated for high-throughput screening in 20 replicates of each control group.
  • D Analysis of DENV infection for ribavirin using the GOViRA system. DENV-infected Vero E6 cells were treated with ribavirin concentrations ranging from 6.25 ⁇ M to 400 ⁇ M. After 48 hours, the PNA-DRGON complex was treated and DENV activity was measured.
  • FIG. 10 is a verification of ulipristal in Vero E6 cells.
  • A Chemical structure of ulipristal.
  • B The anti-DENV activity of ulipristal was investigated using FFA. The estimated EC50 for DENV serotype 2 for ulipristal was 8.28 ⁇ M.
  • C Corresponding images of viral lesions treated with representative concentrations of ulipristal.
  • FIG. 14 shows that ulipristal inhibits DENV infection in the entry phase.
  • A Timeline analysis of the addition time of ulipristal.
  • the present invention relates to a pharmaceutical composition for preventing or treating dengue fever comprising a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof.
  • R 1 to R 4 are each independently an alkyl group having 1 to 5 carbon atoms
  • R 5 is hydrogen or an acetyl group
  • the alkyl group may be, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl and the like.
  • R 1 to R 4 may be methyl, and in this case, the compound is ulipristal or ulipristal acetate.
  • Both ulipristal and ulipristal acetate are substances known as selective progesterone receptor modulators (SPRMs), and are widely used as drugs showing equivalent effects in vivo.
  • SPRMs selective progesterone receptor modulators
  • the pharmaceutically acceptable salt means a salt prepared using a specific compound according to the present invention and a relatively non-toxic acid or base.
  • the salt may be, for example, an acid addition salt or a metal salt.
  • Acid addition salts include inorganic acids such as acetate, hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid or phosphorous acid, and aliphatic mono and dicarboxylates, phenyl-substituted alkanoates, and hydroxyalkanoates. and non-toxic organic acids such as alkanedioates, aromatic acids, aliphatic and aromatic sulfonic acids.
  • These pharmaceutically non-toxic salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate, chloride, bromide, ioda.
  • an acid addition salt of a compound represented by the formula (1) can be obtained by dissolving the compound in an excess aqueous acid solution, and precipitating the salt using a hydrating organic solvent such as methanol, ethanol, acetone or acetonitrile. .
  • the metal salt may be a sodium, potassium or calcium salt.
  • Metal salts can be prepared using a base, for example, alkali metal or alkaline earth metal salts are prepared by dissolving the compound in an excess alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt and evaporating the filtrate and/or Or it can be obtained by drying.
  • the pharmaceutical composition of the present invention may be provided by mixing with a conventionally known preventive or therapeutic agent for dengue fever. That is, the pharmaceutical composition of the present invention may be administered in parallel with a known substance having an effect of preventing or treating dengue fever.
  • composition may be formulated and used in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, and sterile injection solutions, respectively, according to conventional methods. not limited
  • Carriers, excipients and diluents that may be included in the composition include lactose, dextrose, sucrose, dextrin, maltodextrin, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate. , calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.
  • a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, and a surfactant, but is not limited thereto.
  • Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, capsules, etc., but these solid preparations include at least one or more excipients in the compound, for example, starch, calcium carbonate , sucrose or lactose, gelatin, etc. are mixed and prepared.
  • excipients for example, starch, calcium carbonate , sucrose or lactose, gelatin, etc.
  • lubricants such as magnesium stearate and talc may also be used.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • As a base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.
  • Liquid preparations for oral use include suspensions, solutions, emulsions, syrups, etc.
  • various excipients for example, wetting agents, sweeteners, fragrances, preservatives, etc. may be included. .
  • the compound of the present invention may, for example, inhibit dengue virus infection by inhibiting invasion of dengue virus into host cells, and may have a preventive or therapeutic effect on dengue fever, but is not limited thereto.
  • the dengue fever is a viral disease mediated by Aedes mosquitoes, and refers to a disease caused by mosquito bites and infection with dengue virus (DENV).
  • a severe form of dengue fever is dengue hemorrhagic fever, which is accompanied by bleeding and presents with circulation disorders, and dengue shock syndrome, which is accompanied by increased vascular permeability and hypotensive shock.
  • Dengue virus belongs to the genus Flavivirus, and there are four types of DENV-1, DENV-2, DENV-3 or DENV-4 depending on the serotype.
  • the dengue fever may be caused by infection with dengue virus DENV-1, DENV-2, DENV-3 or DENV-4.
  • the present invention includes a method for treating dengue fever using the composition.
  • the method may include administering the composition to a subject in need of treatment, and the subject may have a dengue virus infection or may have a dengue virus.
  • the dengue virus may be DENV-1, DENV-2, DENV-3 or DENV-4.
  • the subject may be a mammal including a human.
  • the administration method is not limited and may be according to a method known in the art, and may be administered orally or parenterally.
  • the present invention relates to a screening method for a drug for treating a viral infection.
  • the method may include treating a candidate substance for a therapeutic agent for virus infection with a mixture of a target virus genome, graphene oxide, and a fluorescent probe having binding ability to the genome of the target virus, and comparing the fluorescence intensity with a control.
  • the viral genome may be an isolated genome or a genome contained within a virus.
  • the control may be the fluorescence intensity of the mixture before the treatment.
  • the candidate material may be selected as the therapeutic agent for viral infection.
  • control group may be a negative control having no effect on the treatment of viral infections, a positive control with known effects on treating viral infections, or a control with unknown effects on treating viral infections.
  • the mixture may be present in an environment capable of replication of the viral genome, for example, a host cell of the virus.
  • a host cell of the virus since the viral genome accumulates in the host cell and there may be an increase in fluorescence intensity due to this, the mixture can be compared with other controls to compensate for this.
  • the fluorescence intensity when the fluorescence intensity is measured after the treatment of the virus infection treatment candidate material, when the fluorescence intensity is decreased compared to the case of treatment with the negative control, it can be selected as the virus treatment agent.
  • the candidate material when the fluorescence intensity is equal to or further reduced compared to the case where the positive control is treated after the treatment of the candidate material for the treatment of virus infection, the candidate material may be selected as the treatment for the virus.
  • a control having an unknown effect on the treatment of the virus infection that is, a substance having a greater decrease in fluorescence intensity compared to other candidate substances may be selected as a therapeutic agent.
  • the control group may be one or more.
  • the fluorescence intensity of the control may be each value obtained from one or a plurality of controls, or may be an average value, a median value, a mode, or the like of values obtained therefrom.
  • the decrease in fluorescence intensity due to the treatment of the candidate material is due to the decrease in the genome of the virus of the mixture due to the virus infection treatment effect of the candidate material, so that the fluorescence is quenched by adsorption to the graphene oxide without binding to the genome of the virus. It may be that the number of probes is increased, and thus the fluorescence intensity is weakened.
  • the graphene has a planar single-layer structure in which carbon atoms are filled into a two-dimensional lattice, and graphene has a unique electron transport property, which causes graphene oxide to be close to each other through a fluorescence resonance energy transfer (FRET) phenomenon.
  • FRET fluorescence resonance energy transfer
  • the probe may be adsorbed to the graphene oxide, in which case the fluorescence signal of the fluorescent label bound to the probe is quenched.
  • the adsorption may be, for example, by interaction between graphene oxide and ⁇ electrons of the probe, complexation, ion exchange, electrostatic interaction, surface adsorption by van der Waals attraction, hydrogen bonding, etc.
  • a single-stranded peptide nucleic acid (PNA) probe may be adsorbed to the graphene oxide by pi-pi bonding between the exposed base and the hydrophobic surface of the graphene oxide.
  • the probe When the target virus genome to which the probe specifically binds exists, the probe is not adsorbed to graphene oxide and is released, so that the fluorescence of the fluorescent material contained in the probe is emitted out of the fluorescence resonance energy transfer phenomenon.
  • FIG. 3 of the present application the quenching principle of a fluorescently-labeled probe by graphene oxide is schematically illustrated as an example of a Graphene Oxidebased Viral RNA Analysis system (GOViRA) system.
  • GOViRA Graphene Oxidebased Viral RNA Analysis system
  • the genome of the virus may be DNA or RNA, for example, miRNA.
  • the probe may be a nucleic acid, and may include, for example, peptide nucleic acid (PNA).
  • PNA peptide nucleic acid
  • the virus may be, for example, a dengue virus.
  • the sequence (C term ⁇ N term) of the PNA probe that specifically binds to the dengue virus may be, for example, or include CAGCAGGATCTCTGGTCT.
  • the genome of the virus may exist on a host cell of the virus.
  • the graphene oxide to which the probe is adsorbed passes through the cell membrane of the cell and enters the cytoplasm to access the target material, the viral genome.
  • the PNA probe attached to the surface of the graphene oxide may bind to the viral genome, which is the target material.
  • Measuring the fluorescence intensity enables, for example, quantitative real-time monitoring of intracellular viral RNA levels in cells. Therefore, it is possible to effectively screen an infectious disease treatment agent or candidate material for the virus.
  • Fluorescence emission of the fluorescent material may be detected by a flow cytometer (FACS), a fluorescence reader, qRT-PCR (quantitative real-time PCR), a fluorescence microscope, or an in vivo imaging device, but is not limited thereto.
  • the fluorescence reader may include, but is not limited to, a fluorescence microplate reader capable of measuring fluorescence ranging from about 230 nm to about 999 nm.
  • the fluorescence reader may include selecting about three types of organic fluorescence dye and observing the fluorescence signal so that cross-talk between fluorescence signals can be minimized.
  • the flow cytometer includes a device capable of observing a fluorescence signal of a cell while flowing a single cell into a tube.
  • the fluorescence microscope includes, but is not limited to, those capable of observing intracellular, extracellular, or fluorescence of a sample.
  • the graphene oxide may be in the form of a sheet or particles.
  • the sheet may be composed of a single layer or a plurality of layers.
  • the sheet shape may include a flat surface or a curved surface, and may exist in various forms.
  • the graphene oxide may be in the form of a two-dimensional single-layer sheet.
  • the particle shape may include various shapes such as a spherical shape, an elliptical shape, a rod shape, and a polygonal shape.
  • the graphene oxide may have a nano size.
  • the size is, for example, 5-500 nm, 5-200 nm, 5-150 nm, 5-100 nm, 5-50 nm, 10-500 nm, 10-200 nm, 10-150 nm, 10-100 nm , 10-50 nm, 20-200 nm, 20-150 nm, 20-100 nm, 20-50 nm, 30-200 nm, 30-150 nm, 30-100 nm, 30-50 nm, 50-200 nm , 50 to 150 nm, 50 to 100 nm, 50 to 80 nm, 60 to 200 nm, 60 to 100 nm, 60 resistant 80 nm, 80 to 200 nm, 80 to 150 nm, 80 to 100 nm, 90 to 200 nm , may be 90 to 150 nm or 90 to 100 nm, but is not limited thereto.
  • the particle size is a value calculated by averaging the experimental value obtained by
  • graphene oxide may be a graphene oxide nanocolloid made of conventional graphene oxide or graphite nanofibers made of graphite powder.
  • the graphene oxide may be surface-modified with a water-soluble polymer.
  • the water-soluble polymer refers to a resin or polymer that can be dissolved in water or dispersed into fine particles in water.
  • the water-soluble polymer may be a natural polymer, a semi-synthetic polymer, or a synthetic polymer.
  • the water-soluble polymer usable in the present invention may have a molecular weight of 1 to 20 kDa, 5 to 15 kDa, or 8 to 12 kDa. In one embodiment, the water-soluble polymer may be 10 kDa.
  • Water-soluble polymers include chitosan and derivatives thereof, chitosan salts, dextran and derivatives thereof, hyaluronic acid and derivatives thereof, hyaluronate salts, pectin and derivatives thereof, pectin salts, alginates and derivatives thereof, alginic acid, agar, galactomannan and its derivatives. Derivatives, galactomannan salts, xanthan and derivatives thereof, xanthan salts, beta-cyclodextrin and derivatives thereof, beta-cyclodextrin salts, polyethylene glycol (PEG), polyethyleneimine (PEI) and combinations thereof. have.
  • the water-soluble polymer may be selected from the group consisting of dextran, polyethylene glycol, polyethyleneimine, and combinations thereof.
  • the water-soluble polymer and graphene oxide may be chemically or physically combined.
  • the chemical bond may be an amide bond, an ester bond, an ether bond, or the like, but is not limited thereto.
  • chemical bonding may be achieved through a crosslinking agent.
  • the water-soluble polymer and graphene oxide may be coupled through EDC coupling.
  • the physical bonding may be electrostatic attraction, hydrogen bonding, or van der Waals bonding, but is not limited thereto.
  • the graphene oxide surface-modified by the water-soluble polymer may have improved dispersion ability and stability, and improved biocompatibility.
  • a probe refers to a substance capable of specifically binding to a target substance.
  • the target material is, for example, a viral genome, and may be DNA or RNA.
  • the probe may be applied without limitation as long as it is a material capable of binding thereto, and may be, for example, a nucleic acid.
  • the peptide nucleic acid is a single-stranded PNA, it may include, but is not limited to, a graphene oxide that is easily adsorbed to the surface.
  • the main chain of oligonucleic acid is electrically neutral because the main chain of oligonucleic acid is composed of peptide bonds
  • PNA has superior adsorption to hydrophobic graphene oxide compared to DNA or RNA, which is electrically negative.
  • PNA-RNA binding is stronger than DNA-RNA or RNA-RNA binding, and the Tm value is higher by about 1°C per base. Therefore, the PNA probe has superior binding ability with the nucleic acid as a target material compared to the DNA or RNA probe.
  • PNA is very stable against nucleases or proteases present in the body, the possibility of loss of PNA probes when PNA probes are introduced into cells is higher than that of DNA, RNA, or protein probes. very low
  • PNA is structurally composed of strong covalent bonds, it can maintain stability in various pH ranges and temperature conditions, and thus has excellent conditions compared to other types of nucleic acids as oligonucleic acids to be used as probes.
  • Nucleic acids are 8-100, 8-90, 8-80, 8-70, 8-60, 8-50, 8-40, 8-30, 10-100, 10-90 10 to 80, 10 to 70, 10 to 60, 10 to 50, 10 to 40, 10 to 30, 12 to 28, 15 to 25, 18 to 22 bases
  • the number of bases is not limited thereto as long as it can perform complementary binding to the target nucleic acid sequence.
  • the nucleic acid may consist of 15 to 22 bases.
  • a fluorescent material is bound to the probe.
  • the fluorescent material is present in a state in which fluorescence energy is absorbed by graphene oxide and is quenched, and when the probe specifically binds to a target material and is released from graphene oxide, it exhibits fluorescence.
  • the fluorescent material may be bound to one end or the middle of the probe.
  • the fluorescent material may be located at the 5' or 3' position of the nucleic acid or inside the nucleic acid.
  • the fluorescent material may be directly bound to the probe or may be bound through a crosslinking agent.
  • the method may use two or more different probes to detect two or more target substances.
  • the fluorescent material bound to each type of probe may be different.
  • Fluorescent materials include fluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, fluorescein isothiocyanate (FITC), oregon green, Alex Fluor Rho, carboxyfluorescein (FAM), 6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein (JOE), carboxy-X-rhodamine (ROX), 6 -Carboxy-2',4,4',5',7, 7'-hexachlorofluorescein (HEX), Texas red (sulforhodamine 101 acid chloride), 6-carboxy-2',4,7',7 -Selected from the group consisting of tetrachlorofluorescein (TET), tetramethylrhodamine-isothiocyanate (TRITC), carboxytetramethylrhodamine (TAMRA),
  • the method of the present invention may include treating the target virus genome with graphene oxide and a fluorescent probe having binding ability to the genome of the target virus.
  • the probe before the treatment may be adsorbed to the graphene oxide.
  • Graphite nanofibers were purchased from Carbon Nano-materials Technology. Potassium persulfate (K2S2O8), phosphorus pentoxide (P2O5) and hydrogen peroxide (H2O2, 30%) were purchased from Junsei. Potassium permanganate (KMnO4) and ammonium hydroxide (NH4OH) were purchased from Sigma-Aldrich. Sulfuric acid (H2SO4) and hydrochloric acid (HCl) were purchased from Samcheon Chemical. Dextran was purchased from Fluka. Ribavirin and ulipristal were purchased from Sigma-Aldrich.
  • DRGON was synthesized according to a previously published method (Lee, J.S., Kim, S., Na, H.K., Min, D.H., 2016. Adv Healthc Mater 5 (18), 2386-2395.).
  • the height profile was obtained with an Atomic Force Microscope (AFM) NX-10 (Park Systems).
  • FT-IR measurements were performed using an FT-IR spectrometer NICoLET iS10 (Thermo Scientific). UV-Vis absorbance spectra and PL spectra were obtained with S-3100 (Scinco) and ACTON SpectraPro 2150i spectrometers (Princeton Instruments), respectively.
  • X-ray diffraction (XRD) patterns were obtained using a D8 Advanced (Bruker) system with Cu-K ⁇ radiation (1.54 ⁇ ).
  • TEM images were acquired using an H-7600 (Hitachi) at 100 kV. Energy-dispersive X-ray spectroscopy (EDS) analysis was performed by JEM-F200 (JEOL Ltd).
  • Cy5-labeled PNA probe (Panagene) was mixed with increasing amounts of DRGON in 1 X PBS and incubated for 10 min at RT.
  • single-stranded RNA (Bioneer) was added to the complex. The fluorescence signal was monitored by SynergyMx (Biotek).
  • Vero E6 was provided by K. Ahn, professor of biology at Seoul National University. Vero E6 and Huh7 (Korea Cell Line Bank, 60104) cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS) and P/S. A549 (ATCC, CCL-185) cells were maintained in RPMI supplemented with 10% FBS and P/S.
  • DENV serotype 1 (DenKor-07) was purchased from the National Pathogen Collection.
  • DENV serotypes 2, 3, 4 and JEV KBPV-VR-29, KBPV-VR-30, KVPV-VR-31 and KBPV-VR-27 were purchased from the Korea Pathogenic Virus Bank.
  • ZIKV Zika/Brazil/16321
  • DENV Vero E6 cells
  • DMEM fetal bovine serum
  • FBS fetal bovine serum
  • P/S fetal bovine serum
  • Cells were seeded at an MOI of 0.05.
  • the virus-containing medium was removed by centrifugation at 2000 g for 10 minutes, and aliquots were stored at 80°C.
  • Virus was titrated by FFA in Vero E6 cells. Viruses serially diluted 10-fold in DMEM supplemented with 2% FBS and P/S were added to confluent Vero E6 cell monolayers attached to 96-well, black-walled, optical-bottomed plates (Corning) and incubated for 1 h. . After incubation, 100 ⁇ L of DMEM containing 10% FBS, P/S and methylcellulose was superimposed on the wells and incubated for 2 days. After incubation, cell monolayers were fixed with 4% paraformaldehyde and then treated with blocking solution for 1 hour. Samples were then treated with anti-dengue virus E protein antibody (GeneTex, GTX127277) followed by FITC-labeled goat anti-mouse IgG secondary antibody (Sigma-Aldrich, F0257).
  • Vero E6 cells were seeded in 96 well, black walled, optical bottom plates at a density of 1.5 X 10 4 cells per well and incubated with DMEM supplemented with 10% FBS and P/S. After overnight incubation, cells were briefly washed with 1 ⁇ PBS and infected with DENV. Next, 20 pmol vPNA or ⁇ -actin PNA probe was mixed with 1.2 ⁇ g DRGON solution for 10 min at room temperature. Vero E6 cells were treated with PNADRGON complex for 5 hours. Plates were incubated for up to 72 hours and cell nuclei were counterstained with Hoechst 33342. Fluorescence images were obtained with IN Cell Analyzer 2000 (GE Healthcare) and DeltaVision Elite (GE Healthcare) imaging systems. Quantification of data was processed with IN Cell Developer software (https://cyvitalifesciences.com).
  • CCK-8 assays were performed according to the manufacturer's instructions. Vero E6, Huh7 and A549 cells were seeded in 96-well culture plates containing 100 ⁇ L of complete medium. After incubation for 24 hours, cells were treated with serially diluted concentrations of nanomaterials or drugs for 48 hours. Cells were rinsed twice with 1 X PBS, treated with CCK-8 reagent at a concentration of 10% (v/v), and incubated for 1 hour. The optical density at 450 nm was measured by SynergyMx (Biotek) in absorbance mode.
  • mice (8-10 weeks old, female) were purchased from Marshall BioResources and housed in pathogen-free conditions. Animal research was approved by the Animal Care and Use Committee of the Animal Research Institute of Seoul National University, and was performed in accordance with the recommendations of the Laboratory Animal Management Evaluation and Accreditation Association.
  • mice were exposed to a target dose of 107 FFU of DENV by intraperitoneal injection.
  • One hour after challenge animals were treated with ulipristal.
  • the compound was dissolved in sesame oil to a concentration of 10X and further diluted in 1X PBS. Ulipristal was administered to animals by intraperitoneal injection.
  • mice in the vehicle control group received the drug-free solution. Animals were monitored daily for body weight, morbidity (shaggy coat, hunched posture, etc.) and survival for a total of 14 days post infection. Mice weighing less than 80% of their initial body weight were humanely euthanized. After 3 days, mice in each group were sacrificed. Blood and organ samples were collected. Blood was clarified by centrifugation and viremia was determined by qRT-PCR. Organs were homogenized and total RNA was extracted using Trizol. Relative DENV RNA levels in each organ were determined by qRT-PCR. The primer sequences are shown in Table 1.
  • A549 cells were seeded in 24-well plates. After overnight incubation, cells were treated with ulipristal at various time points and inoculated with DENV. At 48 h p.i., cells were washed with IX PBS and processed for qRT-PCR.
  • DRGON was synthesized by reducing GON with dextran, a biocompatible polysaccharide polymer. AFM analysis using the profile of the corresponding height shows that the thickness of DRGON is ⁇ 6.20 nm thicker than that of GON (Fig. 1A). The increase in the height of DRGON is attributed to the dextran coating obtained during the reduction process of the GON surface.
  • the FT-IR spectrum of DRGON showed that the intensity of the C ⁇ O bond stretch peak was decreased at 1720 cm -1 compared to that of GON (Fig. 1B). A decrease in the number of carbonyl groups indicates a successful synthesis of DRGON by a reduction process.
  • the UV-Vis spectrum of GON showed an absorption peak at about 230 nm due to the ⁇ ⁇ ⁇ * transition of the aromatic C ⁇ C bond, and the shoulder was assigned to the n ⁇ ⁇ * transition at about 305 nm. C ⁇ O bond ( Figure 1C).
  • the UV-Vis absorption spectrum of DRGON shows a redshift from 230 nm to 245 nm, indicating complete reduction and restoration of C ⁇ C bonds.
  • the n ⁇ ⁇ * transition absorption peak decreased in the absorption spectrum of DRGON because the C ⁇ O bond was greatly reduced during the reduction process.
  • the UV-Vis absorption spectra were in good agreement with the FT-IR results.
  • PL spectra of GON and DRGON were obtained using an excitation wavelength of 300 nm (Fig. 1D).
  • the strong emission peak at 430 nm is due to the ⁇ * ⁇ ⁇ transition associated with the aromatic C ⁇ C bond.
  • the peak on the right is due to a defect state due to disorder within the ⁇ - ⁇ * gap.
  • the intensity of the peak induced by the defect state was greatly decreased in the PL spectrum of DRGON, which means that sp2 domain formation was greatly increased during the reduction process.
  • GON The crystal structures of GON and DRGON were characterized by XRD analysis (Fig. 1E).
  • the significant decrease in the interlayer distance of DRGON compared to GON is due to the removal of oxygen groups through the reduction process.
  • Raman spectra show D and G bands commonly found in carbon materials (Fig. 1F).
  • the integrated intensity ratio (ID/IG) of the D and G bands increased from 0.82 to 0.86.
  • the mean hydrodynamic diameters of GON and DRGON measured by DLS were 34.0 ⁇ 0.5 nm and 48.2 ⁇ 0.8 nm, respectively (Fig. 1G).
  • the lateral dimension of the DRGON in the TEM image was smaller than 100 nm (Fig. 1H) and we found a good correlation between the hydrodynamic diameter measured by DLS and the particle dimension measured by TEM.
  • a fluorescent PNA probe with high selectivity for the DENV genome was prepared.
  • the 3' untranslated region (UTR) region of the viral genome conserved in all four serotypes of DENV but not in other flaviviruses, was chosen as the targeting domain for the PNA probe.
  • PNA probe compositions are designed with practical considerations such as probe length, purine content and intramolecular binding to improve the solubility of PNA and reduce self-aggregation problems.
  • a PNA probe complementary to a selected region of the viral genome was named vPNA and conjugated with Cy5 .
  • Vero E6 cells were inoculated with DENV serotype 2 for 48 h and then treated with PNA-DRGON complexes consisting of either vPNA or scPNA for the next 5 h.
  • PNA-DRGON complexes consisting of either vPNA or scPNA for the next 5 h.
  • Cy3 a PNA probe complementary to ⁇ -actin was conjugated with Cy3 and used as an internal control.
  • DENV-infected Vero E6 cells displayed a distinct fluorescence signal in the cytoplasm after addition of the vPNA-DRGON complex, whereas uninfected cells did not.
  • the quantified fluorescence signal corresponding to ⁇ -actin remained constant, indicating that ⁇ -actin was an appropriate internal control ( FIG. 6 ).
  • DENV exists in multiple serotypes displaying partially conserved sequences. When designing the sequences of vPNAs, conserved regions were targeted in all four serotypes. To confirm the ability to monitor DENV infection for all four serotypes, vPNA-DRGON treatment was performed after inoculation with DENV serotypes 1, 2, 3 or 4. Regardless of serotype, the DENV-infected group showed a notable fluorescence signal in response to vPNA-DRGON treatment, whereas the other flavivirus-infected group did not (Fig. 7). These results indicate that the GOViRA system has great specificity for DENV regardless of serotype, suggesting that this system can also be used to differentiate infection of DENV from other flaviviruses.
  • Vero E6 cells inoculated with DENV were treated with PNA-DRGON complexes at serial time intervals from 12 to 72 hours (p.i.) post infection (Fig. 8A).
  • Vero E6 cells were inoculated with DENV at various multiplicity of infection (MOI) from 0.25 to 2 and the cells were monitored by living cell microscopy. The quantified fluorescence signal increased in an MOI dependent manner (Fig. 9B).
  • the GOViRA platform with live cells has been successfully demonstrated, we tried to determine whether the GOViRA platform is suitable for high-throughput screening.
  • the Z'-factor was used as a statistical parameter.
  • the Z'-factor of the GOViRA platform was calculated to be 0.87 in 20 negative and 20 positive controls (Fig. 9C), which can be suggested as evidence of a good assay for high-throughput screening.
  • the system was utilized to investigate the cellular effects of a representative antiviral compound, Ribavirin.
  • the introduction of ribavirin induced a continuous decrease in the fluorescence signal in a dose-dependent manner (Fig. 9D), indicating that the GOViRA system is suitable for a fluorescence-based quantitative antiviral assay.
  • FIG. 9A Cell-based screening was performed on a library of ⁇ 550 FDA-approved drugs using the GOViRA system to find therapeutic candidates with anti-DENV activity. Vero E6 cell monolayers were treated with 10 ⁇ M of each drug in the library or vehicle (DMSO) for 1 h prior to infection. Then, the DENV and PNA-DRGON complexes were sequentially introduced ( FIG. 9A ). According to the screening results considering both antiviral activity and cell viability (FIG. 9E), ulipristal, which exhibits a decrease in fluorescence signal of less than 25% and minimal effect on cell viability, was selected as a strong antiviral candidate (FIG. 10A).
  • Standard assays were performed to confirm the antiviral effect and cytotoxicity of ulipristal in vitro.
  • the activity of ulipristal against DENV was assessed by both FFA and qRT-PCR.
  • FFA Vero E6 cells were infected with DENV in the presence of various concentrations of ulipristal.
  • Anti-DENV activity was assessed by immunostaining with an antibody specific for DENV E protein. With a dose-dependent decrease in the number of lesions, FFA demonstrated that the compound had an antiviral effect against DENV in Vero E6 cells (Fig. 10C), with a half-life effective concentration (EC50) of 8.3 ⁇ 0.1 ⁇ M (Fig. 10B). Relative expression levels of viral RNA confirm that ulipristal is active against DENV and correlates with FFA. The cytotoxicity of the compounds in Vero E6 cells was determined by CCK-8 assay. Ulipristal did not appear to affect cell viability in Vero E6 cells ( FIG. 10D ).
  • the antiviral activity of ulipristal was further validated using the Huh7 (liver cancer cell line) and A549 (lung carcinoma cell line) cell lines as hosts for DENV infection. Both cell monolayers were analyzed by qRT-PCR to observe relative DENV RNA levels. Ulipristal treatment dose-dependently inhibited DENV infection in both cell lines ( FIGS. 11A and B). Moreover, the fluorescence signal of viral E protein from immunostaining was also reduced by ulipristal treatment (Fig. 11C). These results indicate that ulipristal effectively inhibits DENV infection in vitro.
  • this compound was evaluated in a murine DENV infection model.
  • the DENV strain used (KBPV-VR-29) is reported as a mouse-adapted virus strain.
  • AG129 mice deficient in interferon (IFN)- ⁇ / ⁇ and - ⁇ receptors were infected with DENV by intraperitoneal injection at an exposure dose of 1X10 7 FFU, which showed mortality within about 10 days.
  • IFN interferon
  • animals were treated with ulipristal or vehicle over a 14-day period, during which survival was monitored.
  • Ulipristal was administered at a dose of 15 mg/kg daily via intraperitoneal injection. Dosage varies with reported rodent toxicity studies (Pohl, O., Harvey, P.W., McKeag, S., Boley, S.E., Gotteland, J.P., 2013. Curr. Drug Saf. 8 (2), 77-97.) and in vitro. It was determined based on the drug validation results. We wanted to select a dose that would prevent toxicity but would achieve a plasma concentration sufficient to observe an antiviral effect.
  • the systemic and local antiviral effects of ulipristal were confirmed.
  • the ulipristal-treated group showed a significant decrease in blood viremia compared to the control group (FIG. 12C).
  • the viral RNA load of each organ of the mice administered with ulipristal was significantly decreased consistent with blood viremia, but the viral RNA load of the small intestine of the vehicle and the ulipristal-treated group was not statistically significant (Fig. 12D). . Representative tissue samples from each group were examined to further determine histological differences.
  • ulipristal is widely known as a SPRM compound
  • a cell line without PR expression was selected to rule out the effect of PR signaling on the addition time experiment.
  • PR expression was observed in three groups of A549 cells: untreated (NT), vehicle treated and ulipristal treated group. After 24 hours of incubation, the RNA expression level of each group was analyzed. There was no PR expression in the NT group ( FIG. 13 ).
  • vehicle or ulipristal treatment did not affect PR expression levels in A549 cells. Therefore, we investigated the mode of action of ulipristal using the A549 cell line.
  • A549 cells were treated with ulipristal in three different conditions: pre-infection (pre-treatment), co-infection (co-treatment), and post-infection (post-treatment) (Fig. 14A).
  • the antiviral effect by drug administration was observed in the pre-treatment group and the co-administration group.
  • ulipristal was added after virus inoculation, less inhibitory effect was observed.
  • the degree of the inhibitory effect decreased ( FIG. 14B ).

Abstract

본 발명은 뎅기열 예방 또는 치료용 약학 조성물에 관한 것이다. 구체적으로 상기 조성물은 울리프리스탈, 울리프리스탈 아세테이트 또는 이의 약학적으로 허용되는 염을 포함하는 것일 수 있으며, 뎅기 바이러스의 감염을 억제할 수 있다.

Description

뎅기열 예방 또는 치료용 약학 조성물
본 발명은 뎅기열의 예방 또는 치료용 약학 조성물에 관한 것으로 의료 분야에서 사용될 수 있다.
플라비바이러스는 양성 가닥 RNA 바이러스로 뎅기 바이러스, 황열 바이러스, 웨스트나일 바이러스, 일본 뇌염 바이러스 등이 이에 속한다. 이 중 뎅기 바이러스의 경우에는 모기에 의해 사람에게 전염되며 해마다 1억명 중 약 50명이 감염되며 일부 지역에서는 6%에 육박하는 높은 감염율을 보이는 등 전 세계적으로 심각한 공중 보건 문제의 원인으로 꼽힌다. 특히 심각하게 치명적인 뎅기 감염증 (뎅기 출혈열, 뎅기 쇼크 증후군)은 생명을 위협할 수 있으며 다수의 사망자를 초래해 왔다. 뎅기 바이러스 감염 질환 발생 국가 추이를 살펴보았을 때 열대나 아열대 지역에서 주로 나타나는 경향이 있으나, 최근 한국과 인접한 일본에까지 유행이 번지고 있으며, 전 세계적으로 온난화 현상이 가속되고 있으며 국가 간 인구 이동이 급증하였기 때문에 국내에서도 안심할 수 없는 상황이다.
바이러스 치료용 약물을 개발하기 위해서는 숙주세포에서의 바이러스 감염을 분석하는 방법이 필요하다. 널리 사용되는 뎅기 바이러스 감염 분석법으로는 바이러스 감염능을 분석하는 방법, 바이러스 게놈 및 단백질을 분석하는 방법, 유전자 조작 바이러스를 사용하는 방법 등이 있다. 하지만 이러한 방법들은 재현성이 낮고, 노동 집약적이며 고가의 시료를 사용해야 한다는 단점이 있어 고속 대량 스크리닝을 위해서는 새로운 분석 전략의 개발이 시급하게 요구되는 실정이다.
뎅기 바이러스는 약 11 kb 길이의 단일 가닥 RNA 게놈을 갖고 있으며, 게놈은 open reading frame (ORF)를 암호화 하며, ORF 양쪽으로 5' untranslated region (UTR)과 3' UTR이 존재한다. ORF는 3개의 구조단백질 (캡시드, 막, 외피 단백질)과 7개의 비구조 단백질 (NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5)을 암호화한다. 뎅기 바이러스가 숙주세포에 감염되면 숙주세포의 단백질을 이용하여 자신의 헬리케이스 (helicase)와 핵산중합효소 (RdRp: RNA-dependent RNA Polymerase)를 생성하고 이들을 이용하여 자신의 게놈을 복제해 바이러스를 증식시킨다. 이 과정에서 숙주세포 내에는 뎅기 바이러스 RNA 게놈이 축적되는데, 이 때 세포 내에서 생성된 RNA 게놈의 양을 측정하면 뎅기 바이러스의 감염을 분석 할 수 있다.
이에 본 발명에서는 GOViRA(Graphene Oxide-based Viral RNA Analysis system)을 이용해 뎅기 바이러스에 대한 항바이러스 약물을 스크리닝하고 그 효과를 확인하여 본 발명을 완성하였다.
본 발명은 뎅기열을 예방 또는 치료할 수 있는 약학 조성물을 제공하는 것을 목적으로 한다.
1. 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용되는 염을 포함하는 뎅기열 예방 또는 치료용 약학 조성물:
[화학식 1]
Figure PCTKR2022002339-appb-img-000001
(식 중,
R1 내지 R4는 서로 독립적으로 탄소수 1 내지 5의 알킬기이고,
R5는 수소 또는 아세틸기임).
2. 위 1에 있어서, 상기 R1 내지 R4는 메틸인, 뎅기열 예방 또는 치료용 약학 조성물.
3. 위 1에 있어서, 상기 뎅기열은 뎅기 바이러스 DENV-1, DENV-2, DENV-3 또는 DENV44의 감염에 의한 것인, 뎅기열 예방 또는 치료용 약학 조성물.
도 1은 GON 및 DRGON의 특성을 나타낸다. (A) 높이 프로필이 있는 AFM 이미지. (B) FT-IR 스펙트럼. (C) UV-Vis 스펙트럼. (D) PL 스펙트럼. (E) XRD 패턴. (F) 라만 스펙트럼. (G) DLS 분석. (H) DRGON의 TEM 이미지. 스케일 바: 100 nm. (I) DRGON의 EDS 분석.
도 2의 (A)는 표시된 시간 동안 1 X PBS 및 전체 미디어에서 GON, DRGON 및 PNA-DRGON 복합체의 디지털 이미지 저장 후 100 μg/mL의 나노입자(GON 및 DRGON) 및 1.67 μM의 vPNA를 각 용액에 분산시킨 것이다. (B)는 48시간 동안 연속 희석된 GON 또는 DRGON으로 처리된 Vero E6 세포의 세포 생존율을 나타낸다. 값은 평균 ± SEM을 나타낸다(n = 3).
도 3은 실시간 DENV 게놈 모니터링 GOViRA 플랫폼을 위한 전략을 나타낸 개략도이다.
도 4는 GOViRA 나노센서의 선택성을 나타낸다. (A) PNA-DRGON 복합체 형성의 도식적 이미지. (B) DRGON의 양이 증가함에 따라 Cy5 표지된 PNA 프로브의 상대적 형광 강도. (C) Cy5의 형광 방출 스펙트럼. 형광은 PNA-DRGON 복합체의 형성에 의해 소멸되었다. (D) 서열 특이적 방식으로 표적 RNA를 첨가하여 형광을 회복하였다. (E) 소광된 형광은 혈청의 존재 하에 24시간 동안 안정적으로 유지되었다. (F) 혈청의 존재 하에 서열 특이적 방식으로 표적 RNA의 첨가 시 형광이 회복되었다.
도 5는 비감염 및 DENV 감염 Vero E6 세포에서 GOViRA 시스템을 통한 세포내 DENV 게놈의 정성적 및 정량적 검출을 나타낸다. (A) 비감염 및 DENV 감염 Vero E6 세포의 형광 이미지는 PNA-DRGON 복합 처리 5시간 후에 촬영되었다. PNA-DRGON 복합체는 48시간 p.i.에 도입되었다. Cy5 표지된 vPNA 또는 scPNA를 포함한다. 스케일 바: 25μm. (빨간색, PNA 프로브의 Cy5 신호; 파란색, 핵의 Hoechst 신호) (B) 비감염 및 DENV 감염 Vero E6 세포에서 처리된 PNA-DRGON 복합체의 Cy5 신호 정량 분석. 각 신호의 상대 강도는 내부 대조군으로 β-액틴 신호로 정규화되었다. 값은 평균 ± SEM을 나타낸다(n = 3). 통계적 유의성은 Student's t-test(n.s.: 유의하지 않음, ****P ≤ 0.0001)에 의해 결정되었다. (C) Vero E6 세포에서 DENV 게놈의 발현에 대한 qRT-PCR 분석. 값은 평균 ± SEM을 나타낸다(n = 3). (D) DeltaVision 현미경으로 vPNA-DRGON 복합 처리 5시간 후에 DENV에 감염된 Vero E6 세포의 형광 이미지를 촬영했다. 스케일 바: 15μm. (빨간색, PNA 프로브의 Cy5 신호, 파란색, 핵의 Hoechst 신호).
도 6은 비감염 및 DENV 감염 Vero E6 세포에서 GOViRA 시스템을 통한 세포내 β-액틴의 정량적 검출을 나타낸다.
도 7은 GOViRA 시스템을 사용하여 다른 플라비바이러스와 DENV를 구별한 것이다. Vero E6 세포는 DENV 혈청형 1, 2, 3, 4 및 기타 플라비바이러스(ZIKV 및 JEV)로 감염되었다. PNA-DRGON 복합체는 72h p.i.에서 동시에 처리되었다. 스케일 바: 25μm. (빨간색, PNA 프로브의 Cy5 신호, 핵의 파란색, Hoechst 신호)
도 8은 DENV에 감염된 Vero E6 세포에서 시간에 따른 형광 신호 증가를 나타낸다. (A) 표시된 각 시점에서 PNA-DRGON 복합체를 처리했다. 형광 이미지는 PNA-DRGON 복합체 처리 5시간 후에 촬영되었다. 스케일 바: 25μm. (빨간색, PNA 프로브의 Cy5 신호, 핵의 파란색, Hoechst 신호) (B) 바이러스 RNA에 해당하는 형광 신호의 상대적 정량화. (C) 각 시점에서 Vero E6 세포에서 바이러스 RNA의 GOViRA와 qRT-PCR 분석 사이의 선형 상관관계. 값은 평균 ± SEM을 나타낸다(n = 3).
도 9는 고처리량 DENV 억제제 스크리닝에 GOViRA 플랫폼을 적용한 것이다. (A) GOViRA 시스템 기반 고처리량 스크리닝 타임라인의 개략도. (B) MOI가 증가함에 따라 형광 신호의 상대적 정량화. 값은 평균 ± SEM을 나타낸다(n = 3). (C) Z'-인자는 각 대조군의 20회 복제에서 고처리량 스크리닝을 위해 계산되었다. (D) GOViRA 시스템을 사용한 리바비린에 대한 DENV 감염 분석. DENV에 감염된 Vero E6 세포를 6.25μM에서 400μM 범위의 리바비린 농도로 처리했다. 48시간 후, PNA-DRGON 복합체를 처리하고 DENV 활성을 측정했다. 리바비린에 대한 DENV 혈청형 2에 대한 예상 EC50 값은 49.2 ±0.2 μM이었다. 값은 평균 ± SEM을 나타낸다(n = 3). (E) 항DENV 제제에 대한 선별을 수행하였다. 각 약물에 대한 세포 생존율 및 해당 형광 강도 값이 플롯된다.
도 10은 Vero E6 세포에서 울리프리스탈을 검증한 것이다. (A) 울리프리스탈의 화학 구조. (B) 울리프리스탈의 항DENV 활성은 FFA를 사용하여 조사되었다. 울리프리스탈에 대한 DENV 혈청형 2에 대한 추정 EC50은 8.28μM이었다. (C) 울리프리스탈의 대표적인 농도로 처리된 바이러스 병소의 해당 이미지. (D) 용량 의존적으로 처리된 울리프리스탈 및 상응하는 세포 생존력이 있는 Vero E6 세포에서 바이러스 RNA의 qRT-PCR 분석. 값은 평균 ± SEM을 나타낸다(n = 3).
도 11은 Huh7 및 A549 세포에서 울리프리스탈을 검증한 것이다. DENV에 감염된 Huh7(A) 및 A549(B) 세포에서 용량 의존적으로 처리된 울리프리스탈을 사용한 바이러스 RNA의 qRT-PCR 분석. 값은 평균 ± SEM을 나타낸다(n = 3). (C) Huh7 및 A549 세포에서 울리프리스탈의 용량 의존적 항바이러스 효과에 대한 DENV E 항원(녹색) 및 핵(파란색)을 보여주는 면역형광 이미지.
도 12는 DENV 감염 마우스 모델에 대한 생체 내 항바이러스 치료 조사 결과이다. DENV에 감염된 AG129 마우스에 15 mg/kg의 울리프리스탈을 하루에 한 번 처리했다. 감염된 마우스는 상대 체중 변화(A) 및 생존 플롯(B)에 대해 모니터링되었다. 값은 평균 ± SEM을 나타낸다(n = 7). 통계적 유의성은 Student's t-test(**P ≤ 0.01; A)와 log-rank test(P = 0.0007; B)에 의해 결정되었다. 혈장(C)의 바이러스혈증 및 DENV 감염 AG129 마우스의 장기(D)에 있는 바이러스 RNA 부하 p.i. 값은 평균 ± SEM을 나타낸다(n = 5). 통계적 유의성은 Student's t-test(n.s.: 유의하지 않음, *P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001 및 ****P ≤ 0.0001; C-D)에 의해 결정되었다. (E) AG129 마우스의 비장과 간의 H&E 단면 현미경 이미지.
도 13은 울리프리스탈의 PR 발현에 미치는 영향을 나타낸다. A549 세포의 세 그룹에서 PR 발현의 qRT-PCR 분석: 무처리(NT), 비히클 처리 및 울리프리스탈 처리 그룹. 값은 평균 ± SEM을 나타낸다(n = 3).
도 14는 울리프리스탈이 진입 단계에서 DENV 감염을 억제함을 나타낸다. (A) 울리프리스탈의 첨가 시간 분석 타임라인. (B) A549 세포에서 세포내 바이러스 RNA 수준의 qRT-PCR 분석. 값은 평균 ± SEM을 나타낸다(n = 3). 통계적 유의성은 스튜던트 t-검정(***P ≤ 0.001, ****P ≤ 0.0001, 대 DMSO)에 의해 결정되었다.
이하 본 발명을 상세히 설명한다.
본 발명은 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용되는 염을 포함하는 뎅기열 예방 또는 치료용 약학 조성물에 관한 것이다.
[화학식 1]
Figure PCTKR2022002339-appb-img-000002
(식 중,
R1 내지 R4는 서로 독립적으로 탄소수 1 내지 5의 알킬기이고,
R5는 수소 또는 아세틸기임).
상기 알킬기는 예를 들면 메틸, 에틸, n-프로필, 이소프로필, n-부틸, 이소부틸, 이차부틸, 삼차부틸, n-펜틸 등 일 수 있다.
구체적으로 상기 R1 내지 R4는 메틸일 수 있고, 이 경우 상기 화합물은 울리프리스탈(ulipristal) 또는 울리프리스탈 아세테이트(ulipristal acetate)이다.
상기 울리프리스탈과 울리프리스탈 아세테이트는 모두 선택적 프로게스테론 수용체 조절제(selective progesterone receptor modulator, SPRM)로 알려진 물질이며, 생체 내에서 서로 동등한 효과를 보이는 약물로 널리 사용된다.
상기 약학적으로 허용되는 염은, 본 발명에 따른 특정 화합물과 비교적 무독성인 산 또는 염기를 이용해서 조제되는 염을 의미한다. 염은 예를 들어 산 부가염 또는 금속염일 수 있다.
산 부가염은 아세테이트, 염산, 질산, 인산, 황산, 브롬화수소산, 요드화수소산, 아질산 또는 아인산과 같은 무기산류와 지방족 모노 및 디카르복실레이트, 페닐-치환된 알카노에이트, 하이드록시 알카노에이트 및 알칸디오에이트, 방향족 산류, 지방족 및 방향족 설폰산류와 같은 무독성 유기산으로부터 형성될 수 있다. 이러한 약학적으로 무독한 염은 설페이트, 피로설페이트, 바이설페이트, 설파이트, 바이설파이트, 니트레이트, 포스페이트, 모노하이드로겐 포스페이트, 디하이드로겐 포스페이트, 메타포스페이트, 피로포스페이트, 클로라이드, 브로마이드, 아이오다이드, 플루오라이드, 프로피오네이트, 데카노에이트, 카프릴레이트, 아크릴레이트, 포메이트, 이소부티레이트, 카프레이트, 헵타노에이트, 프로피을레이트, 옥살레이트, 말로네이트, 석시네이트, 수베레이트, 세바케이트, 푸마레이트, 말리에이트, 부틴- 1,4-디오에이트, 핵산-1，6-디오에이트, 벤조에이트, 클로로벤조에이트, 메틸벤조에이트, 디니트로 벤조에이트, 하이드록시벤조에이트, 메톡시벤조에이트, 프탈레이트, 테레프탈레이트, 벤젠설포네이트, 를투엔설포네이트, 클로로벤젠설포네이트, 크실렌설포네이트, 페닐아세테이트, 페닐프로피오네이트, 페닐부티레이트, 시트레이트, 락테이트, β-하이드톡시부티레이트, 글리콜레이트, 말레이트, 타트레이트, 메탄설포네이트, 프로판설포네이트, 나프탈렌-1-설포네이트, 나프탈렌-2-설포네이트 또는 만델레이트를 포함할 수 있다. 예를 들어, 화학식 1로 표시되는 화합물의 산 부가염은 화합물을 과량의 산 수용액 중에 용해시키고, 염을 수화성 유기 용매, 예컨대 메탄올, 에탄올, 아세톤 또는 아세토니트릴을 사용하여 침전시켜 수득할 수 있다.
금속염은 나트륨, 칼륨 또는 칼슘염일 수 있다. 금속염은 염기를 사용하여 제조할 수 있으며, 예를 들어, 알칼리 금속 또는 알칼리 토금속 염은 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리 토금속 수산화물 용액 중에 용해하고, 비용해 화합물 염을 여과하고 여액을 증발 및/또는 건조시켜 수득할 수 있다.
본 발명 약학 조성물은 종래에 알려져 있는 뎅기열 예방 또는 치료 물질과 혼합하여 제공될 수도 있다. 즉, 본 발명의 약학 조성물은 뎅기열의 예방 또는 치료하는 효과를 가지는 공지의 물질과 병행하여 투여할 수 있다.
상기 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있으나, 이에 제한되지 않는다.
상기 조성물에 함유될 수 있는 담체, 부형제 및 희석제로는 락토오즈, 덱스트로즈, 수크로스, 덱스트린, 말토덱스트린, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있으나, 이에 제한되지 않는다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제되나, 이에 제한되지 않는다.
경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며 이에 제한되지는 않으나, 이러한 고형제제는 상기 화합물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용될 수 있다.
비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다.
본 발명의 화합물은 예를 들면 뎅기바이러스의 숙주 세포로의 침입을 억제함으로써 뎅기바이러스 감염을 억제하고, 이에 뎅기열의 예방 또는 치료 효과를 갖는 것일 수 있으나 이에 제한되는 것은 아니다.
상기 뎅기열은 대숲모기를 매개로 한 바이러스성 질환으로, 모기에게 물려 뎅기 바이러스(dengue virus, DENV)에 감염되어 생기는 병을 의미한다. 뎅기열의 심한 형태로 출혈이 동반되며 순환장애를 나타내는 뎅기출혈열(dengue hemorrhagic fever), 혈관의 투과성 증가와 저혈압성 쇽을 동반하는 뎅기 쇽 증후군(dengue shock syndrome)이 존재한다.
뎅기 바이러스는 플라비 바이러스(Flavivirus)속에 속하며, 혈청형에 따라 DENV-1, DENV-2, DENV-3 또는 DENV-4 네 종류가 존재한다. 본 발명에서 상기 뎅기열은 뎅기 바이러스 DENV-1, DENV-2, DENV-3 또는 DENV-4의 감염에 의한 것일 수 있다.
본 발명은 상기 조성물을 이용한 뎅기열 치료 방법을 포함한다. 구체적으로, 상기 방법은 치료를 필요로 하는 개체에 상기 조성물을 투여하는 단계를 포함할 수 있으며, 개체는 뎅기 바이러스 감염증에 걸렸거나, 뎅기 바이러스를 보유하고 있는 개체일 수 있다. 상기 뎅기 바이러스는 DENV-1, DENV-2, DENV-3 또는 DENV-4일 수 있다. 상기 개체는 인간을 포함한 포유류일 수 있다.
투여 방법은 제한되지 않고 당 분야에 공지된 방법에 의할 수 있으며, 경구 또는 비경구투여 가능하다.
또한, 본 발명은 바이러스 감염증 치료제 약물의 스크리닝 방법에 관한 것이다.
상기 방법은, 바이러스 감염증 치료제 후보 물질을 타겟 바이러스 게놈, 산화그래핀, 타겟 바이러스의 게놈에 대한 결합능을 갖는 형광 프로브의 혼합물에 처리하여, 대조군과 형광 강도를 비교하는 단계를 포함할 수 있다.
바이러스 게놈은 분리된 게놈이거나, 바이러스 내에 포함되어 있는 상태의 게놈일 수 있다.
상기 대조군은 상기 처리 전 혼합물의 형광 강도일 수 있다. 예를 들면, 상기 처리 후 형광 강도가 감소하는 경우 상기 후보 물질을 상기 바이러스 감염증 치료제로 선별할 수 있다.
또한, 상기 대조군은 상기 바이러스 감염증 치료 효과가 없는 음성 대조군, 바이러스 감염증 치료 효과가 알려진 양성 대조군 또는 상기 바이러스 감염증 치료 효과가 알려지지 않은 대조군일 수 있다.
상기 혼합물은 바이러스 게놈이 복제 가능한 환경, 예를 들면 상기 바이러스의 숙주세포에 존재할 수 있다. 이 경우 숙주세포에서 상기 바이러스 게놈이 축적되고 이로 인한 형광 강도의 증가가 있을 수 있으므로, 이를 보완하기 위해 상기 혼합물을 다른 대조군과 비교할 수 있다.
상기 바이러스 감염증 치료제 후보 물질의 처리 후 형광 강도를 측정하였을 때, 상기 음성 대조군을 처리한 경우와 비교하여 형광 강도가 감소하면, 이를 상기 바이러스 치료제로 선별할 수 있다. 또는 상기 바이러스 감염증 치료제 후보 물질을 처리 후 상기 양성 대조군을 처리한 경우와 비교하여 형광 강도가 동등하거나 더 감소하면, 상기 후보 물질을 상기 바이러스 치료제로 선별할 수 있다. 또는 상기 바이러스 감염증 치료 효과가 알려지지 않은 대조군, 즉 다른 후보 물질들과 비교하여 형광 강도가 더 많이 감소한 물질을 치료제로 선별할 수 있다.
상기 대조군은 하나 이상일 수 있다. 상기 대조군의 형광 강도는 하나 또는 복수개의 대조군에서 얻어진 각각의 값이거나, 이들로부터 얻어진 값들의 평균값, 중앙값, 최빈값 등이 될 수 있다.
상기 후보물질의 처리로 인한 형광 강도의 감소는, 후보 물질이 가지는 바이러스 감염증 치료 효과로 인해 혼합물의 바이러스의 게놈이 감소함으로써, 바이러스의 게놈에 결합하지 않고 상기 산화그래핀에 흡착되어 형광이 소광되는 프로브가 증가하고, 이에 형광 강도가 약해진 것일 수 있다.
구체적으로, 상기 그래핀은 탄소원자가 2차원 격자 내로 채워진 평면 단일층 구조를 가지는데, 그래핀은 특이한 전자 전달 특성을 가지며, 이로 인해 산화그래핀은 형광 공명 에너지 전달 (FRET) 현상을 통해 가까이 있는 형광 염료의 형광 신호를 소광시킬 수 있다.
상기 프로브는 상기 산화그래핀에 흡착될 수 있고, 이 때 상기 프로브에 결합된 형광 표지의 형광 신호가 소광된다. 상기 흡착은 예를 들면 산화그래핀과 프로브의 π 전자들 간의 상호작용, 착물형성(complexation), 이온교환, 정전기적 상호작용, 반데르발스 인력에 의한 표면흡착, 수소결합 등에 의한 것일 수 있으며, 예를 들면 단일 가닥 PNA(peptide nucleic acid) 프로브는 노출된 염기와 산화그래핀의 소수성 표면 간의 pi-pi결합에 의하여 상기 산화그래핀에 흡착될 수 있다.
상기 프로브가 특이적으로 결합하는 표적 바이러스 게놈의 존재할 경우, 상기 프로브가 산화그래핀에 흡착되지 못하고 유리되므로, 상기 프로브에 함유된 상기 형광물질의 형광이 형광 공명 에너지 전달 현상에서 벗어나 발광된다.
본원 도 3에서는 산화그래핀에 의한 형광 표지된 프로브의 소광 원리를 GOViRA(Graphene Oxidebased Viral RNA Analysis system) 시스템을 일 예로 도식화하여 나타내었다.
상기 바이러스의 게놈은 DNA 또는 RNA일 수 있고, 예를 들면 miRNA일 수 있다.
상기 프로브는 핵산일 수 있고, 예를 들면 PNA(peptide nucleic acid)을 포함할 수 있다.
상기 바이러스는 예를 들면 뎅기 바이러스 일 수 있다.
상기 뎅기 바이러스에 특이적으로 결합하는 PNA 프로브의 시퀀스(C term → N term)는 예를 들면 CAGCAGGATCTCTGGTCT이거나 이를 포함하는 것일 수 있다.
상기 바이러스의 게놈은 상기 바이러스의 숙주세포상에 존재하는 것일 수 있다. 이 경우, 상기 산화그래핀의 작은 크기와 산화그래핀 표면의 소수성 부위 때문에, 상기 프로브가 흡착된 상기 산화그래핀은 상기 세포의 세포막을 통과하여 세포질 내로 들어가 상기 표적 물질인 바이러스 게놈에 접근할 수 있고, 이에 따라 상기 산화그래핀의 표면에 부착된 상기 PNA 프로브는 상기 표적 물질인 바이러스 게놈과 결합할 수 있다.
상기 형광 강도를 측정함으로써 예를 들면 세포에서 세포내 바이러스 RNA 수준의 정량적인 실시간 모니터링이 가능하게 된다. 따라서 해당 바이러스의 감염증 치료제나 후보물질을 효과적으로 스크리닝 할 수 있다.
상기 형광물질의 형광 발광은, 유세포분석기(FACS), 형광 리더기, qRT-PCR(정량 실시간 PCR), 형광 현미경, 또는 인비보 (in vivo) 이미징 기기에 의하여 검출될 수 있으나, 이에 제한되지 않는다. 예를 들어, 상기 형광 리더기는 형광 마이크로플레이트 리더로 약 230 nm 내지 약 999 nm에 이르는 형광을 측정할 수 있는 것을 포함할 수 있으나, 이에 제한되지 않는다. 예를 들어, 상기 형광 리더기는 형광 신호 사이의 cross-talk 현상이 최소화될 수 있도록 약 세 가지의 유기 형광 염료를 선택하여 그에 대한 형광 신호를 관찰하는 것을 포함할 수 있다. 예를 들어, 상기 유세포분석기는 단일 세포를 튜브로 흘려주며 세포의 형광 신호를 관찰할 수 있는 기기인 것을 포함한다. 상기 형광 현미경은 세포 내, 세포 외, 또는 시료의 형광을 관찰할 수 있는 것을 포함하나, 이에 제한되지 않는다.
산화그래핀은 시트 형태 또는 입자 형태일 수 있다. 상기 시트는 단일층 또는 복수의 층으로 구성될 수 있다. 또한, 시트 형태는 평면 또는 곡면을 포함할 수 있으며, 다양한 형태로 존재할 수 있다. 일 실시예로는 상기 산화그래핀은 2차원 단일층 시트 형태일 수 있다. 또한, 입자 형태는 구형, 타원형, 막대형 및 다각형 등 다양한 형태를 포함할 수 있다.
산화그래핀은 나노 사이즈일 수 있다. 그 사이즈는 예를 들면 5 내지 500 ㎚, 5 내지 200 ㎚, 5 내지 150 ㎚, 5 내지 100 ㎚, 5 내지 50 ㎚, 10 내지 500 ㎚, 10 내지 200 ㎚, 10 내지 150 ㎚, 10 내지 100 ㎚, 10 내지 50 ㎚, 20 내지 200 ㎚, 20 내지 150 ㎚, 20 내지 100 ㎚, 20 내지 50 ㎚, 30 내지 200 ㎚, 30 내지 150 ㎚, 30 내지 100 ㎚, 30 내지 50 ㎚, 50 내지 200 ㎚, 50 내지 150 ㎚, 50 내지 100 ㎚, 50 내지 80 ㎚, 60 내지 200㎚, 60 내지 100 ㎚, 60 내자 80 ㎚, 80 내지 200 ㎚, 80 내지 150 ㎚, 80 내지 100 ㎚, 90 내지 200 ㎚, 90 내지 150 ㎚ 또는 90 내지 100 ㎚일 수 있으나, 이에 제한되지 않는다. 입자 크기는 동적 광 산란(Dynamic Light Scattering)을 이용한 측정으로 얻어진 실험값 또는 원자력 현미경(AFM)이나 주사투과현미경(TEM) 이미지에서 보여지는 크기를 평균해서 계산한 값으로, 나노물질이 구형 또는 원형이라고 가정하고 얻어지는 값을 의미한다.
나노 사이즈의 산화그래핀을 사용하는 경우의 구체적인 예를 들면, 산화그래핀은 그라파이트 파우더로 제조된 통상의 산화그래핀 또는 그라파이트 나노파이버로 제조된 산화그래핀 나노콜로이드일 수 있다.
상기 산화그래핀은 수용성 고분자로 표면 개질된 것일 수 있다.
수용성 고분자란, 물에 녹거나 물 속에서 미세한 입자로 분산될 수 있는 수지 또는 고분자를 의미한다. 상기 수용성 고분자는 천연 고분자, 반 합성 고분자 또는 합성 고분자일 수 있다. 본 발명에서 사용가능한 수용성 고분자는 1 내지 20 kDa, 5 내지 15 kDa 또는 8 내지 12 kDa의 분자량을 가질 수 있다. 일 실시예로서 상기 수용성 고분자는 10 kDa 일 수 있다.
수용성 고분자는 키토산 및 이의 유도체, 키토산염, 덱스트란 및 이의 유도체, 히알루론산 및 이의 유도체, 히알루론산염, 팩틴 및 이의 유도체, 팩틴염, 알긴산염 및 이의 유도체, 알긴산, 아가, 갈락토만난 및 이의 유도체, 갈락토만난염, 잔탄 및 이의 유도체, 잔탄염, 베타-사이클로덱스트린 및 이의 유도체, 베타-사이클로덱스트린염, 폴리에틸렌글리콜(PEG), 폴리에틸렌이민(PEI) 및 이의 조합으로 구성된 군으로부터 선택될 수 있다. 일 실시예로서 상기 수용성 고분자는 덱스트란, 폴리에틸렌글리콜, 폴리에틸렌이민 및 이의 조합으로 구성된 군으로부터 선택될 수 있다.
수용성 고분자 및 산화그래핀은 화학적 또는 물리적으로 결합된 것일 수 있다. 상기 화학적 결합은 아마이드 결합, 에스테르 결합, 에테르 결합 등이 가능하나 이에 한정되지 않는다. 또한, 화학적 결합은 가교제를 통해 이루어질 수 있다. 일 실시예로, 수용성 고분자와 산화그래핀은 EDC 커플링(coupling)을 통해 결합될 수 있다. 또한, 상기 물리적 결합은 정전기적 인력, 수소결합, 반데르발스 결합 일 수 있으나, 이에 한정되지 않는다. 또한, 이와 같이 수용성 고분자에 의해 표면이 개질된 산화그래핀은 분산 능력 및 안정성이 향상될 수 있고, 생체 친화성이 향상될 수 있다.
프로브란 표적 물질에 특이적으로 결합할 수 있는 물질을 의미한다. 본 발명에서 표적물질은 예를 들면 바이러스 게놈으로서, DNA 또는 RNA일 수 있다. 프로브는 이에 결합될 수 있는 물질이라면 제한없이 적용될 수 있고, 예를 들면 핵산일 수 있다.
상기 PNA(peptide nucleic acid)는 단일 가닥 PNA이므로 산화그래핀의 표면에의 흡착이 용이한 것을 포함할 수 있으나, 이에 제한되지 않을 수 있다.
PNA는 올리고핵산의 주사슬이 펩티드 결합으로 구성되어 있어 전기적으로 중성을 띠고 있으므로 소수성인 산화그래핀에의 흡착성이 전기적으로 음성을 띠는 DNA 또는 RNA에 비하여 우수하다. 또한 PNA-RNA 결합은 DNA-RNA, 또는 RNA-RNA 결합보다 강하며 Tm 값이 염기당 약 1℃씩 높다. 따라서 표적물질로서의 핵산과의 결합력은 DNA 또는 RNA 프로브에 비하여 PNA 프로브가 우수하다. 또한, PNA는 체내에 존재하는 핵산분해효소(nuclease) 또는 단백질분해효소(protease)에 대하여 매우 안정하기 때문에 세포 내로 PNA 프로브가 도입되었을 때 PNA 프로브의 소실 가능성이 DNA, RNA, 또는 단백질 프로브에 비하여 매우 낮다. 추가적으로, PNA는 구조적으로 강한 공유결합으로 이루어져 있이 때문에 다양한 pH 범위 및 온도 조건에서 안정성을 유지할 수 있어 프로브로 사용할 올리고핵산으로서 다른 종류의 핵산에 비하여 우수한 조건을 가진다.
핵산은 8 내지 100개, 8 내지 90개, 8 내지 80개, 8 내지 70개, 8 내지 60개, 8 내지 50개, 8 내지 40개, 8 내지 30개, 10 내지 100개, 10 내지 90개, 10 내지 80개, 10 내지 70개, 10 내지 60개, 10 내지 50개, 10 내지 40개, 10 내지 30개, 12 내지 28개, 15 내지 25개, 18 내지 22개의 염기로 구성될 수 있으나, 표적 핵산 서열과 상보적인 결합을 할 수 있다면 염기의 개수는 이에 한정되지 않는다. 일 실시예로서 상기 핵산은 15 내지 22개의 염기로 구성될 수 있다.
프로브에는 형광 물질이 결합되어 있다. 상기 형광 물질은 산화그래핀 의해 형광 에너지가 흡수되어 소광된 상태로 존재하다가, 상기 프로브가 표적 물질과 특이적으로 결합하여, 산화그래핀으로부터 유리되면 형광을 나타내게 된다. 상기 형광 물질은 프로브의 한쪽 말단 또는 중간에 결합될 수 있다. 프로브가 핵산인 경우, 형광 물질은 핵산의 5' 또는 3' 위치 또는 핵산의 내부에 위치할 수 있다. 형광 물질은 프로브에 직접 결합하거나 가교제를 통해 결합할 수 있다.
상기 방법은 2종 이상의 표적 물질 검출을 위해 2종 이상의 상이한 프로브를 사용할 수도 있다. 이때 각 종의 프로브에 결합된 형광 물질은 상이한 것일 수 있다.
형광 물질은 플루오레신, 플루오레신 클로로트리아지닐, 로다민 그린, 로다민 레드, 테트라메틸로다민, 플루오레세인이소티오시안산염(fluorescein isothiocyanate, FITC), 오레곤 그린(oregon green), 알렉스 플루오로, 카복시플루오레스세인(carboxyfluorescein, FAM), 6-카복시-4',5'-디클로로-2',7'-디메톡시플루오레스세인(JOE), 카복시-X-로다민(ROX), 6-카복시-2',4,4',5',7, 7'-헥사클로로플루오레스세인(HEX), 텍사스 레드(sulforhodamine 101 acid chloride), 6-카복시-2',4,7',7-테트라클로로플루오레스세인(TET), 테트라메틸로다민-이소티오시아네이트(TRITC), 카복시테트라메틸로다민(TAMRA), 시아닌 계열 염료, 씨아디카르보시아닌 염료 및 이의 조합으로 구성된 군으로부터 선택될 수 있다. 상기 시아닌 계열 염료는 Cy3, Cy5, Cy5.5, Cy7 및 이의 조합으로 구성된 군으로부터 선택될 수 있다.
본 발명의 방법은 타겟 바이러스 게놈에 산화그래핀, 타겟 바이러스의 게놈에 대한 결합능을 갖는 형광 프로브을 처리하는 단계를 포함할 수 있다.
상기 처리 전의 상기 프로브는 상기 산화그래핀에 흡착되어 있는 것일 수 있다.
이하, 본 발명을 구체적으로 설명하기 위해 실시예를 들어 상세하게 설명하기로 한다.
실시예
실험 방법
1. 시약 및 기구
흑연 나노섬유는 Carbon Nano-materials Technology에서 구입했다. 과황산칼륨(K2S2O8), 오산화인(P2O5) 및 과산화수소(H2O2, 30%)는 Junsei에서 구입했다. 과망간산칼륨(KMnO4) 및 수산화암모늄(NH4OH)은 Sigma-Aldrich에서 구입했다. 황산(H2SO4)과 염산(HCl)은 삼천화학에서 구입하였다. Dextran은 Fluka에서 구입했다. Ribavirin과 울리프리스탈(ulipristal)은 Sigma-Aldrich에서 구입했다.
2. DRGON의 합성 및 특성화
DRGON은 이전에 발표된 방법(Lee, J.S., Kim, S., Na, H.K., Min, D.H., 2016. Adv Healthc Mater 5 (18), 2386-2395.)에 따라 합성되었다. 높이 프로파일은 AFM(Atomic Force Microscope) NX-10(Park Systems)으로 얻었다. FT-IR 측정은 FT-IR 분광기 NICoLET iS10(Thermo Scientific)을 사용하여 수행했다. UV-Vis 흡광도 스펙트럼 및 PL 스펙트럼은 각각 S-3100(Scinco) 및 ACTON SpectraPro 2150i 분광계(Princeton Instruments)로 얻었다. X선 회절(XRD) 패턴은 Cu-Kα 방사선(1.54Å)이 있는 D8 Advanced(Bruker) 시스템을 사용하여 얻었다. 라만 스펙트럼은 대물 렌즈(50X, 개구수 = 0.50)가 있는 BXFM 공초점 현미경을 통해 초점을 맞춘 여기 소스로 Ar 이온 CW 레이저(514.5 nm)를 사용하여 LabRAM HR UV/vis/NIR(Horiba Jobin Yvon)에 의해 획득되었다. 평균 입자 크기 및 제타 전위는 Zetasizer Nano S DLS 분석기(Malvern Panalytical)로 측정되었다. TEM 이미지는 100kV에서 H-7600(Hitachi)을 사용하여 획득했다. Energy-dispersive X-ray spectroscopy (EDS) 분석은 JEM-F200 (JEOL Ltd)에 의해 수행되었다.
3. DRGON을 사용한 PNA 프로브의 형광 신호 소광 및 복구
먼저, 20 pmol Cy5-표지된 PNA 프로브(Panagene)를 1 X PBS에서 증가하는 양의 DRGON과 혼합하고 RT에서 10분 동안 인큐베이션했다. Cy5(Ex/Em = 650/670 nm)의 형광 강도는 PNA-DRGON 복합체 형성 후 측정되었다. PNA-DRGON 복합체의 특이성을 평가하기 위해 단일 가닥 RNA(Bioneer)를 복합체에 추가했다. 형광 신호는 SynergyMx(Biotek)에 의해 모니터링되었다.
4. 세포 배양 및 바이러스
Vero E6은 서울대학교 생물학과 교수인 K. Ahn으로부터 제공받았다. Vero E6 및 Huh7(한국 세포주 은행, 60104) 세포를 10% 소태아혈청(FBS) 및 P/S가 보충된 DMEM에서 유지하였다. A549(ATCC, CCL-185) 세포는 10% FBS 및 P/S가 보충된 RPMI에서 유지되었다. DENV 혈청형 1(DenKor-07)은 국립병원균 컬렉션에서 구입했다. DENV 혈청형 2, 3, 4 및 JEV(KBPV-VR-29, KBPV-VR-30, KVPV-VR-31 및 KBPV-VR-27)는 한국병원성바이러스은행에서 구입했다. ZIKV(Zika/Brazil/16321)는 한국의 바이러스 연구 및 테스트 센터에서 구입했다. DENV, ZIKV 및 JEV는 2% FBS 및 P/S가 보충된 DMEM으로 Vero E6 세포에서 증폭되었다. 세포는 0.05의 MOI로 접종되었다. 바이러스 함유 배지는 2000g에서 10분간 원심분리하여 제거하고, 분취량은 80℃에서 보관하였다.
5. Focus-forming assays (FFA)
바이러스는 Vero E6 세포에서 FFA에 의해 적정되었다. 2% FBS 및 P/S가 보충된 DMEM에서 10배 연속 희석된 바이러스를 96웰, 검은색 벽, 광학 바닥 플레이트(Corning)에 부착된 컨플루언트 Vero E6 세포 단층에 첨가하고 1시간 동안 인큐베이션했다. 인큐베이션 후, 웰에 10% FBS, P/S 및 메틸셀룰로오스가 포함된 100 μL의 DMEM을 중첩하고 2일 동안 인큐베이션하였다. 인큐베이션 후, 세포 단층을 4% 파라포름알데히드로 고정한 다음 차단 용액으로 1시간 동안 처리하였다. 그런 다음 샘플을 항-뎅기열 바이러스 E 단백질 항체(GeneTex, GTX127277)로 처리한 다음 FITC 표지된 염소 항-마우스 IgG 이차 항체(Sigma-Aldrich, F0257)로 처리했다.
6. 살아있는 세포의 이미징
Vero E6 세포를 96웰, 흑색 벽, 광학 바닥 플레이트에 웰당 1.5 X 104개 세포의 밀도로 시딩하고 10% FBS 및 P/S가 보충된 DMEM과 함께 인큐베이션했다. 밤새 배양한 후, 세포를 1 X PBS로 간단히 세척하고 DENV로 감염시켰다. 다음으로, 20pmol vPNA 또는 β-액틴 PNA 프로브를 실온에서 10분 동안 1.2μg DRGON 용액과 혼합했다. Vero E6 세포를 PNADRGON 복합체로 5시간 동안 처리했다. 플레이트를 최대 72시간 동안 배양하고 세포 핵을 Hoechst 33342로 대조염색했다. 형광 이미지는 IN Cell Analyzer 2000(GE Healthcare) 및 DeltaVision Elite(GE Healthcare) 이미징 시스템으로 얻었다. 데이터의 정량화는 IN Cell Developer 소프트웨어(https://cyvitalifesciences.com)로 처리되었다.
7. 세포 생존력 테스트
제조업체의 지침에 따라 CCK-8 분석을 수행했다. Vero E6, Huh7 및 A549 세포를 100μL의 완전 배지가 포함된 96웰 배양 플레이트에 접종했다. 24시간 배양 후, 세포를 48시간 동안 연속적으로 희석된 농도의 나노물질 또는 약물로 처리하였다. 세포를 1 X PBS로 2회 헹구고 CCK-8 시약을 10%(v/v) 농도로 처리하여 1시간 동안 배양하였다. 450 nm에서의 광학 밀도는 흡광도 모드에서 SynergyMx(Biotek)에 의해 측정되었다.
8. qRT-PCR 분석
Trizol(Invitrogen)을 사용하여 총 RNA를 추출했다. cDNA 샘플은 SuperScript II Reverse Transcriptase(Invitrogen)를 사용하여 역전사하여 준비했다. 합성된 cDNA 샘플은 PowerUp SYBR Green Master Mix(Applied Biosystems) 및 CFX Connect(Bio-Rad)를 사용하여 각 유전자에 특이적인 프라이머로 qRT-PCR을 수행했다. 프라이머 서열은 표 1에 나타내었다.
qRT-PCR 분석을 위한 프라이머 시퀀스.
Primers Sequence (5'→3')
DENV forward GCTCCTTCAATGACAATGCGCTGTA
DENV reverse CCTGAAACCCCTTCCACGAAGTC
β-actin forward CGGGAAATCGTGCGTGAC
β-actin reverse ATGCCCAGGAAGGAAGGTTG
Human GAPDH forward TCACTGCCACCCAGAAGACTG
Human GAPDH reverse GGATGACCTTGCCCACAGC
Mouse GAPDH forward TGACCTCAACTACATGGTCTACA
Mouse GAPDH reverse CTTCCCATTCTCGGCCTTG
9. 약물 라이브러리 스크리닝
약물 라이브러리 스크리닝 실험을 위해 웰당 총 부피가 100μL인 1.5 X 104 Vero E6 세포를 10% FBS 및 P/S가 보충된 DMEM 배지를 사용하여 96-웰, 블랙 월, 광학 바닥 플레이트에 접종하고 밤새 배양했다. 다음으로, 세포를 2% FBS 및 P/S가 보충된 DMEM에서 50 μL의 실험 화합물 또는 비히클(vehicle)로 전처리하고 37℃에서 1시간 배양하였다. 다음으로, 50μL의 DENV(0.5의 최종 MOI)를 각 웰에 첨가하여 각 화합물에 대해 10μM의 최종 농도를 생성하고 세포를 48시간 동안 인큐베이션했다.
각 웰을 1X PBS로 세척하여 감염을 중단시키고 감염된 세포를 PNA-DRGON 복합체로 37℃에서 5시간 동안 처리한 후 1X PBS로 간단히 세척하였다. 형광 이미지는 IN Cell Analyzer 2000으로 얻었고 데이터의 정량화는 IN Cell Developer 소프트웨어를 사용하여 처리되었다.
10. 동물 실험
AG129 마우스(8-10주령, 암컷)는 Marshall BioResources에서 구입하여 병원균이 없는 조건에서 수용했다. 동물 연구는 서울대학교 동물연구소 동물관리이용위원회의 승인을 받았으며 실험동물관리평가인증협회의 권고사항에 따라 수행되었다.
11. 뮤린 DENV 감염 모델
뮤린 DENV 감염 모델은 이전 연구에서 설명된 바와 같다(Park, S.J., Kim, J., Kang, S., Cha, H.J., Shin, H., Park, J., Jang, Y.S., Woo, J.S., Won, C., Min, D.H., 2020. Sci Adv 6 (22), eaaz8201.). AG129 마우스는 복강내 주사에 의해 DENV의 107 FFU의 표적 용량에 노출되었다. 챌린지 1시간 후, 동물을 울리프리스탈로 처리했다. 화합물을 참기름에 10X 농도로 녹이고 1X PBS에 추가로 희석하였다. 울리프리스탈은 복강내 주사에 의해 동물에게 투여되었다.
비히클 대조군의 동물에는 약물이 없는 용액이 투여되었다. 동물은 감염 후 총 14일 동안 체중, 이환율(털이 헝클어진 털, 구부린 자세 등) 및 생존에 대해 매일 모니터링되었다. 체중이 초기 체중의 80% 미만인 마우스를 인도적으로 안락사시켰다. 3일 후, 각 그룹에서 마우스를 희생시켰다. 혈액 및 장기 샘플을 수집했다. 혈액은 원심분리에 의해 정화되었고 바이러스혈증은 qRT-PCR에 의해 결정되었다. 장기를 균질화하고 Trizol을 사용하여 전체 RNA를 추출했다. 각 기관의 상대적인 DENV RNA 수준은 qRT-PCR에 의해 결정되었다. 프라이머 서열은 표 1에 나타내었다.
12. 헤마톡실린 및 에오신(H&E) 염색
장기 샘플을 4% 파라포름알데히드로 고정하고 파라핀에 포매했다. 파라핀 절편은 서울대학교병원 의료혁신센터 병리 핵심 시설에서 H&E로 염색되었다.
13. 첨가 시간 분석
A549 세포를 24웰 플레이트에 접종했다. 밤새 배양한 후, 세포를 다양한 시점에서 울리프리스탈로 처리하고 DENV로 접종하였다. 48시간 p.i.에서 세포를 1X PBS로 세척하고 qRT-PCR을 위해 처리했다.
14. 통계
도면에 표시된 범례에서 설명된 바와 같이 GraphPad Prism 소프트웨어를 사용하여 통계 분석을 수행했다. 통계적 유의성은 P 값이 <0.05일 때 할당되었다. Error bars는 그림 범례에 표시된 SEM과 n의 수를 나타낸다.
실험 결과
1. DRGON의 특성화
생체적합성 다당류 고분자인 dextran으로 GON을 환원시켜 DRGON을 합성하였다. 해당 높이의 프로파일을 사용한 AFM 분석은 DRGON의 두께가 GON보다 두꺼운 ~6.20nm임을 보여준다(도 1A). DRGON의 높이 증가는 GON 표면의 환원 과정에서 얻은 dextran 코팅에 기인한다.
DRGON의 FT-IR 스펙트럼은 GON의 스펙트럼에 비해 1720 cm-1에서 C〓O bond stretch peak의 세기가 감소함을 보여주었다(도 1B). 카르보닐기 수의 감소는 환원 과정에 의한 DRGON의 성공적인 합성을 나타낸다.
GON의 UV-Vis 스펙트럼은 방향족 C〓C 결합의 π → π* 전이에 기인한 약 230 nm에서 흡수 피크를 보여주었으며, 약 305 nm에서 숄더가 n → π* 전이에 할당된 것을 보여주었다. C〓O 결합(도 1C). DRGON의 UV-Vis 흡수 스펙트럼은 230nm에서 245nm로의 적색 편이를 보여 C〓C 결합의 완전한 감소 및 복원을 의미한다. n → π* 전이 흡수 피크는 환원 과정에서 C〓O 결합이 크게 감소했기 때문에 DRGON의 흡수 스펙트럼에서 감소했다. UV-Vis 흡수 스펙트럼은 FT-IR 결과와 잘 일치했다.
이 관찰은 PL 스펙트럼에 의해 더욱 뒷받침되었다. GON 및 DRGON의 PL 스펙트럼은 300 nm의 여기 파장을 사용하여 얻어졌다(도 1D). 430 nm에서 강한 방출 피크는 방향족 C〓C 결합과 관련된 π* → π 전이에 기인한다. 오른쪽의 피크는 π-π* 갭 내에서 무질서로 인한 결함 상태에 기인한다. 결함 상태에 의해 유도된 피크의 강도는 DRGON의 PL 스펙트럼에서 크게 감소했으며, 이는 환원 과정에서 sp2 도메인 형성이 크게 증가했음을 의미한다.
GON 및 DRGON의 결정 구조는 XRD 분석에 의해 특성화되었다(도 1E). GON은 2θ = 10.8에서 d-간격 값이 8.2Å인 흑연 피크를 나타냈다. DRGON의 XRD 패턴에서는 이 피크가 나타나지 않았지만 dspace 값이 4.8 Å인 2θ = 18.5에서 새로운 피크가 관찰되었다. GON에 비해 DRGON의 층간 거리의 현저한 감소는 환원 과정을 통한 산소 그룹의 제거 때문이다.
라만 스펙트럼은 탄소 재료에서 일반적으로 발견되는 D 및 G 밴드를 보여준다(도 1F). D 밴드와 G 밴드의 통합 강도 비율(ID/IG)이 0.82에서 0.86으로 증가했다. DLS로 측정한 GON 및 DRGON의 평균 유체역학적 직경은 각각 34.0 ± 0.5 nm 및 48.2 ± 0.8 nm였다(도 1G). TEM 이미지에서 DRGON의 측면 치수는 100nm보다 작았고(도 1H) DLS로 측정한 유체역학적 직경과 TEM으로 측정한 입자 치수 사이에 좋은 상관 관계를 발견했다.
DRGON의 원소분석은 EDS를 이용하여 조사하였고(도 1I), DRGON의 제타전위는 38.0 ± 0.3 mV였다. 전반적으로 분석 데이터는 DRGON의 성공적인 합성을 나타낸다. 그래핀 관련 나노물질은 엔도사이토시스(endocytosis)에 의해 세포에 들어가고 입자의 분산성은 세포 흡수를 강력하게 조절한다. 생리학적 용액에서 그래핀 산화물 기반 나노물질의 불안정성은 생물학적 영역에서의 응용을 제한한다. GON, DRGON 및 PNA-DRGON 복합체의 안정성을 조사하기 위해 1X PBS 용액과 완전한 매체에 나노 입자를 분산 시켰다(도 2A). DRGON 및 PNA-DRGON 복합체는 1X PBS 용액과 완전한 배지에서 24시간 동안 가시적인 응집을 나타내지 않고 현탁액을 유지했다. 반면, GON은 1시간 후 두 용액 모두에서 입자 응집 및 침전을 보였다. 또한 DRGON에서는 명백한 독성이 측정되지 않았다(도 2B). 400μg/mL의 고농도에서도 세포 생존율은 85%로 유지되어 GON보다 훨씬 높다. 이러한 결과는 덱스트란 코팅이 생리학적 용액에서 콜로이드 안정성을 효과적으로 개선하고 세포독성을 감소시킴을 보여준다. 또한, 이러한 결과는 DRGON이 생물학적 응용에 적합함을 보여준다.
2. 형광 기반 DENV 검출 분석인 GOViRA를 위한 설계
이후 DENV 게놈에 대해 높은 선택성을 갖는 형광성 PNA 프로브를 준비했다. DENV의 4가지 혈청형 모두에서 보존되지만 다른 플라비바이러스에서는 보존되지 않는, 바이러스 게놈의 3' 비번역 영역(UTR) 영역이 PNA 프로브의 표적화 도메인으로 선택되었다. PNA 프로브 조성물은 프로브 길이, 퓨린 함량 및 분자 내 결합과 같은 실용적인 고려 사항으로 설계되어 PNA의 용해도를 향상시키고 자기 응집 문제를 감소시킨다. 바이러스 게놈의 선택된 영역에 상보적인 PNA 프로브는 vPNA로 명명되고 Cy5와 접합되었다.
각 타겟에 해당하는 PNA 시퀀스
Target PNA sequence (C term→N term)
DENV CAGCAGGATCTCTGGTCT
Scrambled ATCGAATAGTCTGACTACAACT
β-actin ATCTTGATTTTCATCGTGC
GOViRA의 개발(도 3)을 위해 준비된 DRGON과 vPNA 프로브를 사용하여 형광 소광 및 회복 테스트를 수행했다(도 4A). Cy5-labeled vPNA 20pmol에 1.2μg의 DRGON을 첨가했을 때 형광 강도는 초기 값과 비교하여 1%로 감소되었고 혈청 존재하에서 24시간 동안 형광 강도를 유지했다(도 4 B, C 및 이자형). 형광 회복은 표적 서열을 갖는 화학적으로 합성된 단일 가닥 RNA를 사용하여 측정하였다. vPNA의 소광된 형광은 표적 RNA가 첨가되었을 때 회복되었다. GOViRA 시스템의 선택성을 조사하기 위해 Cy5로 표지된 scPNA가 무작위로 스크램블된 불일치 시퀀스로 준비되었다(표 2).
표적 RNA의 존재 하에 scPNA-DRGON 복합체로부터 형광 신호가 관찰되지 않았다. 또한, RNA의 스크램블된 서열이 vPNA-DRGON 복합체와 혼합되었을 때 형광 회복의 주목할만한 관찰도 없었다(도 4D 및 F). 이러한 결과는 GOViRA 시스템이 매우 안정적이며 시퀀스 특정 방식으로만 작동함을 나타낸다.
3. 살아있는 세포에서 GOViRA 시스템의 검증
살아있는 세포에서 DENV 감염을 시각화하는 GOViRA 시스템의 능력을 조사하기 위해 Vero E6 세포에 DENV 혈청형 2를 48시간 동안 접종한 다음 vPNA 또는 scPNA로 구성된 PNA-DRGON 복합체로 다음 5시간 동안 처리했다. 상대적 정량화를 위해 β-액틴에 상보적인 PNA 프로브를 Cy3와 접합하여 내부 대조군으로 사용했다. 접종 후 세포내 바이러스 게놈이 복제됨에 따라, DENV에 감염된 Vero E6 세포는 vPNA-DRGON 복합체를 첨가한 후 세포질에서 뚜렷한 형광 신호를 나타내는 반면, 감염되지 않은 세포는 형광 신호를 나타내지 않았다. 대조적으로, scPNA-DRGON 복합체를 사용한 DENV 감염 세포의 처리는 형광 반응의 징후를 나타내지 않았으며(도 5A 및 B), 이는 살아있는 세포에서 GOViRA 시스템에 대한 높은 표적 특이성을 나타낸다. 동일한 평면에서 zsectioned 이미지를 조사했을 때 vPNA 프로브(빨간색으로 표시됨)의 Cy5 신호는 대부분 세포질 영역에서 관찰되었다(도 5D).
또한, GOViRA 시스템의 신뢰성을 검증하기 위해 동일한 실험 조건에서 qRT-PCR을 통해 세포질 내 바이러스 RNA 사본의 수를 정량화했다. DENV에 감염된 세포에서만 다량의 바이러스 게놈이 검출되었으며(도 5C), 이는 형광 신호를 분석한 결과와 높은 상관관계를 보였다.
또한, β-액틴에 해당하는 정량화된 형광 신호는 β-액틴이 적절한 내부 대조군임을 나타내는 일정하게 유지되었다(도 6). DENV는 부분적으로 보존된 서열을 나타내는 다중 혈청형으로 존재한다. vPNA의 서열을 설계할 때, 4가지 혈청형 모두에서 보존 영역을 표적으로 설정하였다. 4가지 혈청형 모두에 대한 DENV 감염을 모니터링하는 능력을 확인하기 위해 DENV 혈청형 1, 2, 3 또는 4를 접종한 후 vPNA-DRGON 처리를 했다. 혈청형에 관계없이 DENV에 감염된 그룹은 vPNA-DRGON 처리에 반응하여 주목할만한 형광 신호를 보인 반면, 다른 플라비바이러스에 감염된 그룹은 그렇지 않았다(도 7). 이러한 결과는 GOViRA 시스템이 혈청형에 관계없이 DENV에 대해 큰 특이성을 가지고 있음을 나타내며, 이 시스템이 DENV의 감염을 다른 플라비바이러스와 구별하는 데에도 사용할 수 있음을 시사한다.
세포내 바이러스 RNA 발현 수준의 동적 변화를 측정하고 바이러스 감염의 진행을 모니터링하는 GOViRA 시스템의 능력을 결정하기 위해, 시간에 따른 형광 강도의 변화를 모니터링했다. DENV로 접종된 Vero E6 세포는 감염 후 12시간에서 72시간(p.i.)까지 일련의 시간 간격으로 PNA-DRGON 복합체로 처리되었다(도 8A). 도 8B에서 볼 수 있듯이 세포의 형광 신호는 qRT-PCR 분석 결과(도 8C)와 높은 선형 상관 관계(R2 = 0.9997)로 시간 의존적 증가를 보였다. 다음으로, Vero E6 세포에 0.25에서 2까지의 다양한 감염 다중도(MOI)에서 DENV를 접종하고 세포를 살아있는 세포 현미경으로 모니터링했다. 정량화된 형광 신호는 MOI 의존 방식으로 증가했다(도 9B). 이러한 데이터는 GOViRA 플랫폼이 DENV 감염의 실시간 시각화뿐만 아니라 살아있는 세포에서 세포내 바이러스 RNA의 정량 분석을 용이하게 함을 시사한다.
4. 항DENV 활성이 있는 화합물을 식별하기 위한 승인된 약물의 고속 스크리닝
살아있는 세포가 있는 GOViRA 플랫폼이 성공적으로 시연되었기 때문에 GOViRA 플랫폼이 높은 처리량 스크리닝에 적합한지 여부를 확인하려고 했다. 고처리량 스크리닝 분석으로서 이의 전신적 신뢰성을 확인하기 위해, Z'-인자를 통계적 매개변수로 사용했다. GOViRA 플랫폼의 Z'-인자는 20개의 음성 대조군과 20개의 양성 대조군에서 0.87로 계산되었으며(도 9C), 이는 높은 처리량 스크리닝을 위한 우수한 분석의 증거로 제안될 수 있다. GOViRA 시스템이 항바이러스 활성의 정량적 분석이 가능한지 여부를 추가로 확인하기 위해 시스템을 활용하여 대표적인 항바이러스 화합물인 Ribavirin에 의한 세포 효과를 조사했다. 리바비린의 도입은 용량 의존적으로 형광 신호의 연속적인 감소를 유도하였고(도 9D), 이는 GOViRA 시스템이 형광 기반 정량적 항바이러스 분석에 적합함을 나타낸다.
GOViRA 시스템을 사용하여 ~550개의 FDA 승인 약물 라이브러리에서 세포 기반 스크리닝을 수행하여 항DENV 활성을 가진 치료제 후보를 찾았다. Vero E6 세포 단층은 감염 전 1시간 동안 라이브러리에 있는 각 약물 10μM 또는 비히클(DMSO)로 처리되었다. 그런 다음 DENV 및 PNA-DRGON 복합체를 순차적으로 도입했다(도 9A). 항바이러스 활성과 세포 생존율을 모두 고려한 스크리닝 결과(도 9E)에 따라 형광 신호 감소가 25% 미만이고 세포 생존율에 미치는 영향이 최소인 울리프리스탈을 강력한 항바이러스 후보로 선택했다(도 10A).
5. 울리프리스탈의 시험관 내 DENV 감염 억제
시험관 내에서 울리프리스탈의 항바이러스 효과와 세포독성을 확인하기 위해 표준 분석을 수행했다. DENV에 대한 울리프리스탈의 활성은 FFA와 qRT-PCR 모두에 의해 평가되었다. FFA의 경우 Vero E6 세포는 다양한 농도의 울리프리스탈이 있는 상태에서 DENV로 감염되었다.
항-DENV 활성은 DENV E 단백질에 특이적인 항체로 면역염색하여 평가하였다. 병소의 수가 용량 의존적으로 감소함에 따라 FFA는 화합물이 Vero E6 세포에서 DENV에 대해 항바이러스 효과가 있음을 입증했으며(도 10C), 반감기 유효 농도(EC50)는 8.3 ± 0.1μM이었다(도 10B). 바이러스 RNA의 상대적 발현 수준은 울리프리스탈이 DENV에 대해 활성이고 FFA와 상관관계가 있음을 확인시켜 준다. Vero E6 세포에서 화합물의 세포독성은 CCK-8 분석에 의해 결정되었다. 울리프리스탈은 Vero E6 세포에서 세포 생존력에 영향을 미치지 않는 것으로 나타났다(도 10D).
Huh7(간암 세포주) 및 A549(폐 암종 세포주) 세포주를 DENV 감염의 숙주로 사용하여 울리프리스탈의 항바이러스 활성을 추가로 검증했다. 두 세포 단층을 qRT-PCR로 분석하여 상대적인 DENV RNA 수준을 관찰했다. 울리프리스탈 처리는 두 세포주에서 DENV 감염을 용량 의존적으로 억제하였다(도 11A 및 B). 더욱이, 면역염색으로부터 바이러스 E 단백질의 형광 신호도 울리프리스탈 처리에 의해 감소되었다(도 11C). 이러한 결과는 울리프리스탈이 시험관 내에서 DENV 감염을 효과적으로 억제한다는 것을 나타낸다.
6. 뮤린 DENV 모델에서 울리프리스탈의 항DENV 효과
생체 내 DENV 감염에서 울리프리스탈의 항바이러스 활성을 확인하기 위해 이 화합물을 뮤린 DENV 감염 모델에서 평가했다. 사용한 DENV 균주(KBPV-VR-29)는 마우스 적응 바이러스 균주로 보고되어 있다. 연구를 위해 인터페론(IFN)-α/β 및 -γ수용체가 결핍된 AG129 마우스를 1X107 FFU의 노출량으로 복강 주사하여 DENV에 감염시켰으며, 이는 약 10일 이내에 치사율을 나타낸다. 감염 1시간 후, 동물을 울리프리스탈 또는 비히클을 14일에 걸쳐 처리하고, 그 기간 동안 생존을 모니터링하였다.
울리프리스탈은 복강 내 주사를 통해 매일 15 mg/kg의 용량으로 투여되었다. 용량은 보고된 설치류 독성 연구(Pohl, O., Harvey, P.W., McKeag, S., Boley, S.E., Gotteland, J.P., 2013. Curr. Drug Saf. 8 (2), 77-97.)와 시험관 내 약물 검증 결과를 기반으로 결정되었다. 독성을 예방할 수 있지만 항바이러스 효과를 관찰하기에 충분한 혈장 농도에 도달할 수 있는 용량을 선택하고자 했다.
울리프리스탈 치료가 뮤린 DENV 모델에서 증상을 완화할 수 있는지 여부를 조사하기 위해 개별 마우스의 체중을 측정하고 매일 이환율에 대해 시각적으로 모니터링했다. 울리프리스탈 처리군과 비교하여 대조군은 큰 체중 감소(도 12A)와 헝클어진 털, 구부린 자세, 운동성 감소 등의 질병 증상을 보였다(Shresta, S., Sharar, K.L., Prigozhin, D.M., Beatty, P.R., Harris, E., 2006. J. Virol. 80 (20), 10208-10217.). 감염된 마우스에서 울리프리스탈 치료는 또한 생존 플롯에 표시된 통계적으로 유의한 생존 이점(P = 0.0007)을 초래했다(도 12B). 다음으로 울리프리스탈의 전신 및 국소 항바이러스 효과를 확인하였다. 3일차에 울리프리스탈 처리군은 대조군에 비해 혈액 내 바이러스혈증이 유의하게 감소된 것으로 나타났다(도 12C). 국소 치료 효과를 평가하기 위해 대표적인 5개 장기(비장, 폐, 간, 소장, 대장)의 바이러스 RNA 발현 정도와 조직 형태를 조사했다. 울리프리스탈을 투여한 마우스의 각 기관의 바이러스 RNA 부하는 혈액 내 바이러스혈증과 일치하여 유의하게 감소했지만, 비히클의 소장과 울리프리스탈 처리군의 바이러스 RNA 부하는 통계적으로 유의하지 않았다(도 12D). 조직학적 차이를 추가로 결정하기 위해 각 그룹의 대표적인 조직 샘플을 조사했다.
Hematoxylin과 eosin(H&E)으로 염색된 각 그룹의 비장과 간의 부분을 분석하였다(도 12E). 감염되지 않은 대조군에서 볼 수 있듯이 정상 비장은 백혈구와 적색과육 구조로 구별되며, 이는 바이러스 감염 후 심하게 파열된다(DENV 감염, 비히클 처리군). 이러한 경계 손실은 울리프리스탈 처리군에서 감소하는 것으로 관찰되어 울리프리스탈 투여가 바이러스 감염 관련 비장 손상을 완화할 수 있음을 나타낸다. 또한, 간 조직에서도 몇 가지 주목할 만한 변화가 관찰되었다. DENV 감염의 병리학적 특징은 간세포의 핵 다형성, 정현파의 확장, 국소 괴사(검은색 화살표로 표시됨)를 포함한다.
대조군과 비교하여 울리프리스탈 투여군에서 이러한 증상의 유의한 감소가 관찰되었다. 종합하면 전체 데이터는 울리프리스탈이 DENV 감염 증상을 줄이는 데 기여할 수 있으며, 그 결과 생체 내에서 상당한 생존 이점을 얻을 수 있음을 나타낸다.
7. 바이러스 진입 억제로 매개되는 울리프리스탈의 작용 방식
바이러스 감염 단계의 어느 시점이 울리프리스탈 투여에 의해 영향을 받는지를 알아보기 위해 추가 시간 실험을 수행하였다. 울리프리스탈은 SPRM 화합물로 널리 알려져 있기 때문에, PR 신호전달이 첨가 시간 실험에 미치는 영향을 배제하기 위해 PR 발현이 없는 세포주를 선택했다. PR 발현은 A549 세포의 3개 그룹, 즉 무처리(NT), 비히클 처리 및 울리프리스탈 처리군에서 관찰되었다. 24시간 배양 후, 각 그룹의 RNA 발현 수준을 분석했다. NT 그룹에서는 PR 발현이 없었다(도 13). 또한, 비히클 또는 울리프리스탈 처리는 A549 세포에서 PR 발현 수준에 영향을 미치지 않았다. 따라서 A549 세포주를 사용하여 울리프리스탈의 작용 방식을 조사했다.
A549 세포는 감염 전 처리(전처리), 감염과 함께 처리(공동 처리), 감염 후 처리(처리 후)의 세 가지 다른 조건에서 울리프리스탈로 처리되었다(도 14A). 약물 투여에 의한 항바이러스 효과는 전처치군과 병용투여군에서 관찰되었다. 그러나 바이러스 접종 후 울리프리스탈을 첨가한 경우에는 억제 효과가 덜 관찰되었다. 또한 울리프리스탈 투여가 지연됨에 따라 억제 효과의 정도가 감소하였다(도 14B). 종합하면, 울리프리스탈의 억제 동역학은 울리프리스탈이 DENV 수명 주기의 진입 단계에서 바이러스 감염을 억제하고 세포내이입 억제제로 작용함을 시사한다.

Claims (3)

  1. 하기 화학식 1로 표시되는 화합물 또는 이의 약학적으로 허용되는 염을 포함하는 뎅기열 예방 또는 치료용 약학 조성물:
    [화학식 1]
    Figure PCTKR2022002339-appb-img-000003
    (식 중,
    R1 내지 R4는 서로 독립적으로 탄소수 1 내지 5의 알킬기이고,
    R5는 수소 또는 아세틸기임).
  2. 청구항 1에 있어서, 상기 R1 내지 R4는 메틸인, 뎅기열 예방 또는 치료용 약학 조성물.
  3. 청구항 1에 있어서, 상기 뎅기열은 뎅기 바이러스 DENV-1, DENV-2, DENV-3 또는 DENV-4의 감염에 의한 것인, 뎅기열 예방 또는 치료용 약학 조성물.
PCT/KR2022/002339 2021-02-17 2022-02-17 뎅기열 예방 또는 치료용 약학 조성물 WO2022177316A1 (ko)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020237027552A KR20230131257A (ko) 2021-02-17 2022-02-17 뎅기열 예방 또는 치료용 약학 조성물
US18/277,653 US20240139209A1 (en) 2021-02-17 2022-02-17 Pharmaceutical composition for preventing or treating dengue fever

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163150117P 2021-02-17 2021-02-17
US63/150,117 2021-02-17

Publications (1)

Publication Number Publication Date
WO2022177316A1 true WO2022177316A1 (ko) 2022-08-25

Family

ID=82930942

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/002339 WO2022177316A1 (ko) 2021-02-17 2022-02-17 뎅기열 예방 또는 치료용 약학 조성물

Country Status (3)

Country Link
US (1) US20240139209A1 (ko)
KR (1) KR20230131257A (ko)
WO (1) WO2022177316A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110136819A (ko) * 2009-02-27 2011-12-21 시가 테크놀로지스, 인크. 뎅기 바이러스 감염의 치료 및 예방을 위한 티에노피리딘 유도체
US20170051007A1 (en) * 2015-08-03 2017-02-23 Pop Test Oncology Limited Liability Company Pharmaceutical compositions and methods
CN108727453A (zh) * 2017-04-20 2018-11-02 华东理工大学 新型pd-1抑制剂及其应用
WO2020069138A1 (en) * 2018-09-28 2020-04-02 Axsome Therapeutics, Inc. Dosage forms comprising active pharmaceutical ingredients

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110136819A (ko) * 2009-02-27 2011-12-21 시가 테크놀로지스, 인크. 뎅기 바이러스 감염의 치료 및 예방을 위한 티에노피리딘 유도체
US20170051007A1 (en) * 2015-08-03 2017-02-23 Pop Test Oncology Limited Liability Company Pharmaceutical compositions and methods
CN108727453A (zh) * 2017-04-20 2018-11-02 华东理工大学 新型pd-1抑制剂及其应用
WO2020069138A1 (en) * 2018-09-28 2020-04-02 Axsome Therapeutics, Inc. Dosage forms comprising active pharmaceutical ingredients

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
MURJI ALLY; CROSIER REBECCA; CHOW TIFFANY; YE XIANG Y.; SHIRREFF LINDSAY: "Role of ethnicity in treating uterine fibroids with ulipristal acetate", FERTILITY AND STERILITY, vol. 106, no. 5, 20 June 2016 (2016-06-20), NL , pages 1165 - 1169, XP029753819, ISSN: 0015-0282, DOI: 10.1016/j.fertnstert.2016.06.012 *

Also Published As

Publication number Publication date
US20240139209A1 (en) 2024-05-02
KR20230131257A (ko) 2023-09-12

Similar Documents

Publication Publication Date Title
Heidary et al. Ivermectin: a systematic review from antiviral effects to COVID-19 complementary regimen
Kao et al. The antiparasitic drug niclosamide inhibits dengue virus infection by interfering with endosomal acidification independent of mTOR
Millet et al. Middle East respiratory syndrome coronavirus infection is inhibited by griffithsin
Nabila et al. Antiviral action of curcumin encapsulated in nanoemulsion against four serotypes of dengue virus
Song et al. Antiviral activity of sulfated Chuanminshen violaceum polysaccharide against duck enteritis virus in vitro
KR102464428B1 (ko) 코로나바이러스 감염 치료를 위한 방법 및 조성물
WO2022177316A1 (ko) 뎅기열 예방 또는 치료용 약학 조성물
Shin et al. A graphene oxide-based fluorescent nanosensor to identify antiviral agents via a drug repurposing screen
Ayala-Nuñez et al. Antibody-dependent enhancement of dengue virus infection is inhibited by SA-17, a doxorubicin derivative
Shen et al. Repurposing the antiemetic metoclopramide as an antiviral against dengue virus infection in neuronal cells
CN107028955B (zh) 25-羟基胆固醇在制备抑制黄病毒的药物中的用途
Teixeira et al. The mTOR pathway as a target for SARS-COV-2: Rapamycin as a possible alternative pharmacological therapeutic for COVID-19
WO2022021315A1 (zh) 褐藻酸衍生物在抗冠状病毒及其所致疾病中的应用
CN110526843A (zh) 抑制钙/钙调蛋白依赖性蛋白激酶ⅱ的化合物及其应用
Gazina et al. Ion transport blockers inhibit human rhinovirus 2 release
ES2965161T3 (es) Método y composiciones para el tratamiento de infección por coronavirus
CN105232562B (zh) 一种人呼吸道合胞病毒的抑制剂和抗病毒药物设计靶点
JP2023537229A (ja) ＳＡＲＳ－ＣｏＶ－２タンパク質と宿主細胞の分子機構および細胞機構との相互作用、およびＣＯＶＩＤ－１９を処置するための製剤
CN115867276A (zh) 化合物用于治疗病毒感染的用途
CN113197894B (zh) 奥巴托克在制备广谱抗冠状病毒药物中的应用
Obłoza et al. Polymers as candidates for broad‐spectrum antivirals—in vitro inhibition of Z ika virus with sodium polyanethole sulfonate
Zhang et al. Enterovirus 71 leads to abnormal mitochondrial dynamics in human neuroblastoma SK-N-SH cells
EP3932409A1 (en) Compounds for the treatment and prevention of viral infections caused by coronaviruses
RU2798102C1 (ru) Средство, обладающее противовирусным действием в отношении вируса клещевого энцефалита
WO2022216118A1 (ko) 로틀레린을 유효성분으로 포함하는 바이러스 감염증의 예방 또는 치료용 약제학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22756514

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 20237027552

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020237027552

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 18277653

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22756514

Country of ref document: EP

Kind code of ref document: A1