WO2022154343A1 - Alzheimer-resistant cell model including apoe christchurch mutation and construction method therefor - Google Patents

Alzheimer-resistant cell model including apoe christchurch mutation and construction method therefor Download PDF

Info

Publication number
WO2022154343A1
WO2022154343A1 PCT/KR2022/000012 KR2022000012W WO2022154343A1 WO 2022154343 A1 WO2022154343 A1 WO 2022154343A1 KR 2022000012 W KR2022000012 W KR 2022000012W WO 2022154343 A1 WO2022154343 A1 WO 2022154343A1
Authority
WO
WIPO (PCT)
Prior art keywords
alzheimer
apoe
model
pluripotent stem
christchurch
Prior art date
Application number
PCT/KR2022/000012
Other languages
French (fr)
Korean (ko)
Inventor
서진수
배심성
이혜인
장금미
조준호
Original Assignee
재단법인대구경북과학기술원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020210152474A external-priority patent/KR20220102552A/en
Application filed by 재단법인대구경북과학기술원 filed Critical 재단법인대구경북과학기술원
Publication of WO2022154343A1 publication Critical patent/WO2022154343A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses

Definitions

  • the present invention relates to an Alzheimer's-resistant human induced pluripotent stem cell and brain cell/brain organoid model in which Victoria mutation is dissolved in the ApoE gene, and a method for manufacturing the same, and more specifically, by inserting the ApoE Victoria mutation using the CRISPR/Cas9 system, It relates to Alzheimer's-resistant human induced pluripotent stem cells and brain cells/brain organoid models in which arginine, the 136th amino acid of the protein encoded by ApoE, is substituted with serine (R136S), a method for preparing the same, and the cell.
  • R136S serine
  • Alzheimer's disease As an aging society enters, various diseases of the elderly are emerging as a major social problem, causing a burden of medical expenses and a huge loss to the national economy. Among these diseases, Alzheimer's disease is accompanied by various psychological and behavioral disorder symptoms along with the claudication of motor and cognitive ability decline. It is a disease that causes enormous economic burden. In particular, Alzheimer's disease affects about 10% of the 65-74 year-old population, about 19% of the 75-84 year-old population, and about 47% of the 85-year-old population. It is an emerging degenerative neurological disease.
  • ApoE apolipoprotein E
  • ApoE4 apolipoprotein E
  • AD1 E280A apolipoprotein E
  • the present inventors introduced Zealand mutation in the apolipoprotein E (ApoE) gene through the CRISPR/Cas9 system in human induced pluripotent stem cells. By dissolving, the present invention was completed.
  • ApoE apolipoprotein E
  • the present invention comprises the steps of (a) preparing a vector for ApoE-targeting guide RNA (sgRNA), ssODN and Cas9 protein expression; And (b) introducing the vector into human induced pluripotent stem cells and culturing, including the step of culturing, ApoE (apolipoprotein E) gene in which Wales mutation is dissolved (Knock-in) Alzheimer's-resistant human induced pluripotent stem cells and brain cells /
  • An object of the present invention is to provide a method for preparing a brain organoid model.
  • Another object of the present invention is to provide an Alzheimer's-resistant human induced pluripotent stem cell and brain cell/brain organoid model in which Wales mutation is knocked-in in the ApoE (apolipoprotein E) gene, prepared by the above method. do it with
  • the present invention provides Alzheimer's-resistant human induced pluripotent stem cells and brain cells/brain in which Wales mutation is knocked-in in ApoE (apolipoprotein E) gene, prepared by the above method, for use in the diagnosis of Alzheimer's disease It aims to provide uses for the organoid model.
  • ApoE apolipoprotein E
  • the present invention provides Alzheimer's disease-resistant human induced pluripotent stem cells and brain cells/brain organoid models in which Wales mutations are knocked-in in the ApoE (apolipoprotein E) gene, prepared by the above method.
  • An object of the present invention is to provide a method of diagnosis or treatment.
  • the present invention comprises the steps of (a) preparing a vector for ApoE-targeting guide RNA (sgRNA), ssODN and Cas9 protein expression; And (b) introducing the vector into human induced pluripotent stem cells and culturing, ApoE (apolipoprotein E) gene in which Wales mutation is knocked-in (Knock-in) Alzheimer's resistance human induced pluripotent stem cell model manufacturing method provides
  • sgRNA ApoE-targeting guide RNA
  • ssODN ssODN
  • step (b) the step of separating only the vector-introduced cells from among the cultured cells may be further included.
  • it may further include the step of differentiating the cultured cells after step (b).
  • the cells may be differentiated into neurons, astrocytes or brain organoids.
  • the guide RNA may consist of the nucleotide sequence of SEQ ID NO: 1.
  • the ssODN may consist of the nucleotide sequence of SEQ ID NO: 2.
  • the culturing in step (b) may be made for 1 to 3 days.
  • the present invention provides an Alzheimer's-resistant human induced pluripotent stem cell model prepared by the above method, in which Victoria mutation is knocked-in in ApoE (apolipoprotein E) gene.
  • ApoE apolipoprotein E
  • the Alzheimer's resistance may be a decrease in neuronal inflammation or a restoration of autophagy function.
  • the present invention provides an Alzheimer's-resistant neuron model in which a Victoria mutation is knocked-in in an apolipoprotein E (ApoE) gene, differentiated from the human induced pluripotent stem cell model.
  • ApoE apolipoprotein E
  • the present invention provides a model of Alzheimer's-resistant astrocytes differentiated from the human induced pluripotent stem cell model, in which Wales mutations are knocked-in in the ApoE (apolipoprotein E) gene.
  • ApoE apolipoprotein E
  • the present invention provides an Alzheimer's-resistant brain organoid model in which a Victoria mutation is knocked-in in an apolipoprotein E (ApoE) gene, differentiated from the human induced pluripotent stem cell model.
  • ApoE apolipoprotein E
  • a human-derived Alzheimer's resistance model was prepared by inserting an ApoE Georgia mutation into human induced pluripotent stem cells using CRISPR/Cas9 gene editing technology and differentiation into neurons, astrocytes or brain organoids. It is possible to overcome limitations such as expression patterns of proteins that are different from those of human cells observed in animal models, and the model of the present invention may be usefully used for research on the pathogenesis of Alzheimer's disease.
  • Figure 2 relates to a method of differentiating the ApoE Victoria mutation model into brain neurons.
  • Figure 2a shows a method for inducing differentiation into brain neurons
  • Figure 2b shows the results of confirming the differentiation into brain neurons through fluorescence staining. to be.
  • Figure 3 relates to a method of differentiating the ApoE Eck mutation model into astrocytes.
  • Figure 3a shows a method for inducing differentiation into astrocytes
  • Figure 3b is the result of confirming the differentiation into astrocytes through fluorescence staining.
  • FIG. 4 is a method for differentiating the ApoE Eck mutation model into brain organoids.
  • FIG. 4a shows a method for inducing differentiation into brain organoids
  • FIG. 4b is a photograph of the differentiation process into brain organoids.
  • FIG. 5 is a result of confirming Alzheimer's dementia resistance by APOE Leon in a neuronal mutation model
  • FIG. 5a is an abnormally increased gene in the ApoE4 Alzheimer's neuron model, confirming that it was restored to a normal level by APOE castle
  • Figure 5b confirms that abnormally reduced genes in the ApoE4 Alzheimer's neuron model were restored to normal levels by APOE castle.
  • Figure 6 is a result of confirming Alzheimer's dementia resistance by APOE Victoria in an astrocyte mutation model
  • Figure 6a is an ApoE4 Alzheimer's astrocyte model that is abnormally reduced and that the ApoE protein pattern with reduced stability is alleviated by APOE Victoria 6b confirms that the p62 protein accumulated by abnormal autophagy function in the ApoE4 Alzheimer's astrocyte model is normalized by APOE castle.
  • the present inventors inserted ApoE Georgia mutations into human induced pluripotent stem cells for Alzheimer's resistance
  • the present invention was completed by making a human induced pluripotent stem cell model.
  • the present invention provides a method for preparing an Alzheimer's-resistant human induced pluripotent stem cell model in which a Victoria mutation is knocked-in in an apolipoprotein E (ApoE) gene, comprising the following steps.
  • sgRNA ApoE-targeting guide RNA
  • ssODN ApoE-targeting guide RNA
  • Cas9 Cas9 protein expression
  • knock in refers to one-to-one substitution of a target gene DNA sequence or insertion of specific sequence information into a target gene through genetic engineering.
  • ApoE Victoria mutation refers to a mutation in which Cysteine, nucleotide 460 of the ApoE (apolipoprotein E) gene, is substituted with Adenine. It means a mutation that is substituted.
  • the step (a) of the present invention is a step of preparing a vector expressing CRISPR/Cas9 for the purpose of inserting the ApoE Georgia mutation into human induced pluripotent stem cells.
  • vector refers to DNA that can be propagated by introducing a desired DNA fragment into a host cell, and is also referred to as a cloning vehicle.
  • Expression vector means a recombinant DNA molecule comprising a desired coding sequence and an appropriate nucleic acid sequence essential for expressing a coding sequence operably linked in a particular host organism.
  • single guide RNA refers to a single-stranded RNA that serves to guide the Cas protein to the target DNA by locating the specific DNA to be edited, the guide
  • the RNA is adjacent to the PAM (protospacer adjacent motif) site and may include a sequence complementary to a nucleotide sequence of 10 to 25 bp of the DNA to be edited.
  • the guide RNA may have 1 to 3 additional nucleotides, more specifically 2 or 3 nucleotides in front of the 5' region of the sequence capable of base pairing with the complementary strand of the target DNA sequence.
  • the guide RNA may include a portion having a sequence complementary to a sequence in the target DNA (this is also called a spacer region, a target DNA recognition sequence, a base pairing region, etc.) and a hairpin structure for binding Cas protein. More specifically, it may include a portion having a sequence complementary to a sequence in the target DNA, a hairpin structure for Cas protein binding, and a terminator sequence, but is not limited thereto.
  • the guide RNA targets the ApoE gene, and more specifically, may consist of the nucleotide sequence of SEQ ID NO: 1.
  • ssODN single strand oligonucleotide
  • ssODN single strand oligonucleotide
  • the ssODN may include a sequence complementary to a nucleotide sequence of 30 to 100 bp in both directions with respect to the ApoE gene target position.
  • CRISPR-Cas9 refers to "CRISPR-Cas9"
  • CRISPR-Cas9 recognizes, cuts, and edits a specific nucleotide sequence to be used as a third-generation gene scissors, and inserts a specific gene into the target site of the genome It is useful for simple, quick and efficient operation of stopping the activity of a specific gene.
  • Cas9 protein or gene information may be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI), but is not limited thereto.
  • GenBank of the National Center for Biotechnology Information
  • NCBI National Center for Biotechnology Information
  • a person skilled in the art can appropriately link additional domains.
  • the Cas9 protein may include all variants of Cas9 as long as it has the function of a nuclease for gene editing as well as wild-type Cas9.
  • the Cas9 protein in the present invention is not limited in its origin, and as non-limiting examples, Streptococcus pyogenes, Francisella novicida, Streptococcus thermophilus, Legionella It may be derived from Legionella pneumophila, Listeria innocua, or Streptococcus mutans, and those skilled in the art may appropriately select and use it.
  • step (b) is a step of introducing and culturing the vector prepared in step (a) into human induced pluripotent stem cells.
  • induced pluripotent stem cell refers to an embryonic stem that is returned to the cell stage prior to differentiation by injecting a cell differentiation-related gene into a somatic cell that has been differentiated as a dedifferentiated stem cell. Cells that have elicited pluripotency, such as cells.
  • the induced pluripotent stem cells used in the present invention are cells derived from a healthy 75-year-old woman provided by Harvard medical school, but are not limited thereto.
  • the method of introducing the vector into the human induced pluripotent stem cells in step (b) is not particularly limited as long as it is a known method capable of delivering the vector into the cell.
  • electroporation a method using calcium phosphate, a method using DEAE dextran, a microinjection method, a method using a cationic lipid, or liposome may be used.
  • a method using calcium phosphate for example, electroporation, a method using calcium phosphate, a method using DEAE dextran, a microinjection method, a method using a cationic lipid, or liposome may be used.
  • a method using calcium phosphate for example, electroporation, a method using calcium phosphate, a method using DEAE dextran, a microinjection method,
  • methods, conditions, etc. for introducing and culturing the vector into human induced pluripotent stem cells are not particularly limited, and those skilled in the art may appropriately adjust the method according to the target cell and method of introducing the vector.
  • the culture may be made for 1 to 3 days, preferably for 2 days.
  • the step (b) may further include a process of additionally selecting and isolating only the cells into which the vector has been introduced.
  • a process of isolating only cells expressing the GFP protein using the expression of the vector-encoded GFP gene was used, but the specific method is not limited thereto, and a known method may be appropriately used by those skilled in the art.
  • it may further include the step of differentiating the cultured cells after step (b).
  • induced pluripotent stem cells are neurons, astrocytes or brain It means to have the characteristics of an organoid.
  • neuroneuron cell refers to a cell constituting the nervous system, which expresses an ion channel such as a sodium channel or a potassium channel, and can transmit signals in an electrical manner unlike other cells.
  • astroglia is a cell that exists in the brain and spinal cord, has many projections, and serves to supply nutrients to the inner nerve cells of the blood brain barrier, and other nerve cells. It is a cell that performs various roles such as regulation of cell ion concentration, support of nerve cells, removal of waste products, and phagocytosis.
  • organs refers to a three-dimensional cell aggregate formed through self-renewal and self-organization from adult stem cells, embryonic stem cells or induced pluripotent stem cells, and includes specific cells of a model organ.
  • the model organ may be the brain.
  • the present inventors prepared an Alzheimer's-resistant human induced pluripotent stem cell model by inserting the ApoE Victoria mutation into human induced pluripotent stem cells through specific examples (see Example 1).
  • the present invention provides an Alzheimer's-resistant human induced pluripotent stem cell model in which Wales mutation is knocked-in in the apolipoprotein E (ApoE) gene by the above production method.
  • ApoE apolipoprotein E
  • the present invention provides a neuronal cell mutation model, an astrocyte mutation model, or a brain organoid mutation model by differentiating the Alzheimer's-resistant human induced pluripotent stem cells (see Examples 2 and 3) .
  • the present invention provides the use of an Alzheimer's-resistant human induced pluripotent stem cell model in which Wales mutations are knocked-in in the apolipoprotein E (ApoE) gene prepared by the above method for use in the diagnosis of Alzheimer's disease. .
  • ApoE apolipoprotein E
  • the present invention provides the use of an Alzheimer's-resistant neuron model in which Wales mutations are knocked-in in the ApoE (apolipoprotein E) gene, differentiated from the human induced pluripotent stem cell model for use in the diagnosis of Alzheimer's disease. do.
  • ApoE apolipoprotein E
  • the present invention provides the use of an Alzheimer's-resistant astrocyte model in which Wales mutations are knocked-in in the ApoE (apolipoprotein E) gene, differentiated from the human induced pluripotent stem cell model for use in the diagnosis of Alzheimer's disease. do.
  • ApoE apolipoprotein E
  • the present invention provides the use of an Alzheimer's-resistant brain organoid model in which Wales mutations are knocked-in in the ApoE (apolipoprotein E) gene, differentiated from the human induced pluripotent stem cell model for use in the diagnosis of Alzheimer's disease. to provide.
  • ApoE apolipoprotein E
  • diagnosis refers to any act of confirming the presence or characteristics of Alzheimer's disease using the cell model according to the present invention.
  • the present invention provides a method for diagnosing Alzheimer's disease using an Alzheimer's-resistant human induced pluripotent stem cell model in which Wales mutation is knocked-in in the apolipoprotein E (ApoE) gene prepared by the above method.
  • ApoE apolipoprotein E
  • the present invention provides a method for treating Alzheimer's disease using an Alzheimer's-resistant human induced pluripotent stem cell model in which Victoria mutation is knocked-in in the apolipoprotein E (ApoE) gene prepared by the above method.
  • ApoE apolipoprotein E
  • treatment refers to any action in which symptoms for Alzheimer's disease are improved or beneficially changed using the cell model according to the present invention.
  • the present invention provides a method for diagnosing Alzheimer's disease using an Alzheimer's-resistant neuron model in which a Wales mutation is knocked-in in an apolipoprotein E (ApoE) gene, differentiated from the human induced pluripotent stem cell model.
  • ApoE apolipoprotein E
  • the present invention provides a method for treating Alzheimer's disease using an Alzheimer's-resistant neuron model in which Wales mutation is knocked-in in an apolipoprotein E (ApoE) gene, differentiated from the human induced pluripotent stem cell model.
  • ApoE apolipoprotein E
  • the present invention provides a method for diagnosing Alzheimer's disease using the Alzheimer's-resistant astrocyte model in which Wales mutation is knocked-in in the ApoE (apolipoprotein E) gene, differentiated from the human induced pluripotent stem cell model.
  • ApoE apolipoprotein E
  • the present invention provides a method for treating Alzheimer's disease using an Alzheimer's-resistant astrocyte model in which Wales mutation is knocked-in in the ApoE (apolipoprotein E) gene, differentiated from the human induced pluripotent stem cell model.
  • ApoE apolipoprotein E
  • the present invention provides a method for diagnosing Alzheimer's disease using an Alzheimer's-resistant brain organoid model in which Wales mutation is knocked-in in ApoE (apolipoprotein E) gene, differentiated from the human induced pluripotent stem cell model. .
  • ApoE apolipoprotein E
  • the present invention provides a method for treating Alzheimer's disease using an Alzheimer's-resistant brain organoid model in which Wales mutation is knocked-in in ApoE (apolipoprotein E) gene, differentiated from the human induced pluripotent stem cell model. .
  • ApoE apolipoprotein E
  • Example 1 Preparation of human induced pluripotent stem cells inserted with ApoE Georgia mutations through CRISPR/Cas9 genome editing
  • the present inventors tried to produce human induced pluripotent stem cells in which Wales mutation was dissolved in the ApoE gene using induced pluripotent stem cells derived from a 75-year-old Caucasian normal female provided by Harvard Medical School in the United States. The overall process is illustrated in FIG. 1a. did.
  • sgRNA guide RNA
  • Cas9-expressing plasmid pSpCas9(BB)- 2A-GFP, Addgene
  • ssODN single-strand oligonucleotide
  • FIG. 2a A previously known method (Zhang et al., 2013) was used to differentiate the human induced pluripotent stem cells containing the ApoE Wales mutant prepared in Example 1 into brain neurons, and the overall differentiation induction process is shown in FIG. 2a. It was.
  • lentivirus in which Ngn2 expression is induced by TetO gene was treated and 24 hours later, BDNF (10 ng/ml), NT-3 (10 ng/ ml), laminin (0.2 ug/ml), and doxycycline (2 ug/ml) were treated.
  • the culture medium was changed to Neurobasal, and BDNF (10 ng/ml), NT-3 (10 ng/ml), laminin (0.2 ug/ml), doxycycline (2 ug/ml) together with B27 and GlutaMAX (2 ug/ml) , cells not infected with the virus were removed while continuing to induce differentiation by treatment with puromycin (1 ug/ml).
  • treatment with Ara-C (1 uM) for 3 days inhibited the growth of proliferating non-neuronal cells, and astrocyte conditioned media was used as a culture medium to promote neuronal development.
  • the differentiation of neurons was confirmed by synaptic marker synaptophysin and PSD-95 fluorescence staining (FIG. 2b).
  • the present inventors could confirm that the human induced pluripotent stem cells inserted with the ApoE Zealand mutation of the present invention were differentiated into brain neurons.
  • a previously known method (Lin et al., 2018) was used to differentiate the human induced pluripotent stem cells in which the ApoE Wales mutant was prepared in Example 1 into astrocytes, and the overall differentiation induction process is shown in FIG. 3a. .
  • the Smad signaling inhibitors Dorsomophin (1 uM) and SB431542 (10 uM) were treated for 11 days to prepare neural progenitor cells. After promoting the formation of the rosettes structure, differentiation into astrocytes was induced by treatment with bone morphogenic protein 4 (BMP4, 10 ng/ml) for one month.
  • BMP4 bone morphogenic protein 4
  • the present inventors were able to confirm that the human induced pluripotent stem cells inserted with the ApoE Zealand mutation of the present invention were differentiated into astrocytes.
  • a previously known method was used to differentiate the human induced pluripotent stem cells in which the ApoE Wales mutation prepared in Example 1 was dissolved into brain organoids.
  • 12,000 cells were seeded in a V-shape 96-well plate and Knock-out Serum, sodium pyruvate, Non-essential amino acid, Wnt inhibitor, ROCK inhibitor, TGF-beta inhibitor SB431542 for 19 days. It was cultured in a GMEM culture medium containing During culture, from the 19th to the 35th day, DMEM:F12 + Glutamax culture medium was treated with N2 supplement and chemically defined lipid concentrate and cultured.
  • this culture medium was further treated with Fatal bovine serum, heparin, and matrigel, After 70 days, B27 supplement was additionally treated (Fig. 4a).
  • the human induced pluripotent stem cells that differentiate into brain organoids through this culture process were photographed on days 6, 10, 31, 55, and 60, and are shown in FIG. 4B.
  • the APOE4 mutation the strongest genetic mutation in Alzheimer's disease, is known to induce a change in the gene expression of neurons and decrease the ApoE4 protein expression in astrocytes, it was confirmed whether this change is inhibited by the APOE Victoria mutation.
  • APOE4 Alzheimer's neuron model and APOE 1994 were additionally extracted total RNA of the inserted neurons, and quality control was performed through Analytical-fragment Analyzer. After that, Illumina RNA-seq library preparation and Illumina sequencing (100 pair-end) were performed, and raw fastq data were aligned with human hg19 assembly to compare differentially expressed genes between groups.
  • ApoE4 Alzheimer's astrocyte model and APOE Wales additionally inserted astrocytes were lysates with RIPA buffer (50 mM Tris, 150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS) and protease and phosphatase inhibitors. Then, immunoblotting was performed to measure the expression levels of ApoE protein and p62 protein. To measure the stability of the ApoE protein, the protein production inhibitor, cycloheximide (50 ug/ml), was treated together for a certain period of time (0h, 1h, 2h, 4h, 6h) and the amount of ApoE protein remaining was measured. time was checked.
  • Alzheimer resistant cell model comprising APOE castle mutation and preparation method thereof

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to an Alzheimer-resistant human pluripotent stem cell model having an ApoE Christchurch mutation inserted thereinto and a construction method therefor and, more specifically, to an Alzheimer-resistant human induced pluripotent stem cell model and brain cell/brain organoid into which an ApoE Christchurch mutation is inserted using a CRISPR/Cas9 system, and a construction method therefor. According to the present invention, Alzheimer-resistant human induced pluripotent stem cells and a brain cell/brain organoid are constructed by inserting an ApoE Christchurch mutation into human induced pluripotent stem cells with the aid of a CRISPR/Cas9 gene editing technique and as such, can surmount the limitations observed in preexisting animal models, such as protein expression patterns different from those in human cells, etc. The Alzheimer-resistant cell model of the present invention can find advantageous applications in research into ApoE-associated Alzheimer pathogenesis, etc.

Description

APOE CHRISTCHURCH 돌연변이를 포함하는 알츠하이머 저항성 세포 모델 및 이의 제조방법Alzheimer's-resistant cell model containing APOE CHRISTCHURCH mutation and method for preparing the same
본 출원은 2021년 01월 13일 출원된 대한민국 특허출원 제10-2021-0004832호 및 2021년 11월 08일 출원된 대한민국 특허출원 제10-2021-0152474호를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다.This application claims priority to Korean Patent Application No. 10-2021-0004832, filed on January 13, 2021, and Korean Patent Application No. 10-2021-0152474, filed on November 08, 2021, the entire specification is This application is incorporated herein by reference.
본 발명은 ApoE 유전자에 Christchurch 돌연변이가 녹인된 알츠하이머 저항성 인간유도만능줄기세포 및 뇌 세포/뇌 오가노이드 모델, 이의 제조방법에 관한 것으로, 보다 구체적으로 CRISPR/Cas9 시스템을 이용해 ApoE Christchurch 돌연변이를 삽입하여, ApoE가 암호화하는 단백질의 136번째 아미노산인 아르기닌이 세린으로 치환(R136S)된 알츠하이머 저항성 인간유도만능줄기세포 및 뇌 세포/뇌 오가노이드 모델, 이의 제조방법 및 상기 세포에 관한 것이다.The present invention relates to an Alzheimer's-resistant human induced pluripotent stem cell and brain cell/brain organoid model in which Christchurch mutation is dissolved in the ApoE gene, and a method for manufacturing the same, and more specifically, by inserting the ApoE Christchurch mutation using the CRISPR/Cas9 system, It relates to Alzheimer's-resistant human induced pluripotent stem cells and brain cells/brain organoid models in which arginine, the 136th amino acid of the protein encoded by ApoE, is substituted with serine (R136S), a method for preparing the same, and the cell.
노령화 사회가 접어들면서 각종 노인 질환이 큰 사회적 문제점으로 대두되고 있으며, 국가적으로도 의료비 부담과 국가 경제에 막대한 손실을 초래하고 있다. 이러한 질환들 중에서도, 알츠하이머병(Alzheimer's disease)은 운동력과 인지능력 저하의 파행적인 진행과 함께 다양한 심리적, 행동장애 증상이 동반되며, 초기에는 경미한 증상에서 시작하나, 최종적으로 자발적인 개인생활이 불가능할 정도로 진행되어 막대한 경제적 부담을 초래하는 질환이다. 특히, 알츠하이머병은 65-74세 인구의 약 10%, 75-84세 인구의 약 19%, 그리고 85세 이상의 인구의 약 47%가 발병하고, 발병률이 해마다 증가하고 있는바, 심각한 사회문제로 떠오르는 퇴행성 뇌신경계 질환이다.As an aging society enters, various diseases of the elderly are emerging as a major social problem, causing a burden of medical expenses and a huge loss to the national economy. Among these diseases, Alzheimer's disease is accompanied by various psychological and behavioral disorder symptoms along with the claudication of motor and cognitive ability decline. It is a disease that causes enormous economic burden. In particular, Alzheimer's disease affects about 10% of the 65-74 year-old population, about 19% of the 75-84 year-old population, and about 47% of the 85-year-old population. It is an emerging degenerative neurological disease.
ApoE(apolipoprotein E)는 후기 발병 알츠하이머 병에 대한 감수성 유전자로 알려져 있으며, ApoE4와 알츠하이머 발병의 연관성 및 ApoE2의 보호 효과에 대해서 수많은 연구가 진행되고 있다(Current Opinion in Biotechnology Volume 5, Issue 6, December 1994, Pages 663-667). 최근 알츠하이머성 치매 유발 변이인 PSEN1 E280A 돌연변이를 보유했으나, 정상적인 뇌기능을 보이는 여성이 ApoE3 Christchurch 돌연변이를 가지고 있는 것이 확인되면서(Nat Med. 2019 Nov;25(11):1680-1683), Christchurch 돌연변이와 알츠하이머성 돌연변이의 관련성에 대한 연구가 태동기에 있으나, 현재까지도 상기 돌연변이의 인간에 대한 작용 기전 등을 연구하기 위한 인간 유래 세포 돌연변이 모델이 제작되지 않고 있어, 연구에 어려움을 겪고 있는 실정이다.ApoE (apolipoprotein E) is known as a susceptibility gene for late-onset Alzheimer's disease, and numerous studies have been conducted on the association between ApoE4 and Alzheimer's disease and the protective effect of ApoE2 (Current Opinion in Biotechnology Volume 5, Issue 6, December 1994). , Pages 663-667). Recently, it was confirmed that a woman with a normal brain function had the ApoE3 Christchurch mutation, although she had the Alzheimer's dementia-causing mutation PSEN1 E280A (Nat Med. 2019 Nov;25(11):1680-1683), and the Christchurch mutation and Although research on the relevance of Alzheimer's mutations is in its infancy, a human-derived cell mutation model for studying the mechanism of action of the mutations on humans has not been produced until now, and thus it is difficult to study.
상기와 같은 배경 하에, 본 발명자들은 알츠하이머 발병 기전 연구를 위한 인간 알츠하이머 저항성 세포 모델을 개발하기 위하여 연구 노력한 결과, 인간유도만능줄기세포에 CRISPR/Cas9 시스템을 통해 ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이를 녹인시킴으로써 본 발명을 완성하였다.As a result of research efforts to develop a human Alzheimer's resistance cell model for the study of the pathogenesis of Alzheimer's disease, the present inventors introduced Christchurch mutation in the apolipoprotein E (ApoE) gene through the CRISPR/Cas9 system in human induced pluripotent stem cells. By dissolving, the present invention was completed.
이에, 본 발명은 (a) ApoE를 표적하는 가이드 RNA(sgRNA), ssODN 및 Cas9 단백질 발현용 벡터를 제작하는 단계; 및 (b) 인간유도만능줄기세포에 상기 벡터를 도입하고 배양하는 단계를 포함하는, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 인간유도만능줄기세포 및 뇌 세포/뇌 오가노이드 모델의 제조방법을 제공하는 것을 목적으로 한다.Accordingly, the present invention comprises the steps of (a) preparing a vector for ApoE-targeting guide RNA (sgRNA), ssODN and Cas9 protein expression; And (b) introducing the vector into human induced pluripotent stem cells and culturing, including the step of culturing, ApoE (apolipoprotein E) gene in which Christchurch mutation is dissolved (Knock-in) Alzheimer's-resistant human induced pluripotent stem cells and brain cells / An object of the present invention is to provide a method for preparing a brain organoid model.
또한, 본 발명은 상기 방법에 의해 제조된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 인간유도만능줄기세포 및 뇌 세포/뇌 오가노이드 모델을 제공하는 것을 다른 목적으로 한다.Another object of the present invention is to provide an Alzheimer's-resistant human induced pluripotent stem cell and brain cell/brain organoid model in which Christchurch mutation is knocked-in in the ApoE (apolipoprotein E) gene, prepared by the above method. do it with
또한, 본 발명은 알츠하이머 질환의 진단에 사용하기 위한, 상기 방법에 의해 제조된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 인간유도만능줄기세포 및 뇌 세포/뇌 오가노이드 모델의 용도를 제공하는 것을 목적으로 한다.In addition, the present invention provides Alzheimer's-resistant human induced pluripotent stem cells and brain cells/brain in which Christchurch mutation is knocked-in in ApoE (apolipoprotein E) gene, prepared by the above method, for use in the diagnosis of Alzheimer's disease It aims to provide uses for the organoid model.
또한, 본 발명은 상기 방법에 의해 제조된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 인간유도만능줄기세포 및 뇌 세포/뇌 오가노이드 모델을 이용한, 알츠하이머 질환의 진단 또는 치료 방법을 제공하는 것을 목적으로 한다.In addition, the present invention provides Alzheimer's disease-resistant human induced pluripotent stem cells and brain cells/brain organoid models in which Christchurch mutations are knocked-in in the ApoE (apolipoprotein E) gene, prepared by the above method. An object of the present invention is to provide a method of diagnosis or treatment.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.
상기와 같은 본 발명의 목적을 달성하기 위하여, 본 발명은 (a) ApoE를 표적하는 가이드 RNA(sgRNA), ssODN 및 Cas9 단백질 발현용 벡터를 제작하는 단계; 및 (b) 인간유도만능줄기세포에 상기 벡터를 도입하고 배양하는 단계를 포함하는, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 인간유도만능줄기세포 모델의 제조방법을 제공한다.In order to achieve the object of the present invention as described above, the present invention comprises the steps of (a) preparing a vector for ApoE-targeting guide RNA (sgRNA), ssODN and Cas9 protein expression; And (b) introducing the vector into human induced pluripotent stem cells and culturing, ApoE (apolipoprotein E) gene in which Christchurch mutation is knocked-in (Knock-in) Alzheimer's resistance human induced pluripotent stem cell model manufacturing method provides
본 발명의 일구현예로, 상기 단계 (b)에서, 배양된 세포 중 벡터가 도입된 세포만을 분리하는 단계를 더 포함하는 것일 수 있다.In one embodiment of the present invention, in step (b), the step of separating only the vector-introduced cells from among the cultured cells may be further included.
본 발명의 다른 구현예로, 상기 (b) 단계 이후에 상기 배양된 세포를 분화시키는 단계를 더 포함하는 것일 수 있다.In another embodiment of the present invention, it may further include the step of differentiating the cultured cells after step (b).
본 발명의 또 다른 구현예로, 상기 세포는 신경세포, 성상교세포 또는 뇌 오가노이드로 분화하는 것일 수 있다.In another embodiment of the present invention, the cells may be differentiated into neurons, astrocytes or brain organoids.
본 발명의 또 다른 구현예로, 상기 가이드 RNA는 서열번호 1의 염기서열로 이루어진 것일 수 있다.In another embodiment of the present invention, the guide RNA may consist of the nucleotide sequence of SEQ ID NO: 1.
본 발명의 또 다른 구현예로, 상기 ssODN는 서열번호 2의 염기서열로 이루어진 것일 수 있다.In another embodiment of the present invention, the ssODN may consist of the nucleotide sequence of SEQ ID NO: 2.
본 발명의 또 다른 구현예로, 상기 단계 (b)에서 배양은 1 내지 3일 동안 이루어진 것일 수 있다.In another embodiment of the present invention, the culturing in step (b) may be made for 1 to 3 days.
또한, 본 발명은 상기 방법에 의해 제조된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 인간유도만능줄기세포 모델을 제공한다.In addition, the present invention provides an Alzheimer's-resistant human induced pluripotent stem cell model prepared by the above method, in which Christchurch mutation is knocked-in in ApoE (apolipoprotein E) gene.
본 발명의 일구현예로, 상기 알츠하이머 저항성은, 신경세포 염증이 감소하거나 자가포식기능이 회복되는 것일 수 있다.In one embodiment of the present invention, the Alzheimer's resistance may be a decrease in neuronal inflammation or a restoration of autophagy function.
또한, 본 발명은 상기 인간유도만능줄기세포 모델로부터 분화된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 신경세포 모델을 제공한다.In addition, the present invention provides an Alzheimer's-resistant neuron model in which a Christchurch mutation is knocked-in in an apolipoprotein E (ApoE) gene, differentiated from the human induced pluripotent stem cell model.
또한, 본 발명은 상기 인간유도만능줄기세포 모델로부터 분화된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 성상교세포 모델을 제공한다.In addition, the present invention provides a model of Alzheimer's-resistant astrocytes differentiated from the human induced pluripotent stem cell model, in which Christchurch mutations are knocked-in in the ApoE (apolipoprotein E) gene.
또한, 본 발명은 상기 인간유도만능줄기세포 모델로부터 분화된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 뇌 오가노이드 모델을 제공한다.In addition, the present invention provides an Alzheimer's-resistant brain organoid model in which a Christchurch mutation is knocked-in in an apolipoprotein E (ApoE) gene, differentiated from the human induced pluripotent stem cell model.
본 발명에 따르면, 인간 유도만능줄기세포에 CRISPR/Cas9 유전자 편집기술을 이용해 ApoE Christchurch 돌연변이를 삽입하고 신경세포, 성상교세포 또는 뇌 오가노이드로 분화시킴으로써 인간 유래의 알츠하이머 저항성 모델을 제작하였는바, 이는 기존 동물 모델에서 관찰되는 인간세포와 상이한 단백질의 발현패턴 등의 한계점들을 극복할 수 있으며, 본 발명의 모델을 통해 알츠하이머 발병 기전 연구 등에 유용하게 이용될 수 있을 것이다.According to the present invention, a human-derived Alzheimer's resistance model was prepared by inserting an ApoE Christchurch mutation into human induced pluripotent stem cells using CRISPR/Cas9 gene editing technology and differentiation into neurons, astrocytes or brain organoids. It is possible to overcome limitations such as expression patterns of proteins that are different from those of human cells observed in animal models, and the model of the present invention may be usefully used for research on the pathogenesis of Alzheimer's disease.
단, 본 발명의 효과는 상기 효과로 한정되는 것은 아니며, 본 발명의 상세한 설명 또는 청구범위에 기재된 발명의 구성으로부터 추론 가능한 모든 효과를 포함하는 것으로 이해되어야 한다.However, the effect of the present invention is not limited to the above effect, and it should be understood to include all effects that can be inferred from the configuration of the invention described in the detailed description or claims of the present invention.
도 1은 CRISPR/Cas9 유전체 편집기술을 이용하여 APOE Christchurch 돌연변이를 삽입한 인간유도만능줄기세포를 제작 방법에 관한 것으로서, 도 1a는 전체적인 APOE Christchurch 돌연변이 모델 제작방법을 나타낸 것이고, 도 1b는 ApoE Christchurch 돌연변이의 Sanger sequencing 결과이다.1 is a method for producing human induced pluripotent stem cells into which APOE Christchurch mutation is inserted using CRISPR/Cas9 genome editing technology. of Sanger sequencing.
도 2는 상기 ApoE Christchurch 돌연변이 모델을 뇌 신경세포로 분화시키는 방법에 관한 것으로서, 도 2a는 뇌 신경세포 분화 유도 방법을 나타낸 것이고, 도 2b는 뇌 신경세포로의 분화여부를 형광 염색법을 통해 확인한 결과이다.Figure 2 relates to a method of differentiating the ApoE Christchurch mutation model into brain neurons. Figure 2a shows a method for inducing differentiation into brain neurons, and Figure 2b shows the results of confirming the differentiation into brain neurons through fluorescence staining. to be.
도 3은 상기 ApoE Christchurch 돌연변이 모델을 성상교세포로 분화시키는 방법에 관한 것으로서, 도 3a는 성상교세포 분화 유도 방법을 나타낸 것이고, 도 3b는 성상교세포로의 분화여부를 형광 염색법을 통해 확인한 결과이다.Figure 3 relates to a method of differentiating the ApoE Christchurch mutation model into astrocytes. Figure 3a shows a method for inducing differentiation into astrocytes, and Figure 3b is the result of confirming the differentiation into astrocytes through fluorescence staining.
도 4는 상기 ApoE Christchurch 돌연변이 모델을 뇌 오가노이드로 분화시키는 방법에 관한 것으로서, 도 4a는 뇌 오가노이드 분화 유도 방법을 나타낸 것이고, 도 4b는 뇌 오가노이드로의 분화 과정을 촬영한 결과이다.4 is a method for differentiating the ApoE Christchurch mutation model into brain organoids. FIG. 4a shows a method for inducing differentiation into brain organoids, and FIG. 4b is a photograph of the differentiation process into brain organoids.
도 5는 APOE Christchurch에 의한 알츠하이머성 치매 저항성을, 신경세포 돌연변이 모델에서 확인한 결과로서, 도 5a는 ApoE4 알츠하이머 신경세포 모델에서 비정상적으로 증가된 유전자들이 APOE Christchurch에 의해 정상수준으로 회복된 것을 확인한 것이고, 도 5b는 ApoE4 알츠하이머 신경세포 모델에서 비정상적으로 감소된 유전자들이 APOE Christchurch에 의해 정상수준으로 회복된 것을 확인한 것이다. 5 is a result of confirming Alzheimer's dementia resistance by APOE Christchurch in a neuronal mutation model, FIG. 5a is an abnormally increased gene in the ApoE4 Alzheimer's neuron model, confirming that it was restored to a normal level by APOE Christchurch, Figure 5b confirms that abnormally reduced genes in the ApoE4 Alzheimer's neuron model were restored to normal levels by APOE Christchurch.
도 6은 APOE Christchurch에 의한 알츠하이머성 치매 저항성을, 성상교세포 돌연변이 모델에서 확인한 결과로서, 도 6a는 ApoE4 알츠하이머 성상교세포 모델에서 비정상적으로 감소되고 안정성이 저하된 ApoE 단백질 양상이 APOE Christchurch에 의해 완화되는 것을 확인한 것이고, 도 6b는 ApoE4 알츠하이머 성상교세포 모델에서 비정상적 자가포식기능에 의해 축적된 p62단백질이 APOE Christchurch에 의해 정상화되는 것을 확인한 것이다.Figure 6 is a result of confirming Alzheimer's dementia resistance by APOE Christchurch in an astrocyte mutation model, Figure 6a is an ApoE4 Alzheimer's astrocyte model that is abnormally reduced and that the ApoE protein pattern with reduced stability is alleviated by APOE Christchurch 6b confirms that the p62 protein accumulated by abnormal autophagy function in the ApoE4 Alzheimer's astrocyte model is normalized by APOE Christchurch.
본 발명자들은 기존 동물 모델 중심의 연구 한계를 극복하고 알츠하이머 발병 기전 및 치료물질 연구 개발을 위한 인간 알츠하이머 저항성 돌연변이 모델을 개발하기 위하여 연구 노력한 결과, ApoE Christchurch 돌연변이를 인간유도만능줄기세포에 삽입하여 알츠하이머 저항성 인간유도만능줄기세포 모델을 제작함으로써 본 발명을 완성하였다.As a result of research efforts to overcome the limitations of existing animal model-centered research and develop a human Alzheimer's resistance mutation model for research and development of Alzheimer's disease pathogenesis and therapeutic substances, the present inventors inserted ApoE Christchurch mutations into human induced pluripotent stem cells for Alzheimer's resistance The present invention was completed by making a human induced pluripotent stem cell model.
이에, 본 발명은 하기의 단계를 포함하는, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 인간유도만능줄기세포 모델의 제조방법을 제공한다.Accordingly, the present invention provides a method for preparing an Alzheimer's-resistant human induced pluripotent stem cell model in which a Christchurch mutation is knocked-in in an apolipoprotein E (ApoE) gene, comprising the following steps.
(a) ApoE를 표적하는 가이드 RNA(sgRNA), ssODN 및 Cas9 단백질 발현용 벡터를 제작하는 단계; 및 (b) 인간유도만능줄기세포에 상기 벡터를 도입하고 배양하는 단계. (a) constructing a vector for ApoE-targeting guide RNA (sgRNA), ssODN and Cas9 protein expression; and (b) introducing and culturing the vector into human induced pluripotent stem cells.
본 발명에서 사용되는 용어, "녹인(knock in)"이란 유전 공학을 통해 표적하는 유전자 DNA서열의 일대일 치환하거나 특정 서열정보를 표적 유전자에 삽입하는 것을 의미한다.As used herein, the term “knock in” refers to one-to-one substitution of a target gene DNA sequence or insertion of specific sequence information into a target gene through genetic engineering.
본 발명에서 사용되는 용어 "ApoE Christchurch 돌연변이"란 ApoE(apolipoprotein E) 유전자의 460번 뉴클레오티드인 Cysteine이 Adenine으로 치환된 돌연변이로서, 이로 인해 상기 유전자에 의해 발현되는 단백질의 136번 아미노산인 Arginine이 Serine으로 치환되는 돌연변이를 의미한다.As used herein, the term "ApoE Christchurch mutation" refers to a mutation in which Cysteine, nucleotide 460 of the ApoE (apolipoprotein E) gene, is substituted with Adenine. It means a mutation that is substituted.
본 발명의 상기 단계 (a)는 인간유도만능줄기세포에 ApoE Christchurch 돌연변이를 삽입하기 위한 용도로 CRISPR/Cas9를 발현하는 벡터를 제작하는 단계이다.The step (a) of the present invention is a step of preparing a vector expressing CRISPR/Cas9 for the purpose of inserting the ApoE Christchurch mutation into human induced pluripotent stem cells.
본 발명에서 사용되는 용어, "벡터(vector)"란 목적하는 DNA 단편을 숙주 세포에 도입시켜 증식할 수 있는 DNA로써 클로닝 운반체(cloning vehicle)라고도 한다. "발현 벡터"는 목적하는 코딩서열과, 특정 숙주생물에서 작동가능하게 연결된 코딩 서열을 발현하는데 필수적인 적정 핵산 서열을 포함하는 재조합 DNA 분자를 의미한다. As used herein, the term "vector" refers to DNA that can be propagated by introducing a desired DNA fragment into a host cell, and is also referred to as a cloning vehicle. "Expression vector" means a recombinant DNA molecule comprising a desired coding sequence and an appropriate nucleic acid sequence essential for expressing a coding sequence operably linked in a particular host organism.
본 발명에서 사용되는 용어, "가이드 RNA(single guide RNA; sgRNA)"란 편집하고자 하는 표적하는 특정 DNA의 위치를 찾아내어 Cas 단백질을 표적 DNA로 인도하는 역할을 하는 단일 가닥의 RNA로서, 상기 가이드 RNA는 PAM(protospacer adjacent motif) 자리와 인접하며, 편집하려는 DNA의 10~25bp의 염기 서열과 상보적인 서열을 포함하는 것일 수 있다. 상기 가이드 RNA는 표적 DNA 서열의 상보적 사슬과 염기쌍을 형성할 수 있는 서열의 5' 부위 앞에 1 내지 3개의 추가적인 뉴클레오타이드, 보다 구체적으로 2개 또는 3개의 뉴클레오타이드를 가질 수 있다. 또한 가이드 RNA는 표적 DNA 내 서열과 상보적인 서열을 가지는 부분(이를 Spacer region, Target DNA recognition sequence, base pairing region 등으로도 명명함) 및 Cas 단백질 결합을 위한 hairpin 구조를 포함할 수 있다. 보다 구체적으로, 표적 DNA 내 서열과 상보적인 서열을 가지는 부분, Cas 단백질 결합을 위한 hairpin 구조 및 Terminator 서열을 포함할 수 있으나, 이에 제한되는 것은 아니다. As used herein, the term “single guide RNA (sgRNA)” refers to a single-stranded RNA that serves to guide the Cas protein to the target DNA by locating the specific DNA to be edited, the guide The RNA is adjacent to the PAM (protospacer adjacent motif) site and may include a sequence complementary to a nucleotide sequence of 10 to 25 bp of the DNA to be edited. The guide RNA may have 1 to 3 additional nucleotides, more specifically 2 or 3 nucleotides in front of the 5' region of the sequence capable of base pairing with the complementary strand of the target DNA sequence. In addition, the guide RNA may include a portion having a sequence complementary to a sequence in the target DNA (this is also called a spacer region, a target DNA recognition sequence, a base pairing region, etc.) and a hairpin structure for binding Cas protein. More specifically, it may include a portion having a sequence complementary to a sequence in the target DNA, a hairpin structure for Cas protein binding, and a terminator sequence, but is not limited thereto.
본 발명에 있어서, 가이드 RNA는 ApoE 유전자를 표적하는 것으로, 보다 구체적으로 서열번호 1의 염기서열로 이루어진 것일 수 있다. In the present invention, the guide RNA targets the ApoE gene, and more specifically, may consist of the nucleotide sequence of SEQ ID NO: 1.
본 발명에서 사용되는 용어, "ssODN (single strand oligonucleotide; ssODN)"이란 편집하고자 하는 DNA를 중심으로 양 방향으로 펼쳐진 단일 가닥으로 ApoE Christchurch 돌연변이 염기서열을 포함하여, 세포의 유전체가 Cas9 단백질에 의해 절단된 후 수선할 때 녹인이 발생할 수 있도록 한다. ssODN 은 ApoE 유전자 표적 위치를 중심으로 양방향 각각 30~100bp의 염기 서열과 상보적인 서열을 포함하는 것일 수 있다. As used herein, the term "ssODN (single strand oligonucleotide; ssODN)" refers to a single strand that is spread in both directions around the DNA to be edited. After repair, make sure that rust can occur. The ssODN may include a sequence complementary to a nucleotide sequence of 30 to 100 bp in both directions with respect to the ApoE gene target position.
본 발명에서, 상기 "Cas9"이란 "CRISPR-Cas9"을 지칭하며, CRISPR-Cas9는 3세대 유전자가위로써 이용하고자 하는 특정 염기서열을 인식하여 절단하고 편집하며, 게놈의 목적 장소에 특정 유전자를 삽입하거나 특정 유전자의 활동을 정지시키는 조작을 간단하고 신속하고 효율성 있게 실시하는데 유용하다.In the present invention, the term "Cas9" refers to "CRISPR-Cas9", and CRISPR-Cas9 recognizes, cuts, and edits a specific nucleotide sequence to be used as a third-generation gene scissors, and inserts a specific gene into the target site of the genome It is useful for simple, quick and efficient operation of stopping the activity of a specific gene.
Cas9 단백질 또는 유전자 정보는 NCBI(National Center for Biotechnology Information)의 GenBank와 같은 공지의 데이터 베이스에서 얻을 수 있으나, 이에 제한되는 것은 아니다. 또한, Cas9 단백질은 그 목적에 따라 당업자가 추가적인 도메인을 적절하게 연결할 수 있다. Cas9 protein or gene information may be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI), but is not limited thereto. In addition, according to the purpose of the Cas9 protein, a person skilled in the art can appropriately link additional domains.
본 발명에 있어서, Cas9 단백질은 야생형 Cas9 뿐만아니라, 유전자 편집을 위한 핵산분해효소의 기능을 갖는 것이라면 Cas9의 변이체를 모두 포함할 수 있다.In the present invention, the Cas9 protein may include all variants of Cas9 as long as it has the function of a nuclease for gene editing as well as wild-type Cas9.
또한, 본 발명에서 Cas9 단백질은 그 유래가 제한되지 않으며, 비제한적인 예시로써 스트렙토코커스 피요제네스(Streptococcus pyogenes), 프란시셀라 노비시다 (Francisella novicida), 스트렙토코커스 써모필러스(Streptococcus thermophilus), 레지오넬라 뉴모필라 (Legionella pneumophila), 리스테리아 이노큐아(Listeria innocua), 또는 스트렙토코커스 뮤탄스(Streptococcus mutans) 유래일 수 있고, 당업자가 적절히 선택하여 이용할 수 있다. In addition, the Cas9 protein in the present invention is not limited in its origin, and as non-limiting examples, Streptococcus pyogenes, Francisella novicida, Streptococcus thermophilus, Legionella It may be derived from Legionella pneumophila, Listeria innocua, or Streptococcus mutans, and those skilled in the art may appropriately select and use it.
본 발명에서, 상기 단계 (b)는 단계 (a)에서 제작한 벡터를 인간유도만능줄기세포에 도입하고 배양하는 단계이다. In the present invention, step (b) is a step of introducing and culturing the vector prepared in step (a) into human induced pluripotent stem cells.
본 발명에서 사용되는 용어, "유도만능줄기세포(induced pluripotent stem cell; iPSC)"란 역분화 줄기세포로써 분화가 끝난 체세포에 세포 분화 관련 유전자를 주입하여 분화 이전의 세포 단계로 되돌린, 배아 줄기세포처럼 만능성을 유도해낸 세포를 의미한다. 본 발명에서 사용된 유도만능줄기세포는 Harvard medical school에서 제공받은 건강한 75세의 여성에게 유래한 세포이나, 이에 제한되지 않는다.As used herein, the term "induced pluripotent stem cell (iPSC)" refers to an embryonic stem that is returned to the cell stage prior to differentiation by injecting a cell differentiation-related gene into a somatic cell that has been differentiated as a dedifferentiated stem cell. Cells that have elicited pluripotency, such as cells. The induced pluripotent stem cells used in the present invention are cells derived from a healthy 75-year-old woman provided by Harvard medical school, but are not limited thereto.
상기 단계 (b)에서 상기 인간유도만능줄기세포에 벡터를 도입하는 방법은 세포 내로 벡터를 전달할 수 있는 공지의 방법이라면 특별히 제한되지 않는다. 예컨대, 전기천공법, 인산칼슘을 이용하는 방법, DEAE 덱스트란을 이용하는 방법, 미세주입법, 양이온성 지질을 이용하는 방법 또는 리포좀 등을 이용할 수 있으며, 본 발명에서는 전기천공법을 이용하였으나 당업자가 공지된 방법으로부터 적절히 선택하여 적용할 수 있다. The method of introducing the vector into the human induced pluripotent stem cells in step (b) is not particularly limited as long as it is a known method capable of delivering the vector into the cell. For example, electroporation, a method using calcium phosphate, a method using DEAE dextran, a microinjection method, a method using a cationic lipid, or liposome may be used. Appropriately selected from
또한, 인간유도만능줄기세포에 벡터를 도입하고 배양하는 방법, 조건 등은 특별히 제한되지 않으며, 대상세포 및 벡터의 도입 방법에 따라 당업자가 적절히 조절할 수 있다. In addition, methods, conditions, etc. for introducing and culturing the vector into human induced pluripotent stem cells are not particularly limited, and those skilled in the art may appropriately adjust the method according to the target cell and method of introducing the vector.
단계 (b)에서, 상기 배양은 1 내지 3일 동안 이루어질 수 있고, 바람직하게는 2일 동안 이루어질 수 있다. In step (b), the culture may be made for 1 to 3 days, preferably for 2 days.
상기 단계 (b)에서는, 벡터가 도입된 세포만을 추가로 선별하여 분리하는 과정을 더 포함할 수 있다. 예컨대 본 발명에서는 벡터 암호화된 GFP 유전자의 발현 여부를 이용하여 GFP 단백질이 발현되는 세포만을 분리하는 방법을 이용하였으나, 구체적인 방법은 이것으로 제한되지 않으며 당업자가 공지의 방법을 적절히 이용할 수 있다.The step (b) may further include a process of additionally selecting and isolating only the cells into which the vector has been introduced. For example, in the present invention, a method of isolating only cells expressing the GFP protein using the expression of the vector-encoded GFP gene was used, but the specific method is not limited thereto, and a known method may be appropriately used by those skilled in the art.
본 발명에서, 상기 단계 (b) 이후에 상기 배양된 세포를 분화시키는 단계를 더 포함할 수 있다.In the present invention, it may further include the step of differentiating the cultured cells after step (b).
본 발명에서 사용되는 용어, "분화"란 초기 단계의 미분화 상태의 줄기세포가 각 조직으로써의 특성을 갖게 되는 과정을 일컫는 것으로서, 본 발명의 목적상 유도만능줄기세포가 신경세포, 성상교세포 또는 뇌 오가노이드의 특성을 지니게 되는 것을 의미한다.As used herein, the term "differentiation" refers to a process in which stem cells in an undifferentiated state at an early stage have characteristics as individual tissues, and for the purpose of the present invention, induced pluripotent stem cells are neurons, astrocytes or brain It means to have the characteristics of an organoid.
본 발명에서 사용되는 용어, "신경세포"란 신경계를 구성하는 세포로서 나트륨 통로, 칼륨 통로등의 이온 통로를 발현하여 다른 세포와는 달리 전기적인 방법으로 신호를 전달할 수 있는 세포이다.As used herein, the term “neuron cell” refers to a cell constituting the nervous system, which expresses an ion channel such as a sodium channel or a potassium channel, and can transmit signals in an electrical manner unlike other cells.
본 발명에서 사용되는 용어, "성상교세포"란 뇌와 척수에 존재하는 세포로서 많은 돌기를 가지고 있으면서 혈액-뇌 장벽(blood brain barrier)의 안쪽 신경세포에 영양분을 공급하는 역할을 하며, 그 밖에도 신경세포의 이온농도 조절, 신경세포의 지지, 노페물의 제거, 식세포작용 등의 다양한 역할을 수행하는 세포이다.As used herein, the term "astroglia" is a cell that exists in the brain and spinal cord, has many projections, and serves to supply nutrients to the inner nerve cells of the blood brain barrier, and other nerve cells. It is a cell that performs various roles such as regulation of cell ion concentration, support of nerve cells, removal of waste products, and phagocytosis.
본 발명에서 사용되는 용어, "오가노이드"란 성체줄기세포, 배아줄기세포 또는 유도만능줄기세포로부터 자가 재생 및 자가 조직화를 통해 형성된 3차원 세포집합체로서, 모델 장기의 특이적 세포를 포함한다. 본 발명의 목적상 상기 모델 장기는 뇌일 수 있다.As used herein, the term "organoid" refers to a three-dimensional cell aggregate formed through self-renewal and self-organization from adult stem cells, embryonic stem cells or induced pluripotent stem cells, and includes specific cells of a model organ. For the purposes of the present invention, the model organ may be the brain.
본 발명자들은 구체적인 실시예를 통해, 인간유도만능줄기세포에 ApoE Christchurch 돌연변이를 삽입하여 알츠하이머 저항성 인간유도만능줄기세포 모델을 제작하였다(실시예 1 참조).The present inventors prepared an Alzheimer's-resistant human induced pluripotent stem cell model by inserting the ApoE Christchurch mutation into human induced pluripotent stem cells through specific examples (see Example 1).
또한, 본 발명의 다른 양태로서, 본 발명은 상기 제조방법에 의해 ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 인간유도만능줄기세포 모델을 제공한다.In addition, as another aspect of the present invention, the present invention provides an Alzheimer's-resistant human induced pluripotent stem cell model in which Christchurch mutation is knocked-in in the apolipoprotein E (ApoE) gene by the above production method.
또한, 본 발명의 다른 양태로서, 본 발명은 상기 알츠하이머 저항성 인간유도만능줄기세포를 분화시켜 신경세포 돌연변이 모델, 성상교세포 돌연변이 모델, 또는 뇌 오가노이드 돌연변이 모델을 제공한다 (실시예 2 및 3 참조).In addition, as another aspect of the present invention, the present invention provides a neuronal cell mutation model, an astrocyte mutation model, or a brain organoid mutation model by differentiating the Alzheimer's-resistant human induced pluripotent stem cells (see Examples 2 and 3) .
또한, 본 발명은 알츠하이머 질환의 진단에 사용하기 위한, 상기 방법에 의해 제조된 ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 인간유도만능줄기세포 모델의 용도를 제공한다.In addition, the present invention provides the use of an Alzheimer's-resistant human induced pluripotent stem cell model in which Christchurch mutations are knocked-in in the apolipoprotein E (ApoE) gene prepared by the above method for use in the diagnosis of Alzheimer's disease. .
또한, 본 발명은 알츠하이머 질환의 진단에 사용하기 위한 상기 인간유도만능줄기세포 모델로부터 분화된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 신경세포 모델의 용도를 제공한다.In addition, the present invention provides the use of an Alzheimer's-resistant neuron model in which Christchurch mutations are knocked-in in the ApoE (apolipoprotein E) gene, differentiated from the human induced pluripotent stem cell model for use in the diagnosis of Alzheimer's disease. do.
또한, 본 발명은 알츠하이머 질환의 진단에 사용하기 위한 상기 인간유도만능줄기세포 모델로부터 분화된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 성상교세포 모델의 용도를 제공한다.In addition, the present invention provides the use of an Alzheimer's-resistant astrocyte model in which Christchurch mutations are knocked-in in the ApoE (apolipoprotein E) gene, differentiated from the human induced pluripotent stem cell model for use in the diagnosis of Alzheimer's disease. do.
또한, 본 발명은 알츠하이머 질환의 진단에 사용하기 위한 상기 인간유도만능줄기세포 모델로부터 분화된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 뇌 오가노이드 모델의 용도를 제공한다.In addition, the present invention provides the use of an Alzheimer's-resistant brain organoid model in which Christchurch mutations are knocked-in in the ApoE (apolipoprotein E) gene, differentiated from the human induced pluripotent stem cell model for use in the diagnosis of Alzheimer's disease. to provide.
본 발명에서 사용되는 용어, "진단"이란 본 발명에 따른 세포 모델을 이용하여, 알츠하이머 질환의 존재 또는 특징을 확인하는 모든 행위를 의미한다.As used herein, the term “diagnosis” refers to any act of confirming the presence or characteristics of Alzheimer's disease using the cell model according to the present invention.
또한, 본 발명은 상기 방법에 의해 제조된 ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 인간유도만능줄기세포 모델을 이용한, 알츠하이머 질환의 진단 방법을 제공한다.In addition, the present invention provides a method for diagnosing Alzheimer's disease using an Alzheimer's-resistant human induced pluripotent stem cell model in which Christchurch mutation is knocked-in in the apolipoprotein E (ApoE) gene prepared by the above method.
또한, 본 발명은 상기 방법에 의해 제조된 ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 인간유도만능줄기세포 모델을 이용한, 알츠하이머 질환의 치료 방법을 제공한다.In addition, the present invention provides a method for treating Alzheimer's disease using an Alzheimer's-resistant human induced pluripotent stem cell model in which Christchurch mutation is knocked-in in the apolipoprotein E (ApoE) gene prepared by the above method.
본 발명에서 사용되는 용어, "치료"란 본 발명에 따른 세포 모델을 이용하여, 알츠하이머 질환에 대한 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다.As used herein, the term "treatment" refers to any action in which symptoms for Alzheimer's disease are improved or beneficially changed using the cell model according to the present invention.
또한, 본 발명은 상기 인간유도만능줄기세포 모델로부터 분화된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 신경세포 모델을 이용한, 알츠하이머 질환의 진단 방법을 제공한다.In addition, the present invention provides a method for diagnosing Alzheimer's disease using an Alzheimer's-resistant neuron model in which a Christchurch mutation is knocked-in in an apolipoprotein E (ApoE) gene, differentiated from the human induced pluripotent stem cell model.
또한, 본 발명은 상기 인간유도만능줄기세포 모델로부터 분화된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 신경세포 모델을 이용한, 알츠하이머 질환의 치료 방법을 제공한다.In addition, the present invention provides a method for treating Alzheimer's disease using an Alzheimer's-resistant neuron model in which Christchurch mutation is knocked-in in an apolipoprotein E (ApoE) gene, differentiated from the human induced pluripotent stem cell model.
또한, 본 발명은 상기 인간유도만능줄기세포 모델로부터 분화된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 성상교세포 모델을 이용한, 알츠하이머 질환의 진단 방법을 제공한다.In addition, the present invention provides a method for diagnosing Alzheimer's disease using the Alzheimer's-resistant astrocyte model in which Christchurch mutation is knocked-in in the ApoE (apolipoprotein E) gene, differentiated from the human induced pluripotent stem cell model.
또한, 본 발명은 상기 인간유도만능줄기세포 모델로부터 분화된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 성상교세포 모델을 이용한, 알츠하이머 질환의 치료 방법을 제공한다.In addition, the present invention provides a method for treating Alzheimer's disease using an Alzheimer's-resistant astrocyte model in which Christchurch mutation is knocked-in in the ApoE (apolipoprotein E) gene, differentiated from the human induced pluripotent stem cell model.
또한, 본 발명은 상기 인간유도만능줄기세포 모델로부터 분화된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 뇌 오가노이드 모델을 이용한, 알츠하이머 질환의 진단 방법을 제공한다.In addition, the present invention provides a method for diagnosing Alzheimer's disease using an Alzheimer's-resistant brain organoid model in which Christchurch mutation is knocked-in in ApoE (apolipoprotein E) gene, differentiated from the human induced pluripotent stem cell model. .
또한, 본 발명은 상기 인간유도만능줄기세포 모델로부터 분화된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 뇌 오가노이드 모델을 이용한, 알츠하이머 질환의 치료 방법을 제공한다.In addition, the present invention provides a method for treating Alzheimer's disease using an Alzheimer's-resistant brain organoid model in which Christchurch mutation is knocked-in in ApoE (apolipoprotein E) gene, differentiated from the human induced pluripotent stem cell model. .
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.
[실시예][Example]
실시예 1. CRISPR/Cas9 유전체 편집을 통한 ApoE Christchurch 돌연변이 삽입된 인간유도만능줄기세포의 제작Example 1. Preparation of human induced pluripotent stem cells inserted with ApoE Christchurch mutations through CRISPR/Cas9 genome editing
본 발명자들은 미국 Harvard Medical School에서 제공받은 75세 백인 정상인 여성 유래 유도만능줄기세포를 이용하여 ApoE 유전자에 Christchurch돌연변이가 녹인된 인간유도만능줄기세포를 제작하고자 하였으며, 전반적인 과정을 도 1a에 그림으로 도시하였다.The present inventors tried to produce human induced pluripotent stem cells in which Christchurch mutation was dissolved in the ApoE gene using induced pluripotent stem cells derived from a 75-year-old Caucasian normal female provided by Harvard Medical School in the United States. The overall process is illustrated in FIG. 1a. did.
상기 세포에 ApoE Christchurch 돌연변이를 도입하기 위해서, 상기 유전자를 표적할 수 있는 가이드 RNA(sgRNA)(5'- GAGGCGCACCCGCAGCTCCT -3', 서열번호 1)를 합성하여 Cas9을 발현하는 플라스미드(pSpCas9(BB)-2A-GFP, Addgene)에 ligation 시켰다. 상기 돌연변이만을 삽입하고, 동시에 추가적인 editing이 일어나는 것을 방지하고자 PAM 영역에 silent 돌연변이를 삽입할 수 있는 single-strand oligonucleotide(ssODN) template를 전기천공(electroporation) 방법을 활용하여 유도만능줄기세포에 형질전환 시켰다(P3 Primary Cell 4D X kit, 4D-Nucleofector, Lonza). 2일이 경과한 다음, GFP-양성 세포만을 Sorter(SH-800S cell sorter, Sony)를 활용하여 분리하였고, 이렇게 수득한 세포들을 MEF(mouse embryonic fibroblast) 세포가 코팅된 플레이트에서 배양한 다음, genomic DNA를 추출하여 타겟 부위에 대한 Sanger sequencing을 수행하였다. 그 결과, 도 1b에 나타낸 바와 같이 ApoE 유전자에 발생한 Christchurch 돌연변이(460번 뉴클레오티드인 Cysteine이 Adenine으로 치환, 136번 아미노산인 Arginine이 Serine으로 치환)가 삽입된 세포주를 성공적으로 제작하였다는 사실을 확인하였다.In order to introduce the ApoE Christchurch mutation into the cell, a guide RNA (sgRNA) capable of targeting the gene (5'-GAGGCGCACCCGCAGCTCCT-3', SEQ ID NO: 1) was synthesized and Cas9-expressing plasmid (pSpCas9(BB)- 2A-GFP, Addgene) was ligated. In order to insert only the above mutation and to prevent additional editing from occurring at the same time, a single-strand oligonucleotide (ssODN) template capable of inserting a silent mutation into the PAM region was transformed into induced pluripotent stem cells using an electroporation method. (P3 Primary Cell 4D X kit, 4D-Nucleofector, Lonza). After 2 days, only GFP-positive cells were separated using a sorter (SH-800S cell sorter, Sony), and the obtained cells were cultured on a plate coated with mouse embryonic fibroblast (MEF) cells, and then genomic DNA was extracted and Sanger sequencing was performed on the target site. As a result, as shown in FIG. 1b, it was confirmed that a cell line in which the Christchurch mutation (Cysteine, nucleotide 460, substituted with Adenine, and Arginine, 136th amino acid, with Serine) in the ApoE gene was inserted was successfully prepared. .
실시예 2. 분화를 통한 돌연변이 모델의 제작Example 2. Construction of a mutation model through differentiation
2-1. 신경세포 돌연변이 모델2-1. Neuronal Mutation Model
상기 실시예 1에서 제작한 ApoE Christchurch 돌연변이 녹인된 인간유도만능줄기세포를 뇌 신경세포로 분화시키기 위해 기존에 알려진 방법(Zhang et al., 2013)을 활용하였고, 전체적인 분화 유도 과정은 도 2a에 나타내었다. 분화 유도를 위해 TetO gene 에 의해 Ngn2 발현이 유도되는 lentivirus를 처리하고 24시간 후 N2 / DMEM:F12 / Non-essential amino acid로 구성된 배양액에 BDNF(10 ng/ml), NT-3(10 ng/ml), laminin(0.2 ug/ml), doxycycline(2 ug/ml)을 처리하였다. 2일 후, 배양액을 Neurobasal로 바꾸어 주고 여기에 B27, GlutaMAX 와 함께 BDNF(10 ng/ml), NT-3(10 ng/ml), laminin(0.2 ug/ml), doxycycline(2 ug/ml), puromycin(1 ug/ml)을 처리하여 분화를 계속 유도하면서 바이러스에 infection 되지 않은 세포를 제거하였다. 그 다음날부터 3일동안 Ara-C(1 uM)을 처리하여 증식하는 비신경세포의 성장을 억제하고, astrocyte conditioned media를 배양액으로 사용하여 신경세포 발달을 촉진시켰다. 신경세포의 분화여부는 시냅스 마커인 synaptophysin, PSD-95 형광 염색으로 확인하였다(도 2b). A previously known method (Zhang et al., 2013) was used to differentiate the human induced pluripotent stem cells containing the ApoE Christchurch mutant prepared in Example 1 into brain neurons, and the overall differentiation induction process is shown in FIG. 2a. It was. For differentiation induction, lentivirus in which Ngn2 expression is induced by TetO gene was treated and 24 hours later, BDNF (10 ng/ml), NT-3 (10 ng/ ml), laminin (0.2 ug/ml), and doxycycline (2 ug/ml) were treated. After 2 days, the culture medium was changed to Neurobasal, and BDNF (10 ng/ml), NT-3 (10 ng/ml), laminin (0.2 ug/ml), doxycycline (2 ug/ml) together with B27 and GlutaMAX (2 ug/ml) , cells not infected with the virus were removed while continuing to induce differentiation by treatment with puromycin (1 ug/ml). From the next day, treatment with Ara-C (1 uM) for 3 days inhibited the growth of proliferating non-neuronal cells, and astrocyte conditioned media was used as a culture medium to promote neuronal development. The differentiation of neurons was confirmed by synaptic marker synaptophysin and PSD-95 fluorescence staining (FIG. 2b).
상기와 같은 결과를 통해 본 발명자들은 본 발명의 ApoE Christchurch 돌연변이 삽입된 인간유도만능줄기세포가 뇌 신경세포로 분화된 것을 확인할 수 있었다.Through the above results, the present inventors could confirm that the human induced pluripotent stem cells inserted with the ApoE Christchurch mutation of the present invention were differentiated into brain neurons.
2-2. 성상교세포 돌연변이 모델2-2. Astrocyte Mutation Model
상기 실시예 1에서 제작한 ApoE Christchurch 돌연변이 녹인된 인간유도만능줄기세포를 성상교세포로 분화시키기 위해 기존에 알려진 방법(Lin et al., 2018)을 활용하였고, 전체적인 분화 유도 과정은 도 3a에 나타내었다. 분화 유도를 위해 Smad signaling inhibitors 인 Dorsomophin(1 uM)과 SB431542(10 uM)를 11일동안 처리하여 신경전구세포를 제작하였으며, 이렇게 제작한 신경전구세포를 다시 20 ng/ml 농도의 FGF2를 처리함으로써 rosettes 구조 형성을 촉진시킨 다음, Bone morphogenic protein 4(BMP4, 10 ng/ml)를 한 달 동안 처리하여 성상교세포로의 분화를 유도하였다. GLAST 항체에 의해 염색되는 세포를 Sorter(SH-800S cell sorter, Sony) 장비를 통해 분리하였으며, 분리된 성상교세포의 분화여부는 성상교세포의 마커인 GFAP, AQP4 항체에 대한 형광염색으로 확인하였다(도 3b). A previously known method (Lin et al., 2018) was used to differentiate the human induced pluripotent stem cells in which the ApoE Christchurch mutant was prepared in Example 1 into astrocytes, and the overall differentiation induction process is shown in FIG. 3a. . To induce differentiation, the Smad signaling inhibitors Dorsomophin (1 uM) and SB431542 (10 uM) were treated for 11 days to prepare neural progenitor cells. After promoting the formation of the rosettes structure, differentiation into astrocytes was induced by treatment with bone morphogenic protein 4 (BMP4, 10 ng/ml) for one month. Cells stained with the GLAST antibody were separated using a Sorter (SH-800S cell sorter, Sony) equipment, and the differentiation of the separated astrocytes was confirmed by fluorescence staining for GFAP and AQP4 antibodies, which are markers of astrocytes (Fig. 3b).
상기와 같은 결과를 통해 본 발명자들은 본 발명의 ApoE Christchurch 돌연변이 삽입된 인간유도만능줄기세포가 성상교세포로 분화된 것을 확인할 수 있었다.Through the above results, the present inventors were able to confirm that the human induced pluripotent stem cells inserted with the ApoE Christchurch mutation of the present invention were differentiated into astrocytes.
2-3. 뇌 오가노이드 돌연변이 모델2-3. Brain Organoid Mutation Model
상기 실시예 1에서 제작한 ApoE Christchurch 돌연변이 녹인된 인간유도만능줄기세포를 뇌오가노이드로 분화시키기 위해 기존에 알려진 방법(Raja et al., 2016)을 활용하였다. 분화 유도를 위해 V-shape 96-웰 플레이트에 상기 세포 12,000 개를 시딩(seeding) 하고 19일 동안 Knock-out Serum, sodium pyruvate, Non-essential amino acid, Wnt inhibitor, ROCK inhibitor, TGF-beta inhibitor SB431542가 포함된 GMEM 배양액에 배양하였다. 배양 중, 19일부터 35일까지는 DMEM:F12 + Glutamax 배양액에 N2 supplement 와 Chemically defined lipid concentrate를 처리하여 배양하였고, 35일 이후에는 이 배양액에 Fatal bovine serum 과 heparin, matrigel을 추가 처리하여 배양하였으며, 70일 이후부터는 B27 supplement를 추가 처리하였다(도 4a). 이렇게 배양과정을 통해 뇌 오가노이드로 분화해가는 인간유도만능줄기세포를 6, 10, 31, 55, 60일에 촬영하여 도 4b에 나타내었다.A previously known method (Raja et al., 2016) was used to differentiate the human induced pluripotent stem cells in which the ApoE Christchurch mutation prepared in Example 1 was dissolved into brain organoids. For differentiation induction, 12,000 cells were seeded in a V-shape 96-well plate and Knock-out Serum, sodium pyruvate, Non-essential amino acid, Wnt inhibitor, ROCK inhibitor, TGF-beta inhibitor SB431542 for 19 days. It was cultured in a GMEM culture medium containing During culture, from the 19th to the 35th day, DMEM:F12 + Glutamax culture medium was treated with N2 supplement and chemically defined lipid concentrate and cultured. After 35 days, this culture medium was further treated with Fatal bovine serum, heparin, and matrigel, After 70 days, B27 supplement was additionally treated (Fig. 4a). The human induced pluripotent stem cells that differentiate into brain organoids through this culture process were photographed on days 6, 10, 31, 55, and 60, and are shown in FIG. 4B.
실시예 3. APOE Christchurch에 의한 알츠하이머성 치매 저항성 확인Example 3. Confirmation of Alzheimer's dementia resistance by APOE Christchurch
알츠하이머성 치매의 가장 강력한 유전변이인 APOE4 변이는, 신경세포의 유전자 발현 변화를 유발하고 성상교세포의 ApoE4 단백질 발현을 감소시키는 것으로 알려져 있으므로, 이러한 변화가 APOE Christchurch 변이에 의해 억제되는지를 확인하였다. Since the APOE4 mutation, the strongest genetic mutation in Alzheimer's disease, is known to induce a change in the gene expression of neurons and decrease the ApoE4 protein expression in astrocytes, it was confirmed whether this change is inhibited by the APOE Christchurch mutation.
3-1. 신경세포 돌연변이 모델에서의 확인3-1. Identification in a neuronal mutation model
APOE4 알츠하이머 신경세포 모델과 APOE Christchurch가 추가로 삽입된 신경세포의 총 RNA를 추출하고 Analytical-fragment Analyzer를 통해 Quality Control을 수행하였다. 그 후 Illumina RNA-seq library prepration 및 Illumina sequencing (100 pair-end)을 수행하고, raw fastq data를 human hg19 assembly에 align하여 그룹 간 differentially expressed genes을 비교하였다.APOE4 Alzheimer's neuron model and APOE Christchurch were additionally extracted total RNA of the inserted neurons, and quality control was performed through Analytical-fragment Analyzer. After that, Illumina RNA-seq library preparation and Illumina sequencing (100 pair-end) were performed, and raw fastq data were aligned with human hg19 assembly to compare differentially expressed genes between groups.
그 결과, 도 5에 나타낸 바와 같이, APOE4 변이를 갖는 유도만능줄기세포에서 유래된 신경세포와 비교할 때, APOE Christchurch가 추가로 삽입된 신경세포의 경우, RNA sequencing 결과에서 APOE4 특이적 유전자 변화를 대조군 수준으로 상당부분 교정시키는 것이 확인되었다. As a result, as shown in FIG. 5 , when compared to neurons derived from induced pluripotent stem cells having an APOE4 mutation, in the case of neurons into which APOE Christchurch was additionally inserted, APOE4-specific gene changes were controlled in RNA sequencing results. It was confirmed that a considerable amount of correction was made to the level.
특히, APOE4에 의해 증가된 1514개의 유전자 중 390개가 APOE Christchurch 변이에 의해 회복되었는데, 이들 중에는 'antigen processing and presentation' 염증반응과 관련된 유전자들이 상당수 확인되었다(도 5a). In particular, 390 of 1514 genes increased by APOE4 were recovered by APOE Christchurch mutation, and a significant number of genes related to 'antigen processing and presentation' inflammatory response were identified (FIG. 5a).
또한, APOE4에 의해 감소된 1028개의 유전자 중 331개가 APOE Christchurch 변이에 의해 회복되었는데, 이들 중에는 세포간 및 세포와 세포외부 환경과의 상호 작용에 관여하는 단백질의 유전자들이 상당수 확인되었다(도 5b). In addition, 331 of the 1028 genes reduced by APOE4 were recovered by APOE Christchurch mutation, and among them, many genes of proteins involved in the interaction between cells and the cell-extracellular environment were identified (FIG. 5b).
3-2. 성상교세포 돌연변이 모델에서의 확인3-2. Identification in an astrocyte mutation model
ApoE4 알츠하이머 성상교세포 모델과 APOE Christchurch가 추가로 삽입된 성상교세포를 RIPA buffer (50 mM Tris, 150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS)와 protease 및 phosphatase 억제제를 통해 lysates를 만든 후 immunoblotting을 수행하여 ApoE 단백질 및 p62 단백질의 발현량을 측정하였다. ApoE 단백질의 안정성 측정을 위해 단백질 생성 저해효소인 cycloheximide (50 ug/ml)를 일정시간 (0h, 1h, 2h, 4h, 6h) 함께 처리하고 ApoE 단백질이 잔존량을 측정함으로써 ApoE 단백질이 분해되는데 걸리는 시간을 확인하였다.ApoE4 Alzheimer's astrocyte model and APOE Christchurch additionally inserted astrocytes were lysates with RIPA buffer (50 mM Tris, 150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS) and protease and phosphatase inhibitors. Then, immunoblotting was performed to measure the expression levels of ApoE protein and p62 protein. To measure the stability of the ApoE protein, the protein production inhibitor, cycloheximide (50 ug/ml), was treated together for a certain period of time (0h, 1h, 2h, 4h, 6h) and the amount of ApoE protein remaining was measured. time was checked.
그 결과, 도 6a에 나타낸 바와 같이, APOE4 변이를 갖는 유도만능줄기세포에서 유래된 성상교세포와 비교할 때, APOE Christchurch가 추가로 삽입된 성상교세포의 경우, APOE4 변이에 의해 관찰되는 ApoE 단백질의 발현 감소 및 불안정성이 APOE Christchurch 변이에 의해 완화되는 것을 확인하였다.As a result, as shown in FIG. 6a , when compared to astrocytes derived from induced pluripotent stem cells having APOE4 mutation, in the case of astrocytes additionally inserted with APOE Christchurch, the expression of ApoE protein observed by APOE4 mutation decreased. And it was confirmed that the instability was alleviated by the APOE Christchurch mutation.
또한, 도 6b에 나타낸 바와 같이, APOE4 변이를 갖는 유도만능줄기세포에서 유래된 성상교세포와 비교할 때, APOE Christchurch가 추가로 삽입된 성상교세포의 경우, 비정상적인 자가포식 기능이 회복되는 것을 확인하였다. In addition, as shown in FIG. 6b, when compared to astrocytes derived from induced pluripotent stem cells having an APOE4 mutation, in the case of astrocytes additionally inserted with APOE Christchurch, it was confirmed that the abnormal autophagy function was restored.
상기 진술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.The description of the present invention stated above is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. There will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.
<110> Institute for Basic Science Daegu Gyeongbuk Institute of Science and Technology<110> Institute for Basic Science Daegu Gyeongbuk Institute of Science and Technology
<120> Alzheimer resistant cell model comprising APOE Christchurch mutation and preparation method thereof<120> Alzheimer resistant cell model comprising APOE Christchurch mutation and preparation method thereof
<130> PD20-451<130> PD20-451
<160> 2<160> 2
<170> KoPatentIn 3.0<170> KoPatentIn 3.0
<210> 1<210> 1
<211> 20<211> 20
<212> DNA<212> DNA
<213> Artificial Sequence<213> Artificial Sequence
<220><220>
<223> ApoE Christchurch_sgRNA<223> ApoE Christchurch_sgRNA
<400> 1<400> 1
gaggcgcacc cgcagctcct 20 gaggcgcacc cgcagctcct 20
<210> 2<210> 2
<211> 110<211> 110
<212> DNA<212> DNA
<213> Artificial Sequence<213> Artificial Sequence
<220><220>
<223> ssODN<223> ssODN
<400> 2<400> 2
aggagccgct tacgcagctt gcgcaggtgg gaggcgaggc tcacccgcag ctcctctgtg 60aggagccgct tacgcagctt gcgcaggtgg gaggcgaggc tcacccgcag ctcctctgtg 60
ctctggccga gcatggcctg cacctcgccg cggtactgca ccaggcggcc 110ctctggccga gcatggcctg cacctcgccg cggtactgca ccaggcggcc 110

Claims (20)

  1. 하기의 단계를 포함하는, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 인간유도만능줄기세포 모델의 제조방법:A method for preparing an Alzheimer's-resistant human induced pluripotent stem cell model in which Christchurch mutation is melted (Knock-in) in ApoE (apolipoprotein E) gene, comprising the following steps:
    (a) ApoE를 표적하는 가이드 RNA(sgRNA), ssODN 및 Cas9 단백질 발현용 벡터를 제작하는 단계; 및(a) constructing a vector for ApoE-targeting guide RNA (sgRNA), ssODN and Cas9 protein expression; and
    (b) 인간유도만능줄기세포에 상기 벡터를 도입하고 배양하는 단계.(b) introducing the vector into human induced pluripotent stem cells and culturing.
  2. 제1항에 있어서, According to claim 1,
    상기 단계 (b)에서, 배양된 세포 중 벡터가 도입된 세포만을 분리하는 단계를 더 포함하는 것을 특징으로 하는, 제조방법.In the step (b), the production method, characterized in that it further comprises the step of isolating only the vector-introduced cells from among the cultured cells.
  3. 제1항에 있어서,According to claim 1,
    상기 (b) 단계 이후에 상기 배양된 세포를 분화시키는 단계를 더 포함하는 것을 특징으로 하는, 제조방법.The manufacturing method, characterized in that it further comprises the step of differentiating the cultured cells after the step (b).
  4. 제3항에 있어서, 4. The method of claim 3,
    상기 세포는 신경세포, 성상교세포 또는 뇌 오가노이드로 분화하는 것을 특징으로 하는, 제조방법.The cell is characterized in that the differentiation into neurons, astrocytes or brain organoids, the manufacturing method.
  5. 제1항에 있어서, The method of claim 1,
    상기 가이드 RNA는 서열번호 1의 염기서열로 이루어진 것을 특징으로 하는, 제조방법.The guide RNA is characterized in that consisting of the nucleotide sequence of SEQ ID NO: 1, the production method.
  6. 제1항에 있어서, The method of claim 1,
    상기 ssODN은 서열번호 2의 염기서열로 이루어진 것을 특징으로 하는, 제조방법.The ssODN is a manufacturing method, characterized in that consisting of the nucleotide sequence of SEQ ID NO: 2.
  7. 제1항에 있어서, The method of claim 1,
    상기 단계 (b)에서 배양은 1 내지 3일 동안 이루어진 것을 특징으로 하는, 제조방법.The culturing in step (b) is characterized in that made for 1 to 3 days, the manufacturing method.
  8. 제1항 내지 제7항 중 어느 한 항의 방법에 의해 제조된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 인간유도만능줄기세포 모델.The Alzheimer's-resistant human induced pluripotent stem cell model prepared by the method of any one of claims 1 to 7, wherein the Christchurch mutation is melted (Knock-in) in the ApoE (apolipoprotein E) gene.
  9. 제8항에 있어서,9. The method of claim 8,
    상기 알츠하이머 저항성은, 신경세포 염증이 감소하거나 자가포식기능이 회복되는 것임을 특징으로 하는, 인간유도만능줄기세포 모델.The Alzheimer's resistance, human induced pluripotent stem cell model, characterized in that the neuronal inflammation is reduced or autophagy is restored.
  10. 제8항의 인간유도만능줄기세포 모델로부터 분화된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 신경세포 모델.The Alzheimer's-resistant neuron model in which Christchurch mutations are knocked-in in the ApoE (apolipoprotein E) gene, differentiated from the human induced pluripotent stem cell model of claim 8 .
  11. 제8항의 인간유도만능줄기세포 모델로부터 분화된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 성상교세포 모델.A model of Alzheimer's-resistant astrocytes differentiated from the human induced pluripotent stem cell model of claim 8, in which Christchurch mutations are knocked-in in the ApoE (apolipoprotein E) gene.
  12. 제8항의 인간유도만능줄기세포 모델로부터 분화된, ApoE(apolipoprotein E) 유전자에 Christchurch 돌연변이가 녹인(Knock-in)된 알츠하이머 저항성 뇌 오가노이드 모델.An Alzheimer's-resistant brain organoid model in which Christchurch mutations in the ApoE (apolipoprotein E) gene are knocked-in, differentiated from the human induced pluripotent stem cell model of claim 8.
  13. 알츠하이머 질환의 진단에 사용하기 위한, 제8항의 알츠하이머 저항성 인간유도만능줄기세포 모델의 용도.Use of the Alzheimer's-resistant human induced pluripotent stem cell model of claim 8 for use in the diagnosis of Alzheimer's disease.
  14. 알츠하이머 질환의 진단에 사용하기 위한, 제10항의 알츠하이머 저항성 신경세포 모델의 용도.Use of the Alzheimer's resistant neuronal model of claim 10 for use in the diagnosis of Alzheimer's disease.
  15. 알츠하이머 질환의 진단에 사용하기 위한, 제11항의 알츠하이머 저항성 성상교세포 모델의 용도.Use of the Alzheimer's resistant astrocyte model of claim 11 for use in the diagnosis of Alzheimer's disease.
  16. 알츠하이머 질환의 진단에 사용하기 위한, 제12항의 알츠하이머 저항성 뇌 오가노이드 모델의 용도.Use of the Alzheimer's resistant brain organoid model of claim 12 for use in the diagnosis of Alzheimer's disease.
  17. 제8항의 알츠하이머 저항성 인간유도만능줄기세포 모델을 이용한, 알츠하이머 질환의 진단 또는 치료 방법.A method for diagnosing or treating Alzheimer's disease using the Alzheimer's-resistant human induced pluripotent stem cell model of claim 8.
  18. 제10항의 알츠하이머 저항성 신경세포 모델을 이용한, 알츠하이머 질환의 진단 또는 치료 방법.A method for diagnosing or treating Alzheimer's disease using the Alzheimer's-resistant neuron model of claim 10.
  19. 제11항의 알츠하이머 저항성 성상교세포 모델을 이용한, 알츠하이머 질환의 진단 또는 치료 방법.Using the Alzheimer's-resistant astrocyte model of claim 11, a method for diagnosing or treating Alzheimer's disease.
  20. 제12항의 알츠하이머 저항성 뇌 오가노이드 모델을 이용한, 알츠하이머 질환의 진단 또는 치료 방법.A method for diagnosing or treating Alzheimer's disease using the Alzheimer's-resistant brain organoid model of claim 12.
PCT/KR2022/000012 2021-01-13 2022-01-10 Alzheimer-resistant cell model including apoe christchurch mutation and construction method therefor WO2022154343A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20210004832 2021-01-13
KR10-2021-0004832 2021-01-13
KR10-2021-0152474 2021-11-08
KR1020210152474A KR20220102552A (en) 2021-01-13 2021-11-08 Alzheimer resistant cell model comprising APOE Christchurch mutation and preparation method thereof

Publications (1)

Publication Number Publication Date
WO2022154343A1 true WO2022154343A1 (en) 2022-07-21

Family

ID=82448366

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/000012 WO2022154343A1 (en) 2021-01-13 2022-01-10 Alzheimer-resistant cell model including apoe christchurch mutation and construction method therefor

Country Status (1)

Country Link
WO (1) WO2022154343A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019084958A1 (en) * 2017-11-06 2019-05-09 Shenzhen Cell Inspire Biotechnology Co., Ltd. Novel human induced pluripotent stem cell lines for modeling alzheimer's disease and usage thereof
US20190338363A1 (en) * 2016-12-18 2019-11-07 Selonterra, Inc. Use of apoe4 motif-mediated genes for diagnosis and treatment of alzheimer's disease
US20200095299A1 (en) * 2018-07-14 2020-03-26 City Of Hope STEM CELL MODEL OF APOE GENOTYPE AND Abeta42-DEPENDENT NEURODEGENERATION AND METHODS OF USING THE SAME
KR102170502B1 (en) * 2013-12-11 2020-10-28 리제너론 파마슈티칼스 인코포레이티드 Methods and compositions for the targeted modification of a genome

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102170502B1 (en) * 2013-12-11 2020-10-28 리제너론 파마슈티칼스 인코포레이티드 Methods and compositions for the targeted modification of a genome
US20190338363A1 (en) * 2016-12-18 2019-11-07 Selonterra, Inc. Use of apoe4 motif-mediated genes for diagnosis and treatment of alzheimer's disease
WO2019084958A1 (en) * 2017-11-06 2019-05-09 Shenzhen Cell Inspire Biotechnology Co., Ltd. Novel human induced pluripotent stem cell lines for modeling alzheimer's disease and usage thereof
US20200095299A1 (en) * 2018-07-14 2020-03-26 City Of Hope STEM CELL MODEL OF APOE GENOTYPE AND Abeta42-DEPENDENT NEURODEGENERATION AND METHODS OF USING THE SAME

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ARBOLEDA-VELASQUEZ JOSEPH F.; LOPERA FRANCISCO; O’HARE MICHAEL; DELGADO-TIRADO SANTIAGO; MARINO CLAUDIA; CHMIELEWSKA NATALIA: "Resistance to autosomal dominant Alzheimer’s disease in anChristchurch homozygote: a case report", NATURE MEDICINE, NATURE PUBLISHING GROUP US, NEW YORK, vol. 25, no. 11, 1 November 2019 (2019-11-01), New York, pages 1680 - 1683, XP036927379, ISSN: 1078-8956, DOI: 10.1038/s41591-019-0611-3 *

Similar Documents

Publication Publication Date Title
Phillips et al. Illegitimate recombination induced by DNA double-strand breaks in a mammalian chromosome
Weisberg et al. Role for DNA homology in site-specific recombination: The isolation and characterization of a site affinity mutant of coliphage λ
Glover Gene cloning: the mechanics of DNA manipulation
Berman et al. Promoter mutations in the transfer RNA gene tyrT of Escherichia coli.
US20220136041A1 (en) Off-Target Single Nucleotide Variants Caused by Single-Base Editing and High-Specificity Off-Target-Free Single-Base Gene Editing Tool
AU2012343826A1 (en) Haploid cells
WO2021086063A1 (en) Method for screening stem cells for treatment of brain-nervous system diseases using three-dimensional brain organoid
WO2018030630A1 (en) Nonviral minicircle vector carrying sox gene and construction method therefor
WO2022154343A1 (en) Alzheimer-resistant cell model including apoe christchurch mutation and construction method therefor
WO2022119294A1 (en) Adenine base editor lacking cytosine editing activity and use thereof
Kosaka et al. In VitroCulture System for Iris-Pigmented Epithelial Cells for Molecular Analysis of Transdifferentiation
WO2023177182A1 (en) HUMAN PLURIPOTENT CELL LINE GENETICALLY ENGINEERED TO CO-EXPRESS α-MHC GENE AND FLUORESCENT REPORTER GENE
Schiavo et al. Characterization of a temperature-sensitive carrot cell mutant impaired in somatic embryogenesis
WO2019147025A1 (en) Composition for embryonic development, comprising rad51 activator, and method for improving embryonic development rate using same
KR20220102552A (en) Alzheimer resistant cell model comprising APOE Christchurch mutation and preparation method thereof
WO2021020884A2 (en) Cytosine base-editing composition and use of same
WO2022059891A1 (en) Construction of allergy main gene fel d1 target feline cell line
WO2023068826A1 (en) Composition for inducing direct reprogramming comprising self-assembled rna construct
WO2023204594A1 (en) Method for vector insertion site detection and clonal quantification using tagmentation
WO2023085505A1 (en) Parkinson&#39;s disease-inducing vector and method for constructing canine model using same
WO2023080755A1 (en) Method for preparing stem cell-derived cardiomyopathy model cell line by using crispr-based base editing technology, and cardiomyopathy cell line prepared by same method
WO2024167297A1 (en) Human pluripotent stem cell line genetically engineered to co-express tubb3 gene and fluorescent reporter gene
Tidball Disease in a Dish: Cellular Models to Understand Human Conditions
WO2020158972A1 (en) Method for producing in vitro wilson&#39;s disease model using human pluripotent stem cells, and in vitro wilson&#39;s disease model produced through same
Rummel Functional annotation of cell type and condition specific schizophrenia associated non-coding genetic variants in disease relevant cell types

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22739541

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22739541

Country of ref document: EP

Kind code of ref document: A1