WO2020158972A1

WO2020158972A1 - Method for producing in vitro wilson's disease model using human pluripotent stem cells, and in vitro wilson's disease model produced through same

Info

Publication number: WO2020158972A1
Application number: PCT/KR2019/001278
Authority: WO
Inventors: 김동규; 우동훈; 한충성
Original assignee: (주)넥셀
Priority date: 2019-01-29
Filing date: 2019-01-30
Publication date: 2020-08-06
Also published as: KR20200094016A; KR102159877B1

Abstract

The present invention relates to a method for generating in vitro cultured hepatocytes using an endoplasmic reticulum stress reliever, the method comprising: step A for preparing a guide RNA having a nucleotide sequence of SEQ ID NO: 1; step B for inserting the guide RNA prepared through step A into a Cas9 nuclease expression vector, and thereby preparing a vector for CRISPR/Cas9 cloned so as to include the guide RNA prepared through step A; step C for preparing ssODNs (Single Stranded Oligodeoxynucleotides) having a nucleotide sequence of SEQ ID NO: 2; step D for injecting the vector for CRISPR/Cas9 prepared through step B and the ssODNs prepared through step C into human pluripotent stem cells; step E for obtaining a plurality of single colonies by culturing the human pluripotent stem cells into which the vector for CRISPR/Cas9 and ssODNs have been injected through step D; and step F for sequencing each of the plurality of single colonies obtained through step E, and selecting a single colony having human pluripotent stem cells which have been made able to develop Wilson's disease by being made to include the Wilson's disease-causing gene ATP7B which has mutated into the R778L mutant form through specific gene mutation.

Description

Method for manufacturing an in vitro Wilson disease model using human starch-potential stem cells and an in vitro Wilson disease model produced through the method

The present invention is a method for manufacturing an in vitro Wilson disease model that can be used for the development of a new drug for the treatment of Wilson disease based on human progenitor stem cells and the in vitro Wilson disease model itself, which is induced to enable the development of Wilson disease The present invention relates to stem cells derived from human pluripotent stem cells.

Wilson's Disease is a rare genetic disorder in which copper accumulates in important organs such as the liver and brain due to abnormalities in copper metabolism and the binding function of ceruloplasmin and copper.

The cause of Wilson's disease is the ATP7B gene, which is located on the chromosome 13 of the long arm 14.3 (q14.3) to make the copper-carrying P-type ATPase protein. Until recently, the Wilson of the ATP7B gene, which causes disorder through conversion of the ATP7B protein structure. There are more than 300 types of mutations involved in disease development.

Due to the development of Wilson's disease, as copper is not normally discharged and accumulates in the body, copper toxicity increases, leading to death due to organ failure, including liver abnormalities, nervous system abnormalities, and psychiatric abnormalities.

In order to treat this, drugs such as copper absorption inhibitors such as zinc salt or copper excretion accelerators such as D-Penicillamine and Trientine have been developed, and the efficacy evaluation of these drugs for treating Wilson's disease and the development of new drugs for the treatment of Wilson's disease 'S research is ongoing.

In this regard, prior literature on prior art proposed for the development of therapeutic agents for the treatment of Wilson's disease is described in Korean Patent Application Publication No. 10-2017-0108951 for nucleic acid structures and gene therapy for use in the treatment of Wilson's disease and other conditions Vector" (hereinafter referred to as "prior art").

However, various techniques for the treatment of Wilson's disease, including the prior art, focus only on the preparation of a therapeutic composition that functions directly in the treatment of Wilson's disease, and modeling of Wilson's disease required for research for the development of a composition for the treatment of Wilson's disease ( Modeling and drug screening systems were not established in the direction of technology development.

In addition, since the previously proposed drugs for treating Wilson's disease, including the prior art, have been applied to patients in clinical practice, there is a problem in that patients have different reactivity levels for each drug due to different genetic backgrounds.

In other words, each of Wilson's disease patients had different types of therapeutic drugs that effectively worked, and accordingly, there was a problem in that considerable difficulty was required in finding a suitable therapeutic drug for each patient.

The present invention was created to solve the above problems, and an object of the present invention is to prepare an in vitro (Vitro) Wilson disease model that can be used to develop a new drug for treating Wilson's disease based on human pluripotent stem cells. It is to provide the technology.

In addition, the object of the present invention is to build a drug screening (Screening) system through the manufactured in vitro (In Vitro) Wilson disease model, and based on this, it is easy to select a drug that most effectively treats the function of each Wilson disease patient In order to provide technology to enable.

In order to achieve the above object, the method according to the present invention comprises: A step of preparing a guide RNA having a nucleotide sequence of SEQ ID NO: 1; A step B of inserting a guide RNA prepared in step A into a Cas9 Nuclease expressable vector to prepare a vector for cloning CRISPR/Cas9 to include the guide RNA prepared in step A; Step C to prepare ssODNs (Single Stranded Oligodeoxynucleotides) having the nucleotide sequence of SEQ ID NO: 2; A step D of injecting the vector for CRISPR/Cas9 prepared in step B and the ssODNs prepared in step C into human starch-potential stem cells; E step of culturing the human predifferentiated stem cells injected with the CRISPR/Cas9 vector and ssODNs through the D step to obtain a single colony; And Wilson disease causal gene ATP7B modified to R778L mutant through specific genetic mutation by performing sequencing on each of the single colonies obtained through E step, so that the development of Wilson disease is possible It includes; F step for selecting a single colony with the induced human pluripotent stem cells.

Here, the method for manufacturing an in vitro Wilson disease model using the human pluripotent stem cells, including the R778L mutant-type Wilson disease causative gene ATP7B of a single colony selected through the step F, induced human disease to be induced to develop Wilson disease. G step of differentiating the stem cells to differentiate into hepatocytes; may further include.

In addition, in the step B, the Cas9 Nuclease-expressible vector into which the guide RNA prepared through the step A is inserted may be inserted with an antibiotic resistance selection marker gene.

In addition, step D, step D-1 to perform transfection so that the vector for CRISPR/Cas9 prepared through step B and the ssODNs prepared through step C are injected into human predifferentiated stem cells; And selecting a human starch-potential stem cell in which the CRISPR/Cas9 vector and ssODNs are normally injected by treating the human starch-potential stem cell transfected through the step D-1 with an antibiotic-resistant antibiotic. (Selection) step D-2; may include.

On the other hand, in order to achieve the above object, an in vitro Wilson disease model according to the present invention is prepared through a method for manufacturing an in vitro Wilson disease model using human progenitor stem cells described above.

According to the present invention has the following effects.

First, finally, as an in vitro Wilson disease model itself, it is possible to manufacture stem cells derived from human pluripotent stem cells induced to enable the development of Wilson disease.

Second, the manufactured in vitro Wilson disease models can be used for the development and research of new drugs for the treatment of Wilson disease, and furthermore, it can be used for functional evaluation of treatment efficacy along with existing drugs for treating Wilson disease.

Third, through screening of the manufactured in vitro Wilson disease models, it is possible to easily and accurately select the most functionally effective and optimized drugs for treating Wilson disease by performing screening of drugs for each patient of Walson disease.

1 is a conceptual diagram for explaining a method for manufacturing an in vitro Wilson disease model using human starch-potential stem cells of the present invention.

Figure 2 is a photograph comparing the morphological features of human starch-potential stem cells and normal human starch-potential stem cells induced to enable the development of Wilson's disease as an in vitro Wilson disease model prepared by the present invention.

3 is an in vitro Wilson's disease model prepared by the present invention, human differentiated stem cells, normal human pluripotent stem cells, and dedifferentiated human pluripotent stems derived from somatic cells of patients with Wilson's disease This diagram compares the results of gene analysis through sequencing of each cell.

Figure 4 is an in vitro Wilson disease model prepared by the present invention, after the differentiation of hepatocytes of each of human pluripotent stem cells and normal human pluripotent stem cells induced to enable the development of Wilson's disease, expression of ALB and HNF4a through transfection It is a graph comparing the results of verification of differentiation based on sheep.

5 is an in vitro Wilson's disease model prepared by the present invention, after the differentiation of hepatocytes of each of human pluripotent stem cells and normal human pluripotent stem cells induced to enable the development of Wilson's disease, relative expression of ALB, HNF4a, CYP3A4 It is a graph compared with.

6 is an in vitro Wilson disease model prepared by the present invention, after the differentiation of hepatocytes of each of human predifferentiated stem cells and normal human predifferentiated stem cells induced to enable Wilson disease, glycogen storage capacity through PAS staining results This is a comparison picture.

7 is an in vitro Wilson's disease model prepared by the present invention, after the differentiation of hepatocytes of each of human pluripotent stem cells and normal human pluripotent stem cells induced to enable the development of Wilson's disease, expression of CTR1 and ATP7B associated with copper metabolism Is a graph comparing

Figure 8 is an in vitro Wilson disease model prepared by the present invention, after comparing the stem cell differentiation of each of the human predifferentiated stem cells and normal human predifferentiated stem cells induced to enable the development of Wilson disease, the comparison of the accumulation of intracellular copper It is a graph.

9 is an in vitro Wilson's disease model prepared by the present invention, human differentiated stem cells, normal human pluripotent stem cells, and dedifferentiated human pluripotent stems derived from somatic cells of patients with Wilson's disease This is a picture comparing the cell-specific morphology according to each copper toxicity test after differentiation of each cell.

10 is an in vitro Wilson's disease model prepared by the present invention, human differentiated stem cells, normal human pluripotent stem cells induced to enable the development of Wilson disease, and dedifferentiated human pluripotent stems derived from somatic cells of patients with Wilson's disease It is a photograph comparing the cell viability according to each copper toxicity test after differentiation of each cell.

11 is an in vitro Wilson's disease model prepared by the present invention, human differentiated stem cells induced to enable the development of Wilson's disease, normal human pluripotent stem cells, and dedifferentiated human pluripotent stem derived from somatic cells of patients with Wilson's disease It is a graph comparing the results of evaluating the efficacy of the D-Penicillamine treatment drug after differentiation of each cell.

12 is an in vitro Wilson's disease model prepared by the present invention, which is induced to enable the development of Wilson's disease, human pluripotent stem cells, normal human pluripotent stem cells, and dedifferentiated human pluripotent stems derived from somatic cells of Wilson's disease patients. It is a graph comparing the results of evaluating the efficacy of Trientine treatment drug after differentiating each cell.

13 is an in vitro Wilson's disease model prepared by the present invention, human differentiated stem cells, normal human differentiated stem cells induced to enable the development of Wilson disease, and dedifferentiated human differentiated stems derived from somatic cells of patients with Wilson's disease It is a graph comparing the results of evaluating the efficacy of the BCS therapeutic drug after differentiating each cell from the liver.

With reference to the accompanying drawings, a preferred embodiment of the present invention will be described in more detail, but for the brevity of description, the already well-known technical parts will be omitted or compressed.

1. 인간 전분화능 줄기세포를 이용한 생체 외 윌슨병 모델 제조방법에 관한 설명1. Description of the method for manufacturing an in vitro Wilson disease model using human starch-potential stem cells

The process of manufacturing an in vitro Wilson disease model using a human starch-potential stem cell according to the present invention will be described in detail below.

(1) Guide RNA preparation step <Step A>

In this step (step A), a process of preparing a guide RNA having the nucleotide sequence of SEQ ID NO: 1 is performed.

Here, the guide RNA prepared as the nucleotide sequence of SEQ ID NO: 1 recognizes a specific sequence that is the target of the gene to be applied to the system in the CRISPR/Cas9-based gene scissor system described below. By specifically binding, it is possible to specify and fix the application position of the CRISPR/Cas9 based gene scissors system.

Specifically, the guide RNA of the present invention is designed as the base sequence of'CACCGCATTGCCCTGGGCCGGTGGC' as the base sequence of SEQ ID NO: 1.

The tester performing the manufacturing method of the present invention can be provided with the guide RNA by ordering it to a separate known website for the design of the guide RNA having the nucleotide sequence of SEQ ID NO: 1.

(2) Vector preparation step <Step B> for CRISPR/Cas9

This step (B) is for CRISPR/Cas9 cloned to include the guide RNA having the nucleotide sequence of SEQ ID NO: 1 by inserting the guide RNA prepared through the step (step A) previously performed into the Cas9 Nuclease expression vector. The process of preparing a vector takes place.

In addition, the vector for CRISPR/Cas9 is a state in which an antibiotic resistance selection marker gene is inserted.

Therefore, the vector (Vector) for CRISPR/Cas9 used in the method for manufacturing an in vitro Wilson disease model using the human progenitor stem cell of the present invention is inserted with a gene for expression of Cas9 Nuclease and an antibiotic resistance selection marker gene, and additionally The guide RNA having the nucleotide sequence of SEQ ID NO: 1 is inserted to complete cloning.

Here, the Cas9 Nuclease expressed through the vector for CRISPR/Cas9 plays a role of scissors cutting a specific position around a specific binding position by recognizing a specific sequence (Taget Sequence) by a guide RNA having the nucleotide sequence of SEQ ID NO: 1 Is done.

Specifically, the guide RNA having the nucleotide sequence of SEQ ID NO: 1 specifically binds to the underlined region of the nucleotide sequence of “GTT CATTGCCCTGGGCCG GT GGC TGG” included in Exon8 of the ATP7B gene, as shown in FIG. 1, The Cas9 Nuclease expressed through the vector for CRISPR/Cas9 cuts between the underlined and bold G and T of the guide RNA-coupled sequence.

In addition, the antibiotic resistance selection marker gene is used for cell selection in which normal transfection is performed after transfection to be performed later.

The Cas9 Nuclease-expressing vector is most preferably provided with a px459 vector (Addgene Plasmid #62988), and within the px459 vector, a gene for expression of Cas9 Nuclease, in addition to the antibiotic resistance selectable marker gene, Puromycin resistance gene (Resistant gene) ) Is inserted.

And to more specifically describe the cloning completion process of the CRISPR/Cas9 vector (Vector), first, prepare and anneal a guide RNA having the nucleotide sequence of SEQ ID NO: 1 in Oligo type, and express Cas9 Nuclease prepared with the px459 vector. Possible vectors are digested with BbsI restriction enzyme, and then annealed Oligo-type guide RNA is bound to the truncated position of the px459 vector to complete cloning.

(3) ssODNs preparation step <step C>

In this step (C), a process of preparing single stranded oligodeoxynucleotides (ssODNs) having the nucleotide sequence of SEQ ID NO: 2 is performed.

Here, ssODNs (Single Stranded Oligodeoxynucleotides) provided as the nucleotide sequence of SEQ ID NO: 2 are injected into human predifferentiated stem cells together with a vector for CRISPR/Cas9 to cause mutation of ATP7B, a gene that causes Wilson's disease through induction of specific gene mutation. .

Specifically, the ssODNs of the present invention is'GGAGCCCTGTGACATTCTTCGACACGCCCCCCATGCTCTTTGTGTTCATTGCCCTGGGCC T GTGGCTGGAACACTTGGCAAAGGTAACAGCAGCTTCAGGTTCAGAAAAGAGCTGCTCCTTCAGTAAACAAATCACCTACCTACCT of CTACAGCTAACT.

As described above, ssODNs of the present invention consist of 151 nucleotide sequences as shown in SEQ ID NO: 2, and form the same nucleotide sequence except for Exon8 and one part of the ATP7B gene.

Here, the site inducing a specific gene mutation by injecting into human pre-differentiation stem cells having different nucleotide sequences corresponds to the underlined portion in the nucleotide sequence of SEQ ID NO: 2 described above.

The tester performing the manufacturing method of the present invention can be provided with the corresponding ssODNs by ordering to a separate known website for the design of ssODNs having the nucleotide sequence of SEQ ID NO:2.

(4) Vector and ssODNs injection step for CRISPR/Cas9 in human progenitor stem cells <D step>

In this step (D), a process for injecting the vector for CRISPR/Cas9 prepared through the preceding step B and the ssODNs prepared through the preceding step C into human pluripotent stem cells is performed as shown in FIG. 1.

Specifically, this step (D) is a process for performing transfection so that CRISPR/Cas9 vectors and ssODNs are injected into human pluripotent stem cells (step D-1) and transfection is performed accordingly. The process of selecting a human starch-potential stem cell with normal injection of CRISPR/Cas9 vector and ssODNs (D-2) is sequentially performed by treating antibiotics with a selectable marker resistance to human starch-potential stem cells.

Here, the process of performing transfection (step D-1) so that the vector for CRISPR/Cas9 and ssODNs are injected into human pluripotent stem cells (step D-1) is performed using the Lipofectamine 3000 drug together with the vector for CRISPR/Cas9 and ssODNs. do.

Accordingly, a CRISPR/Cas9-based gene scissor system was constructed in human pluripotent stem cells in which normal injection of CRISPR/Cas9 vectors and ssODNs was made, and guide RNA specifically binds to a specific nucleotide sequence of Exon8 of the ATP7B gene. The location is guided and fixed, and the Cas9 Nuclease linked to the guide RNA performs the cleavage of the specific site described above.

Subsequently, in the human pluripotent stem cells, which are normally injected with the vector for CRISPR/Cas9 and ssODNs, the DNA repair process is performed on the cut site, and ssODNs adjacent to the cut site are bound to the cut site. Subsequently, the nucleotide sequence around the corresponding position is replaced, and HDR (Homology Dependent Repair) proceeds to replace a certain nucleotide sequence region in Exon8 of the ATP7B gene with ssODNs nucleotide sequence 2.

Next, whether the vector for CRISPR/Cas9 and ssODNs were normally injected into human predifferentiated stem cells through transfection, the selection marker previously inserted into the vector for CRISPR/Cas9 treated antibiotics with resistance. The selection method is applied.

Specifically, it is most preferable to apply the Puromycin selection method in consideration of the Puromycin resistance gene inserted as the antibiotic resistance selection marker gene in the px459 vector.

As a result, as a result, only human predifferentiated stem cells into which CRISPR/Cas9 vectors and ssODNs are normally injected are selected.

Therefore, the human predifferentiated stem cells in which the vector for CRISPR/Cas9 finally selected in this step (step D) and ssODNs were normally injected are shown in Figure 2, wherein the base sequence of Position 2333 in Exon8 of the ATP7B gene is G to T Converted to R778L mutation.

That is, the human predifferentiated stem cells in which the vector for CRISPR/Cas9 finally selected in this step (step D) and ssODNs were normally injected include the Wilson disease causative gene ATP7B modified with the R778L mutant type, so that the development of Wilson disease is possible. Corresponds to the human induced pluripotent stem cells.

(5) Stem cell culture step <E stage>

This step (E) is a process for obtaining a plurality of single colonies (Colony) by culturing human pluripotent stem cells injected with CRISPR/Cas9 vectors and ssODNs through the preceding step (step D).

First, in the process of culturing CRISPR/Cas9 vector and human ssODNs normally injected with ssODNs, a coating solution called Synthemax (Corning' Synthemax™ II-SC Substrate) was coated for 30 minutes at room temperature, followed by Synthemax. Is removed and the culture is performed using a culture medium exclusively for stem cells called Essential 8 (Gibco™ Essential 8™ Medium).

Here, the culture medium used is changed daily, and when the cells fill the culture dish by about 80%, passage is performed.

Specifically, in the method of passage, the culture solution was removed, and then washing was performed by treating with DPBS (HyClone Dulbecco's Phosphate Buffered Saline), and then diluting EDTA (Invitrogen™ UltraPure™ 0.5M EDTA, pH 8.0) with 0.5 mM and treating it with 5 Incubation is performed at 37 degrees for about 10 minutes.

Next, by the time the cells start to drop, remove the diluted EDTA and add fresh culture solution to recover the falling cells, and then the recovered stem cells are sown in a new culture dish at a ratio of 1:10 to 1:20. (seeding) and keep the same until the next pass.

Finally, to obtain multiple single colonies, cells that have fallen through the passage of the subculture are well recovered, and then cell density of the cell-suspended solution is measured through cell counting. .

In addition, seeding is performed by adjusting the amount of cells so that one cell can fit in one cell of a 96-well culture dish, and there may be one cell or two or three cells in a 96-well cell. There may be no, it is preferable to cultivate through the process of steadily growing by selecting 96 wells to which only one cell is attached by observing the cells the next day after seeding.

The process of obtaining a plurality of single colony cells by culturing human predifferentiated stem cells infused with CRISPR/Cas9 vector and ssODNs is not limited to the foregoing, and is related to the cultivation of human predifferentiated stem cells. It can be implemented in various ways within the known technical idea.

(6) Human progenitor stem cell selection step induced to enable the development of Wilson's disease <Step F>

This step (F) is performed by sequencing each of a plurality of single colonies obtained through the previous step (step E), and modified to R778L mutant (CGG -> CTG) through specific gene mutation. The process of selecting a single colony with human pluripotent stem cells induced to enable the development of Wilson's disease is made by including the Wilson disease causal gene ATP7B.

Here, the base sequence of the primer set used to track the presence or absence of modification to the R778L mutant through specific gene mutations used in the process of performing sequencing for each of the obtained single colonies It looks like this:

-Forward (F): GCAGCCTTCACTGTCCTTGT

-Reverse (R): ACAGTGCCTGTGCCACTAAA

When the screening process of the present step (F) is performed, the tester performing the manufacturing method of the present invention includes Wilson ATP7B, a genetic cause of Wilson's disease that has been modified into a R778L mutant type (CGG -> CTG) through specific genetic mutation. Only a single colony with human pluripotent stem cells induced to develop the disease is obtained.

(7) Liver cell differentiation step <G step>

This step (G) is a process of differentiating the human pluripotent stem cells induced to enable the development of Wilson's disease into hepatocytes, including the single colony R778L mutant Wilson disease causal gene ATP7B selected through the preceding step (F). This is done.

Accordingly, the human stem cells derived from human pluripotent stem cells derived from R778L mutant type Wilson disease causative gene ATP7B capable of developing Wilson disease do not have any functional damage as hepatocytes, but do not release copper smoothly, thus exhibiting toxicity.

As a result, human predifferentiated stem cell-derived stem cells induced to enable the development of Wilson disease, including the R778L mutant Wilson disease causative gene ATP7B, are an in vitro Wilson disease model and can be used for the development and research of new drugs for the treatment of Wilson disease, and more Furthermore, it can be used for functional evaluation of treatment efficacy along with existing drugs for treating Wilson's disease.

Furthermore, it is also possible to easily and accurately select each of the most functionally effective and optimized drugs for treating Wilson's disease by screening the drugs for each of the patients with Walson's disease through in vitro Wilson's disease models.

When the liver cell differentiation step is described in detail, it proceeds through three subdivided steps below, and the content is based on the patent content of the applicant's previously registered patent No. 10-1918817. However, the process of differentiating a human predifferentiated stem cell into hepatocytes is not limited to the following and can be implemented in various ways according to the implementation.

① Induction of differentiation of endoderm cells and embryonic frontal cells of differentiated stem cells before undifferentiation (step G-1):

In the method of inducing differentiation of human predifferentiated stem cells into hepatocytes, it is essential to acquire highly efficient endoderm cells as the first step in order to differentiate the pluripotent stem cells into hepatic progenitor cells and hepatocytes.

Accordingly, in the first step of differentiation, differentiation of human predifferentiated stem cells (hESCs) and dedifferentiated human predifferentiated stem cells (iPSCs) derived from somatic cells of Wilson disease patients was induced into endoderm cells and embryonic full length cells.

Specifically, after removing mTeSR1 medium, hESCs and iPSCs cultured for 2 days without supporting nutrient cells in a 100 mm culture dish were cultured for 1 day in RPMI medium containing 2 μM CHIR99021 and 100 ng/ml AA (activin A). Thereafter, the culture medium is induced to differentiate for another 2 days in RPMI medium containing 20 ng/ml BMP2 and 5 ng/ml bFGF.

② Induction of differentiation of endoderm cells into hepatoblasts and liver progenitor cells (step G-2):

Differentiation of endoderm cells into hepatoblasts and hepatic progenitor cells The endoderm cells obtained in the first step are cultured for an additional 8 days to induce differentiation into hepatocytes and hepatic progenitor cells.

Specifically, for differentiation of hepatocytes, differentiation-induced endoderm cells were cultured in RPMI medium containing 20 ng/ml BMP4 and B27 adjuvant for 2 days, followed by additional 2 days of 2 μM retinoic acid and B27 adjuvant. After induction of differentiation in the included DMEM medium, for differentiation into hepatic progenitor cells, additional differentiation is induced for 4 days in a medium containing 1 ng/ml bFGF, 100 μM Ascorbic acid, and 1 mM nicotinamide in DMEM medium. .

③ Final differentiation into hepatocytes (G-3 stage):

Differentiation is induced by adding 20ng/ml HGF to DMEM/F12 with ITS and B27 adjuvant for 4 days for final hepatocyte differentiation from liver progenitor cells differentiated in the second stage of differentiation.

Furthermore, after final differentiation, trypLE™ select is treated on differentiated hepatocytes to form a platform suitable for final new drug development and drug toxicity evaluation (experimental), single-celled and pre-coated with type 1 collagen in a 96-well culture vessel. After attaching with 1 X 10 ⁵ cells/well, 10ng/ml Oncostatin M and 10-6M Dexamethasone can be added to DMEM/F12 supplemented with ITS and B27 supplements for 6 days. .

In this way, the final differentiation induced hepatocytes can confirm the expression levels of hepatocyte specific markers ALB, HNF4a and CYP3A4 using flow cytometry, and also confirm the PAS staining results for hepatocellular function evaluation.

2. 인간 전분화능 줄기세포를 이용한 생체 외 윌슨병 모델 제조방법에 의해 제조된 생체 외 윌슨병 모델의 구리 독성 관련 물성 시험에 관한 설명2. Description of copper toxicity-related physical property test of the in vitro Wilson disease model prepared by the method for manufacturing an in vitro Wilson disease model using human progenitor stem cells

In relation to the in vitro Wilson disease model prepared by the in vitro Wilson disease model manufacturing method using the human starch-potential stem cells of the present invention, the method and method of deriving the method characteristics and the functional enhancement form through various experimental methods are described below. For the purpose of explanation, the following experimental methods were used for the purpose of defining properties, etc. by means obvious to those skilled in the art.

(1) Comparison of morphology and nucleotide sequence of normal human pluripotent stem cells and induced human pluripotent stem cells to enable the development of Wilson's disease

First, as shown in FIG. 2, as an in vitro Wilson's disease model prepared by the present invention, human induced pluripotent stem cells (Introduced in FIG. 2) induced to enable the development of Wilson's disease are normal human pluripotent stem cells (FIG. 2). Compared to WT).

However, as shown in FIG. 3, sequencing was performed for each of human progenitor stem cells (R778L-introduced hESCs in FIG. 3) and normal human progenitor stem cells (WT in FIG. 3) induced to develop Wilson disease. Looking at the results of the gene analysis through ), the nucleotide sequence that was'CGG' in the normal (WT in FIG. 3) of the ATP7B gene in Exon8 is an in vitro Wilson disease model produced by the present invention and is induced to enable the development of Wilson disease. It can be seen that the starch-potential stem cells (R778L-introduced hESCs in FIG. 3) were changed to'CTG'.

In addition, as shown in Figure 3 to look at the results of genetic analysis of sequencing (R778L Wilson iPSCs in Figure 3) dedifferentiated human predifferentiated stem cells (R778L Wilson iPSCs) derived from somatic cells of patients with Wilson disease Exon8 of the ATP7B gene It can be confirmed that my nucleotide sequence is the same as that of human starch-potential stem cells (R778L-introduced hESCs in FIG. 3) induced to develop Wilson disease.

As a result, the base sequence of Position 2333 in Exon8 of the ATP7B gene was'G' in normal (WT in FIG. 3), but it was the same as dedifferentiated human predifferentiated stem cells (R778L Wilson iPSCs in FIG. 3) derived from somatic cells of patients with Wilson's disease. Thus, in human predifferentiated stem cells (R778L-introduced hESCs in FIG. 3) induced to enable the development of Wilson's disease, it is converted to'T' to generate an R778L mutation.

Therefore, human predifferentiated stem cells normally injected with a vector for CRISPR/Cas9 and ssODNs can be used as an in vitro Wilson disease model when differentiated into hepatocytes, including the ATP7B, a Wilson disease causal gene modified with the R778L mutant type.

(2) As an in vitro Wilson disease model prepared by the present invention, a test for differentiation verification of stem cells derived from human predifferentiated stem cells induced to enable the development of Wilson disease

First, differentiation of each of the normal human pluripotent stem cells and human pluripotent stem cells induced to enable the development of Wilson's disease into hepatocytes was performed, followed by differentiation verification, and the progress is as shown in FIGS. 4 to 6. .

As shown in Fig. 4, both normal human predifferentiated stem cell-derived hepatocytes (WT in Fig. 4) and human predifferentiated stem cell-derived hepatocytes (R778L-introduced in Fig. 4) induced to develop Wilson's disease are hepatocyte specific. It can be seen that the genes ALB and HNF4a express more than 99%.

In addition, as shown in FIG. 5, hepatocyte specificity of normal human predifferentiated stem cell-derived hepatocytes (WT in FIG. 5) and human predifferentiated stem cell-derived hepatocytes (R778L-introduced in FIG. 5) induced to develop Wilson disease. When comparing the expression levels of the red markers ALB, HNF4a and CYP3A4, it can be seen that the level is similar.

In addition, as shown in FIG. 6, hepatocytes derived from normal human pluripotent stem cells (WT in FIG. 6) and human stem cells derived from human pluripotent stem cells (R778L-introduced in FIG. 6) induced to develop Wilson disease are major. When one of the functions, glycogen storage capacity is observed by PAS staining, both have normal glycogen storage capacity.

In other words, it can be seen that even in the case of stem cells derived from human pluripotent stem cells induced to enable the development of Wilson's disease, the functionality of hepatocytes is maintained at a high level and is not damaged.

(3) Copper metabolism analysis test of human starch-potential stem cell-derived hepatocytes induced to enable the development of Wilson disease as an in vitro Wilson disease model prepared by the present invention

First, the expression of CTR1 and ATP7B is well expressed in normal human pluripotent stem cell-derived stem cells (WT in FIG. 7) and human pluripotent stem cell-derived stem cells (R778L-introduced in FIG. 7) induced to develop Wilson disease. It was confirmed whether it was made, and the results shown in FIG. 7 were obtained.

Specifically, in relation to copper metabolism, normal human predifferentiated stem cell-derived stem cells (WT in FIG. 7) and Wilson's disease on expression of CTR1, a transporter that transports copper into hepatocytes, and expression of ATP7B, which transports copper out of hepatocytes, Comparing the induced human predifferentiated stem cell-derived stem cells (R778L-introduced in FIG. 7) to be possible, it can be seen that it is well performed as shown in FIG.

In addition, in Figure 7, d1, d6, d11 in the X axis refers to the maturation period after induction of differentiation of each hepatocyte, and the relative value of the Y axis is a result of comparative analysis with the Stem cell value set to 1.

Here, it can be confirmed that the expression intensity is similar to that of primary human hepatocytes (PHH).

Next, unlike normal human predifferentiated stem cell-derived hepatocytes (WT in FIG. 8), 6 days after differentiation of human induced pluripotent stem cell-derived hepatocytes (R778L-introduced in FIG. 8) induced to enable the development of Wilson disease At the point in time, copper treatment (X-axis) is performed in the order of 0 uM, 1 uM, 5 uM, and 10 uM.

The next day, the copper concentration in the cell is measured using a drug called copperGREEN (CopperGREEN™ ?? Goryo Chemical). Specifically, after the copper treatment, the culture medium is removed the next day, the culture medium containing copperGREEN 5uM is replaced, and after incubation for a period of time, (Ex 480nm / Em 510nm) was measured under fluorescence, and the Y-axis represents the fluorescence value obtained in each sample.

According to the test results of FIG. 8, unlike normal human predifferentiated stem cell-derived hepatocytes (WT in FIG. 8 ), human predifferentiated stem cell-derived hepatocytes (R778L-introduced in FIG. 8) derived from ATP7B It can be seen that a large amount of copper in the cell is not discharged smoothly due to the malfunction of.

(4) Copper toxicity test of stem cells derived from human pluripotent stem cells induced to enable the development of Wilson disease as an in vitro Wilson disease model prepared by the present invention

First, hepatocytes derived from normal human pluripotent stem cells (Normal in Fig. 9), human stem cells derived from human pluripotent stem cells (R778L-introduced in Fig. 9) induced to enable the development of Wilson disease, and reverses derived from somatic cells of Wilson's disease patients Differentiation of differentiated human progenitor stem cell-derived stem cells (Wilson iPSCs in FIG. 9) was treated with copper chloride (CuCl ₂ ) for 2 days on the 6th day of differentiation to confirm cell viability.

As a result, as shown in FIG. 9, normal human predifferentiated stem cell-derived hepatocytes (Normal in FIG. 9) show excellent morphology and high survival rate of hepatocytes even in a 50 µM copper toxic environment, but can develop Wilson's disease. The human induced pluripotent stem cell-derived hepatocytes (R778L-introduced in Fig. 9) and dedifferentiated human pluripotent stem cell-derived stem cells (Wilson iPSCs in Fig. 9) derived from somatic cells in Wilson's disease were identical in a copper toxic environment. It can be confirmed that the survival rate is deteriorated due to the large number of hepatocyte cell types.

Furthermore, hepatocytes derived from normal human pluripotent stem cells (WT in FIG. 10), human pluripotent stem cell derived stem cells (R778L-introduced in FIG. 10) induced to enable the development of Wilson's disease, and derived from somatic cells of Wilson's disease patients As a result of confirming the survival rate according to various concentration gradients of copper compounds of dedifferentiated human starch-potential stem cell-derived stem cells (Wilson iPSCs in FIG. 10) through CCK-8 analysis, human starch-potential stem cell-derived induced to develop Wilson disease Hepatocytes (R778L-introduced in FIG. 10) and dedifferentiated human predifferentiated stem cell-derived stem cells (Wilson iPSCs in FIG. 10) derived from somatic cells in Wilson's disease patients are normal human predifferentiated stem cell-derived hepatocytes (WT in FIG. 10). Compared to this, it was confirmed that when more cells were toxic, the survival rate was relatively low, suggesting the possibility of reproducing the copper toxicity phenomenon seen in Wilson's disease in vitro (see FIG. 10). -*p <0.05, **p <0.01)

(5) As an in vitro Wilson disease model prepared by the present invention, the efficacy of a therapeutic drug is tested using hepatocytes derived from human pluripotent stem cells induced to enable the development of Wilson disease

First, from normal human predifferentiated stem cell-derived hepatocytes (WT in FIGS. 11 to 13), human progenitor stem cell-derived hepatocytes induced to enable Wilson disease (FIGS. 11-13 R778L-introduced) and somatic cells from Wilson disease patients Derived dedifferentiated human predifferentiated stem cell-derived stem cells (FIGS. 11 to 13 Wilson iPSCs) based on DMEM/F12 (Hyclone SH30023) were added with ITS-X (Gibco™ Insulin-Transferrin-Selenium-X Supplement) The prepared drug was put into the prepared medium, and 20 μM of copper was added to create a copper toxic environment, and a therapeutic drug efficacy test was performed.

Next, three types of previously disclosed treatment drugs, D-Penicillamine, Trientine Hydrochloride, and BCS (Bathocuproinedisulfonic acid) are added to the test medium according to various concentrations (0uM, 0.8uM, 4uM, 20uM, 100uM), and copper Cells were cultured for two days with and drugs specified at the same time, and apoptosis was analyzed by CCK-8 analysis.

Accordingly, FIG. 11 shows normal human predifferentiated stem cell-derived stem cells (WT in FIG. 11) based on the CCK-8 analysis method when the therapeutic drug D-Penicillamine is applied according to various concentrations (0uM, 0.8uM, 4uM, 20uM, 100uM). ), human predifferentiated stem cell-derived hepatocytes (FIG. 11 R778L-introduced) induced to enable the development of Wilson's disease, and cells of dedifferentiated human predifferentiated stem cell-derived hepatocytes (FIG. 11 Wilson iPSCs) derived from Wilson disease patients. It is the result of calculating the mortality rate.

In addition, FIG. 12 shows normal human predifferentiated stem cell-derived stem cells (WT in FIG. 12) based on the CCK-8 analysis method when the therapeutic drug Trientine Hydrochloride is applied according to various concentrations (0uM, 0.8uM, 4uM, 20uM, 100uM). , Cell death of human predifferentiated stem cell-derived stem cells derived from Wilson disease (FIG. 12 R778L-introduced) and dedifferentiated human predifferentiated stem cell-derived stem cells derived from somatic cells of Wilson's disease (FIG. 12 Wilson iPSCs) This is the result of calculating the rate.

Finally, FIG. 13 shows normal human predifferentiated stem cell-derived hepatocytes based on CCK-8 analysis method when the therapeutic drug BCS (Bathocuproinedisulfonic acid) is applied according to various concentrations (0uM, 0.8uM, 4uM, 20uM, 100uM) WT), human predifferentiated stem cell-derived stem cells derived from Wilson disease (Fig. 13 R778L-introduced) and dedifferentiated human predifferentiated stem cell-derived stem cells derived from somatic cells of Wilson's disease (Fig. 13 Wilson iPSCs) It is the result of calculating the cell death rate of.

As a result, the effective therapeutic drug was found to be different depending on the type of cell line. In the case of stem cells derived from human predifferentiated stem cells (Figs. 11 to 13 R778L-introduced) induced to develop Wilson disease, treatment with the Trientine Hydrochloride drug The highest recovery effect was shown, and in the case of dedifferentiated human predifferentiated stem cell-derived stem cells (FIGS. 11 to 13 Wilson iPSCs) derived from somatic cells of patients with Wilson's disease, only the treatment of BCS drug showed a high recovery effect. (See FIGS. 11-13-*p <0.05, **p <0.01)

This means that each patient in the clinical trial has a different response to the treatment drug and an effective drug, and accordingly, it is necessary to select the most effective and optimized treatment drug for Wilson disease according to the genetic characteristics of the patient.

Therefore, the method for manufacturing an in vitro Wilson disease model using the human starch-potential stem cells of the present invention can be used for the development and research of new drugs for the treatment of Wilson disease, and furthermore, the functional evaluation of treatment efficacy with drugs for the treatment of Wilson's disease In addition to the use of Edo, the in vitro Wilson disease model itself, which is able to easily and accurately select the most functionally effective and optimized drugs for treating Wilson disease by performing drug screening for each patient with Walson disease As a result, hepatocytes derived from human starch-potential stem cells derived to enable the development of Wilson's disease can be prepared.

The embodiments disclosed in the present invention are not intended to limit the technical spirit of the present invention, but to explain, and the scope of the technical spirit of the present invention is not limited by these embodiments. The scope of protection should be interpreted by the claims below, and all technical spirits within the scope equivalent thereto should be interpreted as being included in the scope of the present invention.

Claims

Step A to prepare a guide RNA (Guide RNA) having the nucleotide sequence of SEQ ID NO: 1;

A step B of inserting a guide RNA prepared in step A into a Cas9 Nuclease expressable vector to prepare a vector for cloning CRISPR/Cas9 to include the guide RNA prepared in step A;

Step C to prepare ssODNs (Single Stranded Oligodeoxynucleotides) having the nucleotide sequence of SEQ ID NO: 2;

A step D of injecting the vector for CRISPR/Cas9 prepared in step B and the ssODNs prepared in step C into human starch-potential stem cells;

E step of culturing the human predifferentiated stem cells injected with the CRISPR/Cas9 vector and ssODNs through the D step to obtain a single colony; And

Sequencing was performed for each of a plurality of single colonies obtained through the E step to induce the development of Wilson's disease as possible by including the ATP7B of the Wilson disease causal gene modified into the R778L mutant through specific gene mutation. Characterized in that it comprises; F step for selecting a single colony with the humanized human pluripotent stem cells;

A method for manufacturing an in vitro Wilson disease model using human starch-potential stem cells.
According to claim 1,

The method for manufacturing an in vitro Wilson disease model using the human pluripotent stem cells,

Characterized in that it further comprises a step G of differentiating human pro-potential stem cells induced into the pathogenesis of Wilson's disease, including the R778L mutant type Wilson disease causative gene ATP7B of the single colony selected through the step F;

A method for manufacturing an in vitro Wilson disease model using human starch-potential stem cells.
The method of claim 1

In step B, the Cas9 Nuclease-expressible vector into which the guide RNA prepared through step A is inserted is characterized in that an antibiotic resistance selection marker gene is inserted.

A method for manufacturing an in vitro Wilson disease model using human starch-potential stem cells.
According to claim 3,

Step D,

Step D-1 to perform transfection so that the vector for CRISPR/Cas9 prepared in step B and the ssODNs prepared in step C are injected into human progenitor stem cells; And

Through the D-1 step, the human markers of human predifferentiated stem cells transfected are treated with antibiotics with a selectable marker resistant to the CRISPR/Cas9 vector and ssODNs for normal injection of human pluripotent stem cells. Selection) D-2 step; characterized in that it comprises a

A method for manufacturing an in vitro Wilson disease model using human starch-potential stem cells.
An in vitro Wilson disease model prepared by a method for manufacturing an in vitro Wilson disease model using the human progenitor stem cell of any one of claims 1 to 4.