WO2022093846A1 - Safe harbor loci - Google Patents

Safe harbor loci Download PDF

Info

Publication number
WO2022093846A1
WO2022093846A1 PCT/US2021/056689 US2021056689W WO2022093846A1 WO 2022093846 A1 WO2022093846 A1 WO 2022093846A1 US 2021056689 W US2021056689 W US 2021056689W WO 2022093846 A1 WO2022093846 A1 WO 2022093846A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
safe harbor
locus
engineered
harbor locus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/056689
Other languages
English (en)
French (fr)
Inventor
Xinying ZHENG
Brendan GALVIN
Somya Khare
Aaron Cooper
Michelle NGUYEN
Anzhi YAO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Arsenal Biosciences Inc
Original Assignee
Arsenal Biosciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to PE2023001489A priority Critical patent/PE20231514A1/es
Priority to IL302315A priority patent/IL302315A/en
Priority to EP21887358.6A priority patent/EP4232049A4/en
Priority to CR20230220A priority patent/CR20230220A/es
Priority to KR1020237017816A priority patent/KR20230101839A/ko
Priority to MX2023004822A priority patent/MX2023004822A/es
Priority to JP2023525019A priority patent/JP2023547887A/ja
Priority to CN202180081810.2A priority patent/CN116546993A/zh
Priority to CA3196269A priority patent/CA3196269A1/en
Application filed by Arsenal Biosciences Inc filed Critical Arsenal Biosciences Inc
Priority to BR112023007874A priority patent/BR112023007874A2/pt
Priority to AU2021369494A priority patent/AU2021369494A1/en
Publication of WO2022093846A1 publication Critical patent/WO2022093846A1/en
Priority to DO2023000080A priority patent/DOP2023000080A/es
Anticipated expiration legal-status Critical
Priority to CONC2023/0006809A priority patent/CO2023006809A2/es
Priority to DO2024000162A priority patent/DOP2024000162A/es
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14Blood; Artificial blood
    • A61K35/17Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/48Reproductive organs
    • A61K35/54Ovaries; Ova; Ovules; Embryos; Foetal cells; Germ cells
    • A61K35/545Embryonic stem cells; Pluripotent stem cells; Induced pluripotent stem cells; Uncharacterised stem cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/31Chimeric antigen receptors [CAR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/421Immunoglobulin superfamily
    • A61K40/4211CD19 or B4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4254Adhesion molecules, e.g. NRCAM, EpCAM or cadherins
    • A61K40/4255Mesothelin [MSLN]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/31Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the route of administration
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/38Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/46Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
    • A61K2239/48Blood cells, e.g. leukemia or lymphoma
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/50Fusion polypeptide containing protease site
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/71Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]

Definitions

  • Cancer continues to present a significant clinical burden despite the substantial research efforts and scientific advances in cancer therapies.
  • Blood and bone marrow cancers are frequently diagnosed cancer types, including multiple myelomas, leukemia, and lymphomas.
  • Current treatment options for these cancers are not effective for all patients and/or can have substantial adverse side effects.
  • Other types of cancer also remain challenging to treat using existing therapeutic options.
  • Cancer immunotherapies are a promising solution because they can be highly specific, allowing for increased therapeutic effectiveness and the mitigation of side effects.
  • SHS safe harbor sites
  • the present disclosure is directed, inter alia, to safe harbor loci that exhibit high knock-in efficiency and stable expression of their transgenes. These safe harbor loci can be used to alter T cells for immunotherapy. These safe harbor loci are useful for the treatment of various diseases, including cancer.
  • the present disclosure provides an engineered cell, comprising at least one sequence encoding a transgene, wherein the at least one sequence is inserted within a safe harbor locus, the safe harbor locus is at any one or more of the sgRNA target loci provided in Table 4; and wherein expression of the at least one sequence encoding the transgene is operatively linked to an endogenous promoter.
  • the present disclosure provides an engineered cell, comprising at least one sequence encoding a transgene, wherein the at least one sequence is inserted within a safe harbor locus, the safe harbor locus is at any one or more of the sgRNA target loci provided in Table 4; and wherein expression of the at least one sequence encoding the transgene is operatively linked to an exogenous promoter.
  • the target locus is selected from: chrl0:33130000-33140000, chrl0:72290000-72300000, chrl 1 : 128340000-128350000, chrl 1 :65425000-65427000 (NEAT1), chrl 5:92830000-92840000, chrl6: 11220000-11230000, chr2: 87460000- 87470000, chr3: 186510000- 186520000, chr3: 59450000-59460000, chr8: 127980000- 128000000, and chr9:7970000-7980000.
  • the target locus is selected from: chrl0:72290000-72300000, chrl 1 : 128340000-128350000, chrl 5:92830000-92840000, and chrl6: 11220000-11230000.
  • the target locus is chrl 1 : 128340000- 128350000.
  • the target locus is chrl 5:92830000-92840000.
  • the target locus is a gene selected from: APRT, B2M, CAPNS1, CBLB, CD2, CD3E, CD3G, CD5, EDF1, FPL, PTEN, PTPN2, PTPN6, PTPRC, PTPRCAP, RPS23, RTRAF, SERF2, SLC38A1, SMAD2, SOCS1, RP14, SRSF9, SUB1, TET2, TIGIT, TRAC, and TRIM28.
  • the safe harbor locus is selected from any one of the integration sites in Table 4 designated: GS88, GS89, GS90, GS91, GS92, GS93, GS94, GS95, GS96, GS97, GS98, GS99, GS100, GS101, GS102, GS103, GS104, GS105, GS106, GS107, GS108, GS109, GS110, GS111, GS112, GS113, GS114, GS115, GS116, GS117, GS118, GS119, GS120.
  • the safe harbor locus is selected from any one of the integration sites in Table 4 designated: GS91, GS92, GS93, GS94, GS95, GS96, GS100, GS101, GS102, GS103, GS104, and GS105. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated: GS103, GS104, and GS105. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated: GS94, GS95, and GS96. In some embodiments, the safe harbor locus is the GS94 integration site in Table 4.
  • the safe harbor locus is selected from any one of the integration sites in Table 4 designated: GS100, GS101, and GS102. In some embodiments, the safe harbor locus is the GS102 integration site in Table 4. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated: GS91, GS92, and GS93.
  • the exogenous promoter is an EFla promoter.
  • the engineered cell is a stem cell, a human cell, a primary cell, an hematopoietic cell, an adaptive immune cell, an innate immune cell, a T cell or a T cell progenitor.
  • the transgene encodes a recombinant protein, optionally a therapeutic agent.
  • the transgene encodes a chimeric antigen receptor (CAR).
  • the present disclosure provides a composition comprising the engineered cell as described herein and a pharmaceutical excipient.
  • the present disclosure provides a guide ribonucleic acids (gRNA) for editing a cell at a safe harbor locus, wherein gRNA comprises any one of the sgRNA sequences in Table 4.
  • gRNA guide ribonucleic acids
  • the gRNA comprises any one of SEQ ID NOS: 1-120. In some embodiments, the gRNA comprises any one of SEQ ID NOS: 91-96 and 100-105. In some embodiments, the gRNA comprises SEQ ID NO:94 or SEQ ID NO: 102. In some embodiments, the gRNA comprises SEQ ID NO:94. In some embodiments, the gRNA comprises SEQ ID NO: 102. In some embodiments, the cell is a stem cell, a human cell, a primary cell, an hematopoietic cell, an adaptive immune cell, an innate immune cell, a T cell or a T cell progenitor.
  • the present disclosure provides a method of editing a cell having chromosomal DNA, comprising inserting at least one sequence encoding a transgene within a safe harbor locus in the chromosomal DNA of the cell, wherein the safe harbor locus is any one or more of the sgRNA target loci provided in Table 4.
  • the target locus is selected from: chrlO:33130000-33140000, chrl0:72290000-72300000, chrl 1 : 128340000-128350000, chrl 1 :65425000-65427000 (NEAT1), chrl 5:92830000-92840000, chrl6: 11220000-11230000, chr2: 87460000- 87470000, chr3: 186510000- 186520000, chr3: 59450000-59460000, chr8: 127980000- 128000000, and chr9:7970000-7980000.
  • the target locus is selected from: chrl0:72290000-72300000, chrl 1 : 128340000-128350000, chrl 5:92830000-92840000, and chrl6: 11220000-11230000.
  • the target locus is chrl 1 : 128340000- 128350000.
  • the target locus is chrl 5:92830000-92840000.
  • the target locus is a gene selected from: A PR E B2M, CAPNS1, CBLB, CD2, CD3E, CD3G, CD5, EDF1, FTP, PTEN, PTPN2, PTPN6, PTPRC, PTPRCAP, RPS23, RTRAF, SERF2, SLC38A1, SMAD2, SOCS1, RP14, SRSF9, SUB1, TET2, TIGIT, TRAC, and TRIM28.
  • the safe harbor locus is selected from any one of the integration sites in Table 4 designated: GS88, GS89, GS90, GS91, GS92, GS93, GS94, GS95, GS96, GS97, GS98, GS99, GS100, GS101, GS102, GS103, GS104, GS105, GS106, GS107, GS108, GS109, GS110, GS111, GS112, GS113, GS114, GS115, GS116, GS117, GS118, GS119, GS120.
  • the safe harbor locus is selected from any one of the integration sites in Table 4 designated: GS91, GS92, GS93, GS94, GS95, GS96, GS100, GS101, GS102, GS103, GS104, and GS105. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated: GS103, GS104, and GS105. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated: GS94, GS95, and GS96. In some embodiments, the safe harbor locus is the GS94 integration site in Table 4.
  • the safe harbor locus is selected from any one of the integration sites in Table 4 designated: GS100, GS101, and GS102. In some embodiments, the safe harbor locus is the GS102 integration site in Table 4. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated: GS91, GS92, and GS93.
  • the transgene encodes a recombinant protein, optionally a therapeutic agent. In some embodiments, the transgene encodes a chimeric antigen receptor (CAR).
  • the at least one sequence comprises an exogenous promoter and the exogenous promoter is operably linked to the transgene. In some embodiments, the exogenous promoter is an EFla promoter.
  • the cell is a stem cell, a human cell, a primary cell, an hematopoietic cell, an adaptive immune cell, an innate immune cell, a T cell or T cell progenitor. In some embodiments, the at least one sequence is inserted using a homology-directed repair.
  • the at least one sequence is inserted using a homology independent targeted insertion. In some embodiments, the at least one sequence is inserted using one or more guide ribonucleic acids (gRNAs) and one or more Cas9 endonucleases.
  • gRNAs guide ribonucleic acids
  • the one or more gRNAs comprises any one of SEQ ID NOS: 1-120. In some embodiments, the one or more gRNAs comprises any one of SEQ ID NOS: 91-96 and 100-105. In some embodiments, the gRNA comprises SEQ ID NO:94 or SEQ ID NO: 102. In some embodiments, the gRNA comprises SEQ ID NO:94. In some embodiments, the gRNA comprises SEQ ID NO: 102.
  • the present disclosure provides a method of editing a T cell, comprising contacting a T cell with one or more guide ribonucleic acids (gRNAs), at least one sequence encoding a transgene, and one or more Cas9 endonucleases, wherein the one or more gRNAs and Cas9 endonucleases facilitate the insertion of the at least one sequence into chromosomal DNA within a safe harbor locus, wherein the safe harbor locus is selected from any one or more of the sgRNA target loci in Table 4.
  • gRNAs guide ribonucleic acids
  • Cas9 endonucleases facilitate the insertion of the at least one sequence into chromosomal DNA within a safe harbor locus, wherein the safe harbor locus is selected from any one or more of the sgRNA target loci in Table 4.
  • the one or more gRNAs comprises a sequence selected from any one of the sgRNA sequences in Table 4. In some embodiments, the one or more gRNAs comprises any one of SEQ ID NOS: 1-120. In some embodiments, the one or more gRNAs comprises any one of SEQ ID NOS: 91-96 and 100-105. In some embodiments, the gRNA comprises SEQ ID NO:94 or SEQ ID NO: 102. In some embodiments, the gRNA comprises SEQ ID NO:94. In some embodiments, the gRNA comprises SEQ ID NO: 102.
  • the target locus is selected from: chrl0:33130000-33140000, chrl0:72290000-72300000, chrl 1 : 128340000-128350000, chrl 1 :65425000-65427000 (NEAT1), chrl 5:92830000-92840000, chrl6: 11220000-11230000, chr2: 87460000- 87470000, chr3: 186510000- 186520000, chr3: 59450000-59460000, chr8: 127980000- 128000000, and chr9:7970000-7980000.
  • the target locus is selected from: chrl0:72290000-72300000, chrl 1 : 128340000-128350000, chrl 5:92830000-92840000, and chrl6: 11220000-11230000.
  • the target locus is chrl 1 : 128340000- 128350000.
  • the target locus is chrl 5:92830000-92840000.
  • the target locus is a gene selected from: A PR E B2M, CAPNS1, CBLB, CD2, CD3E, CD3G, CD5, EDF1, FTP, PTEN, PTPN2, PTPN6, PTPRC, PTPRCAP, RPS23, RTRAF, SERF2, SLC38A1, SMAD2, S0CS1, SRP14, SRSF9, SUB1, TET2, TIGIT, TRAC, and TRIM28.
  • the safe harbor locus is selected from any one of the integration sites in Table 4 designated: GS88, GS89, GS90, GS91, GS92, GS93, GS94, GS95, GS96, GS97, GS98, GS99, GS100, GS101, GS102, GS103, GS104, GS105, GS106, GS107, GS108, GS109, GS110, GS111, GS112, GS113, GS114, GS115, GS116, GS117, GS118, GS119, GS120.
  • the safe harbor locus is selected from any one of the integration sites in Table 4 designated: GS91, GS92, GS93, GS94, GS95, GS96, GS100, GS101, GS102, GS103, GS104, and GS105. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated: GS103, GS104, and GS105. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated: GS94, GS95, and GS96. In some embodiments, the safe harbor locus is the GS94 integration site in Table 4.
  • the safe harbor locus is selected from any one of the integration sites in Table 4 designated: GS100, GS101, and GS102. In some embodiments, the safe harbor locus is the GS102 integration site in Table 4. In some embodiments, the safe harbor locus is selected from any one of the integration sites in Table 4 designated: GS91, GS92, and GS93
  • the present disclosure provides an ex vivo method of obtaining an engineered cell or population thereof, comprising (a) obtaining a cell; and (b) genetically modifying the cell by inserting at least one sequence encoding a transgene within a safe harbor locus, wherein the safe harbor locus is selected from any one of the sgRNA target loci in Table 4.
  • obtaining the cell comprises: (i) collecting a tissue sample from a subject, (ii) isolating the cells from the tissue samples, and (iii) culturing the cells in vitro.
  • the tissue sample is a blood sample.
  • the cell is a stem cell, a human cell, a primary cell, an hematopoietic cell, an adaptive immune cell, an innate immune cell, a T cell or T cell precursor (T cell progenitor).
  • the at least one sequence is inserted using a homology-directed repair. In some embodiments, the at least one sequence is inserted using a homology independent targeted insertion.
  • the genetically modifying in step (b) comprises contacting the cell with one or more guide ribonucleic acids (gRNAs), the at least one sequence, and one or more Cas9 endonucleases, wherein the one or more gRNAs and Cas9 endonucleases facilitate the insertion of the at least one sequence into chromosomal DNA within the safe harbor locus.
  • the one or more gRNAs comprises a sequence selected from any one of the sgRNA sequences in Table 4.
  • the transgene encodes a recombinant protein, optionally a therapeutic agent. In some embodiments, the transgene encodes a chimeric antigen receptor (CAR). In some embodiments, the at least one sequence comprises an exogenous promoter and the exogenous promoter is operably linked to the transgene. In some embodiments, the exogenous promoter is an EFla promoter.
  • the present disclosure provides a method of treating a subject having or at risk of having a disease, comprising administering to the subject an effective amount of an engineered cell as described herein, a population thereof, or a composition as described herein.
  • the cell, the population thereof, or the composition is administered to the subject by infusion.
  • the present disclosure provides a method of treating a subject having or at risk of having a disease, comprising (a) conducting any one of the methods described supra, and (b) administering to the subject an effective amount of a composition comprising the cell or a population thereof.
  • the composition is administered to the subject by infusion.
  • the disease is cancer.
  • the disease is blood cancer.
  • the present disclosure provides a method of identifying a safe harbor locus, comprising: (a) identifying genes or non-coding regions in a chromosome that are above a threshold level for expression across developmental cell states and/or a threshold level for accessibility of chromatin; (b) generating a linear model that correlates the gene or non-coding region from step (a) with knock-in (KI) efficiency and estimates the KI efficiency of any gene or coding region on the chromosome; and (c) selecting the safe harbor locus based on threshold parameters; wherein the safe harbor locus is selected for insertion of at least one sequence encoding a transgene within a cell.
  • KI knock-in
  • the threshold parameters include one or more of: stable expression of a transgene, knockout of the gene confers benefit to the function of the cell, no known function within the cell, stable transgene expression in vitro with or without CD3/CD28 stimulation, negligible off-target cleavage as detected by iGuide-Seq or CRISPR- Seq, less off-target cleavage relative to other loci as detected by iGuide-Seq or CRISPR-Seq, negligible transgene-independent cytotoxicity, negligible transgene-independent cytokine expression, negligible transgene-independent chimeric antigen receptor expression, negligible deregulation or silencing of nearby genes, and positioned outside of a cancer-related gene.
  • the stable expression of a transgene at the safe harbor locus is less than or equal to 2-fold expression change over the course of at least 1, 2, 3, 4, 5, 6, or 7 days, and wherein expression change is measured by mean fluorescence intensity of a reporter gene encoded by the at least one sequence.
  • the accessibility of chromatin is measured using an assay for transposase-accessible chromatin using sequencing (ATAC-seq).
  • the level of expression across developmental cell states is measured using RNA sequencing (RNA-seq).
  • the cell is a stem cell, a human cell, a primary cell, an hematopoietic cell, an adaptive immune cell, an innate immune cell, a T cell or T cell progenitor.
  • the linear model has a coefficient of determination (R 2 value) of at least 30%.
  • the present disclosure provides an engineered cell, composition, gRNA or method as described herein, wherein insertion within the safe harbor locus increase cell cytotoxicity of diseased cells.
  • the present disclosure provides an engineered cell, composition, gRNA or method as described herein, wherein knock-in efficiency at the safe harbor locus is increased relative to other locations along the chromosome.
  • FIG. 1 includes a schematic depicting the methodology used to identify safe harbor loci in the present disclosure, in some embodiments.
  • FIGS. 2A-2C include schematic depicting 3 top safe harbor loci known in the art: AAVS1 (FIG. 2A), CCR5 (FIG. 2B), and Rosa26 (FIG. 2C).
  • AAVS1 FIG. 2A
  • CCR5 FIG. 2B
  • Rosa26 FIG. 2C
  • the figures were retrieved from Sadelain, M., et al. (2012). Safe harbours for the integration of new DNA in the human genome. Nature reviews Cancer, 12(1), 51-58, the relevant disclosures of which are herein incorporated by reference in their entirety.
  • FIG. 3 includes a schematic outlining the data provided in Roth, T. L., et al. 2019. Rapid discovery of synthetic DNA sequences to rewrite endogenous T cell circuits. bioRxiv, 604561, the relevant disclosures of which are herein incorporated by reference in their entirety.
  • FIGS. 4A-4B include heatmaps with samples clustered based on activation status and cell type, generated with processed RNA-seq data.
  • FIG. 4A includes a heatmap of samples generated with processed RNA-seq data.
  • FIG. 4B includes a heatmap sample generated with processed RNA-seq data, showing the clustering of ⁇ 20k genes.
  • FIGS. 5A-5B include plots generated using processed RNA-seq data.
  • FIG. 5A includes a plot showing direct correlation between transcript expression data from Roth, T.L., et al. 2019 and transcript expression data generated by the inventors of the present disclosure.
  • FIG.5B includes a heatmap showing clusters of the top 10% expressed genes.
  • FIG. 6 includes a heatmap of samples generated with processed ATAC-seq data.
  • FIGS. 7A-7B includes plots depicting the signal enrichment at transcription start sites (TSS) (FIG. 7A) and peak size distribution (FIG. 7B), generated with processed ATAC-seq data for coding regions.
  • FIG. 8 includes a plot depicting the open chromatin regions around the TRAC locus.
  • FIG. 9 includes a plot depicting KI (knock-in) efficiency for coding regions/genes with GFP as a reporter.
  • FIG. 10 includes a plot depicting KI efficiency for coding regions/genes with tNGFR as a reporter.
  • FIG. 11 includes plots showing scaled KI efficiency for 90 genes vs d2 (day-2) RNA- seq data, d4 (day-4) RNA-seq data and ATAC-seq data, utilized for the predictive linear model.
  • FIG. 12 includes a plot showing chromatin accessibility for a top candidate noncoding region, measured using ATAQ sequencing.
  • FIG. 13A includes plots showing the cell counts for GFP controls used for the evaluation of candidate KI loci.
  • FIG. 13B includes pmax (GFP high) readings for GFP controls used for the evaluation of candidate KI loci.
  • FIG. 14A includes plots showing the maximum episomal GFP expression
  • FIG. 14B includes the cell count for nontargeting controls from donors 1, 2, and 3.
  • FIG. 15 includes the cell count and maximum GFP expression (GFP high) readings for WT controls.
  • FIG. 16 includes plots showing the cell count and maximum GFP expression (GFP high) readings when using sgRNA5, which targets a B2M safe harbor locus, and the construct expression was driven by an endogenous promoter.
  • FIG. 17 includes plots showing the cell count and maximum GFP expression
  • GFP GFP high readings when using sgRNA5, which targets a B2M safe harbor locus, and the construct expression was driven by an EFla promoter.
  • FIG. 18 includes plots showing the cell count and maximum GFP expression
  • FIG. 19 includes plots showing the cell count and maximum GFP expression
  • GFP high readings when using sgRNA79, which targets a TRAC safe harbor locus, and the construct expression was driven by an exogenous promoter.
  • FIG. 20 includes plots showing TCR (T cell receptor) vs. GFP among all donors and time points when using sgRNA79, and the construct is driven by an endogenous promoter.
  • FIG. 21 includes plots showing TCR vs. GFP among all donors and time points when using sgRNA79 and the construct is driven by an exogenous promoter.
  • FIG. 22 includes plots showing the cell count and maximum GFP expression
  • GFP high readings when using sgRNA83, which targets a TRAC safe harbor locus, and the construct expression was driven by an endogenous promoter.
  • FIG. 23 includes plots showing the cell count and maximum GFP expression
  • GFP high readings when using sgRNA83, which targets a TRAC safe harbor locus, and the construct expression was driven by an exogenous promoter.
  • FIG. 24 includes plots showing TCR vs. GFP among all donors and time points when using sgRNA83 and the construct is driven by an endogenous promoter.
  • FIG. 25 includes plots showing TCR vs. GFP among all donors and time points when using sgRNA83 and the construct is driven by an exogenous promoter.
  • FIG. 26 includes plots illustrating potential sources of variation (e.g., edge effects and electroporation errors) observed between replicates and donors.
  • potential sources of variation e.g., edge effects and electroporation errors
  • FIG. 27 includes plots illustrating potential sources of variation observed between replicates and donors, e.g., relating to inherent differences between donors.
  • FIG. 28 includes plots illustrating potential sources of variation observed between replicates and donors, e.g., relating to gating errors.
  • FIG. 29 includes plots showing the GFP mean fluorescence intensity (GFP MFI) and KI efficiency for top KI loci evaluated with endogenous promoters.
  • GFP MFI GFP mean fluorescence intensity
  • FIG. 30 includes plots showing the GFP mean fluorescence intensity (GFP MFI) and KI efficiency for top KI loci evaluated with the EFla promoter.
  • FIGS. 31A-31C include plots showing all the significant KI loci (top KI loci) as evaluated with endogenous and EFla promoters.
  • FIG. 31 A includes a plot showing that the expression from the EFla promoter was approximately 10 times higher than expression from an endogenous promoter.
  • FIG. 31B shows the top KI loci ranked by GFP MFI at week 3.
  • FIG. 31C shows the top integration loci ranked by GFP MFI (at weeks 3 and 4; donors 1-3).
  • FIG. 32A includes a plot showing some target loci and their measured transgene expression levels.
  • FIG. 32B includes plots showing the transgene (Prime Receptor (PrimeR)) and TCR expression for the control and insertion at GS94, GS102 and TRAC loci.
  • FIG. 33A includes a plot showing the PrimeR levels measured for the indicated integration sites.
  • FIG. 33B includes a schematic showing the GS94 integration site on Chromosome 11.
  • FIG. 34A includes plots showing CAR induction and primeR expression of engineered T cells after 48 hours of coculturing with K562-CD19 cells.
  • FIG. 34B includes plots showing the cytotoxity and cytokine secretion levels for engineered T cells 48 hours of coculturing with K562-CD19/MSLN cells.
  • FIG. 35A includes a schematic showing the experimental overview for evaluating the effect of integration site on cytotoxicity.
  • FIG. 35B includes plots showing the measured cytotoxicity for engineerred T cells cocultured for 48 hours with the K562 CD19+/MSLN+ or K562 CD19-/MSLN+ cells.
  • FIG. 36A includes a schematic showing the experimental overview for evaluating the effect of integration site on cytokine secretion.
  • FIG. 36B includes plots showing the measured cytokine levels for engineerred T cells cocultured for 48 hours with K562 CD19+/MSLN+ cells.
  • FIG. 37 includes a schematic showing the in vitro experiment conducted to determin the effect of integration site on primeR-independent CAR expression.
  • Flow refers to flow cytometry and “restim” refers to repetitive CD3/CD28 stimualation of the engineered T cells.
  • EP refers to electroporation.
  • FIGS. 38A and 38B include plots showing the stability of PrimeR expression over time when using the indicated integration sites.
  • Flow refers to flow cytometry and “restim” refers to repetitive CD3/CD28 stimualation of the engineered T cells.
  • EP refers to electroporation.
  • the PrimeR expression is normalized to the expression from using the TRAC integration site.
  • FIG. 39A includes a schematic showing the iGuide-Seq assay technique.
  • FIG. 39B includes a plot showing the on-target efficiency, using iGuide Seq assay, for the indicated integration sites.
  • FIG. 39C includes schematics from the iGuide-Seq analysis showing that GS94 had no reproducible putatitve off-targets across two donors.
  • FIG. 40 includes a schematic showing the iGuide-Seq workflow and data.
  • FIG. 41 includes a plot showing rhAmp-seq analysis of putative off-target sites identified by iGUIDE-seq and Elevation prediction.
  • FIG. 42 includes plots showing RNA-seq analysis of cells with GS94, GS102 and TRAC knock-in of CD19/MSLN circuits. Scatterplot of gene expression in cells with integration at the GS94 locus (y-axis) vs cells with integration at either the TRAC or the GS102 locus (x-axis) in two donors. The yellow dots correspond to ETS1 and FLU. In blue are the genes that were found to be differentially expressed using edgeR (fold-change > 0, FDR-corrected p-value ⁇ 0.01, average counts-per-million across compared conditions at least 2).
  • FIG. 43 includes plots showing the absence of cytokine-independent growth in cells with CD19/MSLN circuit KI at GS94.
  • FIG. 44 shows a diagram of a 8.3 kb cassette that was inserted into the GS94 safe harbor locus.
  • FIG. 45 shows the expression of a 8.3 kb transgene circuit comprising a priming receptor and CAR in K562 cells.
  • FIG. 46 shows that non-viral editing generated less differentiated T cells.
  • the present disclosure provides safe harbor loci and methods for identifying safe harbor loci that exhibit high integration efficiency (e.g., high knock-in (KI) efficiency), high and constant levels of transgene expression, and such benefits independent of T cell activation/differentiation state.
  • the safe harbor loci also exhibit minimal to no disruption to T cell function and/or capacity for product manufacturing.
  • these loci are useful for effective and safe integration and expression of transgenes in T cells (e.g. in CAR T therapies).
  • the methods described herein can be used for the identification of safe harbor loci for insertion of transgenes in other types of cells.
  • FIG. 1 illustrates the overall approach that the inventors of the present disclosure used to identify safe harbor loci.
  • the present disclosure provides a method comprising the identification of genes within a genome and non-coding regions with sustained expression in a treatment cell (e.g. T cell) and using a predictive model of KI efficiency as a function of T cell chromatic state and computational analysis to predict candidate integration sites. The method further comprises evaluating the candidate integration sites for actual KI efficiency, sustained levels of transgene expression of a transgene, and minimal disruption to the treatment cell phenotype (e.g., T cell function and/or capacity for treatment product expansion and manufacturing).
  • the safe harbor loci allow for integration of a transgene driven by an endogenous promoter.
  • the safe harbor loci allow for integration of a transgene driven by an exogenous promoter (e.g. EFla promoter).
  • the term “about” indicates and encompasses an indicated value and a range above and below that value. In certain embodiments, the term “about” indicates the designated value ⁇ 10%, ⁇ 5%, or ⁇ 1%. In certain embodiments, where applicable, the term “about” indicates the designated value(s) ⁇ one standard deviation of that value(s).
  • the term “gene” refers to the basic unit of heredity, consisting of a segment of DNA arranged along a chromosome, which codes for a specific protein or segment of protein.
  • a gene typically includes a promoter, a 5' untranslated region, one or more coding sequences (exons), optionally introns, a 3' untranslated region.
  • the gene may further comprise a terminator, enhancers and/or silencers.
  • locus refers to a specific, fixed physical location on a chromosome where a gene or genetic marker is located.
  • target locus refers to a locus on a chromosome within which a safe harbor locus can be used for the insertion of a sequence.
  • a target locus can consist of multiple potential safe harbor loci (integration sites). Examples of target loci are provided in Table 4, as sgRNA target loci.
  • the notation used for the sgRNA target loci in Table 4 refers to the genomic region of the target locus, defined by the chromosome of the target locus and the coordinate range for that target locus.
  • chrl0:33130000- 33140000 refers to a target locus on ChrlO (chromosome 10) starting from coordinate 33130000 and ending with coordinate 33140000.
  • safe harbor locus refers to a locus at which genes or genetic elements can be incorporated without disruption to expression or regulation of adjacent genes. These safe harbor loci are also referred to as safe harbor sites (SHS).
  • SHS safe harbor sites
  • a safe harbor locus refers to an “integration site” or “knock-in site” at which a sequence encoding a transgene, as defined herein, can be inserted. In some embodiments the insertion occurs with replacement of a sequence that is located at the integration site. In some embodiments, the insertion occurs without replacement of a sequence at the integration site. Examples of integration sites contemplated are provided in Table 4.
  • the term “insert” refers to a nucleotide sequence that is integrated (inserted) at a safe harbor site.
  • the insert can be used to refer to the genes or genetic elements that are incorporated at the safe harbor site using, for example, homology-directed repair (HDR) CRISPR/Cas9 genome-editing or other methods for inserting nucleotide sequences into a genomic region known to those of ordinary skill in the art.
  • HDR homology-directed repair
  • CRISPR/Cas refers to a widespread class of bacterial systems for defense against foreign nucleic acid.
  • CRISPR/Cas systems are found in a wide range of eubacterial and archaeal organisms.
  • CRISPR/Cas systems include type I, II, and III subtypes. Wild-type type II CRISPR/Cas systems utilize an RNA-mediated nuclease, Cas9 in complex with guide and activating RNA to recognize and cleave foreign nucleic acid.
  • Guide RNAs having the activity of both a guide RNA and an activating RNA are also known in the art. In some cases, such dual activity guide RNAs are referred to as a small guide RNA (sgRNA).
  • sgRNA small guide RNA
  • Cas9 homologs are found in a wide variety of eubacteria, including, but not limited to bacteria of the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes- Chlorobi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae.
  • An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and homologs thereof are described in, e.g., Chylinksi, et al., RNA Biol.
  • the Cas9 nuclease domain can be optimized for efficient activity or enhanced stability in the host cell.
  • RNA-mediated nuclease e.g., of bacterial or archeal orgin, or derived therefrom.
  • RNA-mediated nuclases include the foregoing Cas9 proteins and homologs thereof, and include but are not limited to, CPF1 (See, e.g., Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015).
  • Cas9 ribonucleoprotein complex and the like refers to a complex between the Cas9 protein, and a crRNA (e.g., guide RNA or small guide RNA), the Cas9 protein and a trans-activating crRNA (tracrRNA), the Cas9 protein and a small guide RNA, or a combination thereof (e.g., a complex containing the Cas9 protein, a tracrRNA, and a crRNA guide RNA).
  • a crRNA e.g., guide RNA or small guide RNA
  • tracrRNA trans-activating crRNA
  • Cas9 protein and a small guide RNA e.g., a complex containing the Cas9 protein, a tracrRNA, and a crRNA guide RNA
  • T lymphocyte and “T cell” are used interchangeably and refer to cells that have completed maturation in the thymus, and identify certain foreign antigens in the body. The terms also refer to the major leukocyte types that have various roles in the immune system, including activation and deactivation of other immune cells.
  • the T cell can be any T cell such as a cultured T cell, e.g., a primary T cell, or a T cell derived from a cultured T cell line, e.g., a Jurkat, SupTl, etc., or a T cell obtained from a mammal.
  • the T cell can be a CD3 + cell.
  • the T cell can be any type of T cell, CD4 + / CD8 + double positive T cells, CD4 + helper T cells (e.g. Thl and Th2 cells), CD8 + T cells (e.g. cytotoxic T cells), peripheral Including but not limited to blood mononuclear cells (PBMC), peripheral blood leukocytes (PBL), tumor infiltrating lymphocytes (TIL), memory T cells, naive T cells, regulatory T cells, y6 T cells, etc. It can be any T cell at any stage of development. Additional types of helper T cells include Th3 (Treg) cells, Thl7 cells, Th9 cells, or Tfh cells.
  • helper T cells include Th3 (Treg) cells, Thl7 cells, Th9 cells, or Tfh cells.
  • T cells such as central memory T cells (Tcm cells), effector memory T cells (Tern cells and TEMRA cells).
  • a T cell can also refer to a genetically modified T cell, such as a T cell that has been modified to express a T cell receptor (TCR) or a chimeric antigen receptor (CAR).
  • T cells can also be differentiated from stem cells or progenitor cells (e.g., precursor cells).
  • CD4 + T cells refers to a subset of T cells that express CD4 on their surface and are associated with a cellular immune response.
  • CD4 + T cells are characterized by a poststimulation secretion profile that can include secretion of cytokines such as IFN-y, TNF-a, IL-2, IL-4 and IL-10.
  • CD4 is a 55 kD glycoprotein originally defined as a differentiation antigen on T lymphocytes, but was also found on other cells including monocytes / macrophages.
  • the CD4 antigen is a member of the immunoglobulin superfamily and has been implicated as an associative recognition element in MHC (major histocompatibility complex) class II restricted immune responses.
  • MHC major histocompatibility complex
  • CD8 + T cells refers to a subset of T cells that express CD8 on their surface, are MHC class I restricted, and function as cytotoxic T cells.
  • the “CD8” molecule is a differentiation antigen present on thymocytes, as well as on cytotoxic and suppressor T lymphocytes.
  • the CD8 antigen is a member of the immunoglobulin superfamily and is an associative recognition element in major histocompatibility complex class I restriction interactions.
  • ex vivo generally includes experiments or measurements made in or on living tissue, preferably in an artificial environment outside the organism, preferably with minimal differences from natural conditions.
  • construct refers to a complex of molecules, including macromolecules or polynucleotides.
  • the term “integration” refers to the process of stably inserting one or more nucleotides of a construct into the cell genome, i.e., covalently linking to a nucleic acid sequence in the chromosomal DNA of the cell. It may also refer to nucleotide deletions at a site of integration. Where there is a deletion at the insertion site, “integration” may further include substitution of the endogenous sequence or nucleotide deleted with one or more inserted nucleotides.
  • the term “exogenous” refers to a molecule or activity that has been introduced into a host cell and is not native to that cell.
  • the molecule can be introduced, for example, by introduction of the encoding nucleic acid into host genetic material, such as by integration into a host chromosome, or as non-chromosomal genetic material, such as a plasmid.
  • the term, when used in connection with expression of an encoding nucleic acid refers to the introduction of the encoding nucleic acid into a cell in an expressible form.
  • the term “endogenous” refers to a molecule or activity that is present in a host cell under natural, unedited conditions.
  • the term, when used in connection with expression of the encoding nucleic acid refers to expression of the encoding nucleic acid that is contained within the cell and not introduced exogenously.
  • a “polynucleotide donor construct” refers to a nucleotide sequence (e.g. DNA sequence) that is genetically inserted into a polynucleotide and is exogenous to that polynucleotide.
  • the polynucleotide donor construct is transcribed into RNA and optionally translated into a polypeptide.
  • the polynucleotide donor construct can include prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences.
  • the polynucleotide donor construct can be a miRNA, shRNA, natural polypeptide (i.e., a naturally occurring polypeptide) or fragment thereof or a variant polypeptide (e.g. a natural polypeptide having less than 100% sequence identity with the natural polypeptide) or fragments thereof.
  • the term “transgene” refers to a polynucleotide that has been transferred naturally, or by any of a number of genetic engineering techniques from one organism to another. It is optionally translated into a polypeptide. It is optionally translated into a recombinant protein.
  • a “recombinant protein” is a protein encoded by a gene — recombinant DNA — that has been cloned in a system that supports expression of the gene and translation of messenger RNA (see expression system).
  • the recombinant protein can be a therapeutic agent, e.g. a protein that treats a disease or disorder disclosed herein.
  • transgene can refer to a polynucleotide that encodes a polypeptide.
  • a transgene can also refer to a non-encoding sequence, such as, but not limited to shRNAs, miRNAs, and miRs.
  • operably linked refers to the binding of a nucleic acid sequence to a single nucleic acid fragment such that one function is affected by the other.
  • a promoter is capable of affecting the expression of a coding sequence or functional RNA (i.e., the coding sequence or functional RNA is under transcriptional control by the promoter)
  • the promoter is operably linked thereto.
  • Coding sequences can be operably linked to control sequences in both sense and antisense orientation.
  • developmental cell states refers to, for example, states when the cell is inactive, actively expressing, differentiating, senescent, etc.
  • developmental cell state may also refer to a cell in a precursor state (e.g., a T cell precursor or T cell progenitor).
  • the term “encoding” refers to a sequence of nucleic acids which codes for a protein or polypeptide of interest.
  • the nucleic acid sequence may be either a molecule of DNA or RNA.
  • the molecule is a DNA molecule.
  • the molecule is a RNA molecule.
  • When present as a RNA molecule it will comprise sequences which direct the ribosomes of the host cell to start translation (e.g., a start codon, ATG) and direct the ribosomes to end translation (e.g., a stop codon). Between the start codon and stop codon is an open reading frame (ORF).
  • ORF open reading frame
  • inserting refers to a manipulation of a nucleotide sequence to introduce a non-native sequence. This is done, for example, via the use of restriction enzymes and ligases whereby the DNA sequence of interest, usually encoding the gene of interest, can be incorporated into another nucleic acid molecule by digesting both molecules with appropriate restriction enzymes in order to create compatible overlaps and then using a ligase to join the molecules together.
  • restriction enzymes and ligases whereby the DNA sequence of interest, usually encoding the gene of interest, can be incorporated into another nucleic acid molecule by digesting both molecules with appropriate restriction enzymes in order to create compatible overlaps and then using a ligase to join the molecules together.
  • the term “subject” refers to a mammalian subject. Exemplary subjects include humans, monkeys, dogs, cats, mice, rats, cows, horses, camels, goats, rabbits, pigs and sheep. In certain embodiments, the subject is a human. In some embodiments the subject has a disease or condition that can be treated with an engineered cell provided herein or population thereof. In some aspects, the disease or condition is a cancer.
  • promoter refers to a nucleotide sequence (e.g. DNA sequence) capable of controlling the expression of a coding sequence or functional RNA.
  • the promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers.
  • a promoter can be derived from natural genes in its entirety, can be composed of different elements from different promoters found in nature, and/or may comprise synthetic DNA segments.
  • a promoter, as contemplated herein, can be endogenous to the cell of interest or exogenous to the cell of interest. It is appreciated by those skilled in the art that different promoters can induce gene expression in different tissue or cell types, or at different developmental stages, or in response to different environmental conditions.
  • a promoter can be selected according to the strength of the promoter and/or the conditions under which the promoter is active, e.g., constitutive promoter, strong promoter, weak promoter, inducible/repressible promoter, tissue specific Or developmentally regulated promoters, cell cycle-dependent promoters, and the like.
  • a promoter can be an inducible promoter (e.g., a heat shock promoter, tetracycline- regulated promoter, steroid-regulated promoter, metal-regulated promoter, estrogen receptor- regulated promoter, etc.).
  • the promoter can be a constitutive promoter (e.g., CMV promoter, UBC promoter).
  • the promoter can be a spatially restricted and/or temporally restricted promoter (e.g., a tissue specific promoter, a cell type specific promoter, etc.). See for example US Application No. 15/715,068, the disclosures of which are herein incorporated by reference in their entirety.
  • Gene editing may involve a gene (or nucleotide sequence) knock-in or knock-out.
  • knock-in refers to an addition of a DNA sequence, or fragment thereof into a genome.
  • DNA sequences to be knocked-in may include an entire gene or genes, may include regulatory sequences associated with a gene or any portion or fragment of the foregoing.
  • a polynucleotide donor construct encoding a recombinant protein may be inserted into the genome of a cell carrying a mutant gene.
  • a knock-in strategy involves substitution of an existing sequence with the provided sequence, e.g., substitution of a mutant allele with a wild-type copy.
  • the term “knock-out” refers to the elimination of a gene or the expression of a gene.
  • a gene can be knocked out by either a deletion or an addition of a nucleotide sequence that leads to a disruption of the reading frame.
  • a gene may be knocked out by replacing a part of the gene with an irrelevant (.e.g., non-coding) sequence.
  • non-homologous end joining refers to a cellular process in which cut or nicked ends of a DNA strand are directly ligated without the need for a homologous template nucleic acid. NHEJ can lead to the addition, the deletion, substitution, or a combination thereof, of one or more nucleotides at the repair site.
  • the term “homology directed repair” or HDR refers to a cellular process in which cut or nicked ends of a DNA strand are repaired by polymerization from a homologous template nucleic acid.
  • the homologous template nucleic acid can be provided by homologous sequences elsewhere in the genome (sister chromatids, homologous chromosomes, or repeated regions on the same or different chromosomes).
  • an exogenous template nucleic acid can be introduced to obtain a specific HDR-induced change of the sequence at the target site. In this way, specific mutations can be introduced at the cut site.
  • vectors can be linear or circular. Vectors can integrate into a target genome of a host cell or replicate independently in a host cell. Vectors can comprise, for example, an origin of replication, a multicloning site, and/or a selectable marker.
  • An expression vector typically comprises an expression cassette.
  • Vectors and plasmids include, but are not limited to, integrating vectors, prokaryotic plasmids, eukaryotic plasmids, plant synthetic chromosomes, episomes, viral vectors, cosmids, and artificial chromosomes.
  • expression cassette is a polynucleotide construct, generated recombinantly or synthetically, comprising regulatory sequences operably linked to a selected polynucleotide to facilitate expression of the selected polynucleotide in a host cell.
  • the regulatory sequences can facilitate transcription of the selected polynucleotide in a host cell, or transcription and translation of the selected polynucleotide in a host cell.
  • An expression cassette can, for example, be integrated in the genome of a host cell or be present in an expression vector.
  • the phrase “subject in need thereof’ refers to a subject that exhibits and/or is diagnosed with one or more symptoms or signs of a disease or disorder as described herein.
  • a “chemotherapeutic agent” refers to a chemical compound useful in the treatment of cancer.
  • Chemotherapeutic agents include “anti-hormonal agents” or “endocrine therapeutics” which act to regulate, reduce, block, or inhibit the effects of hormones that can promote the growth of cancer.
  • composition refers to a mixture that contains, e.g., an engineered cell or protein contemplated herein.
  • the composition may contain additional components, such as adjuvants, stabilizers, excipients, and the like.
  • composition or “pharmaceutical composition” refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective in treating a subject, and which contains no additional components which are unacceptably toxic to the subject in the amounts provided in the pharmaceutical composition.
  • the term “effective amount” refers to the amount of a compound e.g., a compositions described herein, cells described herein) sufficient to effect beneficial or desired results.
  • An effective amount can be administered in one or more administrations, applications or dosages and is not intended to be limited to a particular formulation or administration route.
  • the term “treating” includes any effect, e.g., lessening, reducing, modulating, ameliorating or eliminating, that results in the improvement of the condition, disease, disorder, and the like, or ameliorating a symptom thereof.
  • modulate and “modulation” refer to reducing or inhibiting or, alternatively, activating or increasing, a recited variable.
  • increase and activate refer to an increase of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater in a recited variable.
  • reduce and “inhibit” refer to a decrease of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater in a recited variable.
  • Safe Harbor Loci a decrease of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater in a recited variable.
  • Gene editing therapies include, for example, viral vector integration and site specific integration.
  • Site-specific integration is a promising alternative to random integration of viral vectors, as it mitigates the risks of insertional mutagenesis or insertional oncogenesis (Kolb et al. Trends Biotechnol. 2005 23:399-406; Porteus et al. Nat Biotechnol. 2005 23:967- 973; Paques et al. Curr Gen Ther. 2007 7:49-66).
  • site specific integration continues to face challenges such as poor knock-in efficiency, risk of insertional oncogenesis, unstable and/or anomalous expression of adjacent genes or the transgene, low accessibility (e.g. within 20 kB of adjacent genes), etc..
  • SHS safe harbor loci or safe harbor sites
  • the most widely used of the putative human safe harbor sites is the AAVS1 site on chromosome 19q, which was initially identified as a site for recurrent adenoassociated virus insertion.
  • Other potential SHS have been identified on the basis of homology, with sites first identified in other species (e.g., the human homolog of the permissive murine Rosa26 locus) or among the growing number of human genes that appear non-essential under some circumstances.
  • One putative SHS of this type is the CCR5 chemokine receptor gene, which, when disrupted, confers resistance to human immunodeficiency virus infection.
  • Additional potential genomic SHS have been identified in human and other cell types on the basis of viral integration site mapping or gene-trap analyses, as was the original murine Rosa26 locus.
  • the AAVS1 (also known as the PPP1R12C locus) on human chromosome 19 is a known SHS for hosting transgenes (e.g. DNA transgenes) with expected function. It is at position 19ql3.42. It has an open chromatin structure and is transcription-competent.
  • the canonical SHS locus for AAVS1 is chrl9: 55,625,241-55,629,351. See Pellenz et al. “New Human Chromosomal Sites with "Safe Harbor” Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30,7 (2019): 814-828, the relevant disclosures of which are herein incorporated by reference.
  • An exemplary AAVS1 target gRNA and target sequence are provided below:
  • AAVS1 -gRNA sequence • AAVS1 -gRNA sequence: ggggccactagggacaggatGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT
  • CCR5 which is located on chromosome 3 at position 3p21.31, encodes the major co-receptor for HIV-1. Disruption at this site in the CCR5 gene has been beneficial in HIV/AIDS therapy and prompted the development of zinc-finger nucleases that target its third exon.
  • the canonical SHS locus for CCR5 is chr3: 46,414,443-46,414,942. See Pellenz et al. “New Human Chromosomal Sites with "Safe Harbor” Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30,7 (2019): 814-828, the relevant disclosures of which are herein incorporated by reference.
  • the mouse Rosa26 locus is particularly useful for genetic modification as it can be targeted with high efficiency and is expressed in most cell types tested.
  • Irion et al. 2007 (“Identification and targeting of the ROSA26 locus in human embryonic stem cells.” Nature biotechnology 25.12 (2007): 1477-1482, the relevant disclosure of which are herein incorporated by reference) identified the human homolog, human ROSA26, in chromosome 3 (position 3p25.3).
  • the canonical SHS locus for human Rosa26 (hRosa26) is chr3: 9,415,082- 9,414,043. See Pellenz et al. “New Human Chromosomal Sites with "Safe Harbor” Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30,7 (2019): 814-828, the relevant disclosures of which are herein incorporated by reference.
  • the present disclosure is directed to methods for identifying safe harbor loci with benefits including, but not limited to, high knock-in efficiency and high expression of transgene.
  • An example of applications of the presently disclosed methods is the identification of safe harbor loci for insertion of transgenes (e.g., chimeric antigen receptors (CAR)) into T- cells.
  • the safe harbor loci of the present disclsoure are useful for the insertion of a sequence encoding a transgene.
  • the safe harbor sites allow for high transgene expression (sufficient to allow for transgene functionality or treatment of a disease of interest) and stable expression of the transgene over several days, weeks or months.
  • knockout of the gene at the safe harbor locus confers benefit to the function of the cell, or the gene at the safe harbor locus has no known function within the cell.
  • the safe harbor locus results in stable transgene expression in vitro with or without CD3/CD28 stimulation, negligible off-target cleavage as detected by iGuide-Seq or CRISPR-Seq, less off-target cleavage relative to other loci as detected by iGuide-Seq or CRISPR-Seq, negligible transgene-independent cytotoxicity, negligible transgene-independent cytokine expression, negligible transgeneindependent chimeric antigen receptor expression, negligible deregulation or silencing of nearby genes, and positioned outside of a cancer-related gene.
  • a “nearby gene” can refer to a gene that is within about lOOkB, about 125kB, about 150kB, about 175kB, about 200kB, about 225kB, about 250kB, about 275kB, about 300kB, about 325kB, about 350kB, about 375kB, about 400kB, about 425kB, about 450kB, about 475kB, about 500kB, about 525kB, about 550kB away from the safe harbor locus (integration site).
  • the present disclosure contemplates inserts that comprise one or more transgenes.
  • the transgene can encode a therapeutic protein, an antibody, a peptide, a suicide gene, an apoptosis gene or any other gene of interest.
  • the safe harbor loci identified using the method described herein allow for transgene integration that results in , for example, enhanced therapeutic properties.
  • These enhanced therapeutic properties refer to an enhanced therapeutic property of a cell when compared to a typical immune cell of the same normal cell type.
  • an NK cell having “enhanced therapeutic properties” has an enhanced, improved, and/or increased treatment outcome when compared to a typical, unmodified and/or naturally occurring NK cell.
  • the therapeutic properties of immune cells can include, but are not limited to, cell transplantation, transport, homing, viability, self-renewal, persistence, immune response control and regulation, survival, and cytotoxicity.
  • the therapeutic properties of immune cells are also manifested by: antigen-targeted receptor expression; HLA presentation or lack thereof; tolerance to the intratumoral microenvironment; induction of bystander immune cells and immune regulation; improved target specificity with reduction; resistance to treatments such as chemotherapy.
  • the term “insert size” refers to the length of the nucleotide sequence being integrated (inserted) at the safe harbor site. In some embodiments, the insert size comprises at least about 100, 200, 300, 400 or 500 basepairs.
  • the insert size comprises about 500 nucleotides or basepairs. In some embodimetns, the insert size comprises up to 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
  • the insert size is greater than 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
  • the insert size is within the range of 3-15 kbp or is any number in that range. In some embodiments, the insert size is within the range of 1.5-8.3 kbp or is any number in that range. In some embodiments, the insert size is within the range of 1.5-15 kbp or is any number in that range. In some embodiments, the insert size is within the range of 0.5-20 kbp or is any number in that range. In some embodiments, the insert size is 0.5-10, 0.6-10, 0.7-10, 0.8-10, 0.9-10, 1-10, 2-10, 3- 10, 4-10, 5-10, 6-10, 7-10, 8-10, 9-10 kbp.
  • the insert size is 0.5-11, 0.6-11, 0.7-11, 0.8-11, 0.9-11, 1-11, 2-11, 3-11, 4-11, 5-11, 6-11, 7-11, 8-11, 9-11, or 10-11 kbp. In some embodiments, the insert size is 0.5-12, 0.6-12, 0.7-12, 0.8-12, 0.9-12, 1-12, 2- 12, 3-12, 4-12, 5-12, 6-12, 7-12, 8-12, 9-12, 10-12, or 11-12 kbp.
  • the insert size is 0.5-13, 0.6-13, 0.7-13, 0.8-13, 0.9-13, 1-13, 2-13, 3-13, 4-13, 5-13, 6-13, 7-13, 8-13, 9-13, 10-13, 11-13, or 12-13 kbp. In some embodiments, the insert size is 0.5-14, 0.6- 14, 0.7-14, 0.8-14, 0.9-14, 1-14, 2-14, 3-14, 4-14, 5-14, 6-14, 7-14, 8-14, 9-14, 10-14, 11-14, 12-14 or 13-14 kbp.
  • the insert size is 0.5-15, 0.6-15, 0.7-15, 0.8-15, 0.9-15, 1-15, 2-15, 3-15, 4-15, 5-15, 6-15, 7-15, 8-15, 9-15, 10-15, 11-15, 12-15, 13-15, or 14-15 kbp. In some embodiments, the insert size is 0.5-16, 0.6-16, 0.7-16, 0.8-16, 0.9-16, 1-
  • the insert size is 0.5-17, 0.6-17, 0.7-17, 0.8-17, 0.9-17, 1-17, 2-
  • the insert size is 0.5-18, 0.6-18, 0.7-18, 0.8-18, 0.9-18, 1-
  • the insert size is 0.5-19, 0.6-19, 0.7-19, 0.8-19, 0.9-19, 1-19, 2-19, 3-19, 4-19, 5-19, 6-19, 7-19, 8-19, 9-19, 10-19, 11-19, 12-19, 13-19, 14-
  • the insert size is 0.5-20, 0.6-20, 0.7-20, 0.8-20, 0.9-20, 1-20, 2-20, 3-20, 4-20, 5-20, 6-20, 7-20, 8-20, 9-20, 10-20, 11-20, 12-
  • the inserts of the present disclosure refer to nucleic acid molecules or polynucleotide inserted at a safe harbor site.
  • the nucleotide sequence is a DNA molecule, e.g., genomic DNA, or comprises deoxy-ribonucleotides.
  • the insert comprises a smaller fragment of DNA, such as a plastid DNA, mitochondrial DNA, or DNA isolated in the form of a plasmid, a fosmid, a cosmid, a bacterial artificial chromosome (BAC), a yeast artificial chromosome (YAC), and/or any other sub-genome segment of DNA.
  • the insert is an RNA molecule or comprises ribonucleotides.
  • nucleotides in the insert are contemplated as naturally occuring nucleotides, non-naturally occuring, and modified nucleotides.
  • Nucleotides may be modified chemically or biochemically, or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications.
  • the polynucleotides can be in any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpinned, circular conformations, and other three-dimension conformations contemplated in the art.
  • the inserts can have coding and/or non-coding regions.
  • the insert can comprises a non-coding sequence (e.g., control elements, e.g., a promoter sequence).
  • the insert encodes transcription factors.
  • the insert encodes an antigen binding receptors such as single receptors, T-cell receptors (TCRs), syn- notch, CARs, mAbs, etc.
  • the inserts are RNAi molecules, including, but not limited to, miRNAs, siRNA, shRNAs, etc.
  • the insert is a human sequence.
  • the insert is chimeric.
  • the insert is a multi-gene/multi-module therapeutic cassette.
  • a multi-gene/multi-module therapeutic cassette referst to an insert or cassette having one or more than one receptor (e.g., synthetic receptors), other exogenous protein coding sequences, non-coding RNAs, transcriptional regulatory elements, and/or insulator sequences, etc.
  • receptor e.g., synthetic receptors
  • other exogenous protein coding sequences e.g., non-coding RNAs, transcriptional regulatory elements, and/or insulator sequences, etc.
  • a cell comprising a safe harbor site and/or a cell comprising an insert at a safe harbor site as described in the present disclosure can be referred to as an engineered cell.
  • the cells can include, but are not limited to, eukaryotic cells, prokaryotic cells, animal cells, plant cells, fungal cells and the like.
  • the cell is a mammalian cell, for example, a human cell.
  • that engineered cell is a stem cell, a human cell, a primary cell, an hematopoietic cell, an adaptive immune cell, an innate immune cell, a T cell or a T cell progenitor.
  • Non-limiting examples of immune cells that are contemplated in the present disclosure include T cell, B cell, natural killer (NK) cell, NKT/iNKT cell, macrophage, myeloid cell, and dendritic cells.
  • Non-limiting examples of stem cells that are contemplated in the present disclosure include pluripotent stem cells (PSCs), embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), embryo-derived embryonic stem cells obtained by nuclear transfer (ntES; nuclear transfer ES), male germline stem cells (GS cells), embryonic germ cells (EG cells), hematopoietic stem/progenitor stem cells (HSPCs), somatic stem cells (adult stem cells), hemangioblasts, neural stem cells, mesenchymal stem cells and stem cells of other cells (including osteocyte, chondrocyte, myocyte, cardiac myocyte, neuron, tendon cell, adipocyte, pancreocyte, hepatocyte, nephrocyte and follicle cells and so on
  • the engineered cells is a T cell, NK cells, iPSC, and HSPC.
  • the engineered cells used in the present disclosure are human cell lines grown in vitro (e.g. deliberately immortalized cell lines, cancer cell lines, etc.).
  • the methods for integrating the inserts at the safe harbor sites can be viral or non- viral delivery techniques.
  • the nucleic acid sequence is inserted into the genome of the engineered cell by introducing a vector, for example, a viral vector, comprising the nucleic acid.
  • a viral vector for example, a viral vector
  • examples of viral vectors include, but are not limited to, adeno-associated viral (AAV) vectors, retroviral vectors or lentiviral vectors.
  • the lentiviral vector is an integrase-deficient lentiviral vector.
  • the nucleic acid sequence is inserted into the genome of the T cell via non-viral delivery.
  • the nucleic acid can be naked DNA, or in a non-viral plasmid or vector.
  • Non-viral delivery techniques can be site-specific integration techniques, as described herein or known to those of ordinary skill in the art. Examples of site-specific techniques for integration into the safe harbor loci include, without limitation, homology-dependent engineering using nucleases and homology independent targeted insertion using Cas9.
  • the non-viral delivery method comprises electroporation.
  • the insert is integrated at a safe harbor site by introducing into the engineered cell, (a) a targeted nuclease that cleaves a target region in the safe harbor site to create the insertion site; and (b) the nucleic acid sequence (insert), wherein the insert is incorporated at the insertion site by, e.g., HDR.
  • a targeted nuclease that cleaves a target region in the safe harbor site to create the insertion site
  • the nucleic acid sequence (insert) wherein the insert is incorporated at the insertion site by, e.g., HDR.
  • Examples of non-viral delivery techniques that can be used in the methods of the present disclosure are provided in US Application Nos. 16/568,116 and 16/622,843, the relevant disclosures of which are herein incorporated by reference in their entirety.
  • the engineered cell can retain its undifferentiated state after insertion of the transgenes.
  • the engineered cell is undifferentiated. In some embodiments, the engineered cell is undifferentiated after insert of the transgene. In some embodiments, the engineered cell is CD45RA + and CCR7 + after insertion of the transgene. In some embodiments, the engineered cell is CD45RA + CCR7 + CD27 + after insertion of the transgene.
  • Chimeric antigen receptor (CAR) T cells are T cells that have been genetically engineered to produce an artificial T-cell receptor for use in immunotherapy.
  • Chimeric antigen receptors are receptor proteins that have been engineered to confer T cells with the ability to target a specific protein.
  • the genetic modification of lymphocytes (e.g. T cells) by incorporation of, for example, CARs, and administration of the engineered cells to a subject is an example of “adoptive cell therapy”.
  • the term “adoptive cell therapy” refers to cell-based immunotherapy for transfusion of autologous or allogeneic lymphocytes, referred to as T cells or B cells. In this CAR therapy approach, cells are expanded and cultured ex vivo and genetically modified, prior to transfusion.
  • T-cells are harvested from a subject — they can be autologous T-cells from the subject own blood or from a donor that will not be receiving the CAR therapy. Once isolated, the T-cells are genetically modified with a CAR, expanded ex vivo, and administered to the subject (i.e. patient) by, e.g. infusion.
  • the CARs may be introduced into the T-cells using, for example, a viral technique (e.g., retroviral integration) or site-specific technique.
  • a viral technique e.g., retroviral integration
  • site-specific technique e.g. CARs
  • the transgenes may be targeted to a safe harbor locus.
  • site-specific techniques for integration into the safe harbor loci include, without limitation, homology-dependent engineering using nucleases and homology independent targeted insertion using Cas9.
  • the engineered CAR T cells have applications to immune-oncology.
  • the CAR for example, can be selected to target a specific tumor antigen.
  • cancers that can be effectively targeted using CAR T cells are blood cancers.
  • CAR T cell therapy can be used to treat solid tumors.
  • gene editing or “genome editing”, as used herein, refer to a type of genetic manipulation in which DNA is inserted, replaced, or removed from the genome using artificially manipulated nucleases or “molecular scissors”. It is a useful tool for elucidating the function and effect of sequence-specific genes or proteins or altering cell behavior (e.g. for therapeutic purposes).
  • TALENs transcription activator-like effector nucleases
  • safe harbor loci e.g. the adeno-associated virus integration site 1 (AAVS1) safe harbor locus.
  • AAVS1 adeno-associated virus integration site 1
  • DICE dual integrase cassette exchange
  • phiC31 integrase and Bxbl integrase phiC31 integrase
  • Bxbl integrase a tool for target integration.
  • CRISPR/Cas9 clustered regularly interspaced short palindromic repeat/Cas9
  • Site specific gene editing approaches can include homology dependent mechanisms or homology independent mechanisms.
  • One effective example of gene editing is the Crisp-Cas approach (e.g. Crispr- Cas9).
  • This approach incorporates the use of a guide polynucleotide (e.g. guide ribonucleic acid or gRNA) and a cas endonuclease (e.g. Cas9 endonuclease).
  • a guide polynucleotide e.g. guide ribonucleic acid or gRNA
  • a cas endonuclease e.g. Cas9 endonuclease
  • a polypeptide referred to as a “Cas endonuclease” or having “Cas endonuclease activity” refers to a CRISPR-related (Cas) polypeptide encoded by a Cas gene, wherein a Cas polypeptide is a target DNA sequence that can be cleaved when operably linked to one or more guide polynucleotides (see, e.g., US Pat. No. 8,697,359). Also included in this definition are variants of Cas endonuclease that retain guide polynucleotide-dependent endonuclease activity.
  • the Cas endonuclease used in the donor DNA insertion method detailed herein is an endonuclease that introduces double-strand breaks into DNA at the target site (e.g., within the target locus or at the safe harbor site).
  • guide polynucleotide relates to a polynucleotide sequence capable of complexing with a Cas endonuclease and allowing the Cas endonuclease to recognize and cleave a DNA target site.
  • the guide polynucleotide can be a single molecule or a double molecule.
  • the guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (RNA-DNA combination sequence).
  • a guide polynucleotide comprising only ribonucleic acid is also referred to as “guide RNA”.
  • a polynucleotide donor construct is inserted at a safe harbor locus using a guide RNA (gRNA) in combination with a cas endonuclease (e.g. Cas9 endonuclease).
  • gRNA guide RNA
  • cas endonuclease e.g. Cas9 endonuclease
  • the guide polynucleotide includes a first nucleotide sequence domain (also referred to as a variable targeting domain or VT domain) that is complementary to a nucleotide sequence in the target DNA, and a second nucleotide that interacts with a Cas endonuclease polypeptide.
  • It can be a double molecule (also referred to as a double-stranded guide polynucleotide) comprising a sequence domain (referred to as a Cas endonuclease recognition domain or CER domain).
  • the CER domain of this double molecule guide polynucleotide comprises two separate molecules that hybridize along the complementary region.
  • the two separate molecules can be RNA sequences, DNA sequences and/or RNA- DNA combination sequences.
  • Genome editing using CRISPR-Cas approaches relies on the repair of site-specific DNA double-strand breaks (DSBs) induced by the RNA-guided Cas endonuclease (e.g. Cas 9 endonuclease). Homology-directed repair (HDR) of these DSBs enables precise editing of the genome by introducing defined genomic changes, including base substitutions, sequence insertions, and deletions.
  • HDR-based CRISPR/Cas9 genome-editing involves transfecting cells with Cas9, gRNA and donor DNA containing homologous arms matching the genomic locus of interest.
  • HITI non-homologous end joining
  • NHEJ non-homologous end joining
  • gRNAs Guide RNAs
  • donor plasmids lack homology arms and DSB repair does not occur through the HDR pathway.
  • the donor polynucleotide construct can be engineered to include Cas9 cleavage site(s) flanking the gene or sequence to be inserted. This results in Cas9 cleavage at both the donor plasmid and the genomic target sequence. Both target and donor have blunt ends and the linearized donor DNA plasmid is used by the NHEJ pathway resulting integration into the genomic DSB site.
  • the guide RNAs and/or mRNA (or DNA) encoding an endonuclease can be chemically linked to one or more moi eties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide.
  • Non-limiting examples of such moieties include lipid moieties such as a cholesterol moiety, cholic acid, a thioether, a thiocholesterol, an aliphatic chain (e.g., dodecandiol or undecyl residues), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O-hexadecyl- rac-glycero-3-H- phosphonate, a polyamine or a polyethylene glycol chain, adamantane acetic acid, a palmityl moiety and an octadecylamine or hexylamino-carbonyl-t oxycholesterol moiety. See for example US Application No. 15/715,068, the disclosures of which are herein incorporated by reference in their entirety.
  • the engineered cells, populations thereof, or compositions thereof are administered to a subject, generally a mammal, generally a human, in an effective amount.
  • the engineered cells may be administered to a subject by infusion e.g., continuous infusion over a period of time) or other modes of administration known to those of ordinary skill in the art.
  • the engineered cells provided herein can be administered as part of a pharmaceutical compositions.
  • the present disclosure provides compositions comprising a guide RNA of the present disclosure.
  • the pharmaceutical composition may comprise one or more pharmaceutical excipients. Any suitable pharmaceutical excipient may be used, and one of ordinary skill in the art is capable of selecting suitable pharmaceutical excipients. Accordingly, the pharmaceutical excipients provided below are intended to be illustrative, and not limiting. Additional pharmaceutical excipients include, for example, those described in the Handbook of Pharmaceutical Excipients, Rowe et al. (Eds.) 6th Ed. (2009), incorporated by reference in its entirety.
  • the engineered cells provided herein not only find use in gene therapy but also in non-pharmaceutical uses such as, e.g., production of animal models and production of recombinant cell lines expressing a protein of interest.
  • the engineered cells of the present disclosure can be any cell, generally a mammalian cell, generally a human cell that has been modified by integrating a transgene at a safe harbor locus described herein.
  • the engineered cells are immune cells.
  • the engineered cells are lymphocytes.
  • the engineered cells are T cells or T cell progenitors.
  • the engineered cells, compositions and methods of the present disclosure are useful for therapeutic applications such as CAR T cell therapy and TCR T cell therapy.
  • the insertion of a sequence encoding a transgene within a safe harbor locus maintains the TCR expression relative to instances when there is no insertion and enables transgene expression while maintaining TCR function.
  • Non-limiting examples of such diseases include alopecia areata, autoimmune hemolytic anemia, autoimmune hepatitis, cancer, dermatomyositis, diabetes (type 1), certain juvenile idiopathic arthritis, glomerulonephritis, Graves' disease, Guillain Valley Syndrome, idiopathic thrombocytopenic purpura, myasthenia gravis, certain myocarditis, multiple sclerosis, pemphigus/pemphigoid, pernicious anemia, polyarteritis nodosa, polymyositis, primary bile With cirrhosis, psoriasis, rheumatoid arthritis, scleroderma/systemic sclerosis, Sjogren's syndrome, systemic lupus erythematosus, certain thyroiditis, certain uveitis, vitilig
  • Cancers that can be treated with the engineered cells (e.g., CAR T-cells) of the present disclosure, populations thereof, or compositions thereof include blood cancers.
  • the cancer treated using the engineered cells (e.g., CAR T-cells) described herein, populations thereof, or compositions thereof is a hematologic malignancy or leukemia.
  • the engineered cells (e.g., CAR T-cells) described herein, populations thereof, or compositions thereof are used for the treatment of acute lymphoblastic leukemia (ALL) or diffuse large B-cell lymphoma (DLBCL).
  • ALL acute lymphoblastic leukemia
  • DLBCL diffuse large B-cell lymphoma
  • the cancer is acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), myelodysplasia, myelodysplastic syndromes, acute T-lymphoblastic leukemia, or acute promyelocytic leukemia, chronic myelomonocytic leukemia, or myeloid blast crisis of chronic myeloid leukemia.
  • AML acute myeloid leukemia
  • ALL acute lymphoblastic leukemia
  • myelodysplasia myelodysplasia
  • myelodysplastic syndromes myelodysplastic syndromes
  • acute T-lymphoblastic leukemia or acute promyelocytic leukemia
  • chronic myelomonocytic leukemia chronic myelomonocytic leukemia
  • myeloid blast crisis of chronic myeloid leukemia.
  • cancers treatable using the engineered cells (e.g., CAR T-cells) described herein include, without limitation, breast cancer, ovarian cancer, esophageal cancer, bladder or gastric cancer, salivary duct carcinoma, salivary duct carcinomas, adenocarcinoma of the lung or aggressive forms of uterine cancer, such as uterine serous endometrial carcinoma.
  • the cancer is brain cancer, breast cancer, cervical cancer, colon cancer, colorectal cancer, endometrial cancer, esophageal cancer, leukemia, lung cancer, liver cancer, melanoma, ovarian cancer, pancreatic cancer, rectal cancer, renal cancer, stomach cancer, testicular cancer, or uterine cancer.
  • the cancer is a squamous cell carcinoma, adenocarcinoma, small cell carcinoma, melanoma, neuroblastoma, sarcoma (e.g., an angiosarcoma or chondrosarcoma), larynx cancer, parotid cancer, biliary tract cancer, thyroid cancer, acral lentiginous melanoma, actinic keratoses, acute lymphocytic leukemia, acute myeloid leukemia, adenoid cystic carcinoma, adenomas, adenosarcoma, adenosquamous carcinoma, anal canal cancer, anal cancer, anorectum cancer, astrocytic tumor, bartholin gland carcinoma, basal cell carcinoma, biliary cancer, bone cancer, bone marrow cancer, bronchial cancer, bronchial gland carcinoma, carcinoid, cholangiocarcinoma, chondrosarcoma, choroid
  • the present disclosure provides methods of treating a subject in need of treatment by administering to the subject a composition comprising any of the engineered cells described herein.
  • the terms “treat,” “treatment,” and the like refer generally to obtaining a desired pharmacological and/or physiological effect. That effect is preventive in terms of complete or partial prevention of the disease and/or therapeutic in terms of partial or complete cure of the disease and/or adverse effects resulting from the disease.
  • treatment encompasses any treatment of a disease in a subject (e.g., mammal, e.g., human).
  • Treatment may also refer to the administration of the engineered cells provided herein to a subject that is susceptible to the disease but has not yet been diagnosed as suffering from it, including preventing the disease from occurring; inhibiting disease progression; or reducing the disease (i.e., causing a regression of the disease). Further, treatment may stabilize or reduce undesirable clinical symptoms in subjects (e.g., patients).
  • the cells provided herein populations thereof, or compositions thereof may be administered before, during or after the occurrence of the disease or injury.
  • the subject has a disease, condition, and/or injury that can be treated and/or ameliorated by cell therapy.
  • the subject in need of cell therapy is a subject having an injury, disease, or condition, thereby causing cell therapy (e.g., therapy in which cellular material is administered to the subject).
  • cell therapy e.g., therapy in which cellular material is administered to the subject.
  • a subject in need of cell therapy includes, but is not limited to, a bone marrow transplant or stem cell transplant candidate, a subject who has received chemotherapy or radiation therapy, a hyperproliferative disease or cancer (e.g., a hematopoietic system), a subject having or at risk of developing a hyperproliferative disease or cancer), a subject having or at risk of developing a tumor (e.g., solid tumor), viral infection or virus. It is also intended to encompass subjects suffering from or at risk of suffering from a disease associated with an infection.
  • a hyperproliferative disease or cancer e.g., a hematopoietic system
  • a subject having or at risk of developing a hyperproliferative disease or cancer e.g., solid tumor
  • a tumor e.g., solid tumor
  • the present disclosure provides a composition of the present disclosure along with instructions for use.
  • the instructions for use can be present in the kits as a package insert, in the labeling of the container of the kit or components thereof, or can be in digital form (e.g. on a CD-ROM, via a link on the internet).
  • a kit can include one or more of a genome-targeting nucleic acid, a polynucleotide encoding a genometargeting nucleic acid, a site-directed polypeptide, and/or a polynucleotide encoding a site- directed polypeptide. Additional components within the kits are also contemplated, for example, buffer (such as reconstituting buffer, stabilizing buffer, diluting buffer), and/or one or more control vectors.
  • an engineered cells of the present disclosure or composition thereof is administered with at least one additional therapeutic agent.
  • Any suitable additional therapeutic agent may be administered with an engineered cell provided herein, populations thereof, or compositions thereof.
  • the additional therapeutic agent is selected from radiation, an ophthalmologic agent, a cytotoxic agent, a chemotherapeutic agent, a cytostatic agent, an anti-hormonal agent, an immunostimulatory agent, an anti-angiogenic agent, and combinations thereof.
  • an engineered cell of the present disclosure or composition thereof is administered with a steroid.
  • the administration of a steroid can prevent or mitigate the risk of a subject receiving the engineered cell(s) or composition thereof having an autoimmune reaction.
  • the additional therapeutic agent may be administered by any suitable means.
  • the engineered cells described herein, populations thereof, or compositions thereof and the additional therapeutic agent is administered in the same pharmaceutical composition, e.g. by infusion.
  • the engineered cells described herein and additional therapeutic agent are included in different pharmaceutical compositions.
  • the pharmaceutical composition may comprise one or more pharmaceutical excipients. Any suitable pharmaceutical excipient may be used, and one of ordinary skill in the art is capable of selecting suitable pharmaceutical excipients. Accordingly, the pharmaceutical excipients provided below are intended to be illustrative, and not limiting. Additional pharmaceutical excipients include, for example, those described in the Handbook of Pharmaceutical Excipients, Rowe el al. (Eds.) 6th Ed. (2009), incorporated by reference in its entirety.
  • the additional therapeutic agent is administered by any suitable mode of administration.
  • modes of administration include, without limitation, intravitreal, subretinal, suprachoroidal, intraarterial, intradermal, intramuscular, intraperitoneal, intravenous, nasal, parenteral, topical, pulmonary, and subcutaneous routes.
  • administration of the engineered cells provided herein can occur prior to, simultaneously, and/or following, administration of the additional therapeutic agent.
  • engineered cells comprising at least one sequence encoding a transgene, wherein the at least one sequence is inserted within a safe harbor locus; wherein the safe harbor locus is at any one or more of the sgRNA target loci selected from: chrl0:33130000-33140000, chrl0:72290000-72300000, chrl 1:128340000- 128350000, chrl 1 :65425000-65427000 (NEAT1), chrl 5:92830000-92840000, chrl6: 11220000-11230000, chr2:87460000-87470000, chr3: 186510000- 186520000, chr3: 59450000-59460000, chr8: 127980000-128000000, chr9:7970000-7980000, APRT, B2M, CAPNS1, CBLB, CD2, CD3E, CD3G, CD
  • expression of the at least one sequence encoding the transgene is operatively linked to an endogenous promoter.
  • expression of the at least one sequence encoding the transgene is operatively linked to an exogenous promoter.
  • the target locus is selected from: chrlO:33130000- 33140000, chrl0:72290000-72300000, chrl 1 : 128340000-128350000, chrl 1:65425000- 65427000 (NEAT1), chrl 5:92830000-92840000, chrl6: 11220000-11230000, chr2 : 87460000-87470000, chr3 : 186510000- 186520000, chr3 : 59450000-59460000, chr8: 127980000-128000000, and chr9:7970000-7980000.
  • the target locus is chrl 1 : 128340000-128350000 or chrl 5:92830000-92840000.
  • the target locus is a gene selected from: APRT, B2M, CAPNS1, CBLB, CD2, CD3E, CD3G, CD5, EDF1, FTL, PTEN, PTPN2, PTPN6, PTPRC, PTPRCAP, RPS23, RTRAF, SERF2, SLC38A1, SMAD2, S0CS1, SRP14, SRSF9, SUB1, TET2, TIGIT, TRAC, and TRIM28.
  • the safe harbor locus is the GS94 or GS102 integration site in Table 4.
  • the exogenous promoter is an EFla promoter.
  • the engineered cell is a natural killer (NK) cell, an induced pluripotent stem cells (iPSC), a human pluripotent stem cell (HSPC), a T cell or a T cell progenitor.
  • NK natural killer
  • iPSC induced pluripotent stem cells
  • HSPC human pluripotent stem cell
  • T cell T cell progenitor
  • the transgene encodes a recombinant protein, a therapeutic agent, or a chimeric antigen receptor (CAR).
  • CAR chimeric antigen receptor
  • compositions comprising the engineered cell described herein and a pharmaceutical excipient.
  • gRNA guide ribonucleic acids
  • methods of editing a cell having chromosomal DNA comprising inserting at least one sequence encoding a transgene within a safe harbor locus in the chromosomal DNA of the cell, wherein the safe harbor locus is at any one or more of the sgRNA target loci selected from: chrl 0:33130000-33140000, chrl0:72290000-72300000, chrl 1 : 128340000-128350000, chrl 1 :65425000-65427000 (NEAT1), chrl 5:92830000-92840000, chrl6: 11220000-11230000, chr2: 87460000- 87470000, chr3: 186510000- 186520000, chr3: 59450000-59460000, chr8: 127980000- 128000000, chr9:7970000-7980000, APRT, B2M,
  • the target locus is selected from: chrlO:33130000- 33140000, chrl0:72290000-72300000, chrl 1 : 128340000-128350000, chrl 1:65425000- 65427000 (NEAT1), chrl 5:92830000-92840000, chrl6: 11220000-11230000, chr2 : 87460000-87470000, chr3 : 186510000- 186520000, chr3 : 59450000-59460000, chr8: 127980000-128000000, and chr9:7970000-7980000.
  • the target locus is chrl 1 : 128340000-128350000 or chrl 5:92830000-92840000.
  • the target locus is a gene selected from: APRT, B2M, CAPNS1, CBLB, CD2, CD3E, CD3G, CD5, EDF1, FTL, PTEN, PTPN2, PTPN6, PTPRC, PTPRCAP, RPS23, RTRAF, SERF2, SLC38A1, SMAD2, S0CS1, SRP14, SRSF9, SUB1, TET2, TIGIT, TRAC, and TRIM28.
  • the transgene encodes a recombinant protein, a therapeutic agent, or a chimeric antigen receptor (CAR).
  • CAR chimeric antigen receptor
  • the at least one sequence comprises an exogenous promoter and the exogenous promoter is operably linked to the transgene.
  • the cell is a T cell or T cell progenitor.
  • the at least one sequence is inserted using a homology- directed repair or a homology independent targeted insertion.
  • the at least one sequence is inserted using one or more guide ribonucleic acids (gRNAs) and one or more Cas9 endonucleases, wherein the one or more gRNAs comprises any one of SEQ ID NOS: 1-120.
  • gRNAs guide ribonucleic acids
  • Cas9 endonucleases wherein the one or more gRNAs comprises any one of SEQ ID NOS: 1-120.
  • ex vivo methods of obtaining an engineered cell or population thereof comprising: obtaining a cell; genetically modifying the cell by inserting at least one sequence encoding a transgene within a safe harbor locus, wherein the safe harbor locus is at any one or more of the sgRNA target loci selected from: chrl0:33130000-33140000, chrl0:72290000-72300000, chrl 1 : 128340000-128350000, chrl 1 :65425000-65427000 (NEAT1), chrl 5:92830000-92840000, chrl6: l 1220000- 11230000, chr2:87460000-87470000, chr3: 186510000- 186520000, chr3:59450000- 59460000, chr8: 127980000-128000000, chr9:7970000-7980000, APRT, B
  • the cell is a stem cell, a natural killer (NK) cell, an induced pluripotent stem cells (iPSC), a human pluripotent stem cell (HSPC), a T cell or a T cell progenitor.
  • NK natural killer
  • iPSC induced pluripotent stem cells
  • HSPC human pluripotent stem cell
  • T cell T cell progenitor
  • the at least one sequence is inserted using a homology- directed repair or a homology independent targeted insertion.
  • the genetically modifying in step (b) comprises contacting the cell with one or more guide ribonucleic acids (gRNAs), the at least one sequence, and one or more Cas9 endonucleases, wherein the one or more gRNAs and Cas9 endonucleases facilitate the insertion of the at least one sequence into chromosomal DNA within the safe harbor locus and wherein the one or more gRNAs comprises any one of SEQ ID NOS: 1-120.
  • gRNAs guide ribonucleic acids
  • Cas9 endonucleases facilitate the insertion of the at least one sequence into chromosomal DNA within the safe harbor locus and wherein the one or more gRNAs comprises any one of SEQ ID NOS: 1-120.
  • the at least one sequence comprises an exogenous promoter and the exogenous promoter is operably linked to the transgene.
  • provided herein are methods of treating a subject having or at risk of having a disease, comprising administering to the subject an effective amount of the engineered cell described herein.
  • kits for treating a subject having or at risk of having a disease comprising: conducting the method described herein; and administering to the subject an effective amount of a composition comprising the cell or a population thereof.
  • the disease is cancer.
  • Table 1 Criteria used for identification of candidate knock-in loci within coding regions
  • FIG 4A and FIG 4B show the processed RNA-seq data, showing that samples cluster based on activation status and by cell type.
  • Donor 4 (AKI4) was identified as an outlier, as it clustered differently than the others, and was removed from remaining analysis.
  • the transcript expression data from RNA-seq experiments on the 90 genes cited in the Roth, T.L. et al. paper was correlated to transcript expression data in Roth, T.L. et al. paper. (See FIG. 5A and FIG. 5B)
  • FIG. 6 shows the process ATAC-seq data, which focused on the 10 kb area around the transcription start site (TSS). Again, donor 4 (AKI4) was identified as an outlier, based on expression profile in both CD4 and CD8 cells, and was removed from remaining analysis. The results of the remaining ATAC-seq analysis are shown in FIGS. 7A-8. The data in FIG. 7A for TSS enrichment scores also indicated that all libraries were high quality. The data on open chromatin regions around the TRAC locus revealed the highest signal near exon 3 rather than exon 1 (FIG. 8)
  • FIG. 11 shows KI efficiency versus day 2 (d2) RNA-seq data, day 4 (d4) RNA seq data, and d2 ATAC data.
  • the linear model was applied to remaining candidate genes to estimate their KI efficiency.
  • the candidate coding loci were selected by first ranking all genes in the pooled data sets by predicted KI efficiency, using RNA-seq expression data from d2 (day 2).
  • the candidate loci also had to be accessible based on ATAC-seq data.
  • 16 well- characterized coding genes were selected as candidate genes. The knockout of these 16 would confer a benefit to the function of CAR T cells (e.g. B2M, CD5, SMAD2, PTPRC, CD3E).
  • An additional 12 coding genes with high predicted KI efficiency and no apparent essential function were selected as candidate genes. (See
  • FIG. 12 is a plot showing the normalized ATAQ SEQ data for a top candidate non-coding region.
  • NGS next generation sequencings
  • ⁇ eGFP was used as the reporter ⁇ V ector b ackb one : pUC 57 -Kan b ackb one
  • FACS panel GFP, TCR, Zombie
  • RNA-seq data at dO, d2, and d4 (to determine stable expression)
  • ATAC-seq data at d2 (to identify activated cells).
  • the methods used for conducting the RNA-seq and ATAC-seq experiments are in Roth, T. L., et al. 2019. (Rapid discovery of synthetic DNA sequences to rewrite endogenous T cell circuits. bioRxiv, 604561), which is herein incorporated by reference in its entirety.
  • the loci were ranked based on mean florescence intensity (MFI) of reporter gene, GFP, and KI efficiency.
  • MFI mean florescence intensity
  • FIG. 29 shows GFP MFI and KI efficiency for all significant loci having endogenous promoters.
  • the B2M locus reported the highest GFP MFI.
  • the TRAC locus was among the top 10 MFI.
  • the highest GFP MFI readings were reported in week 1 and reduced slightly in weeks 3 and 4.
  • the results also showed most top loci have more than 1 sgRNA.
  • the SOCS1 locus reported the highest KI efficiency.
  • Overall, KI efficiency showed greater variation among donors than GFP MFI.
  • FIG. 30 shows GFP MFI and KI efficiency for all significant loci having exogenous promoters (e.g. EFla promoters).
  • the TRAC locus reported the highest GFP MFI. There was comparable expression between weeks 3 and 4. The results also showed most top loci have more than 1 sgRNA.
  • the SOCS1 locus reported the highest KI efficiency. Overall, KI efficiency showed less variation when driven by the exogenous promoters than when driven by endogenous promoters.
  • FIGS. 31A, 31B, and 31C show GFP MFI and KI efficiency for all significant loci having endogenous and exogenous (e.g., EFla) promoters.
  • endogenous and exogenous (e.g., EFla) promoters The results showed that expression driven by EFla promoters is about 10 X higher than endogenous promoters (FIG. 31 A).
  • KI efficiency the SOCS1 locus reported the highest KI efficiency. At weeks 3 and 4, KI efficiency was higher when driven by the exogenous promoters than when driven by endogenous promoters.
  • Example 5 Evaluation of TCR expression in candidate noncoding sites [00259] This experiment was conducted to identify target loci and integration sites that enable high transgene expression without disrupting the TCR. Some gene deserts (e.g. gene deserts 2, 3, 5, and 6) were identified as having high transgene expression (FIG. 32A). [00260] To evaluate and identify preferred knock-in sites, TCR expression was measured following circuit cassette knock in of PrimeR (Prime Receptor (Myc)). Myc denotes an N- terminal Myc epitope tag to facilate detection of surface expressed primer receptor. Briefly, CD3-CD28 Dynabead-activated T cells were electroporated with sgRNA/Cas9 RNPs targeting the indicated sites (see FIG.
  • GS94 is a candidate integration site located on chromosome H’s distal q arm. It is within 180-350kb of the promoters for ETS1 and FLU (FIG. 33B), however that is considered low-risk for integration vector gene therapy. The circuit expression and function potential of the GS94 gene was evaluated.
  • T cells underwent circuit cassette integration with PrimeR at GS79 (TRAC) integration site and GS94 integration site.
  • the cells were cocultured with K562 C19 cells for 48 hours and then the PrimeR induced CAR MFI was compared to the PrimeR MFI.
  • T cells generated as described in the Example above were cocultured with K562 CD19+/MSLN- cells at day 7 post-electroporation.
  • MSLN mesothelin
  • GS94 yields superior CAR induction with high prime R expression following the 48-hour coculture with the K562 C19 cells. See FIG. 34A.
  • GS94 resulted in prime antigen-dependent CAR expression that was approximately two-fold higher than the expression in several other candidate integration sites as well as the TRAC integration site. Additionally, on average, the prime receptor surface expression level was no less than 50% of expression level when using the TRAC integration site.
  • T cells that had undergone circuit cassette integration with PrimeR at GS79 (TRAC) integration site and GS94 integration site were cocultured with K562 C19/MSLN cells for 48 hours.
  • MSLN is a gene that is overexpressed in human pancreatic cancer.
  • the cells were treated at a 1 : 1 effectortarget cell ratio (1 : 1 E:T)).
  • T cells generated as described above were cocultured with K562 CD19+/MSLN+ cells at day 7 postelectroporation. 48h post initiation of coculture, supernatants were collected and analyzed via Luminex for cytokine levels.
  • the cytokines measure were IL-2, INFg, and TNF. Cytotoxicity was analyzed by measuring luciferase activity of remaining target cells after 48h. Each of the data points in FIG. 34B represent two replicates and the lines represent the range of cytotoxicity for the replicates. As shown in FIG. 34B, the GS94 integration sites resulted in superior cy cotoxic ability and cytokine secretion following the 48-hour coculture with K562 C19/MSLN cells.
  • T cells that had undergone circuit cassette integration with PrimeR at GS79 (TRAC) integration site and GS94 integration site were cocultured with K562 CD19+/MSLN+ cells or K562 CD19-/MSLN+ cells (“K562 MSLN”) at day 7 postelectroporation for 48 hours. 0.3, 1.0, and 3.0 E:T cell ratios were tested. See FIG. 35A and FIG. 35B.
  • cytotoxicity was analyzed by measuring luciferase activity of remaining target cells
  • the GS94 integration site resulted in equivalent cytotoxic potential to the TRAC integration site and there was no prime-independent cytotoxicity.
  • a group that had target cells only (E:T 0; Targets only) was compared to a group with an E:T cell ratio of 1.
  • E:T 0; Targets only
  • E:T 0; Targets only
  • Luminex for cytokine levels to measure secretion of IL-2, INFg and TNF cytokines. See FIG. 36A and FIG. 36B.
  • the GS94 integration site resulted in equivalent cytokine secretion to the TRAC integration site and and there was no prime-independent secretion of IL-2, INFg or TNF.
  • Prime-independent CAR expression To evaluate the effect of the candidate integration site on prime-independent CAR expression, T cells that had undergone circuit cassette integration with PrimeR at GS79 (TRAC) integration site, GS94 integration site, and GS102 integration site were cultured in vitro for 32 days. The cells were treated with repetitive CD3/CD28 stimulation at days 5, 12, 19 and 28 of the experiment. On Day 16, the cells were evaluated for CAR expression using a flow cytometry assay. As shown in FIG. 37, T cell activation through TCR did not result in prime R-independent CAR expression from circuit cassette integration at the candidate integration sites.
  • T cells that had undergone circuit cassette integration with PrimeR at GS79 (TRAC) integration site, GS94 integration site, and GS102 integration site were cultured in vitro for 32 days. The cells were treated with repetitive CD3/CD28 stimulation at days 5, 12, 19 and 28 of the experiment. On Day 16, the cells were evaluated for CAR expression using a flow cytometry assay. As shown in FIG. 37, T cell activation through TCR did
  • T cells generated as described above were cultured in 96-well plates, with T cell growth medium being exchanged every 2 days. At days 5, 12, 19 and 28, T cells were stimulated with 1 : 1 CD3/CD28 Dynabeads. Cells were analyzed for PrimeR expression by myc epitope tag staining, and for CAR expression by FLAG epitope tag staining at the indicated time points. Flow analysis was performed on an Attune NxT flow cytometer.
  • Example 7 Evaluating stability of prime receptor expression over several weeks [00270]
  • T cells that had undergone circuit cassette integration with PrimeR at the integration sites indicated in FIG. 38 were cultured in vitro for 32 days. Briefly, T cells generated as described above were cultured in 96-well plates, with T cell growth medium being exchanged every 2 days. At days 5, 12, 19 and 28, T cells were stimulated with 1 : 1 CD3/CD28 Dynabeads repetitive stimulation. Flow cytometry assays were run on days 16 and 32 using an Attune NxT flow cytometer. The cells were analyzed for PrimeR expression by myc epitope tag staining. As shown in FIGS. 38A and 38B, the GS94 integration site resulted in stable PrimeR expression over at least a 4-week period.
  • Elevation prediction Computational predictions of potential off-target sites from (gs94) were performed using Elevation- search (algorithm described in Listberg et al. 2018. Prediction of off-target activities for the end-to-end design of CRISPR guide RNAs. Nat Biomed Engr 2, 37-48; software obtained from https://github.com/Microsoft/Elevation). All sites identified by Elevation-search were subjected to analysis using rhAmp-seq.
  • rhAmpSeq 49 candidate off-target sites for GS94 identified by iGUIDE or the Elevation prediction algorithm and the GS94 target site were characterized by rhAmpSeq (Integrated DNA Technologies, Inc.). This targeted amplification enables NGS-based quantification of the editing occurring at numerous sites simultaneously. Genomic DNA from T cells from at least 2 donors that had been treated singly with each of the following 7 guides: GS84, GS94, GS95, GS96, GS102, GS108, and GS138 was isolated with the GenFind V3 DNA purification system (Beckman Coulter).
  • rhAmpSeq amplification pools Two separate rhAmpSeq amplification pools were used to cover the 50 loci, the procedure was performed as recommended by Integrated DNA Technologies for each of the samples.
  • the rhAmpSeq libraries were sequenced on a MiniSeq with a Mid Output Kit (300-cycles) (Illumina).
  • the CRISPResso2 algorithm https://github.com/pinellolab/CRISPResso2 was used to determine the percentage of insertions and deletions at each of the amplified loci.
  • Statistical significance FDR-adjusted p-value ⁇ 0.001 using a chi-squared test was only observed at the GS94 site.
  • RNA-seq To evaluate changes induced by GS94 integration at the transcriptional level, a CD19/MSLN circuit was integrated at the GS79 (TRAC), GS94, and GS102 integration sites. On day 6 post-integration, le6 edited cells were sorted using a BD FACSAria based on transgene expression. RNA was isolated from sorted T cells with the RNeasy kit (Qiagen). Purified RNA was converted into an NGS library using the TruSeq RNA Library Prep Kit v2 (Illumina). Libraries were sequenced on either the NovaSeq 6000 or NextSeq 550 instruments (Illumina). The STAR 2.7.3a aligner (Dobin A. et al.
  • Cytokine-independent growth assay To evaluate the safety of the primary T cells with GS94 locus KI, cytokine-independent growth assay was performed to evaluate the potential for oncogenic transformation. Briefly, primary human T cells that had undergone CD19/MSLN circuit cassette integration at GS94 locus were thawed and recovered overnight. IxlO 6 cells were then seeded in one well of a 24 well-GRex plate, culturing for 5 days in the medium with or without cytokines. Cell number and viability were recorded at days 0, 3 and 5. As a positive control, IxlO 6 Jurkat cells were cultured in the medium without cytokines in parallel. As shown in FIG.
  • CRISPR reagents e.g. SpCas9 complexed with sgRNA
  • GS94- targeting CRISPR RNP showed the highest percentage of iGUIDE-seq oligo cassette trapping events of all candidates evaluated, and the control sgRNA sequences from the iGUIDE-seq paper showed similar specificities to what was reported in the original publication, suggesting that the assay performed as expected.
  • Putative off-target sites were taken from the iGUIDE-seq output, which already suggested that the putative sites were spurious. Additional target sites were predicted by a computational approach (Elevation software package). rhAmp-seq was used to prepare high- throughput sequencing libraries for each of the putative off-target sites, and the method was applied to DNA samples from T cells electroporated with CRISPR RNPs targeting the candidate target sites. The resulting NGS data were processed with CRISPResso2 software, and the frequency of insertions and deletions (indels) was taken as indication of CRISPR cleavage activity, as is common in the field.
  • indels frequency of insertions and deletions
  • T cells electroporated with GS94-targeting CRISPR RNP showed no greater frequency of indels at the set of putative off-target sites than T cells treated with CRISPR RNP targeting other sites, consistent with the GS94-targeting CRISPR RNP having no consequential or detectable off-target activity, and therefore being the most specific out of the set evaluated (FIG. 41).
  • RNA-seq libraries were prepared and sequenced, and analysis of the resulting Illumina sequencing data revealed no biologically or statistically significant differences in expression of any genes within 300kb of the GS94 site in cells with integrations at GS94 compared to cells with integration at TRAC or the GS102 sites (FIG. 42). Furthermore, other gene expression differences that reached statistical significance were minimal in number and in effect size, consistent with them being noise in the comparison.
  • T cells with a transgene cassette expressing a CAR recognizing a tumor antigen, or a CAR recognizing a tumor antigen under control of a priming receptor recognizing an antigen in the anatomical vicinity of the tumor, is assessed against human tumor cells such as K562 engineered to express the CAR antigen or to express antigens recognized by both the priming receptor and the CAR.
  • Tumor cells e.g. Ie6
  • Tumor growth is assessed by dimensional measurement by calipers every 2-4 days.
  • mice are intravenously injected with 5e6 T cells with a CAR or prime-CAR circuit cassette integrated at a specific site by CRISPR-mediated insertion, or with T cells engineered with CRISPR RNP alone, or with PBS alone as a sham injection. Tumor growth is monitored and mice are euthanized when tumor volume reaches 2000 cubic mm. Peripheral blood is bled from mice through a retro-orbital procedure, and flow cytometry and/or ddPCR is used to observe engineered T cell expansion over time.
  • spleen, blood, tumor and/or other tissue is analyzed via flow cytometry, ddPCR, and/or immunohistochemistry for the presence of engineered T cells.
  • the results demonstrate that T cells engineered with cassette integration at one of the defined genomic loci lead to tumor regression and clearance in injected mice as compared to T cells without cassette integration, and that engineered T cells are detectable in the peripheral blood and tissues of injected mice.
  • Example 11 Evaluation of non-viral insertion of a large 8.3kb expression cassette in GS94
  • Plasmids contained homology arms homologous to sequences flanking the CRISPR target sites in the genome of 1.2kb or 450 bp in length.
  • T-cells were enriched from peripheral blood mononuclear cells (PBMCs) obtained from normal donor Leukopaks (STEMCELL Technologies) using Lymphoprep (STEMCELL Technologies) and the EasySep Human T-Cell Isolation Kit (STEMCELL Technologies).
  • PBMCs peripheral blood mononuclear cells
  • T- cells were subsequently activated with CD3/CD28 Dynabeads at 1 : 1 bead to cell ratio (ThermoFisher, 40203D) in TexMACS medium (Miltenyi 130-197-196) supplemented with 3% human AB serum (Gemini Bio) and 12.5 ng/ml human IL-7 and IL-15 (Miltenyi premium grade) and cultured at 37°C, 5% CO2 for 48 hours before electroporation.
  • TexMACS medium Miltenyi 130-197-196
  • human IL-7 and IL-15 Miltenyi premium grade
  • CRISPR RNP were prepared by combining 120 pM sgRNA (Synthego) targeting DNA sequence GAGCCATGCTTGGCTTACGA (GS94, SEQ ID NO: 94), 62.5 pM sNLS- SpCas9-sNLS (Aldevron) and P3 buffer (Lonza) at a volume ratio of 5: 1 :3:6, and incubated for 15 minutes at room temperature.
  • An optimized amount of plasmid DNA determined by dose titration experiments (ranging from 0.5-3 micrograms) was mixed with 3.5 pl of RNP.
  • T-cells were counted, debeaded, centrifuged at 90 X G for 10 minutes and resuspended at 10 A 6 cells/14.5 pl of P3 with supplement added (Lonza). 14.5 pl of T-cell suspension was added to the DNA/RNP mixture, transferred to Lonza 384-well nucleocuvette plate, and pulsed in a Lonza HT Nucleofector System with code EH-115. Cells were allowed to rest for 15 minutes at room temperature before transfer to 96-well plates (Sarstedt) in TexMACS medium supplemented with 12.5 ng/ml human IL-7 and IL-15 (Miltenyi premium grade).
  • Transgene expression was detected by staining with anti-Myc antibody (Cell Signaling Technology clone 9B11) and anti-Flag antibody (RnD systems, clone 1042E) and analyzed on an Attune NxT Flow Cytometer.
  • Other antibodies used were live/dead Fixable Near-IR (Thermo Fisher), TCRalpha/beta antibody (BioLegend clone IP26), CD4 antibody (BioLegend clone RPA-T4), CD8 antibody (BioLegend clone SKI).
  • transgene ie. synthetic circuit
  • edited T cells were co-cultured with target cell line expressing priming antigen at 1 : 1 E:T ratio, and incubated for 24hrs. T cells were harvested and stained with anti-Myc and anti-Flag antibodies to assess for Priming Receptor and CAR expression, respectively.
  • T cells edited as described above with a priming receptor and CAR synthetic circuit were phenotypically profiled with cell surface T cell subset markers by flow cytometry. Resting T cells were taken from in vitro culture conditions, rinsed with PBS prior to staining with Zombie-Aqua viability dye, CD4, CD8, CD45RA, CCR7 and CD27 with FMOs used as controls for gating and analyzed with an Attune NxT.
  • FlowJo single, viable lymphocytes were selected by SSC and FSC and subset profiling by a combination of CCR7, CD27, CD45RA were used to identify Naive- or stem cell memory- (Tn/Tscm: CD45RA+CCR7+CD27+), central memory- (Tern: CD45RA-CCR7+CD27+), effector memory- (Tern: CD45RA-CCR7-CD27-), or terminal effector- (Tte: CD45RA+CCR7-CD27- ) T cells on CD4+ and CD8+ subpopulations.
  • the non-viral editing generated a less differentiated T cell product (FIG. 46). In both donors, the non-viral editing did not contribute to an expansion of terminally differentiated T cells, as the major subset of T cells in both subpopulations retained positive expression of CD45RA and CCR7. (FIG. 46). This suggests that the edited T cells contain the capacity to expand, survive and persist in vivo.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Cell Biology (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Developmental Biology & Embryology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Virology (AREA)
  • Hematology (AREA)
  • Reproductive Health (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Gynecology & Obstetrics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Mycology (AREA)
PCT/US2021/056689 2020-10-26 2021-10-26 Safe harbor loci Ceased WO2022093846A1 (en)

Priority Applications (14)

Application Number Priority Date Filing Date Title
CA3196269A CA3196269A1 (en) 2020-10-26 2021-10-26 Safe harbor loci
EP21887358.6A EP4232049A4 (en) 2020-10-26 2021-10-26 Safe harbor loci
CR20230220A CR20230220A (es) 2020-10-26 2021-10-26 Loci de puerto seguro
KR1020237017816A KR20230101839A (ko) 2020-10-26 2021-10-26 세이프 하버 유전자좌위
MX2023004822A MX2023004822A (es) 2020-10-26 2021-10-26 Loci de puerto seguro.
JP2023525019A JP2023547887A (ja) 2020-10-26 2021-10-26 セーフハーバー遺伝子座
CN202180081810.2A CN116546993A (zh) 2020-10-26 2021-10-26 安全港基因座
PE2023001489A PE20231514A1 (es) 2020-10-26 2021-10-26 Loci de puerto seguro
BR112023007874A BR112023007874A2 (pt) 2020-10-26 2021-10-26 Loci de porto seguro
IL302315A IL302315A (en) 2020-10-26 2021-10-26 Secure port sites
AU2021369494A AU2021369494A1 (en) 2020-10-26 2021-10-26 Safe harbor loci
DO2023000080A DOP2023000080A (es) 2020-10-26 2023-04-25 Loci de puerto seguro
CONC2023/0006809A CO2023006809A2 (es) 2020-10-26 2023-05-25 Loci de puerto seguro
DO2024000162A DOP2024000162A (es) 2020-10-26 2024-08-21 Loci de puerto seguro

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US202063105834P 2020-10-26 2020-10-26
US63/105,834 2020-10-26
US202163141926P 2021-01-26 2021-01-26
US63/141,926 2021-01-26
US202163179143P 2021-04-23 2021-04-23
US63/179,143 2021-04-23

Publications (1)

Publication Number Publication Date
WO2022093846A1 true WO2022093846A1 (en) 2022-05-05

Family

ID=81383221

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/056689 Ceased WO2022093846A1 (en) 2020-10-26 2021-10-26 Safe harbor loci

Country Status (15)

Country Link
EP (1) EP4232049A4 (https=)
JP (1) JP2023547887A (https=)
KR (1) KR20230101839A (https=)
AU (1) AU2021369494A1 (https=)
BR (1) BR112023007874A2 (https=)
CA (1) CA3196269A1 (https=)
CL (1) CL2023001176A1 (https=)
CO (1) CO2023006809A2 (https=)
CR (1) CR20230220A (https=)
DO (2) DOP2023000080A (https=)
IL (1) IL302315A (https=)
MX (1) MX2023004822A (https=)
PE (1) PE20231514A1 (https=)
WO (1) WO2022093846A1 (https=)
ZA (1) ZA202402949B (https=)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115896227A (zh) * 2022-12-20 2023-04-04 西北农林科技大学 一种鉴定外源基因整合位点以增强转基因表达的方法
US12037407B2 (en) 2021-10-14 2024-07-16 Arsenal Biosciences, Inc. Immune cells having co-expressed shRNAS and logic gate systems
US12257304B2 (en) 2023-03-03 2025-03-25 Arsenal Biosciences, Inc. Systems targeting PSMA and CA9
EP4204575A4 (en) * 2020-08-28 2025-07-09 Arsenal Biosciences Inc IMMUNE CELLS MODIFIED WITH PRIMING RECEPTORS

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070083334A1 (en) * 2001-09-14 2007-04-12 Compugen Ltd. Methods and systems for annotating biomolecular sequences
US20070161031A1 (en) * 2005-12-16 2007-07-12 The Board Of Trustees Of The Leland Stanford Junior University Functional arrays for high throughput characterization of gene expression regulatory elements
US20160143953A1 (en) * 2012-12-05 2016-05-26 Sangamo Biosciences, Inc. Methods and compositions for regulation of metabolic disorders
WO2019169233A9 (en) * 2018-03-02 2019-10-10 Generation Bio Co. Closed-ended dna (cedna) vectors for insertion of transgenes at genomic safe harbors (gsh) in humans and murine genomes

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20250141836A (ko) * 2015-11-04 2025-09-29 페이트 세러퓨틱스, 인코포레이티드 만능 세포의 유전자 조작
CN113227374A (zh) * 2018-10-16 2021-08-06 因特利亚治疗公司 用于免疫疗法的组合物和方法
MX2023002455A (es) * 2020-08-28 2023-05-16 Arsenal Biosciences Inc Células inmunitarias modificadas con receptores cebadores.
JP2024537991A (ja) * 2021-10-14 2024-10-18 アーセナル バイオサイエンシズ インコーポレイテッド 共発現されるshRNAと論理ゲートシステムとを有する免疫細胞

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070083334A1 (en) * 2001-09-14 2007-04-12 Compugen Ltd. Methods and systems for annotating biomolecular sequences
US20070161031A1 (en) * 2005-12-16 2007-07-12 The Board Of Trustees Of The Leland Stanford Junior University Functional arrays for high throughput characterization of gene expression regulatory elements
US20160143953A1 (en) * 2012-12-05 2016-05-26 Sangamo Biosciences, Inc. Methods and compositions for regulation of metabolic disorders
WO2019169233A9 (en) * 2018-03-02 2019-10-10 Generation Bio Co. Closed-ended dna (cedna) vectors for insertion of transgenes at genomic safe harbors (gsh) in humans and murine genomes

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP4232049A4 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4204575A4 (en) * 2020-08-28 2025-07-09 Arsenal Biosciences Inc IMMUNE CELLS MODIFIED WITH PRIMING RECEPTORS
US12037407B2 (en) 2021-10-14 2024-07-16 Arsenal Biosciences, Inc. Immune cells having co-expressed shRNAS and logic gate systems
CN115896227A (zh) * 2022-12-20 2023-04-04 西北农林科技大学 一种鉴定外源基因整合位点以增强转基因表达的方法
US12257304B2 (en) 2023-03-03 2025-03-25 Arsenal Biosciences, Inc. Systems targeting PSMA and CA9

Also Published As

Publication number Publication date
AU2021369494A1 (en) 2023-06-22
CO2023006809A2 (es) 2023-08-09
IL302315A (en) 2023-06-01
CA3196269A1 (en) 2022-05-05
MX2023004822A (es) 2023-05-10
AU2021369494A9 (en) 2025-01-09
DOP2023000080A (es) 2023-08-31
JP2023547887A (ja) 2023-11-14
EP4232049A1 (en) 2023-08-30
EP4232049A4 (en) 2025-06-18
ZA202402949B (en) 2024-12-18
DOP2024000162A (es) 2024-09-30
BR112023007874A2 (pt) 2023-10-24
CL2023001176A1 (es) 2024-03-08
CR20230220A (es) 2023-08-24
KR20230101839A (ko) 2023-07-06
PE20231514A1 (es) 2023-09-28

Similar Documents

Publication Publication Date Title
JP7590015B2 (ja) 低抗原性細胞の製造方法
US11590171B2 (en) Targeted replacement of endogenous T cell receptors
US11761004B2 (en) Safe harbor loci
TW202035693A (zh) 用於免疫療法之組合物及方法
EP4232049A1 (en) Safe harbor loci
CN118389602B (zh) 经人工操纵的免疫细胞
TW202235617A (zh) 用於減少細胞中ii類mhc之組合物及方法
WO2024059618A2 (en) Immune cells having co-expressed tgfbr shrnas
JP2020528046A (ja) T細胞に基づく免疫療法の有効性増強のための組成物および方法
EP4593847A1 (en) Inhibition of genotoxic stress to improve t cell engineering
HK40098585A (zh) 安全港基因座
EA050294B1 (ru) Безопасный локус
US20250222103A1 (en) Immune cells with combination gene perturbations
CN116546993A (zh) 安全港基因座
Hirneise Developing a CRISPR-Mediated Knockout TCR Human T Cell Line for Use in Cloning Antigen-Specific T Cell Receptors
HK40037128A (en) Targeted replacement of endogenous t cell receptors

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21887358

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3196269

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2023525019

Country of ref document: JP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023007874

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 202347035906

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 20237017816

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: NC2023/0006809

Country of ref document: CO

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021887358

Country of ref document: EP

Effective date: 20230526

WWE Wipo information: entry into national phase

Ref document number: 202180081810.2

Country of ref document: CN

ENP Entry into the national phase

Ref document number: 2021369494

Country of ref document: AU

Date of ref document: 20211026

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112023007874

Country of ref document: BR

Free format text: REAPRESENTAR, EM ATE 60 (SESSENTA) DIAS, AS REIVINDICACOES NA PETICAO NO 870230034683 DE26/04/2023 CONTENDO 16 PAGINAS, OU CONFIRMAR SER UM ERRO DE PREENCHIMENTO E RE-ENVIAR OCONTEUDO COM PAGINACAO CORRETA.

WWP Wipo information: published in national office

Ref document number: NC2023/0006809

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 112023007874

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230426

WWE Wipo information: entry into national phase

Ref document number: 523440498

Country of ref document: SA

WWE Wipo information: entry into national phase

Ref document number: 523440498

Country of ref document: SA

WWE Wipo information: entry into national phase

Ref document number: 523440498

Country of ref document: SA

WWE Wipo information: entry into national phase

Ref document number: 523440498

Country of ref document: SA