WO2022150773A2 - Ribozyme-activated rna constructs and uses thereof - Google Patents

Ribozyme-activated rna constructs and uses thereof Download PDF

Info

Publication number
WO2022150773A2
WO2022150773A2 PCT/US2022/012004 US2022012004W WO2022150773A2 WO 2022150773 A2 WO2022150773 A2 WO 2022150773A2 US 2022012004 W US2022012004 W US 2022012004W WO 2022150773 A2 WO2022150773 A2 WO 2022150773A2
Authority
WO
WIPO (PCT)
Prior art keywords
rna
ribozyme
construct
sequence
polypeptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2022/012004
Other languages
English (en)
French (fr)
Other versions
WO2022150773A9 (en
WO2022150773A3 (en
Inventor
Prashant MALI
Andrew PORTELL
Amir DAILAMY
Aditya Kumar
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of California Berkeley
University of California San Diego UCSD
Original Assignee
University of California Berkeley
University of California San Diego UCSD
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of California Berkeley, University of California San Diego UCSD filed Critical University of California Berkeley
Priority to EP22737300.8A priority Critical patent/EP4247946A4/en
Priority to US18/271,832 priority patent/US20260115275A1/en
Priority to JP2023541690A priority patent/JP2024502620A/ja
Publication of WO2022150773A2 publication Critical patent/WO2022150773A2/en
Publication of WO2022150773A3 publication Critical patent/WO2022150773A3/en
Publication of WO2022150773A9 publication Critical patent/WO2022150773A9/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/12Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • C12N2310/128Type of nucleic acid catalytic nucleic acids, e.g. ribozymes processing or releasing ribozyme
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3519Fusion with another nucleic acid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16041Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/20011Coronaviridae
    • C12N2770/20034Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/36011Togaviridae
    • C12N2770/36111Alphavirus, e.g. Sindbis virus, VEE, EEE, WEE, Semliki
    • C12N2770/36141Use of virus, viral particle or viral elements as a vector
    • C12N2770/36143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/20Vector systems having a special element relevant for transcription transcription of more than one cistron

Definitions

  • the disclosure provides for ribozyme-mediated fusion constructs and systems and methods thereof, for use in a variety of applications, including for inducible gene expression systems, gene therapy, and combinatorial screening.
  • Ribozymes are RNA molecules that have the ability to catalyze specific biochemical reactions, including cRNA splicing in gene expression, similar to the action of protein enzymes. Ribozymes participate in a variety of RNA processing reactions, including RNA splicing, viral replication, and transfer RNA biosynthesis. Examples of ribozymes include the hammerhead ribozyme, the VS ribozyme, Leadzyme and the hairpin ribozyme. Ribozymes have been proposed and developed for the treatment of disease through gene therapy.
  • the disclosure provides for innovative engineering of endogenous RNA processing machinery to create linked RNA fusion constructs which can be utilized for RNA-based readouts for combinatorial genetic interaction screens as well as inducible gene expression.
  • separately transcribed sequences with complementarity to one another are fused to self cleaving ribozymes.
  • the auto-catalytic activity of the ribozymes cleaves the transcripts to create unique ends. Due to the complementary region, the two transcripts will then hybridize, juxtaposing the cleaved ends which can then be recognized by endogenous RNA ligases to create a linked fusion construct.
  • RNAi RNAi
  • ASO ADAR-recruiting guide RNAs
  • guide RNAs guide RNAs in CRISPR-Cas.
  • the disclosure provides a ribozyme activated RNA- construct(s) comprising one or more ribozymes; and one or more RNA coding sequences for at least one polypeptide of interest, wherein the transcription of the one or more RNA coding sequences for at least one polypeptide of interest is activated by or dependent upon the activity of the one or more ribozymes.
  • the ribozyme activated RNA-construct further comprises a first engineered RNA element comprising an optional primer region, an optional barcode region, an RNA coding sequence for a polypeptide of interest and a complementary sequence to a sequence of a second engineered RNA element, and a first self-cleaving ribozyme; a second engineered RNA element comprising an optional primer region, an optional barcode region, an RNA coding sequence for a polypeptide of interest and a complementary sequence to a sequence of the first engineered RNA element, and a second self-cleaving ribozyme; wherein cleavage of the first and second engineered RNA elements by the first and second self-cleaving ribozymes, respectively, provides for a hybridization construct that comprises a region of dsRNA from the commentary sequences being hybridized together, wherein the hybridization construct can be further ligated by an RNA ligase to form an RNA-fusion construct, and wherein expression from the RNA-
  • the first engineered RNA element comprises a barcode sequence or a unique molecular identity (UMI) sequence and/or wherein the second engineered RNA element comprises a barcode sequence or a UMI sequence.
  • the barcode sequence or the UMI sequence of the first engineered element has a different sequence than the barcode region or the UMI sequence from the second engineered RNA element.
  • the first engineered RNA element comprises a primer sequence, and/or wherein the second engineered RNA element comprises a primer sequence.
  • the primer sequence of the first engineered RNA element is different from the primer sequence from the second engineered RNA element.
  • the first and second complementary sequences are from 30 to 60 bp in length.
  • the first and second complementary sequence are from 40 to 50 bp in length.
  • the first and second ribozymes are Twister ribozymes.
  • the first ribozyme is a P3 Twister ribozyme.
  • the second ribozyme is a PI Twister ribozyme.
  • the RNA ligase is RtcB.
  • a vector or plasmid comprises the first engineered element, wherein the first engineered element is located downstream of a first RNA promoter and a first perturbation element; and/or wherein a vector or plasmid comprises the second engineered element, wherein the second engineered element is located downstream of a second RNA promoter and a second perturbation element.
  • the first RNA promoter and/or the second RNA promoter is a polymerase III promoter.
  • the polymerase III promoter is a hU6 promoter.
  • the first perturbation element and/or the second perturbation element is a sgRNA utilized in a CRISPR knockout screen.
  • a first engineered RNA element comprising an RNA coding sequence for a polypeptide of interest, an intron sequence, a complementary sequence to a sequence of a second engineered RNA element and a 3' aptamer, and a first self-cleaving ribozyme, and wherein the 3' aptamer interacts with a first self-cleaving ribozyme to stabilize it;
  • a second engineered RNA element comprising an RNA coding sequence for a polypeptide of interest, an intron sequence, a complementary sequence to a sequence of the first engineered RNA element, and a 3' aptamer, wherein the second engineered RNA template is tethered to a second self-cleaving ribozyme, and wherein the 3' aptamer interacts with a second self-cleaving ribozyme to stabilize it; wherein cleavage of the first and second engineered RNA elements by the first and second self-cleaving ribozymes,
  • the intron sequence is derived from dihydrofolate reductase.
  • the RNA coding sequences for a polypeptide of interest are adjacent to each of the intron sequences.
  • the RNA coding sequences for a polypeptide of interest encode a polypeptide/protein selected from insulin, clotting factor IX, the cystic fibrosis transmembrane conductance regulator protein, and the dystrophin protein.
  • the ribozyme activated RNA-construct(s) comprises one or more promoter sequences; one or more RNA coding sequences for at least one polypeptide of interest; one or more ribozymes, wherein the one or more ribozymes are aptazyme-based riboswitches; a 3' UTR sequence comprising the aptazyme-based riboswitches; and a poly(A) sequence; wherein the aptazyme-based riboswitches when not bound to target ligands destabilize the ribozyme activated RNA-construct(s) leading to decreased expression of the at least polypeptide of interest, and wherein the aptazyme- based riboswitches when bound to target ligands stabilize the ribozyme activated RNA-construct(s) leading to increased expression of the at least polypeptide of interest.
  • the aptazyme-based riboswitches are hammerhead aptazymes.
  • the target ligands are selected from tetracycline, theophylline, and guanine.
  • the at least one polypeptide of interest is selected from the group consisting of a prodrug activating enzyme, a biological response modifier, a receptor ligand, an immunoglobulin derived binding polypeptide, a non-immunoglobulin binding polypeptide, an antigenic polypeptide, a genome editing enzyme, and any combination thereof wherein multiple polypeptides are separated by a 2A or 2A-like peptide.
  • the biological response modifier or an immunopotentiating cytokine is selected from the group consisting of interleukins 1 through 38, interferon, tumor necrosis factor (TNF), and granulocyte-macrophage-colony stimulating factor (GM-CSF).
  • the 2A- or 2A-like peptide further comprises a GSG linker moiety.
  • the genome editing enzyme is selected from the group consisting of a zinc finger nuclease, a transcription activator-like effector nuclease (TALEN), an engineered meganuclease and an RNA-guided DNA endonuclease (Cas) polypeptide.
  • the one or more promoter sequences are polymerase II (pol-II) promoter sequences.
  • the one or more promoter sequences have a sequence(s) for EFloi, hU6, SV40, CMV, a RSV, NEUROD2 and/or TBX20.
  • the poly(A) sequence is a bGH poly(A) sequence.
  • the disclosure also provides a pharmaceutical composition
  • a pharmaceutical composition comprising the ribozyme activated RNA-construct(s) as described above, wherein the ribozyme activated RNA-construct(s) is linearized and comprises a 5' ribozyme; a 5' ligation sequence; an internal ribosome entry site (IRES) sequence; an RNA coding sequence for at least one polypeptide of interest; a 3' ligation sequence; and a 3' ribozyme sequence, and a pharmaceutically acceptable carrier.
  • the linear ribozyme activated RNA-construct(s) lacks a polymerase binding region.
  • the 5' and 3' ribozymes are selected from the group consisting of a twister ribozyme, a hammerhead ribozyme, a hatchet ribozyme, a hepatitis delta virus ribozyme, a ligase ribozyme, a pistol ribozyme, a twister sister ribozyme, a Vgl ribozyme, a VS ribozyme and derivatives of any of the foregoing.
  • the 5' and 3' ligation sequences are substrates of naturally occurring ligases in situ.
  • the naturally occurring ligase is RtcB.
  • the IRES comprises a sequence of any one of the sequences of SEQ ID NO:1-1328 and sequences thereof wherein T is U.
  • the at least one polypeptide of interest comprises two or more polypeptides of interest separated by a self-cleaving peptide.
  • the self-cleaving peptide comprises a 2A- or 2A- like-peptide.
  • the at least one polypeptide of interest is selected from the group consisting of a prodrug activating enzyme, a biological response modifier, a receptor ligand, an immunoglobulin derived binding polypeptide, a non immunoglobulin binding polypeptide, an antigenic polypeptide, a genome editing enzyme, and any combination thereof wherein multiple polypeptides are separated by a 2A or 2A-like peptide.
  • the biological response modifier or an immunopotentiating cytokine is selected from the group consisting of a prodrug activating enzyme, a biological response modifier, a receptor ligand, an immunoglobulin derived binding polypeptide, a non immunoglobulin binding polypeptide, an antigenic polypeptide, a genome editing enzyme, and any combination thereof wherein multiple polypeptides are separated by a 2A or 2A-like peptide.
  • the biological response modifier or an immunopotentiating cytokine is selected from the group consisting of a prodrug activating enzyme, a biological response modifier,
  • the immunopotentiating cytokine is selected from the group consisting of interleukins 1 through 38, interferon, tumor necrosis factor (TNF), and granulocyte-macrophage-colony stimulating factor (GM-CSF).
  • the 2A- or 2A-like peptide further comprises a GSG linker moiety.
  • the genome editing enzyme is selected from the group consisting of a zinc finger nuclease, a transcription activator-like effector nuclease (TALEN), an engineered meganuclease and an RNA-guided DNA endonuclease (Cas) polypeptide.
  • the 5' and 3' ribozyme sequences are independently selected from a sequence that is at least 85-100% identical to 5'-
  • the 5' and 3' ligation sequences are independently selected from a sequence that is at least 85-100% identical to 5'-AACCATGCCGACTGATGGCAG-3' (SEQ ID NO:1356) or 5'- CTGCCATCAGTCGGCGTGGACTGTAG-3 1 (SEQ ID NO:1357) and either of the foregoing wherein T is U.
  • the IRES sequence is at least 85-100% identical to 5'- gcggccgcgtcgacgggcccgcggaattccgcccccccctctcccccccctaacgttac tggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgt ctttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctcgccaaaggaatgcaaggtctgtgtgaatgtcgtgaatgtcgtgaaggaagcagttctctctggaaggaatgcaaggtctgtgtg
  • the disclosure also provides a vaccine composition
  • a vaccine composition comprising the ribozyme activated RNA-construct(s) of the disclosure, wherein the ribozyme activated RNA-construct(s) is linearized and comprises a 5' ribozyme; a 5' ligation sequence; an internal ribosome entry site (IRES) sequence; an RNA coding sequence for at least one antigenic polypeptide; a 3' ligation sequence; and a 3' ribozyme sequence, and a pharmaceutically acceptable carrier.
  • IRS internal ribosome entry site
  • the linearized ribozyme activated RNA- construct(s) lacks a polymerase binding region.
  • the 5' and 3' ribozyme is selected from the group consisting of a twister ribozyme, a hammerhead ribozyme, a hatchet ribozyme, a hepatitis delta virus ribozyme, a ligase ribozyme, a pistol ribozyme, a twister sister ribozyme, a Vgl ribozyme, a VS ribozyme and derivatives of any of the foregoing.
  • the 5' and 3' ligation sequences are substrates of naturally occurring ligases in situ.
  • the naturally occurring ligase is RtcB.
  • the IRES comprises any one of the sequences of SEQ ID NO:1-1328 and sequences thereof wherein T is U.
  • the at least one antigenic polypeptide comprises two or more antigenic polypeptides separated by a self-cleaving peptide.
  • the self-cleaving peptide comprises a 2A- or 2A-like-peptide.
  • the 2A- or 2A-like peptide further comprises a GSG linker moiety.
  • the 5' and 3' ribozyme sequences are independently selected from a sequence that is at least 85-100% identical to 5'-
  • AACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACGC-3' (SEQ ID NO:1355) and sequences of either of the foregoing wherein T is U.
  • the 5' and 3' ligation sequences are independently selected from a sequence that is at least 85-100% identical to 5'-AACCATGCCGACTGATGGCAG-3' (SEQ ID NO:1356) or 5'- CTGCCATCAGTCGGCGTGGACTGTAG-3 1 (SEQ ID NO:1357) and sequences of either of the foregoing wherein T is U.
  • the IRES sequence is at least 85-100% identical to 5'- gcggccgcgtcgacgggcccgcggaattccgcccccccctctcccccccctaacgttac tggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgt ctttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctcgccaaaggaatgcaaggtctgtgtgaatgtcgtgaatgtcgtgaaggaagcagttctctctggaaggaatgcaaggtctgtgtg
  • the antigenic polypeptide comprises a SARS-CoV-2 spike protein.
  • the at least one polypeptide of interest or antigenic polypeptide is contained within a self-amplifying RNA construct.
  • the self-amplifying RNA construct comprises an alphavirus or a Paramyxovirus.
  • the disclosure also provides a plasmid or capsid comprising the ribozyme activated RNA-construct(s) of the disclosure.
  • the plasmid or capsid is an AAV- based plasmid or capsid.
  • the plasmid expresses a Cas9 protein and a gRNA.
  • the disclosure also provides a combinatorial screen comprising the ribozyme activated RNA-construct(s) of any of the foregoing embodiments.
  • the disclosure provides a ribozyme-mediated RNA-fusion construct or system comprising: a first engineered RNA element comprising a primer region, a barcode region, and a complementary sequence to a sequence of a second engineered RNA element, wherein the first engineered RNA template is tethered to a first self-cleaving ribozyme; a second engineered RNA element comprising a primer region, a barcode region, and a complementary sequence to a sequence of the first engineered RNA element, wherein the second engineered RNA template is tethered to a second self cleaving ribozyme; wherein cleavage of the first and second engineered RNA elements by the first and second self-cleaving ribozymes, respectively, provides for a hybridization construct that comprises a region of dsRNA from the commentary sequences being hybridized together, and wherein the hybridization construct can be further ligated by an RNA ligase to form
  • the first engineered RNA element comprises a barcode region that has a different sequence than the barcode region from the second engineered RNA element.
  • the first engineered RNA element comprises a primer region that has a different sequence than the primer region from the second engineered RNA element.
  • the first and second complementary sequence are from 30 to 60 bp in length.
  • the first and second complementary sequence are from 40 to 50 bp in length.
  • the first and second ribozymes are Twister ribozymes.
  • the first ribozyme is a P3 Twister ribozyme.
  • the second ribozyme is a PI Twister ribozyme.
  • the RNA ligase is RtcB.
  • the disclosure also provides a vector or plasmid comprising a first engineered element of described herein, wherein the first engineered element is located downstream of a first RNA promoter and a first perturbation element.
  • the disclosure also provides a vector or plasmid, comprising the second engineered element described herein, wherein the second engineered element is located downstream of a second RNA promoter and a second perturbation element.
  • the first RNA promoter and/or the second RNA promoter is a polymerase III promoter.
  • the polymerase III promoter is hU6 promoters.
  • the first perturbation element and/or the second perturbation element is a sgRNA utilized in a CRISPR knockout screen.
  • the disclosure further provides for a combinatorial screen comprising the vector or plasmid described herein.
  • the disclosure provides an inducible ribozyme-mediated RNA-fusion construct or system comprising: a first engineered RNA element comprising an intron sequence, a complementary sequence to a sequence of a second engineered RNA element and a 3' aptamer, wherein the first engineered RNA template is tethered to a first self-cleaving ribozyme, and wherein the 3' aptamer interacts with a first self cleaving ribozyme to stabilize it; a second engineered RNA element comprising an intron sequence, a complementary sequence to a sequence of the first engineered RNA element, and a 3' aptamer, wherein the second engineered RNA template is tethered to a second self-cleaving ribozyme, and wherein the 3' aptamer interacts with a second self-cleaving ribozyme to stabilize it; wherein cleavage of the first and second engineered RNA elements by
  • the intron sequence is derived from dihydrofolate reductase.
  • portions of therapeutic genes or proteins are fused to each of the intron sequences.
  • the therapeutic genes or proteins are selected from the human insulin gene, clotting factor IX, the cystic fibrosis transmembrane conductance regulator protein, and the dystrophin protein.
  • Figure 1A-C provides the results from preliminary studies.
  • A Schematic illustrating the fusion of disparate barcodes at the RNA level.
  • B Gel electrophoresis image following RT-PCR of plasmid transfection of fragL and fragR either alone or in combination.
  • C Sanger sequencing trace of purified PCR product shown in panel B compared to the expected fusion (SEQ ID NO:1347).
  • Figure 2A-E provides (A) schematic illustrating the plasmid design for a combinatorial screen in which the ribozyme, complementary linker, barcode and primer of the ribozyme-mediated RNA-fusion construct are cloned downstream of a perturbation such as an sgRNA utilized in a CRISPR knockout screen. (B) Gel electrophoresis of an RT-PCR following plasmid transfection of HEK293T cells with the sgRNA_fragL and sgRNA_fragR constructs alone or in combination.
  • FIG. 3 provides a schematic illustrating the ribozyme- mediated RNA fusion approach for inducible gene expression.
  • a therapeutic payload is split between two constructs.
  • the fragL construct contains the N-terminus of the protein fused to an intronic sequence, a complementary region, a self-cleaving ribozyme, a complementary region, an intronic sequence, and the C-terminus of the therapeutic protein.
  • an aptamer-binding ligand Upon addition of an aptamer-binding ligand, the tertiary interactions between the aptamer and ribozyme are disrupted, allowing for autocatalytic cleavage of the transcript.
  • the complementary regions hybridize to one another and the generated ends are ligated together by the endogenous RNA- ligase, RtcB. With the intronic sequences juxtaposed to one another, the cellular splicing machinery can recognize the splice sites and create a full-length functional protein.
  • FIG. 4 presents a schematic of RNA fusion from PolII promoters.
  • Two constructs are cloned into the px600 AAV backbone which contains two halves of green fluorescent protein (GFP).
  • GFP green fluorescent protein
  • Each GFP is linked to a DHFR intron and contains the RNA fusion linker (45 bp complementary region) as well as either the P3 (GFP-L) or Pi (GFP-R) Twister Ribozyme.
  • the ribozymes undergo self-cleavage to generate 5' hydroxyl and 2',3'-cyclic phosphate ends.
  • the complementary linker regions will then hybridize, be ligated by RtcB, bringing the intronic sequences near one another.
  • the endogenous spliceosome machinery will then spice out the introns to generate a fluorescent GFP molecule.
  • Figure 5A-C presents (A) fluorescent images taken 48 hours after transfection of HEK293FT cells with the plasmids containing the RNA fusion machinery linked to one half of GFP (GFP- Left or GFP-Right) and an intronic sequences that are recognized by the spliceosome. (B) RNA was isolated from the HEK293FT cells shown in panel A and RT-PCR was performed using primers on both halves of the GFP transcript. (C) The PCR product was purified and Sanger sequenced (SEQ ID NO:1350) to confirm the proper ligation of the full-length protein.
  • Figure 6A-E presents (A) fluorescent images taken 48 hours after transfection of HEK293FT cells with the plasmids containing the RNA fusion machinery linked to one half of GFP (GFP- Left or GFP-Right) and different intronic sequences. (B) Flow cytometry was run on transfected cells after 48 hours and the percent of GFP+ cells was quantified. (C) RT-qPCR relative expression of GFP with the DHFR intron after 48 hours. (D) RT-qPCR relative expression of GFP with the pCI constructs after 48 hours. (E) The activation ratio was calculated from qPCR comparing the relative GFP expression levels when the complementary sequence was present.
  • Figure 7 provides the results of cells isolated 48 hours after transfection and analyzed via flow cytometry. Shown is the percentage of GFP + cells from the total cells present.
  • Figure 8A-B shows (A) schematic of a plasmid design for the ribozyme-mediated RNA barcode fusion constructs driven by the polymerase-II and polymerase-III-like Hi promoter; (B) Relative expression, as determined by quantitative RT-PCR (qRT-PCR) of the RNA fusion construct (normalized to GAPDH) for cells transfected with either a negative control (lentiCRISPRv2 plasmid backbone) or both the fragL and fragR constructs driven by a U6- or Hl-promoter.
  • Figure 9A-B provides (A) schematic illustrating the design for ribozyme-mediated circularized RNA barcodes.
  • the 3' end of the fragL construct is modified with a 'designer exon' and an intron, while the 5' end of the fragR construct is mediated with an intron followed by a "designer exon'.
  • the ribozymes will self-cleave, the complementary sequences will hybridize, which juxtaposes the designer exons and introns with one another.
  • Figure 11A-B shows (A) a schematic illustrating the plasmid design for the dual-promoter system in which the GFP-pCI-L construct is driven by the U6 promoter while the GFP-pCI-R construct is driven by the CMV promoter; and (B) Relative expression of the GFP RNA transcript as determined by qRT-PCT. The fold activation between the full length and the link free construct without the ribozyme and complementary sequence is show above the two graphs.
  • Figure 12A-C shows (A) a schematic illustrating the mechanism of inducible gene expression using a tetracycline- responsive hammerhead aptazyme embedded into the 3' UTR of the gene of interest (GOI); (B) Insulin ELISA absorbance values from cell culture supernatant collected 48 hours after transfection with DMEM(-) or tetracycline (+) added 4-6 hours after transfection; and (C) Insulin ELISA absorbance values form cell culture supernatant collected 48 hours after transfection. Increasing concentrations of tetracycline were added 4-6 hours after transfection.
  • Figure 13A-B shows (A) a schematic of the various ribozyme positions which have been assessed for their effect on gene expression induction; and (B) cell culture supernatant insulin ELISA levels for the plasmid design shows in panel (A) 48 hours after transfection in HEK293T cells.
  • Figure 14A-E shows (A) a schematic of the plasmid design for the ribozyme mediated inducible SaCas9 construct; (B) SaCas9 mRNA levels as measured by quantitative PCR 48 hours after transfection in HEK293T cells; (C) timeline of experiment performed to assess tetracycline-induced Cas9 mediated editing of the Pcsk9 gene.
  • Figure 15 schematically shows an in vitro transcribed RNA delivery system wherein a linear RNA construct is circularized in situ.
  • in vitro linear RNA is generated, the linear RNA is delivered into cells, and in situ it circularizes. In some embodiments, only in situ does it circularize.
  • Figure 16A-D provide (A) a general template for engineering circular RNA (SEQ ID NO:1329) wherein the payload is provided as GFP but can be any polypeptide of interest; (B) a schematic of the circularized RNA construct and resulting GFP expression comparing linear and circular constructs on Day 1, 2 and 3; (C) micrographs of fluorescent expression and expression; and (D) relative GFP RNA expression over time.
  • SEQ ID NO:1329 a general template for engineering circular RNA
  • the payload is provided as GFP but can be any polypeptide of interest
  • B a schematic of the circularized RNA construct and resulting GFP expression comparing linear and circular constructs on Day 1, 2 and 3
  • C micrographs of fluorescent expression and expression
  • D relative GFP RNA expression over time.
  • Figure 17A-C provides (A) schematic of a circular format containing exemplary payloads of CRISPR/ZF/TALEs/Genes; (B) a graph showing editing efficiency for linear vs. circular constructs containing Zinc Finger (ZF) protein; and (C) a graph showing editing efficiency for constructs containing Cas9 protein.
  • Figure 18 shows a design of a construct to generate in situ circularized RNA containing a self-amplifying RNA construct (SEQ ID NO:1330).
  • Figure 19 provides sequence of IRESs (Table 2) useful in the methods and compositions of the disclosure.
  • Figure 20 provides sequence of circular constructs useful in the methods and compositions of the disclosure (SEQ ID Nos: 1331- 1346).
  • alphavirus has its conventional meaning in the art, and includes the various species such as Venezuelan Equine Encephalitis (VEE) Virus, Eastern Equine Encephalitis (EEE) virus, Everglades Virus (EVE), Mucambo Virus (MUC), Pixuna Virus (PIX), and Western Equine Encephalitis Virus, all of which are members of the VEE/EEE Group of alphaviruses.
  • VEE Venezuelan Equine Encephalitis
  • EEE Eastern Equine Encephalitis
  • EVE Eastern Equine Encephalitis
  • MUC Mucambo Virus
  • PIX Pixuna Virus
  • Western Equine Encephalitis Virus all of which are members of the VEE/EEE Group of alphaviruses.
  • alphaviruses include, e.g., Semliki Forest Virus (SFV), Sindbis, Ross River Virus, Chikungunya Virus, S.A. AR86, Barmah Forest Virus, Middleburg Virus, O'nyong-nyong Virus, Getah Virus, Sagiyama Virus, Bebaru Virus, Mayaro Virus, Una Virus, Aura Virus, Whataroa Virus, Banbanki Virus, Kyzylagach Virus, Highlands J Virus, Fort Morgan Virus, Ndumu Virus, and Buggy Creek Virus.
  • Alphaviruses particularly useful in the constructs and methods described herein are VEE/EEE group alphaviruses.
  • alphavirus RNA replicon alphavirus RNA replicon
  • RNA "alphavirus RNA vector replicon”, “vector replicon RNA” and “self-replicating RNA construct” are used interchangeably to refer to an RNA molecule expressing nonstructural protein genes such that it can direct its own replication (amplification) and comprises, at a minimum, 5' and 3' alphavirus replication recognition sequences, coding sequences for alphavirus nonstructural proteins, and a polyadenylation tract. It may additionally contain one or more elements (e.g., IRES sequences, core or mini-promoters, 2A peptide sequence and the like) to direct the expression, meaning transcription and translation, of a coding sequence of interest.
  • the alphavirus replicon of the disclosure can comprise, in one embodiment, 5' and 3' alphavirus replication recognition sequences, coding sequences for alphavirus nonstructural proteins, a polyadenylation tract.
  • AAV adeno-associated virus
  • AAV adeno-associated virus
  • AAV refers to a member of the class of viruses associated with this name and belonging to the genus depend parvovirus, family Parvoviridae. Multiple serotypes of this virus can be suitable for gene delivery. In some cases, serotypes can infect cells from various tissue types. Examples of AAV serotypes are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVIO, and AAVll.
  • Non-limiting exemplary serotypes useful for the purposes disclosed herein include any of the 11 serotypes, e.g., AAV2 and AAV8.
  • nucleic acid molecule e.g., an engineered guide RNA
  • a nucleic acid molecule can generally refer to a nucleic acid molecule that can be represented as a polynucleotide sequence in a circular 2- dimensional format with one nucleotide after the other wherein the represented polynucleotide is circular or a closed loop.
  • a circular nucleic acid molecule does not comprise a 5' reducing hydroxyl, a 3' reducing hydroxyl, or both capable of being exposed to a solvent
  • a nucleic acid includes a nucleotide sequence described as having a "percent complementarity" or "percent homology" to a specified second nucleotide sequence.
  • a nucleotide sequence may have 80%, 90%, or 100% complementarity to a specified second nucleotide sequence, indicating that 8 of 10, 9 of 10 or 10 of 10 nucleotides of a sequence are complementary to the specified second nucleotide sequence.
  • encode as it is applied to polynucleotides can refer to a polynucleotide which is said to “encode” a polypeptide if, in its native state or when manipulated, it can be transcribed and/or translated to produce the mRNA for the polypeptide and/or a fragment thereof.
  • the antisense strand is the complement of such a nucleic acid, and the encoding sequence can be deduced therefrom.
  • the terms “equivalent” or “biological equivalent” are used interchangeably when referring to a particular molecule, biological or cellular material having minimal homology while still maintaining desired structure or functionality.
  • expression can refer to the process by which polynucleotides are transcribed into mRNA and/or the process by which the transcribed mRNA is subsequently being translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression can include splicing of the mRNA in a eukaryotic cell.
  • Homology or “identity” or “similarity” can refer to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which can be aligned for purposes of comparison. For example, when a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated” or “non-homologous " sequence shares less than 40% identity, or alternatively less than 25% identity, with one of the sequences of the disclosure.
  • Homology can refer to a percent (%) identity of a sequence to a reference sequence. As a practical matter, whether any particular sequence can be at least 50%, 60%, 70%, 80%, 85%,
  • any sequence described herein such particular peptide, polypeptide or nucleic acid sequence can be determined conventionally using computer programs such the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711).
  • Bestfit program Wiconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711.
  • Bestfit or any other sequence alignment program can be set such that the percentage of identity is calculated over the full length of the reference sequence and that gaps in homology of up to 5% of the total reference sequence are allowed.
  • the identity between a reference sequence (query sequence, a sequence of the disclosure) and a subject sequence can be determined using the FASTDB computer program.
  • the percent identity can be corrected by calculating the number of residues of the query sequence that are lateral to the N- and C-terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence.
  • a determination of whether a residue is matched/aligned can be determined by results of the FASTDB sequence alignment. This percentage can be then subtracted from the percent identity, calculated by the FASTDB program using the specified parameters, to arrive at a final percent identity score. This final percent identity score can be used for the purposes of this embodiment. In some cases, only residues to the N- and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manually adjusting the percent identity score. That is, only query residue positions outside the farthest N- and C-terminal residues of the subject sequence are considered for this manual correction. For example, a 90 residue subject sequence can be aligned with a 100 residue query sequence to determine percent identity.
  • the deletion occurs at the N-terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residues at the N- terminus.
  • the 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C-termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity can be 90%.
  • a 90 residue subject sequence is compared with a 100 residue query sequence. This time the deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query.
  • Hybridization can refer to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues.
  • the hydrogen bonding can occur by Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific manner.
  • the complex can comprise two strands forming a duplex structure, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination of these.
  • a hybridization reaction can constitute a step in a more extensive process, such as the initiation of a PC reaction, or the enzymatic cleavage of a polynucleotide by a ribozyme.
  • Examples of stringent hybridization conditions include: incubation temperatures of about 25°C to about 37°C; hybridization buffer concentrations of about 6x SSC to about lOx SSC; formamide concentrations of about 0% to about 25%; and wash solutions from about 4x SSC to about 8x SSC.
  • Examples of moderate hybridization conditions include: incubation temperatures of about 40°C to about 50°C; buffer concentrations of about 9x SSC to about 2x SSC; formamide concentrations of about 30% to about 50%; and wash solutions of about 5x SSC to about 2x SSC.
  • high stringency conditions include: incubation temperatures of about 55°C to about 68°C; buffer concentrations of about lx SSC to about 0.lx SSC; formamide concentrations of about 55% to about 75%; and wash solutions of about lx SSC, 0.lx SSC, or deionized water.
  • hybridization incubation times are from 5 minutes to 24 hours, with 1, 2, or more washing steps, and wash incubation times are about 1, 2, or 15 minutes.
  • SSC is 0.15 M NaCl and 15 mM citrate buffer. It is understood that equivalents of SSC using other buffer systems can be employed.
  • isolated can refer to molecules or biologicals or cellular materials being substantially free from other materials.
  • the term “isolated” can refer to nucleic acid, such as DNA or RNA, or protein or polypeptide (e.g., an antibody or derivative thereof), or cell or cellular organelle, or tissue or organ, separated from other DNAs or RNAs, or proteins or polypeptides, or cells or cellular organelles, or tissues or organs, respectively, that are present in the natural source.
  • isolated also can refer to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized.
  • an "isolated nucleic acid” is meant to include nucleic acid fragments which are not naturally occurring as fragments and may not be found in the natural state.
  • the term “isolated” is also used herein to refer to polypeptides which are isolated from other cellular proteins and is meant to encompass both purified and recombinant polypeptides.
  • the term “isolated” is also used herein to refer to cells or tissues that are isolated from other cells or tissues and is meant to encompass both cultured and engineered cells, or tissues.
  • a "ligation sequence” refers to a sequence complementary to another sequence, which enables the formation of Watson-Crick base pairing to form suitable substrates for ligation by a ligase, e.g., an RNA ligase.
  • a 5' ligation sequence and a 3' ligation sequence are substrates for an RNA ligase such as, but not limited to RtcB.
  • the 5' and 3' ligation sequences when ligated circularize an RNA molecule of the disclosure. Such circularization reduces RNA degradation and improves persistence in vivo.
  • operably linked refers to an arrangement of elements where the components so described are configured so as to perform their usual function.
  • control sequences operably linked to a coding sequence are capable of effecting the transcription, and in some cases, the translation, of a coding sequence.
  • the control sequences need not be contiguous with the coding sequence so long as they function to direct the expression of the coding sequence.
  • polynucleotide and “oligonucleotide” are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides or analogs or combinations thereof. Polynucleotides can have any three- dimensional structure and can perform any function.
  • polynucleotides a gene or gene fragment (for example, a probe, primer, EST or SAGE tag), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, RNAi, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers.
  • a polynucleotide can comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs.
  • modifications to the nucleotide structure can be imparted before or after assembly of the polynucleotide.
  • the sequence of nucleotides can be interrupted by non-nucleotide components.
  • a polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component.
  • the term also can refer to both double and single stranded molecules. Unless otherwise specified or required, any embodiment of this disclosure that is a polynucleotide can encompass both the double stranded form and each of two complementary single stranded forms known or predicted to make up the double stranded form.
  • a polynucleotide can include both RNA and DNA nucleotides.
  • polynucleotide sequence can be the alphabetical representation of a polynucleotide molecule. This alphabetical representation can be input into databases in a computer having a central processing unit and used for bioinformatics applications such as functional genomics and homology searching. In any alphabetic representation, the disclosure contemplates both RNA and DNA (wherein “T” is replaced with “U” or vice-a-versa).
  • promoter may be used to drive transcription of an operably linked nucleic acid.
  • promoter refers to a DNA sequence which contains the binding site for RNA polymerase and initiates transcription of a downstream nucleic acid sequence.
  • a promoter for use in the disclosure can be a constitutive, inducible or tissue specific, or a temporal promoter. Suitable promoters can be derived from viruses, prokaryotes and eukaryotes. Suitable promoters can be used to drive expression by any RNA polymerase.
  • inducible promoters include, but are not limited to, T7 RNA polymerase promoter, T3 RNA polymerase promoter, isopropyl-beta-D-thiogalactopyranoside (IPTG)-regulated promoter, lactose induced promoter, heat shock promoter, tetracycline-regulated promoter, steroid-regulated promoter, metal- regulated promoter, estrogen receptor-regulated promoter, and the like.
  • Inducible promoters can be regulated by various molecules such as doxycycline.
  • the promoter is a prokaryotic promoter selected from the group consisting of T7, T3, SP6 and derivatives thereof.
  • a "ribozyme” (ribonucleic acid enzyme) is an RNA molecule capable of catalyzing biochemical reactions.
  • a "self-cleaving ribozyme” is a ribozyme capable of cleaving itself.
  • the ribozyme used in the disclosure can be any small endonucleolytic ribozyme that will self-cleave in the target cell type including, for example, hammerhead, hairpin, the hepatitis delta virus, the Varkud satellite, twister, twister sister, pistol and hatchet. See, e.g., Roth et al., Nat Chem Biol. 10(1):56—60; and Weinberg et al., Nat Chem Biol.
  • U.S. 2015/0056174 provides modified hammerhead ribozymes with enhanced endonucleolytic activity. Ribozymes cleave the substrate RNA in a sequence specific manner at a substrate cleavage site. Typically, a ribozyme contains a catalytic region flanked by two binding regions. The ribozyme binding regions hybridize to the substrate RNA, while the catalytic region cleaves the substrate RNA at a substrate cleavage site to yield a cleaved RNA product.
  • the 5' or 3' of various constructs can be a Twister ribozyme or a Twister Sister ribozyme.
  • the 5' and 3' ribozymes of various constructs are either a P3 or Pi Twister ribozyme but not both P3 or both Pi.
  • transfection are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection (e.g., using commercially available reagents such as, for example, LIPOFECTIN® (Invitrogen Corp., San Diego, CA), LIPOFECTAMINE® (Invitrogen), FUGENE® (Roche Applied Science, Basel, Switzerland), JETPEITM (Polyplus-transfection Inc., New York, NY), EFFECTENE® (Qiagen, Valencia, CA), DREAMFECTTM (OZ Biosciences, France) and the like), or electroporation.
  • LIPOFECTIN® Invitrogen Corp., San Diego, CA
  • LIPOFECTAMINE® Invitrogen
  • FUGENE® Roche Applied Science, Basel, Switzerland
  • JETPEITM Polyplus-transfection Inc., New
  • Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989), and other laboratory manuals. Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described in Sambrook, J., Fritsch, E.F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, 2 nd ed.; Cold Spring Harbor Laboratory: Cold Spring Harbor, N.Y., (1989) and by Silhavy, T.J., Bennan, M.L.
  • treat refers to ameliorating symptoms associated with a disease or disorder. Also, the terms “treat”, “treating” and “treatment” include preventing or delaying the onset of the disease or disorder symptoms, and/or lessening the severity or frequency of symptoms of the disease or disorder.
  • vector can refer to a nucleic acid construct deigned for transfer between different hosts, including but not limited to a plasmid, a virus, a cosmid, a phage, a bacterial artificial chromosome (BAC), a yeast artificial chromosome (YAC), etc.
  • a "viral vector” is defined as a recombinantly produced virus or viral particle that comprises a polynucleotide to be delivered into a host cell, either in vivo, ex vivo or in vitro.
  • plasmid vectors can be prepared from commercially available vectors.
  • viral vectors can be produced from baculoviruses, retroviruses, adenoviruses, AAVs.
  • the viral vector is a lentiviral vector.
  • examples of viral vectors include retroviral vectors, adenovirus vectors, adeno-associated virus vectors, alphavirus vectors and the like.
  • Infectious tobacco mosaic virus (TMV)-based vectors can be used to manufacturer proteins and have been reported to express Griffithsin in tobacco leaves.
  • Alphavirus vectors such as Semliki Forest virus-based vectors and Sindbis virus-based vectors, have also been developed for use in gene therapy and immunotherapy.
  • a vector construct can refer to the polynucleotide comprising the retroviral genome or part thereof, and a gene of interest.
  • the disclosure describes implementations of engineered endogenous RNA processing machinery to create linked RNA fusion constructs which can be utilized for RNA-based readouts for combinatorial genetic interaction screens as well as inducible gene expression.
  • RNA-based readouts for combinatorial genetic interaction screens as well as inducible gene expression.
  • ribozymes Separately transcribed sequences, with complementarity to one another, are fused to self-cleaving ribozymes. Once transcribed, the auto-catalytic activity of the ribozymes cleaves the transcripts to create unique ends. Due to the complementary region, the two transcripts will then hybridize, juxtaposing the cleaved ends which can then be recognized by endogenous RNA ligases to create a linked fusion construct.
  • the disclosure further demonstrates the applicability of this approach to link two transcripts delivered to cells on disparate library elements, and when linked to intronic sequences, the RNA-fusion constructs can be utilized for controllable expression of full-length gene products.
  • the disclosure describes the use of engineered RNA elements that undergo multiple endogenous processing events to create linked RNA fusion constructs that can be used for a variety of applications, including combinatorial genetic screens or inducible gene expression. These elements, termed the left fragment (fragL) and right fragment (fragR), have been engineered to be expressed from both polymerase II and polymerase III promoters.
  • the RNA elements can further comprise flanking amplification primers, and/or a variable barcode region.
  • the RNA elements comprise a 45-base pair (bp) complementary region to one another and are tethered to the P3 and PI self-cleaving Twister ribozymes, as illustrated in FIG. 1A.
  • the P3 Twister ribozyme Upon transcription, the P3 Twister ribozyme self-cleaves and generates a 5' hydroxyl group on the fragL construct while the PI Twister ribozyme generates a 2',3' -cyclic phosphate group on the 3' end of the fragR construct. Due to the complementary regions of the fragments, the two transcripts will then hybridize, juxtaposing these two ends which enables recognition by the endogenous ligase, RtcB, creating a linked fusion construct.
  • fusion constructs are completely tunable, allowing for additional classes of ribozymes or transfer RNAs to be used in combination with different ligases and RNA processing enzymes to create higher order fusion linkages.
  • a major limitation with prior implementation of genetic interaction screens is the need to physically link multiple perturbations on the same library element in order to enable genotype to phenotype mapping. This can make library generation complex and prevents different classes of genome and transcriptome engineering toolsets from being readily combined.
  • RNA-fusion constructs to enable genotype to phenotype linking at the RNA level so that multiple libraries (e.g. CRISPR-knockout, CRISPR activation/inhibition, open reading frame, shRNA, etc.) can be delivered to cells individually, but read out together.
  • libraries e.g. CRISPR-knockout, CRISPR activation/inhibition, open reading frame, shRNA, etc.
  • This approach is demonstrated by cloning the ribozyme-RNA fusion constructs downstream of the U6-driven sgRNA sequence in the lentiCRISPRv2 backbone (termed sgRNA fragL and sgRNA fragR) (FIG.
  • RNA-fusion constructs As shown in FIG. 2B, the presence of a non-targeting sgRNA transcript in the 5' position of the RNA-fusion constructs does not alter the RNA-processing machinery that create the ligated fusion. Furthermore, the EcoRI restriction site on the sgRNA fragR construct shown in FIG. 2C highlights the ability to identify a theoretical barcode placed in this location for perturbation mapping using RNA- sequencing.
  • the ribozyme-mediated RNA-fusion constructs of the disclosure allow for genotype to phenotype linking at the RNA level so that multiple libraries (e.g., CRISPR-knockout, CRISPR activation/inhibition, open reading frame, shRNA, etc.) can be delivered to cells individually, but read out together.
  • libraries e.g., CRISPR-knockout, CRISPR activation/inhibition, open reading frame, shRNA, etc.
  • genetic interactions screens can be highly multiplexed. This approach allows for the linking of disparate libraries such as CRISPR-knockout sgRNA libraries and open reading frame overexpression libraries.
  • RNA fusion constructs disclosed herein by using screens looking at the combined activation and inhibition of genes, through systems such as CRISPRactivation and CRISPRinhibition, in a cell.
  • a screening strategy with RNA fusions is not limited to fitness measurements and can be coupled to screens using other readouts such as phenotype, protein expression, or other functional endpoints that are broadly applicable across the biological sciences.
  • RNA fusion constructs of the disclosure can be used in inducible gene expression systems.
  • Inducible gene expression systems are powerful tools for a broad variety of basic and applied research areas, including functional genomics, tissue engineering, biopharmaceutical protein production, and gene therapy.
  • the most common of these systems such as tetracycline-controlled operons, protein-protein interaction chimeric systems, and tamoxifen- controlled recombinase systems all require the addition of exogenous proteins. This can lead to immunogenic reactions in vivo and the delivery and transfection of these large-sized plasmids can be burdensome.
  • the ribozyme-mediated RNA-fusion approach with intronic sequences described herein has broad utility. Through the addition of an aptazyme on either fragment that is responsive to molecules, such as tetracyline, theophylline, or guanine, the system of the disclosure can enable robust control of gene expression (see FIG.
  • RNA fusion constructs of the disclosure have great utility in gene therapy space to treat widespread diseases. In both type 1 and type 2 diabetes, insulin production is limited and therefore patients commonly must exogenously administer insulin when their blood glucose levels rise.
  • the inducible ribozyme-mediated RNA-fusion system described herein can be adapted to contain two halves of the insulin gene fused to intronic sequences. The two constructs are constitutively present in muscular tissue, but one half would only be transcribed upon additional of an aptamer-binding ligand such as a synthetic sugar. This would lead to the rapid upregulation of ribozyme-mediated hybridization and splicing to generate the full length, functional insulin protein. Upon degradation of the inducer, the one fusion fragment would become repressed and no more insulin would be produced until more of the ligand is administered, thus replacing the need for painful and burdensome exogenous administration of insulin with an endogenous system with precise temporal control.
  • the inducible ribozyme-mediated RNA-fusion system described herein can be applied to generate an inducible gene expression system for the clotting factor IX for patients with hemophilia, the cystic fibrosis transmembrane conductance regulator protein for patients with cystic fibrosis, and the dystrophin protein for patients with Duchenne's muscular dystrophy.
  • any disease that results from a poorly expressed or mutated protein could benefit from the inducible ribozyme-mediated RNA-fusion system disclosed herein. This includes, but is not limited to, disease such as b-thalassemia, severe combined immunodeficiency, spinal muscle atrophy, and age-related macular degeneration.
  • the inducible ribozyme-mediated RNA-fusion system described herein can be broadly applied to gene therapies using the CRISPR/Cas toolset.
  • CRISPR/Cas genome editing is highly adaptable and has been engineered to investigate and treat genetic diseases, cancers, immunological diseases, and infectious diseases.
  • a major limitation in the translation of these therapies is the inability to control the expression of the Cas protein in vivo.
  • the inducible ribozyme-mediated RNA-fusion system described herein can overcome this limitation by fusing two portions of the Cas protein to intronic sequences in the fragL and fragR constructs. One of these would be under the control of an inducer as described herein, making the expression of the Cas protein and its subsequent function completely inducible.
  • experiments can be performed utilizing this system (see, e.g., FIG. 12A) to control the expression of the Yamanaka factors, including Oct3/4, Sox2, Klf4, and c-Myc (OSKM), in vivo.
  • OSK and c-Myc can be cloned into an AAV expression vector with the aptazyme of choice subsequently cloned into the 3' UTR.
  • the Oct3/4, Sox2, and Klf4 can be cloned into a polycistronic vector and separated by the self-cleaving 2A peptides.
  • c-Myc a known oncogene, can be cloned into another plasmid with its own aptazyme control element. These plasmids can then be packaged into AAV vectors and then delivered either separately or together based on the reprogramming application at hand.
  • the ribozyme As the ribozyme rapidly cleaves the 3'- poly(A) tail upon transcription, the background expression of OSKM will be low and transduction via iAAV will not alter cellular state at baseline expression. Upon delivery of the ligand specific for the aptamer, the ribozyme will stabilize and the transduced cells will exhibit higher expression levels of OSKM based on the dose of the ligand that was delivered. With the rapid turnove kinetics of mRNA transcripts, the stabilization of the ribozyme and resulting gene expression levels are directly dependent on the half-life of the ligand delivered and the administration regimen that was chosen, thus enabling dynamic, pulsatile, and transient control of OSKM expression. As these transcription factors have been thoroughly studied to induce a state of pluripotency based upon their expression levels. This system can be utilized to dynamically reprogram cells in vivo.
  • reprogramming factors which have been implicated in directing cellular phenotype via their overexpression. Like OSKM, these factors require temporal control to effectively, and safely exhibit their effect on cell state. Therefore, the ribozyme-mediated control system can be used to dynamically control the expression of a broad range of genes in vivo which have an ability to reprogram cellular identity. These genes which the system could be applied to are included, but not limited to, those genes listed in Table 1.
  • This system is further tunable as the AAV serotype used can be altered without having to alter the expression plasmid.
  • Various serotypes can be used which specifically target tissues such as AAV8 for the liver, AAV9 for skeletal muscle, or AAV-PHP.B for the central nervous system.
  • engineered recombinant AAVs which specifically target distinct cell types can also be utilized in addition to the broad range of serotypes already available to further enhance the specificity of the partial reprogramming system.
  • Table 1 [0081] Utilizing the system described herein for the in vivo control of reprogramming factors, the system can be harnessed for a broad range of applications.
  • the ligand that is specific for the aptamer sequence could be administered at the desired dose and treatment regimen in order to achieve cyclic expression of OSKM.
  • the physiological alterations induced by this approach could include a reduction in the DNA damage response associated with aging, downregulation of senescence and stress-related genes, and alterations to the epigenetic modifications that occur with aging. These molecular alterations at the cellular level have important implications for reducing the systematic aging issues.
  • this strategy can be an important therapeutic option to systematically reduce physiological hallmarks of aging while also prolonging the lifespan of those affected.
  • the system of the disclosure can demonstrate an important therapeutic benefit as engineering of the AAV capsid can be utilized for cell-specific targeting of the inducible-reprogramming strategy.
  • transient expression of OSK could be utilized to restore youthful DNA methylation patterns and transcriptomes in the retinal ganglion cells in order to promote axonal regeneration after injury and promote vision restoration for the aging population or those afflicted with visual impairments such as glaucoma.
  • targeting the system of the disclosure to specific brain regions e.g., hippocampus
  • TFs reprogramming transcription factors
  • Table 1 reprogramming transcription factors
  • TFs could be delivered either individually or in combination with either matching aptazyme sequences or separate aptazymes to enable temporal control of gene expression.
  • engineered TFs can be applied to the healthy and diseased settings with even broader implications for the whole field of regenerative medicine.
  • the iAAV-partial reprogramming approach of the disclosure has broad applications across a diverse array of organ systems and disease settings.
  • RNA is inherently transient and this transience impacts their activity both as an interacting moiety as well as a template. Circularization of RNA improve persistence, however simple and scalable approaches to achieve the same are lacking.
  • icRNAs in situ circularized RNAs
  • RNA ligases e.g., the ubiquitous endogenous RNA ligase RtcB
  • FIG. 15 This scalable icRNA system has broad utility in basic science and therapeutic applications.
  • the icRNA system is exemplified herein in three contexts: first, durable protein expression via this system using GFP as a test protein (FIG. 16A-D); second, improved genome targeting via zinc finger nucleases; and third, genome targeting via CRISPRs, including deimmunized Cas9 proteins (FIG. 17A-C).
  • compositions herein can be used to treat a disease or condition in a subject.
  • a ribozyme-activated RNA construct of the disclosure can be administered to treat a disease described herein.
  • a pharmaceutical composition can comprise a first active ingredient.
  • the first active ingredient can comprise a ribozyme- activated RNA construct of the disclosure.
  • the pharmaceutical composition can be formulated in unit dose form.
  • the pharmaceutical composition can comprise a pharmaceutically acceptable excipient, diluent, or carrier.
  • the pharmaceutical composition can comprise a second, third, or fourth active ingredient.
  • an excipient can compromise an excipient.
  • an excipient can comprise a pharmaceutically acceptable excipient.
  • An excipient can comprise a cryo-preservative, such as DMSO, glycerol, polyvinylpyrrolidone (PVP), or any combination thereof.
  • An excipient can comprise a cryo- preservative, such as a sucrose, a trehalose, a starch, a salt of any of these, a derivative of any of these, or any combination thereof.
  • An excipient can comprise a pH agent (to minimize oxidation or degradation of a component of the composition), a stabilizing agent (to prevent modification or degradation of a component of the composition), a buffering agent (to enhance temperature stability), a solubilizing agent (to increase protein solubility), or any combination thereof.
  • An excipient can comprise a surfactant, a sugar, an amino acid, an antioxidant, a salt, a non-ionic surfactant, a solubilizer, a triglyceride, an alcohol, or any combination thereof.
  • An excipient can comprise sodium carbonate, acetate, citrate, phosphate, poly-ethylene glycol (PEG), sorbitol, sucrose, trehalose, polysorbate 80, sodium phosphate, sucrose, disodium phosphate, mannitol, polysorbate 20, histidine, citrate, albumin, sodium hydroxide, glycine, sodium citrate, trehalose, arginine, sodium acetate, acetate, HC1, disodium edetate, lecithin, glycerin, xanthan rubber, soy isoflavones, polysorbate 80, ethyl alcohol, water, teprenone, or any combination thereof.
  • PEG poly-ethylene glycol
  • a carrier or a diluent can comprise an excipient.
  • a carrier or diluent can comprise a water, a salt solution (e.g., a saline), an alcohol or any combination thereof.
  • Non-limiting examples of suitable excipients can include a buffering agent, a preservative, a stabilizer, a binder, a compaction agent, a lubricant, a chelator, a dispersion enhancer, a disintegration agent, a flavoring agent, a sweetener, a coloring agent.
  • an excipient can be a buffering agent.
  • Non-limiting examples of suitable buffering agents can include sodium citrate, magnesium carbonate, magnesium bicarbonate, calcium carbonate, and calcium bicarbonate.
  • sodium bicarbonate, potassium bicarbonate, magnesium hydroxide, magnesium lactate, magnesium glucomate, aluminum hydroxide, sodium citrate, sodium tartrate, sodium acetate, sodium carbonate, sodium polyphosphate, potassium polyphosphate, sodium pyrophosphate, potassium pyrophosphate, disodium hydrogen phosphate, dipotassium hydrogen phosphate, trisodium phosphate, tripotassium phosphate, potassium metaphosphate, magnesium oxide, magnesium hydroxide, magnesium carbonate, magnesium silicate, calcium acetate, calcium glycerophosphate, calcium chloride, calcium hydroxide and other calcium salts or combinations thereof can be used in a pharmaceutical formulation.
  • an excipient can comprise a preservative.
  • Non-limiting examples of suitable preservatives can include antioxidants, such as alpha-tocopherol and ascorbate, and antimicrobials, such as parabens, chlorobutanol, and phenol.
  • Antioxidants can further include but not limited to EDTA, citric acid, ascorbic acid, butylated hydroxytoluene (BHT), butylated hydroxy anisole (BHA), sodium sulfite, p-amino benzoic acid, glutathione, propyl gallate, cysteine, methionine, ethanol and N- acetyl cysteine.
  • a preservatives can include validamycin A, TL-3, sodium ortho vanadate, sodium fluoride, N-a- tosyl-Phe- chioromethy1ketone, N-a-tosyl-Lys-chloromethylketone, aprotinin, phenylmethylsulfonyl fluoride, diisopropylfluorophosphate, kinase inhibitor, phosphatase inhibitor, caspase inhibitor, granzyme inhibitor, cell adhesion inhibitor, cell division inhibitor, cell cycle inhibitor, lipid signaling inhibitor, protease inhibitor, reducing agent, alkylating agent, antimicrobial agent, oxidase inhibitor, or other inhibitor.
  • a pharmaceutical formulation can comprise a binder as an excipient.
  • suitable binders can include starches, pregelatinized starches, gelatin, polyvinylpyrolidone, cellulose, methylcellulose, sodium carboxymethylcellulose, ethylcellulose, polyacrylamides, polyvinyloxoazolidone, polyvinylalcohols, C12-C18 fatty acid alcohol, polyethylene glycol, polyols, saccharides, oligosaccharides, and combinations thereof.
  • the binders that can be used in a pharmaceutical formulation can be selected from starches such as potato starch, corn starch, wheat starch; sugars such as sucrose, glucose, dextrose, lactose, maltodextrin; natural and synthetic gums; gelatin; cellulose derivatives such as microcrystalline cellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methyl cellulose, carboxymethyl cellulose, methyl cellulose, ethyl cellulose; polyvinylpyrrolidone (povidone); polyethylene glycol (PEG); waxes; calcium carbonate; calcium phosphate; alcohols such as sorbitol, xylitol, mannitol and water or a combination thereof.
  • starches such as potato starch, corn starch, wheat starch
  • sugars such as sucrose, glucose, dextrose, lactose, maltodextrin
  • natural and synthetic gums such as cellulose derivatives such as microcrystalline cellulose
  • a pharmaceutical formulation can comprise a lubricant as an excipient.
  • suitable lubricants can include magnesium stearate, calcium stearate, zinc stearate, hydrogenated vegetable oils, sterotex, polyoxyethylene monostearate, talc, polyethyleneglycol, sodium benzoate, sodium lauryl sulfate, magnesium lauryl sulfate, and light mineral oil.
  • the lubricants that can be used in a pharmaceutical formulation can be selected from metallic stearates (such as magnesium stearate, calcium stearate, aluminum stearate), fatty acid esters (such as sodium stearyl fumarate), fatty acids (such as stearic acid), fatty alcohols, glyceryl behenate, mineral oil, paraffins, hydrogenated vegetable oils, leucine, polyethylene glycols (PEG), metallic lauryl sulphates (such as sodium lauryl sulphate, magnesium lauryl sulphate), sodium chloride, sodium benzoate, sodium acetate and talc or a combination thereof.
  • metallic stearates such as magnesium stearate, calcium stearate, aluminum stearate
  • fatty acid esters such as sodium stearyl fumarate
  • fatty acids such as stearic acid
  • fatty alcohols glyceryl behenate
  • mineral oil such as sodium stearyl fumarate
  • fatty acids
  • a pharmaceutical formulation can comprise a dispersion enhancer as an excipient.
  • suitable dispersants can include starch, alginic acid, polyvinylpyrrolidones, guar gum, kaolin, bentonite, purified wood cellulose, sodium starch glycolate, isomorphous silicate, and microcrystalline cellulose as high HLB emulsifier surfactants.
  • a pharmaceutical formulation can comprise a disintegrant as an excipient.
  • a disintegrant can be a non-effervescent disintegrant.
  • suitable non-effervescent disintegrants can include starches such as corn starch, potato starch, pregelatinized and modified starches thereof, sweeteners, clays, such as bentonite, micro-crystalline cellulose, alginates, sodium starch glycolate, gums such as agar, guar, locust bean, karaya, pectin, and tragacanth.
  • a disintegrant can be an effervescent disintegrant.
  • suitable effervescent disintegrants can include sodium bicarbonate in combination with citric acid, and sodium bicarbonate in combination with tartaric acid.
  • an excipient can comprise a flavoring agent.
  • Flavoring agents incorporated into an outer layer can be chosen from synthetic flavor oils and flavoring aromatics; natural oils; extracts from plants, leaves, flowers, and fruits; and combinations thereof.
  • a flavoring agent can be selected from the group consisting of cinnamon oils; oil of wintergreen; peppermint oils; clover oil; hay oil; anise oil; eucalyptus; vanilla; citrus oil such as lemon oil, orange oil, grape and grapefruit oil; and fruit essences including apple, peach, pear, strawberry, raspberry, cherry, plum, pineapple, and apricot.
  • an excipient can comprise a sweetener.
  • Non-limiting examples of suitable sweeteners can include glucose (corn syrup), dextrose, invert sugar, fructose, and mixtures thereof (when not used as a carrier); saccharin and its various salts such as a sodium salt; dipeptide sweeteners such as aspartame; dihydrochalcone compounds, glycyrrhizin; Stevia Rebaudiana (Stevioside); chloro derivatives of sucrose such as sucralose; and sugar alcohols such as sorbitol, mannitol, sylitol, and the like.
  • glucose corn syrup
  • dextrose invert sugar
  • fructose fructose
  • mixtures thereof when not used as a carrier
  • saccharin and its various salts such as a sodium salt
  • dipeptide sweeteners such as aspartame
  • dihydrochalcone compounds glycyrrhizin
  • Stevia Rebaudiana Stevia Rebaudiana
  • chloro derivatives of sucrose such as
  • a composition may comprise a combination of the active agent, e.g., a ribozyme-activated RNA construct of the disclosure, a compound or composition, and a naturally-occurring or non-naturally- occurring carrier, inert (for example, a detectable agent or label) or active, such as an adjuvant, diluent, binder, stabilizer, buffers, salts, lipophilic solvents, preservative, adjuvant or the like and include pharmaceutically acceptable carriers.
  • the active agent e.g., a ribozyme-activated RNA construct of the disclosure, a compound or composition
  • a naturally-occurring or non-naturally- occurring carrier for example, a detectable agent or label
  • active such as an adjuvant, diluent, binder, stabilizer, buffers, salts, lipophilic solvents, preservative, adjuvant or the like and include pharmaceutically acceptable carriers.
  • Carriers also include pharmaceutical excipients and additives proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, di-, tri-, tetra-oligosaccharides, and oligosaccharides; derivatized sugars such as alditols, aldolic acids, esterified sugars and the like; and polysaccharides or sugar polymers), which can be present singly or in combination, comprising alone or in combination 1-99.99% by weight or volume.
  • Exemplary protein excipients include serum albumin such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, and the like.
  • amino acid/antibody components which can also function in a buffering capacity, include alanine, arginine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, aspartame, and the like.
  • Carbohydrate excipients are also intended within the scope of this technology, examples of which include but are not limited to monosaccharides such as fructose, maltose, galactose, glucose, D-mannose, sorbose, and the like; disaccharides, such as lactose, sucrose, trehalose, cellobiose, and the like; polysaccharides, such as raffinose, melezitose, maltodextrins, dextrans, starches, and the like; and alditols, such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol) and myoinositol.
  • monosaccharides such as fructose, maltose, galactose, glucose, D-mannose, sorbose, and the like
  • disaccharides such as lactose, sucrose
  • a pharmaceutical composition can be formulated in milligrams (mg), milligram per kilogram (mg/kg), copy number, or number of molecules.
  • a composition can comprise about 0.01 mg to about 2000 mg of the active agent.
  • a composition can comprise about: 0.01 mg, 0.1 mg, 1 mg, 10 mg, 100 mg, 500 mg, 1000 mg, 1500 mg, or about 2000 mg of the active agent.
  • a subject, host, individual, and patient may be used interchangeably herein to refer to any organism eukaryotic or prokaryotic.
  • subject may refer to an animal, such as a mammal.
  • a mammal can be administered a ribozyme-activated RNA construct of the disclosure or composition as described herein.
  • Non-limiting examples of mammals include humans, non-human primates (e.g., apes, gibbons, chimpanzees, orangutans, monkeys, macaques, and the like), domestic animals (e.g., dogs and cats), farm animals (e.g., horses, cows, goats, sheep, pigs) and experimental animals (e.g., mouse, rat, rabbit, guinea pig).
  • a mammal is a human.
  • a mammal can be any age or at any stage of development (e.g., an adult, teen, child, infant, or a mammal in utero).
  • a mammal can be male or female.
  • a mammal can be a pregnant female.
  • a subject is a human.
  • a subject has or is suspected of having a cancer or neoplastic disorder.
  • a subject has or is suspected of having a disease or disorder associated with aberrant protein expression.
  • a human can be more than about: 1 day to about 10 months old, from about 9 months to about 24 months old, from about 1 year to about 8 years old, from about 5 years to about 25 years old, from about 20 years to about 50 years old, from about 1 year old to about 130 years old or from about 30 years to about 100 years old.
  • Humans can be more than about: 1, 2, 5, 10, 20,
  • Humans can be less than about: 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120 or 130 years of age.
  • method of treating a human in need thereof can comprise administering to the human a ribozyme-activated RNA construct of the disclosure.
  • compositions herein can be used to treat disease and conditions.
  • a disease or condition can comprise a neurodegenerative disease, a muscular disorder, a metabolic disorder, an ocular disorder, or any combination thereof.
  • the disease or condition can comprise cystic fibrosis, albinism, alpha-l-antitrypsin deficiency, Alzheimer disease, Amyotrophic lateral sclerosis (ALS), Asthma, b-thalassemia, Cadasil syndrome, Charcot-Marie-Tooth disease, Chronic Obstructive Pulmonary Disease (COPD), Distal Spinal Muscular Atrophy (DSMA), Duchenne/Becker muscular dystrophy, Dystrophic Epidermolysis bullosa, Epidermylosis bullosa, Fabry disease, Factor V Leiden associated disorders, Familial Adenomatous, Polyposis, Galactosemia, Gaucher's Disease, Glucose-6-phosphate dehydrogenase, Haemophilia, Hereditary Hematochromatosis, Hunter Syndrome, Huntington's disease, Hurler Syndrome, Inflammatory Bowel Disease (IBD), Inherited polyagglutination syndrome, Leber congenital amaurosis, Lesch-
  • a disease or condition can comprise Mucopoysaccharidosis type I (MPSI).
  • MPSI Mucopoysaccharidosis type I
  • the MPSI can comprise Hurler syndrome, Hurler-Scheie syndrome, Scheie syndrome, or any combination thereof.
  • the disease or condition can comprise a muscular dystrophy, an ornithine transcarbamylase deficiency, a retinitis pigmentosa, a breast cancer, an ovarian cancer,
  • a composition can be sufficient to: (a) decrease expression of a gene relative to an expression of the gene prior to administration; (b) edit at least one point mutation in a subject, such as a subject in need thereof; (c) edit at least one stop codon in the subject to produce a readthrough of a stop codon; (d) produce an exon skip in the subject, or (e) any combination thereof.
  • a disease or condition may comprise a muscular dystrophy.
  • a muscular dystrophy may include myotonic, Duchenne, Becker, Limb-girdle, facioscapulohumeral, congenital, oculopharyngeal, distal, Emery- Dreifuss, or any combination thereof.
  • a disease or condition may comprise pain, such as a chronic pain. Pain may include neuropathic pain, nociceptive pain, or a combination thereof. Nociceptive pain may include visceral pain, somatic pain, or a combination thereof.
  • a vector can be employed to deliver a ribozyme-activated RNA construct of the disclosure.
  • a vector can comprise DNA, such as double stranded DNA or single stranded DNA.
  • a vector can comprise RNA.
  • the RNA can comprise one or more base modifications.
  • the vector can comprise a recombinant vector.
  • the vector can be a vector that is modified from a naturally occurring vector.
  • the vector can comprise at least a portion of a non-naturally occurring vector. Any vector can be utilized.
  • the vector can comprise a viral vector, a liposome, a nanoparticle, an exosome, an extracellular vesicle, or any combination thereof.
  • plasmid vectors can be prepared from commercially available vectors.
  • viral vectors can be produced from baculoviruses, retroviruses, adenoviruses, AAVs, or a combination thereof.
  • the viral vector is a lentiviral vector.
  • viral vectors include retroviral vectors, adenovirus vectors, adeno-associated virus vectors, alphavirus vectors and the like.
  • Infectious tobacco mosaic virus (TMV)-based vectors can be used to manufacturer proteins and have been reported to express Griffithsin in tobacco leaves.
  • Alphavirus vectors such as Semliki Forest virus-based vectors and Sindbis virus-based vectors, have also been developed for use in gene therapy and immunotherapy.
  • a vector construct can refer to the polynucleotide comprising the retroviral genome or part thereof, and a gene of interest.
  • a vector can contain both a promoter and a cloning site into which a polynucleotide can be operatively linked. Such vectors are capable of transcribing RNA in vitro or in vivo and are commercially available.
  • a viral vector can comprise an adenoviral vector, an adeno-associated viral vector (AAV), a lentiviral vector, a retroviral vector, a portion of any of these, or any combination thereof.
  • a nanoparticle vector can comprise a polymeric-based nanoparticle, an aminolipid based nanoparticle, a metallic nanoparticle (such as gold-based nanoparticle), a portion of any of these, or any combination thereof.
  • a vector can comprise an AAV vector.
  • a vector can be modified to include a modified VP1 protein (such as an AAV vector modified to include a VP1 protein).
  • An AAV can comprise a serotype - such as an AAVl serotype, an AAV2 serotype, AAV3 serotype, an AAV4 serotype, AAV5 serotype, an AAV6 serotype, AAV7 serotype, an AAV8 serotype, an AAV9 serotype, an AAVIO serotype, an AAVll serotype, a derivative of any of these, or any combination thereof.
  • a vector can comprise a nucleic acid that encodes a linear precursor of a ribozyme-activated RNA construct of the disclosure.
  • a nucleic acid can comprise a linear precursor of a ribozyme-activated RNA construct of the disclosure.
  • the nucleic acid can be double stranded.
  • the nucleic acid can be DNA or RNA.
  • a nucleic acid can comprise more than one copy of a ribozyme-activated RNA construct of the disclosure.
  • a nucleic acid can comprise 2, 3, 4, 5, or more copies of a ribozyme- activated RNA construct of the disclosure.
  • the nucleic acid can comprise a U6 promoter, a CMV promotor or any combination thereof.
  • Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors.” In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
  • plasmid and 'Vector
  • expression vectors such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.
  • viral vectors e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses
  • the vector or plasmid contains sequences directing transcription and translation of a relevant gene or genes, a selectable marker, and sequences allowing autonomous replication or chromosomal integration.
  • Suitable vectors comprise a region 5' of the gene which harbors transcriptional initiation controls and a region 3' of the DNA fragment which controls transcription termination.
  • Both control regions may be derived from genes homologous to the transformed host cell, although it is to be understood that such control regions may also be derived from genes that are not native to the species chosen as a production host.
  • the vector or plasmid contains sequences directing transcription and translation of a gene fragment, a selectable marker, and sequences allowing autonomous replication or chromosomal integration. Suitable vectors comprise a region 5' of the gene which harbors transcriptional initiation controls and a region 3' of the DNA fragment which controls transcription termination. Both control regions may be derived from genes homologous to the transformed host cell, although it is to be understood that such control regions may also be derived from genes that are not native to the species chosen as a production host.
  • Initiation control regions or promoters which are useful to drive expression of the relevant coding regions in the desired host cell are numerous and familiar to those skilled in the art. Virtually any promoter capable of driving these genetic elements is suitable for use in the disclosure. For example, a pol III promoter, a U6 promoter, a CMV promoter, a T7 promoter, an HI promoter, can be used to drive expression. Termination control regions may also be derived from various genes native to the preferred hosts.
  • Administration of a ribozyme-activated RNA construct of the disclosure can be effected in one dose, continuously or intermittently throughout the course of treatment.
  • Methods of determining the most effective means and dosage of administration can vary with the composition used for therapy, the purpose of the therapy, the target cell being treated, and the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician.
  • Suitable dosage formulations and methods of administering the agents can vary and depend on the disease or condition.
  • Routes of administration can vary with the composition used for treatment, the purpose of the treatment, the health condition or disease stage of the subject being treated, and target cell or tissue.
  • routes of administration include oral administration, nasal administration, injection, and topical application.
  • Administration can refer to methods that can be used to enable delivery of compounds or compositions to the desired site of biological action (such as DNA constructs, viral vectors, or others). These methods can include topical administration (such as a lotion, a cream, an ointment) to an external surface of a surface, such as a skin. These methods can include parenteral administration (including intravenous, subcutaneous, intrathecal, intraperitoneal, intramuscular, intravascular or infusion), oral administration, inhalation administration, intraduodenal administration, and rectal administration. In some instances, a subject can administer the composition in the absence of supervision.
  • a subject can administer the composition under the supervision of a medical professional (e.g., a physician, nurse, physician's assistant, orderly, hospice worker, etc.).
  • a medical professional can administer the composition.
  • a cosmetic professional can administer the composition.
  • Administration or application of a composition disclosed herein can be performed for a treatment duration of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
  • a treatment duration can be from about 1 to about 30 days, from about 2 to about 30 days, from about 3 to about 30 days, from about 4 to about 30 days, from about 5 to about 30 days, from about 6 to about 30 days, from about 7 to about 30 days, from about 8 to about 30 days, from about 9 to about 30 days, from about 10 to about 30 days, from about 11 to about 30 days, from about 12 to about 30 days, from about 13 to about 30 days, from about 14 to about 30 days, from about 15 to about 30 days, from about 16 to about 30 days, from about 17 to about 30 days, from about 18 to about 30 days, from about 19 to about 30 days, from about 20 to about 30 days, from about 21 to about 30 days, from about 22 to about 30 days, from about 23 to about 30 days, from about 24 to about 30 days, from about 25 to about 30 days,
  • compositions disclosed herein can be performed at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 times a day. In some cases, administration or application of composition disclosed herein can be performed at least 1, 2, 3, 4, 5, 6, 7, 8,
  • composition disclosed herein can be performed at least 1, 2, 3, 4, 5, 6, 7, 8,
  • a composition can be administered or applied as a single dose or as divided doses.
  • the compositions described herein can be administered at a first time point and a second time point.
  • a composition can be administered such that a first administration is administered before the other with a difference in administration time of 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 4 days, 7 days, 2 weeks, 4 weeks, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year or more.
  • Kits and articles of manufacture are also described herein that contain ribozyme-mediated RNA-fusion constructs or inducible ribozyme-mediated RNA-fusion system described herein.
  • kits can comprise a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in a method described herein.
  • Suitable containers include, for example, bottles, vials, syringes, and test tubes.
  • the containers can be formed from a variety of materials such as glass or plastic.
  • the container(s) can comprise one or more RNA fusion constructs described herein, optionally in a composition or in combination with another agent as disclosed herein.
  • the container(s) optionally have a sterile access port (for example the container can be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
  • kits optionally comprise a compound disclosed herein with an identifying description or label or instructions relating to its use in the methods described herein.
  • a kit will typically comprise one or more additional containers, each with one or more of various materials (such as reagents, optionally in concentrated form, and/or devices) desirable from a commercial and user standpoint for use of a compound described herein.
  • materials include, but are not limited to, buffers, diluents, filters, needles, syringes; carrier, package, container, vial and/or tube labels listing contents and/or instructions for use, and package inserts with instructions for use.
  • a set of instructions will also typically be included.
  • a label can be on or associated with the container.
  • a label can be on a container when letters, numbers or other characters forming the label are attached, molded or etched into the container itself; a label can be associated with a container when it is present within a receptacle or carrier that also holds the container, e.g., as a package insert.
  • a label can be used to indicate that the contents are to be used for a specific therapeutic application.
  • the label can also indicate directions for use of the contents, such as in the methods described herein.
  • These other therapeutic agents may be used, for example, in the amounts indicated in the Physicians' Desk Reference (PDR) or as otherwise determined by one of ordinary skill in the art.
  • PDR Physicians' Desk Reference
  • ENA-fusion constructs with small ENAs and polymerase III promoters Polymerase III (pol-III) promoters.
  • the ribozyme-RNA fusion constructs were cloned downstream of the U6-driven sgRNA sequence in the lentiCRISPRv2 backbone (termed sgRNA fragL and sgRNA fragR) (see FIG. 2A/.
  • sgRNA fragL and sgRNA fragR As shown in FIG. 2B, the presence of a non targeting sgRNA transcript in the 5' position of the RNA-fusion constructs did not alter the RNA-processing machinery that created the ligated fusion.
  • the EcoRI restriction site on the sgRNA fragR construct shown in FIG. 2C highlights the ability to identify a theoretical barcode placed in this location for perturbation mapping using RNA-sequencing.
  • ENA-fusion constructs for combinatorial screening.
  • the constructs were designed to be amenable to combinatorial screening by orienting the fragL and fragR sequences to be in the antisense direction to the lentiviral 5' long terminal repeat promoter- controlled transcript (termed anti_fragL and anti_fragR). This design prevents degradation of transcripts during lentiviral production due to the fast cleavage rates of the Twister ribozyme implemented in the system. Correct ligation RNA-fusion construct sequences in the antisense direction were confirmed by RT-PCR and Sanger sequencing (see FIG. 2D-E).
  • anti_fragL and anti_fragR constructs were cloned into plasmids containing fluorescent reporters to enable rapid selection of cells in which RNA-fusions are generated.
  • Cells receiving both plasmids are easily identified via fluorescence and can undergo fluorescence-activated cell sorting to screen only those cells receiving both fragments in which the RNA fusion construct can be generated.
  • RNA-fusion system is modular across various polymerase III promoters
  • the constructs are demonstrated to be capable of fusing with one another when driven by the Hi promoter (FIG. 8A), which has been shown to demonstrate both polymerase II and polymerase III activity.
  • FIG. 8B when driven by the Hi promoter, the presence of the RNA fusion construct can be detected. This shows the system is flexible and amenable to the different promoters that may be present on various genome engineering constructs of interest.
  • variable barcodes can be cloned into each sgRNA, or other perturbation, so that the constructs can be identified by the barcodes. This will ensure that each cell in the screen receives a unique pair of barcodes, that serves as unique molecular identifiers (UMIs), and in downstream counting all UMIs will be collapsed.
  • UMIs unique molecular identifiers
  • the library further undergoes next generation sequencing (NGS) to create a lookup table matching barcodes to perturbations.
  • NGS next generation sequencing
  • This library is transduced at an intermediate multiplicity of infection such that most cells receive 2 library elements. Cells are then be sorted for GFP/tdTomato double positive fluorescence to screen cells receiving two barcodes.
  • RNA isolated at multiple timepoints in the screen (day 3, day 14, day 21, and day 28) to ensure robust fitness measurements are obtained.
  • the UMIs from the harvested RNAs are then selectively reverse transcribed, amplified, and sequenced.
  • the identified barcodes at each timepoint are mapped back to the initially generated lookup table to map genotype to phenotype across the experiment.
  • RNA polymerase II is responsible for the transcription of the most cellular genes (mRNA) and pol-II promoters such as EFla, SV40, CMV, and RSV, as well as tissue specific promoters such as NEUROD2 in the CNS and TBX20 in the aorta, are important for the translation of effective gene therapies.
  • RNA-fusion approach could be engineered into an AAV backbone to enable precise control over the expression of various gene therapeutic modalities.
  • the overall schematic for this approach is outlined in FIG. 3.
  • Ligand-responsive aptamer sequences are coupled to the 3' end of the fragL and 5' end of the fragR construct. These aptamers have tertiary interactions with the ribozyme, stabilizing the catalytic loop such that no self-cleavage takes place. In the absence of cleavage, two fragments never hybridize and a ligated RNA-fusion transcript is not generated.
  • the features of the two introns such as the 5' and 3' splice sites, the branch point, and the polypyrimidine tract can be recognized by cellular splicing machinery.
  • Trans-splicing then takes place to remove the intronic sequences and fuse the two exons together to generate a full-length, functional transcript.
  • the outline for the concept is shown in FIG. 4.
  • Two halves of green fluorescent protein (GFP-L and GFP-R) that do not fluoresce when expressed individually were conjugated to intronic sequences.
  • the ribozyme-mediated RNA fusion constructs were then cloned into the px600 AAV backbone.
  • a two-intron model was initially utilized with longer intronic sequences (>250bp each) derived from the Dihydrofolate reductase (DHFR) gene, which have previously been shown to undergo efficient splicing when linked together.
  • DHFR Dihydrofolate reductase
  • Ribozyme-mediated.exonuclease resistant and circular RNA fusion constructs Ribozyme-mediated.exonuclease resistant and circular RNA fusion constructs.
  • the ribozyme mediated fusion barcodes can be engineered to contain a short "exonuclease-resistant" RNA (xrRNA) structures derived from viral genomes (FIG. 4). Once transcribed, these RNA elements can serve to prevent the processive exoribonucleolytic degradation of RNA.
  • xrRNA a short "exonuclease-resistant" RNA
  • FIG. 9A To further increase the persistence of the RNA barcodes in a cellular environment, a circularized RNA barcode design, which is illustrated in FIG. 9A.
  • the left fragment design has been modified to contain a "designer exon” and a chimeric intron on the 3' end of the construct (circ-fragL).
  • the designer exon has can be optimized to be the appropriate length with various exon splicing enhancer (ESE) elements to promote the splicing out of the introns (sequences shown in FIG. 10).
  • ESE exon splicing enhancer
  • the right fragment is also modified on its 5' end with an added intron followed by another designer exon and then the original fragR construct shown in FIG. 1 (circ-fragR).
  • the ribozyme can self-cleave allowing the complementary sequences to hybridize to one another.
  • RNA ligase RtcB
  • the gene expression system was tested by utilizing a chimeric intron (pCI) approach in which GFP-L was fused to the 5' end of an intron derived from the b-hemoglobin gene containing the 5' splice site while GFP-R was fused to the 3' end of an intron derived from the human IgG gene containing the branch point, polypyrimidine tract, and 3' splice site (FIG. 11).
  • pCI vectors containing the ribozyme-mediated RNA fusion constructs robust expression of GFP was observed upon transfection of both plasmids. Fluorescence levels were comparable to the full length GFP transcript expressed individually, demonstrating a robust ability of the approach to generate functional protein (see FIG. 6A).
  • constructs were further engineered with an inducible gene expression system to be contained on one plasmid so that the entire mechanism could be packaged into a single AAV vector.
  • a dual-promoter based system was used,in which GFP-pCI-L was driven by the U6 promoter and GFP-pCI-R is driven by the CMV promoter (FIG. 11A).
  • the transfection of this dual-promoter plasmid construct in HEK293T cells lead to expression of GFP (FIG.11B) with an activation ratio (>80-fold) when compared to the dual-promoter link free design.
  • RNA fusion concept utilizing ribozymes can be used to bring together separately delivered elements to generate a full length, functional proteins.
  • pCI intron sequences high expression levels were realized with a strong increase in expression upon hybridization of the ribozyme-generated complementary regions.
  • This construct was further engineered to be packaged into one plasmid so that it could be packaged into an individual AAV capsid and delivered as a single vector. It is expected that controlled, inducible expression of an effector with the addition of a synthetic riboswitch or other inducible element on one or both constructs can also be utilized.
  • the disclosure demonstrates this feasibility of using a ribozyme-based approach including a tetracycline-responsive ribozyme embedded into the 3' untranslated region (UTR) of a gene of interest (GOI).
  • UTR 3' untranslated region
  • GOI gene of interest
  • the hammerhead ribozyme will self-cleave upon transcription, cleaving off the 3'- poly(A) tail, destabilizing the RNA transcript and leading to relatively low gene expression.
  • Addition of the tetracycline ligand leads to the ligand binding to the tetracycline-responsive aptamer with a high affinity.
  • the disclosure exemplifies the tetracycline induced expression of insulin by cloning the tetracycline hammerhead aptazyme into the 3' UTR of a modified insulin construct.
  • the proinsulin sequence was modified with a H10D, K29R, R31K, and L62R mutations to enable the processing of proinsulin to mature insulin by a furin protease in organs outside of the pancreas.
  • FIG. 12B upon transfection into HEK293T cells in vitro, induction of insulin secretion into the cell culture supernatant was accomplished upon the addition of tetracycline (125 mM).
  • FIG. 13A The number and location of the tetracycline-hammerhead aptazymes (FIG. 13A), and then quantified the amount of insulin that was secreted in the cell culture supernatant of HEK293T cells 48 hours after transfection upon addition of either DMEM or tetracyline (125mM) 4-6 hours after transfection.
  • FIG. 13B the addition of multiple aptazymes resulted in lower background (no tetracycline) expression of insulin. Due to these low background levels, greater than 20-fold induction of secreted insulin with one of the constructs upon the addition of tetracycline.
  • the disclosure demonstrates the feasibility of utilizing this approach to address the insulin needs of diabetic patients.
  • the disclosure shows in vitro that the levels of mature insulin expression are dose-dependent and tunable with engineering of the construct.
  • the feasibility of this disclosure is also shows by first demonstrating its effectiveness with a 3'UTR tetracycline-hammerhead aptazyme, as shown in FIG. 12A.
  • the px601 plasmid backbone was used and the aptazyme riboswitch cloned into the 3' UTR between the SaCas9 protein and the bGH poly(A) sequence (FIG. 14A).
  • the expression of SaCas9 was demonstrated to be tetracycline-inducible in vitro by transfecting HEK293T cells with the plasmid and changing media 4-6 hours after transfection to either DMEM alone or DMEM containing 125 mM tetracycline.
  • the disclosure demonstrates tetracycline-inducible genome editing by SaCas9 in vivo using AAV8 capsid with the construct of FIG. 14B.
  • a SaCas9-specific single guide RNA targeting the mouse Pcsk9 gene was cloned in to the vector.
  • These capsids were then administered to 6-8-week-old C57B1/6 mice via retro-orbital injection at a dose of 5E12 viral genomes/mouse. Serum was collected every week and administered tetracycline (30 mg/kg) at the 2- and 5-week timepoint was performed.
  • RNA construct was generated by transcribing a DNA nucleic acid having a T7 promoter operably linked to a DNA construct encoding a 5' P3 twister ribozyme, a 5' ligation sequence, an IRES operably linked to a coding sequence for GFP, a linker and 3' ligation sequence and a 3' Twister ribozyme followed by a poly-T tail to obtain a linear RNA construct (see FIG. 16A).
  • RNA ** p ⁇ 0.01 t-test comparison within each day. (See FIG. 16B-D).
  • 293T were seeded at 25% confluency in 12 wells and transfected with lipid-RNA complexes consisting of 1 pg of mutated circular or circular GFP RNA and 3.5 pL Lipofectamine MessengerMax. RNA was isolated from cells over three days using the Qiagen RNeasy
  • Kit and qPCR was performed to determine the amount of GFP RNA. * p ⁇ 0.05 t-test comparison within each day.
  • RNA system such as those associated with alpha-viruses was used downstream of the IRES, (see FIG. 18A-B).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pulmonology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Communicable Diseases (AREA)
PCT/US2022/012004 2021-01-11 2022-01-11 Ribozyme-activated rna constructs and uses thereof Ceased WO2022150773A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP22737300.8A EP4247946A4 (en) 2021-01-11 2022-01-11 Ribozyme-activated RNA constructs and uses thereof
US18/271,832 US20260115275A1 (en) 2021-01-11 2022-01-11 Ribozyme-activated rna constructs and uses thereof
JP2023541690A JP2024502620A (ja) 2021-01-11 2022-01-11 リボザイムで活性化されたrna構築物及びその使用

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163136201P 2021-01-11 2021-01-11
US63/136,201 2021-01-11

Publications (3)

Publication Number Publication Date
WO2022150773A2 true WO2022150773A2 (en) 2022-07-14
WO2022150773A3 WO2022150773A3 (en) 2022-08-11
WO2022150773A9 WO2022150773A9 (en) 2023-06-01

Family

ID=82358774

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/012004 Ceased WO2022150773A2 (en) 2021-01-11 2022-01-11 Ribozyme-activated rna constructs and uses thereof

Country Status (4)

Country Link
US (1) US20260115275A1 (https=)
EP (1) EP4247946A4 (https=)
JP (1) JP2024502620A (https=)
WO (1) WO2022150773A2 (https=)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115806984A (zh) * 2022-10-18 2023-03-17 昆明理工大学 环状rna及载体和载体的应用
CN116200442A (zh) * 2023-03-17 2023-06-02 清华大学 一种基于毕赤酵母的无细胞合成体系及应用
WO2025085691A1 (en) * 2023-10-18 2025-04-24 Tacit Therapeutics, Inc. Trans-splicing nucleic acid molecules and methods of use

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2545697C (en) * 2003-11-14 2016-12-20 Richard Mulligan Self-cleaving ribozymes and uses thereof
ES2954929T3 (es) * 2016-02-02 2023-11-27 Meiragtx Uk Ii Ltd Regulación de expresión génica mediante control mediado por aptámeros de ribozimas de autocorte
WO2018237372A1 (en) * 2017-06-23 2018-12-27 Cornell University RNA MOLECULES, METHODS FOR PRODUCING CIRCULAR RNA, AND METHODS OF TREATMENT
SG11202111264TA (en) * 2019-04-12 2021-11-29 Agency Science Tech & Res A ribozyme comprising a target-binding domain
EP4100533A1 (en) * 2020-02-07 2022-12-14 University of Rochester Ribozyme-mediated rna assembly and expression
WO2022204460A1 (en) * 2021-03-26 2022-09-29 Flagship Pioneering Innovations Vii, Llc Compositions and methods for producing circular polyribonucleotides

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115806984A (zh) * 2022-10-18 2023-03-17 昆明理工大学 环状rna及载体和载体的应用
CN115806984B (zh) * 2022-10-18 2023-10-10 昆明理工大学 环状rna及载体和载体的应用
WO2024083095A1 (zh) * 2022-10-18 2024-04-25 昆明理工大学 环状rna及载体和载体的应用
CN116200442A (zh) * 2023-03-17 2023-06-02 清华大学 一种基于毕赤酵母的无细胞合成体系及应用
WO2025085691A1 (en) * 2023-10-18 2025-04-24 Tacit Therapeutics, Inc. Trans-splicing nucleic acid molecules and methods of use

Also Published As

Publication number Publication date
WO2022150773A9 (en) 2023-06-01
EP4247946A2 (en) 2023-09-27
JP2024502620A (ja) 2024-01-22
EP4247946A4 (en) 2025-03-26
US20260115275A1 (en) 2026-04-30
WO2022150773A3 (en) 2022-08-11

Similar Documents

Publication Publication Date Title
US20240417706A1 (en) Systems and methods for the treatment of hemoglobinopathies
US11963982B2 (en) CRISPR/RNA-guided nuclease systems and methods
JP7482028B2 (ja) 血友病aに対する遺伝子編集用組成物及び方法
JP6373763B2 (ja) Aavベクター成分、及び、細胞、臓器並びに組織への遺伝子導入のための方法
EP3134522B1 (en) Recombinant aav vectors useful for reducing immunity against transgene products
US20260115275A1 (en) Ribozyme-activated rna constructs and uses thereof
US20220047637A1 (en) Systems and methods for the treatment of hemoglobinopathies
US20240376499A1 (en) Modular prime editing systems for genome engineering
US20220073951A1 (en) Systems and methods for the treatment of hemoglobinopathies
CA3116885A1 (en) Compositions and methods for delivering transgenes
JP2022524434A (ja) Fviii治療薬を発現するための非ウイルス性dnaベクターおよびその使用
WO2022147573A1 (en) Programmable rna editing in vivo via recruitment of endogenous adars
US12319927B2 (en) Genetic construct
EP4069830A1 (en) Engineering circular guide rnas
US20200263206A1 (en) Targeted integration systems and methods for the treatment of hemoglobinopathies
US20240335476A1 (en) Systems and methods for the treatment of hemoglobinopathies
EP4327829A1 (en) Stabilization of lipid or lipidoid nanoparticle suspensions
US20250163454A1 (en) In vitro and in vivo protein translation via in situ circularized rnas
WO2025036467A1 (en) Circular rna with increased stability and expression
WO2025227064A1 (en) Genomic editing methods to treat cardiovascular disease, and compositions for use in practicing the same
WO2024123842A1 (en) Systems and methods for the treatment of hemoglobinopathies
WO2024254566A2 (en) Systems and methods for the treatment of hemoglobinopathies
WO2025128661A1 (en) Compositions and methods for targeting astrocytes to treat neurological disorders
WO2025186726A1 (en) Modulating expression of agt (angiotensinogen) gene
WO2020219870A1 (en) Crispr/cas9 gene editing of atxn2 for the treatment of spinocerebellar ataxia type 2

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 2022737300

Country of ref document: EP

Effective date: 20230621

WWE Wipo information: entry into national phase

Ref document number: 2023541690

Country of ref document: JP

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22737300

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Ref document number: 2022737300

Country of ref document: EP