WO2022092885A1 - 모노머형 스트렙타비딘을 발현하기 위한 컨스트럭트 - Google Patents

모노머형 스트렙타비딘을 발현하기 위한 컨스트럭트 Download PDF

Info

Publication number
WO2022092885A1
WO2022092885A1 PCT/KR2021/015406 KR2021015406W WO2022092885A1 WO 2022092885 A1 WO2022092885 A1 WO 2022092885A1 KR 2021015406 W KR2021015406 W KR 2021015406W WO 2022092885 A1 WO2022092885 A1 WO 2022092885A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
seq
msa
monomeric streptavidin
regulatory
Prior art date
Application number
PCT/KR2021/015406
Other languages
English (en)
French (fr)
Inventor
권성영
민정준
홍영진
유성환
임진희
Original Assignee
전남대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 전남대학교 산학협력단 filed Critical 전남대학교 산학협력단
Priority to US18/251,176 priority Critical patent/US20230407292A1/en
Publication of WO2022092885A1 publication Critical patent/WO2022092885A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1055—Protein x Protein interaction, e.g. two hybrid selection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/36—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Actinomyces; from Streptomyces (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/0059—Measuring for diagnostic purposes; Identification of persons using light, e.g. diagnosis by transillumination, diascopy, fluorescence
    • A61B5/0071—Measuring for diagnostic purposes; Identification of persons using light, e.g. diagnosis by transillumination, diascopy, fluorescence by measuring fluorescence emission
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to a construct for expressing monomeric streptavidin and a host cell into which a recombinant vector containing the construct has been introduced.
  • Cancer is currently one of the diseases that cause the most deaths worldwide, and the incidence of cancer is continuously increasing due to the extension of the average lifespan and the lowering of the age at which cancer occurs. According to the 2013 statistical data provided by the National Cancer Center of Korea, the total number of cancer patients in Korea registered in the Cancer Registration Statistics Department in 2010 was 202,053, and the number is continuously increasing.
  • streptavidin streptavidin
  • avidin avidin protein
  • biotin biotin
  • an anticancer agent that responds specifically to biotin-expressing tumors Or it can be applied to various biological applications, such as can utilize immune cells.
  • One object of the present invention is to provide a construct for expressing monomeric streptavidin (mSA).
  • Another object of the present invention is to provide a recombinant vector containing the construct and a host cell transformed thereby.
  • Another object of the present invention is to provide a regulatory gene screening method for constructing a gene construct for expressing monomeric streptavidin (mSA).
  • a gene encoding a monomeric streptavidin mSA
  • a gene encoding a maltose-binding protein MBP
  • a regulatory gene for regulating the expression of the gene encoding the monomeric streptavidin it provides a gene construct comprising a.
  • the "gene construct” of the present invention is a construct that enables expression of a desired protein or the like when it is recombinantly or introduced into a host strain or cell through transformation, and is not only a gene encoding the desired protein but also , is meant to include essential regulatory genes operably linked so that the gene can be expressed.
  • the "regulation” to “regulation of expression” may mean that the transcription and translation of a specific gene is activated or repressed.
  • the "streptavidin” is a protein having a high binding affinity to biotin, and has been applied to various biological applications by using a specific interaction with the biotin.
  • the amino acid sequence of the streptavidin protein may be as shown in SEQ ID NO: 1, and the gene encoding the streptavidin may be shown in SEQ ID NO: 2, but is not limited thereto.
  • the "monomeric streptavidin (mSA)" is streptavidin present as a monomer so that the streptavidin forms a tetramer and can lead to unwanted cross-linking of the biotin conjugate.
  • the "maltose-binding protein (MBP)" is a part of the maltose/maltodextrin system of E. coli, and is a protein of about 42.5 kDa that is responsible for maltodextrin absorption and efficient catabolism, and SEQ ID NO: It may be represented by the amino acid sequence of 3, and the gene encoding the maltose binding protein may be represented by SEQ ID NO: 4, but is not limited thereto.
  • the regulatory gene is structurally DNA-dependent RNA polymerase (DNA-dependent RNA polymerase) binding site, transcription initiation point and transcription factor binding site, inhibitory and active protein binding site and directly to those skilled in the art Alternatively, it may refer to a nucleic acid fraction including any other sequence of nucleotides known to indirectly act on transcriptional amount regulation, but is not limited thereto.
  • the regulatory gene may be operably linked 5' upstream of the start codon of the gene encoding the monomeric streptavidin.
  • the regulatory gene consists of a ribosome binding site (RBS), a 5'-untranslated region (5'-UTR) and a transcription factor binding site. It may be at least one selected from the group, but is not limited thereto.
  • the "Ribosome-binding site (RBS)" is responsible for the recruitment of ribosomes upstream of the start codon of the gene to proceed with translation.
  • the ribosome binding site of prokaryotes includes a Shine-Dalgarno (SD) sequence having a 5'-AGGAGG-3' sequence.
  • SD Shine-Dalgarno
  • the 3' end of the 16S rRNA is complementary to the Shine-Dalgarno sequence to start translation, and the CCUCCU sequence, which is the complementary sequence, is called an anti-Shine-Dalgarno (ASD) sequence. .
  • the "5'-untranslated region (5'-UTR)" is a translation located on both sides of the coding region, which is a portion that is translated into amino acids of mRNA in the 5' region. It is a part that does not do this, and it was considered a part (junk) that was unnecessary in the evolutionary process, but it is known that it plays a big role in regulating gene expression.
  • the "transcription factor binding site” is a DNA region that serves to turn on or off a specific gene nearby.
  • the transcription factor binding site may be at least one selected from the group consisting of a promoter, an enhancer, and a silencer of a gene encoding the regulatory protein, but is not limited thereto.
  • the regulatory gene is such that the monomeric streptavidin is expressed in the periplasm of the host cell, inside the host cell. It is preferable because the utilization of the expressed monomeric streptavidin is higher than when it is discharged without staying in or staying in the surrounding cytoplasm.
  • the regulatory gene may be one represented by any one of SEQ ID NOs: 26 to 91.
  • the regulated gene may have a total Gibbs free energy change ( ⁇ Gtotal) of 0 or less.
  • the "total Gibbs free energy change ( ⁇ G total )" is, in the translation process of the monomeric streptavidin, the mRNA transcript of the regulatory gene on the 30S subunit complex of the ribosome. It is the difference between the Gibbs free energy before and after bonding.
  • the total Gibbs free energy change amount ( ⁇ G total ) is 0 or less, the transcription and translation ability of the gene encoding the monomeric streptavidin may be increased.
  • the total Gibbs free energy change amount ( ⁇ Gtotal) may be calculated in the same way as in Equations 1 and 2 below.
  • ( ⁇ G final ) - ( ⁇ G initial ) [( ⁇ G mRNA-rRNA ) + ( ⁇ G spacing ) + ( ⁇ G stacking ) + ( ⁇ G standby ) + ( ⁇ G start )] - ( ⁇ G mRNA )
  • Equations 1 and 2 “ ⁇ G final” is the change in Gibbs free energy after the 30S subunit complex of the ribosome binds to the mRNA transcript of the regulatory gene;
  • the “ ⁇ G initial ” is the change in Gibbs free energy before the 30S subunit complex of the ribosome binds to the mRNA transcript of the regulatory gene.
  • the “ ⁇ G mRNA-rRNA ” is the amount of change in Gibbs free energy when a reaction that forms a complex between the mRNA of the regulatory gene and the 30S subunit of the ribosome occurs
  • the “ ⁇ G spacing ” is the regulatory gene In the mRNA transcript of Spacing) is the amount of change in the Gibbs free energy of nucleotides accumulated in the region
  • the “ ⁇ G standby " is the Gibbs free energy penalty when the binding reaction between the ribosome and the standby site of the mRNA transcript of the regulatory gene occurs
  • the “ ⁇ G” start " is the change in Gibbs free energy when a reaction to form an mRNA-tRNA complex occurs
  • “ ⁇ GmRNA” is the change in Gibbs free energy when the mRNA transcript of the regulatory gene forms a folded complex structure.
  • each Gibbs free energy change is calculated in consideration of variables such as interaction of gene strands in a diluted solution, concentration, complexity of base pairing, knot structure, etc. in a diluted solution, such as NUPACK, ViennaRNA, or UNAfold. It may be calculated by software, but is not limited thereto.
  • the regulatory gene may be one whose translation initiation rate (TIR) is adjusted to have a specific range so as to maximize the production of monomeric streptavidin.
  • TIR translation initiation rate
  • the "Translation Initiation Rate (TIR)" can be calculated by Equation 3 below, and in synthetic biology, the translation step is a step that limits the rate of overall protein production, so it is an important factor in gene expression.
  • TIR exp[k ⁇ ( ⁇ G total ) - ( ⁇ G1 total ) ⁇ ]
  • TIR The unit of TIR is au
  • k is the Boltzmann constant, which may be 0.4 to 0.6 mol/kcal;
  • ⁇ G total is as defined in Equation 1 above;
  • ⁇ G1 total corresponds to the Gibbs free energy change in the gene construct of the present invention not including the regulatory gene, preferably, the free energy change in the gene construct not including the regulatory gene and the rest of the sequence is the same may be, but is not limited to. Therefore, when the regulatory gene is not included, the translation initiation rate corresponds to 1 au.
  • the regulating gene is preferably controlled so that the translation initiation rate is 50 to 45000 au, preferably 900 to 45000 au, because the transformed strain can produce the monomeric streptavidin with high efficiency, but is not limited thereto. does not
  • sequence length of the regulatory gene may be 15 to 39 bp, preferably 26 to 31 bp, but is not limited thereto.
  • the regulatory gene may include "AGG”, which is the gene sequence shown in SEQ ID NO: 5
  • the regulatory gene may include "TAGG”, which is the gene sequence shown in SEQ ID NO: 6
  • the regulatory gene may include, but is not limited to, "ATAGG”, which is the gene sequence shown in SEQ ID NO: 7.
  • the regulatory gene may have a spacing from the 3' end of the gene sequence shown in SEQ ID NOs: 5 to 7 to the start codon of 6 to 13 bp, preferably 6 to 10 bp.
  • the spacing is 6 to 13 bp, the Gibbs free energy penalty ( ⁇ G spacing ) for the non-optimized spacing between the initiation codon and the sequence forming the rRNA complex in the mRNA transcript is minimized, and as a result, the monomeric strep It can increase the expression level of tavidin.
  • the regulatory gene has a total Gibbs free energy change ( ⁇ G total ) of Equation 1 or less, and a translation initiation rate (TIR) of 900 to 45000 au, and a sequence length of 26 to It consists of 31 bp, contains the gene sequence represented by any one of SEQ ID NOs: 5 to 7, and from the 3' end of the gene represented by any one of SEQ ID NOs: 5 to 7 Start of the gene encoding the monomeric streptavidin The spacing to the codon may be 6 to 10 bp.
  • the regulatory gene may be represented by SEQ ID NO: 32 or 36, but is not limited thereto.
  • the present invention relates to a recombinant vector comprising the gene construct of the present invention.
  • the recombinant vector may be a constitutive expression vector or an inducible expression vector, for example, pKD13, pCP20, pMA1, pUC19, pJL, pBAD, pET, pGEX, pMAL, pALTER, pCal, pcDNA, pDUAL, pTrc, pQE, pTet, pProEX HT, pPROLar.A, pPROTet.E, pRSET, pSE280, pSE380, pSE420, pThioHis, pTriEx, pTrxFus, Split GFP Fold 'n' Glow, pACYCDY Glow -1, pCDF-1b, pCDFDuet-1, pCOLADuet-1, pLysS, pRSF-1b, pRSFDuet-1, pT7-FLAG,
  • the pKD13 is about 3.4 kbp
  • beta-lactamase beta-lactamase
  • Tn5 neomycin phosphotransferase Tn5 neomycin phosphotransferase
  • lambda terminator lambda terminator
  • R6K gamma replication Origin R6K gamma replication origin
  • the pCP20 plasmid consists of about 9.4 kbp, EcoRI, cat, Pstl, HindIII, Ci857, flp, bamHi, beta-lactamase, mobA, mob2 and repA101ts gene regions. may include
  • the pMA1 plasmid is Microcystis aeruginosa f. aeruginosa Kutzing, consisting of about 2.3 kbp, and may include a HincII gene region.
  • the pJL plasmid may have an empty backbone and be based on an RNA virus.
  • the pBAD, pCMV and pCMV plasmids are expressed in mammalian host cells, use CMV and a promoter, and may have ampicillin resistance.
  • the pET, pBluescript, pCal and pcDNA plasmids are expressed in a bacterial host cell, use a T7 or Lac promoter, and may have ampicillin resistance.
  • the pMAL and pGEX plasmids may be expressed in a bacterial host cell, use the Tac promoter, and have ampicillin resistance.
  • the pALTER plasmid is expressed in a bacterial host cell, uses the T7 promoter, and may have tetracycline resistance.
  • the pDUAL plasmid is expressed in a bacterial host cell, uses a T7 or Lac promoter, and may have kanamycin resistance.
  • the pTrc plasmid is expressed in a bacterial host cell, uses a trc promoter, and may have ampicillin resistance.
  • the pUC19 plasmid is a vector expressed in a bacterial host cell, composed of circular double-stranded DNA of about 2.6 kbp, and the pUC18 and MCS regions are opposite.
  • the pU19 vector is most widely used for transformation, and the host cells introduced with the foreign DNA by the pU19 have a different color of colonies in the growth medium compared to the control, and thus can be distinguished.
  • the pQE plasmid may use the T5-lac promoter and have ampicillin resistance.
  • the pTet plasmid contains a CMV promoter under the control of a regulatory sequence from the tet operon, so that when co-transfected with pTet-tTAk, a trans activator, the protein can be expressed only in the absence of doxycycline. there is.
  • the pCas9, pwtCas9-bacteria and pgRNA-bacteria plasmids may be for expressing Cas9 nuclease gRNA using CRISPR technology.
  • a host cell transformed by introducing the recombinant vector of the present invention is provided.
  • the method for transforming the recombinant vector into the host cell may be performed according to a conventional introduction method in the art, and the specific method is not particularly limited, but for example, a bacterial transformation method, CaCl2 Hanahan method, electroporation, calcium phosphate precipitation method, protoplasmic fusion method, stirring method using silicon carbide fiber, agrobacterium mediated method, by using DMSO (dimethyl sulfoxide) as a reducing material in the precipitation method and CaCl2 method Transformation method using PEG, dextran sulfate, lipofectamine and drying/suppression mediated transformation can be used.
  • DMSO dimethyl sulfoxide
  • the host cells when the host cells are administered to a tumor-infected individual, there is an effect of expressing the monomeric streptavidin only in cancer tissues. Therefore, in the present invention, when the host cells are administered to a tumor-infected individual, viability is low in normal tissues compared to cancer tissues, there is no infection in normal tissues, and monomeric streptavidin can be expressed only in cancer tissues.
  • the normal tissue may be a tissue of an organ selected from the group consisting of lung, liver, and spleen, but is not limited thereto.
  • the host cell may include cells of mammalian, plant, insect, fungal or cellular origin, for example, bacterial cells such as Escherichia coli, Streptomyces or Salmonella genus strains, yeast cells , fungal cells such as P.
  • bacterial cells such as Escherichia coli, Streptomyces or Salmonella genus strains
  • yeast cells fungal cells such as P.
  • Insect cells such as Drosophila, Spodoptera Sf9 cells, CHO (Chinese hamster ovary cells), SP2/0 (mouse myeloma), human lymphoblastoid, COS, NSO (mouse myeloma) , 293T cells, Bow melanoma cells, HT-1080 cells, BHK cells (Baby Hamster Kidney cells), HEK cells (Human Embryonic Kidney cells) or PERC.6 cells (Human retinal cells). ), but may be at least one selected from the group consisting of animal cells and plant cells, but is not limited thereto.
  • the host cell may be a bacterial cell, preferably an anaerobic strain.
  • the host cell When the host cell is injected into the human body for the purpose of cancer diagnosis and treatment, blood vessel formation is incomplete and oxygen Since it targets the inside of cancer tissue, which is a deficient environment, if a recombinant vector capable of simultaneously expressing a reporter protein capable of imaging in real time and an anticancer protein in such a strain is introduced in a balanced manner, the strain is a biotinylated diagnostic agent. Not only can the location or strain of the cancer tissue pre-targeted in real time be monitored in real time, but also the cancer targeting efficiency of biotinylated anticancer drugs can be increased, enabling very effective diagnosis and treatment of cancer at the same time.
  • the host cell may be at least one selected from the group consisting of Salmonella sp. strain, Clostridium sp. strain, Bifidobacterium sp. strain, and Escherichia coli sp. strain, More preferably, it may be at least one selected from the group consisting of Salmonella typhimurium, Salmonella choleraesuis and Salmonella enteritidis, and more preferably, Salmonella typhimurium. may be, but is not limited thereto.
  • the "Salmonella typhimurium” is a causative bacterium that causes typhoid of the genus Salmonella.
  • the Salmonella typhimurium is a rod-shaped bacillus that has flagella and is Gram-negative.
  • the Salmonella typhimurium is weak to heat and dies in 20 minutes at 60 ° C. It is also a cause of food poisoning because it is primarily contaminated by livestock, wild animals, carriers, etc., milk, eggs, etc. It can cause a type of salmonellosis.
  • the "Salmonella choleraesuis” is a bacterium that is well known as swine cholera in the genus Salmonella and infects both humans and animals.
  • the Salmonella cholerasuis is the main causative agent of acute sepsis caused by Salmonella. This fungus is a Gram-negative, facultative anaerobic bacillus with motile hairs. It has no lactose decomposition ability, does not form indole, and does not produce hydrogen sulfide, which distinguishes it from E. coli.
  • the optimum temperature for growth is 35-37 °C
  • the proliferative temperature range is 10-43 °C
  • it is killed by heating at 60 °C for 20 minutes.
  • the optimum pH is 7.2 ⁇ 7.4, and the size is 0.5 ⁇ 0.8 ⁇ 3 ⁇ 4 ⁇ m.
  • the "Salmonella enteritidis (Salmonella enteritidis)" is a causative bacterium of bacterial infection-type food poisoning of the genus Salmonella, also called enteritis.
  • the Salmonella enteritidis is a representative bacterium of Salmonella, which can cause infection in all animals and has very high host adaptability. It is a Gram-negative, facultative anaerobic bacillus with a motile hair. It has no lactose decomposition ability, does not form indole, and does not produce hydrogen sulfide, which distinguishes it from E. coli.
  • the optimum temperature for growth is 35 ⁇ 37°C, and the temperature range for growth is 10 ⁇ 43°C, and it is killed by heating at 60°C for 20 minutes.
  • the optimum pH is 7.2 ⁇ 7.4, and the size is 0.5 ⁇ 0.8 ⁇ 3 ⁇ 4 ⁇ m.
  • the "Salmonella infantis" is a strain infected by eggs or poultry, and Salmonella paratyphi and Salmonella typhi are the causative strains of typhoid.
  • the host cell may be attenuated to reduce toxicity and other side effects when administered to a subject.
  • the host cell is expressed in aroA, aroC, aroD, aroE, Rpur, htrA, ompR, ompF, ompC, galE, cya, crp, cyp, phoP, phoQ, rfaY, dksA, hupA , sipC, clpB, clpP, clpX, pab, nadA, pncB, pmi, rpsL, hemA, rfc, poxA, galU, cdt, pur, ssa, guaA, guaB, fliD, flgK, flgL, relA, spoT, and A gene encoding at least one selected from the group may be modified and attenuated.
  • the host cell may be attenuated because it lacks the ability to synthesize guanosine polyphosphate.
  • the guanosine polyphosphate may be guanosine-5-diphosphate-3-diphosphate (ppGpp), and the host cell is RelA, which hydrolyzes guanosine-5-diphosphate-3-diphosphate (ppGpp), or
  • the spoT-encoding gene for synthesizing guanosine-5-diphosphate-3-diphosphate (ppGpp) may be modified to lack the ability to synthesize guanosine-5-diphosphate-3-diphosphate (ppGpp),
  • the present invention is not limited thereto.
  • the method of applying a modification to the gene in the host cell may be performed by a method of deletion or disruption of various genes known in the art, for example, the deletion and disruption method is homologous recombination, chemical It may be performed by a method such as mutagenesis, irradiation mutagenesis, or transposon mutagenesis, but is not limited thereto.
  • introducing a gene encoding a monomeric streptavidin (mSA) and a candidate regulatory gene into a vector provides a screening method of a regulatory gene for regulating the expression of monomeric streptavidin, comprising the step of measuring the expression level of the gene encoding the monomeric streptavidin expressed by the vector.
  • mSA monomeric streptavidin
  • the candidate regulated genes are those whose total Gibbs free energy change ( ⁇ G total ) is regulated to 0 or less; translation initiation rate in the range of 900 to 9000 au; a sequence length of 15 to 39 bp; One comprising a gene sequence represented by any one of SEQ ID NOs: 5 to 7; and a gene sequence represented by any one of SEQ ID NOs: 5 to 7, wherein the spacing from the 3' end of the gene sequence to the start codon is 6 to 13 bp; At least one of the conditions may be satisfied, but the present invention is not limited thereto.
  • a gene encoding a maltose-binding protein may be further introduced into the vector.
  • the expression level of the monomeric streptavidin expressed from the host cell transformed by the vector into which the monosolid streptavidin-encoding gene and the candidate regulatory gene are introduced. can be measured and performed.
  • the candidate regulatory gene when the measured monomeric streptavidin expression level is increased compared to before the candidate regulatory gene is introduced, it can be determined that the candidate regulatory gene is for increasing the monomeric streptavidin expression.
  • the step of measuring the expression level may be performed while measuring the expression level of the monomeric streptavidin expressed in the periplasm of the transformed host cell.
  • the monomeric streptavidin when the monomeric streptavidin is expressed in the periplasm of the transformed host cell, it can be determined that the candidate regulatory gene is for increasing the monomeric streptavidin expression.
  • the monomeric streptavidin when the monomeric streptavidin is expressed in the periplasm of the transformed host cell as described above, the monomeric streptavidin is expressed or the monomeric streptavidin is expressed in the cell of the host cell.
  • the utility of the expressed monomeric streptavidin may be higher than when it is discharged without staying in the surrounding cytoplasm afterward.
  • the step of measuring the expression level may further include culturing the transformed host cell.
  • the culturing step may be performed using an LB medium (Lysogeny broth) containing an antibiotic, and the LB medium is Giuseppe Bertani to optimize the growth and plaque formation of Shigella spp. Giuseppe Bertani), and common ingredients include peptides, casein peptones, vitamins (including B vitamins), trace elements (nitrogen, sulfur, magnesium), and minerals, and the osmotic pressure may be one controlled by sodium chloride,
  • the present invention is not limited thereto.
  • the monomeric streptavidin can be expressed in a high production amount in the host cell.
  • the host cell expressing the monomeric streptavidin according to the present invention when administered to a tumor-infected individual, the monomeric streptavidin expressed from the host cell can maintain its functionality in the body. Therefore, when a biotinylated drug for diagnosis or treatment of a tumor is administered together with a tumor-targeting host cell, the biotinylated drug binds to the monomeric streptavidin and can selectively act only on cancer tissues.
  • 5 is an image showing the biotin binding of the recombinant strain in Experimental Example 2 through a confocal microscope.
  • FIG. 6 is an image showing the biotin binding of the recombinant strain in Experimental Example 2 through a confocal microscope.
  • FIG. 11 is a graph showing the results of analyzing the biotin binding of the recombinant strain in Experimental Example 4.
  • FIG. 13 is an image showing the biotin binding of the recombinant strain in Experimental Example 4 through a confocal microscope.
  • 16 is an image showing the biotin binding of the recombinant strain in the tumor animal model in Experimental Example 5.
  • 17 is an image showing the biotin binding of the recombinant strain in the tumor animal model in Experimental Example 5.
  • the monomeric streptavidin (mSA) gene represented by SEQ ID NO: 2 was synthesized (Macrogen, Korea) and amplified, cut with restriction enzymes EcoRI and Sal I, and purified After the gene amplification product was obtained, it was cloned into the pBAD24 plasmid digested with the same restriction enzyme to prepare a pBAD-mSA (B-mSA) plasmid.
  • pBAD_RBS 0.3-mSA B_R0.3-mSA
  • pBAD_RBS 0.6 by inserting BBa_B0032, BBa_B0030, BBa_B0034, which are ribosome binding sites (RBS) of Table 1 below, downstream of the promoter.
  • -mSA B_R0.6-mSA
  • pBAD_RBS 1.0-mSA B_R1.0-mSA
  • the mSA gene was amplified using the pBAD-mSA plasmid as a template, cut with restriction enzymes EcoRI and HindIII, and purified to obtain a gene amplification product, which is then cut with the same restriction enzyme
  • pMAl_p2x pMAl_p2x-mSA
  • M_p-mSA pMAl_p2x-mSA
  • M_c-mSA pMAl_c2x-mSA
  • BBa_B0034 sequence in which the gene encoding the maltose binding protein (MBP) shown in SEQ ID NO: 4 and the mSA gene shown in SEQ ID NO: 2 are fused to M-p-mSA and M-c-mSA plasmids for use in animal experiments was recloned into pBAD24 to pBAD_p2x-mSA (B_p-mSA), pBAD_c2x-mSA (B_c-mSA), pBAD_RBS1-p2x-mSA (B_R1.0-p-mSA), pBAD_RBS1-c2x-mSA (B_R1.0-c).
  • -mSA plasmid was constructed.
  • ( ⁇ G final ) - ( ⁇ G initial ) [( ⁇ G mRNA-rRNA ) + ( ⁇ G spacing ) + ( ⁇ G stacking ) + ( ⁇ G standby ) + ( ⁇ G start )] - ( ⁇ G mRNA )
  • each translation initiation rate according to the regulatory gene sequence prepared as described above was calculated and shown in Table 3 below. .
  • SEQ ID NO: 29 133.266441 SEQ ID NO: 30 678.2310709 SEQ ID NO: 31 152.7003477 SEQ ID NO: 32 6110.586323 SEQ ID NO: 33 1152.963841 SEQ ID NO: 34 287.0559877 SEQ ID NO: 35 216.8312084 SEQ ID NO: 36 5847.72872 SEQ ID NO: 37 374.5906748 SEQ ID NO: 65 143.6296318 SEQ ID NO: 66 43914.95671 SEQ ID NO: 67 1536.365645 SEQ ID NO: 68 526.4033937 SEQ ID NO: 69 403.5382313 SEQ ID NO: 70 975.1871797 SEQ ID NO: 71 204.582929 SEQ ID NO: 72 410.8314232 SEQ ID NO: 73 150.2547754 SEQ ID NO: 74 592.8668512 SEQ ID NO: 75 944.944
  • the regulatory genes of SEQ ID NOs: 29 to 37 and 65 to 91 among the regulatory genes of the prepared plasmid had translation initiation rates in the range of 50 to 45000 au, and among them, the regulatory genes of SEQ ID NOs: 32 and 36 confirmed that the translation initiation rate corresponds to the range of 900 to 9000 au.
  • the regulatory gene sequence according to whether the regulatory gene sequence includes the AGG, TAGG or ATAGG sequence and the spacing from the 3' end of the AGG sequence to the start codon is shown in Table 4 below.
  • SEQ ID NOs: 26, 27, 28, 29, 31, 32, 36, 37, 65, 66, 67, 73, 75, 76, 77, 78, 79 among the regulatory genes of the constructed plasmid , 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 and 91 of the regulatory genes contained the AGG sequence, among them, the regulatory genes of SEQ ID NOs: 32 and 36 of the AGG sequence It was confirmed that the spacing from the 3' end to the start codon was 6 to 13 bp.
  • the regulatory genes of SEQ ID NOs: 32,36, 66, 76, 77, 78, 82, 84, 86, 87, 88, 89, 90 and 91 among the regulatory genes of the produced plasmid include TAGG or ATAGG sequences.
  • E. coli E. coli: DH5a or MG1655
  • Salmonella SHJ2037
  • the transformation was performed using LB solid medium containing Ampicillin. Each strain was cultured overnight. Thereafter, the resulting colonies are newly diluted using LB liquid medium containing antibiotics at a ratio of 1:100, and when the OD600 value reaches 0.5 to 0.7 through additional culture, the final concentration in the culture medium is 0.1% Phosphorus arabinose was added and cultured in a shaking incubator at 200 rpm and 37°C.
  • strains including a plasmid in which RBS sequences known as BBa_B0032, BBa_B0030, and BBa_B0034 were inserted before the mSA gene sequence to improve protein expression were unable to confirm mSA protein expression on SDS-PAGE.
  • RBS sequences known as BBa_B0032, BBa_B0030, and BBa_B0034 were inserted before the mSA gene sequence to improve protein expression
  • M_p-mSA and M_c-mSA plasmids fused with MBP genes were prepared as in Example 1, and then transformed and cultured as in Example 2.
  • IPTG Isopropyl beta-D-1-thiogalactopyranoside
  • the cultured recombinant E. coli was shown in FIG. 2 by adding SDS-PAGE sample buffer based on OD4 and boiling at 95 degrees for 10 minutes, then checking the SDS-PAGE loading and protein expression level.
  • strain lysate was electrophoresed in 12% SDS-PAGE, and the protein was transferred from the gel to a nitrocellulose membrane and blocked at room temperature using 5% skim milk. Thereafter, the expression level of mSA was confirmed using a his tag antibody, and biotin-binding activity of mSA was confirmed using biotinylated peroxidase. performed and shown in FIG. 3 .
  • the expression level of mSA protein fused with MBP of the M_c-mSA and M_p-mSA plasmids into which both the MBP gene and the mSA gene were inserted was not fused with the MBP of the B-mSA plasmid into which only the simple mSA gene was inserted. It was higher than the expression level of mSA protein.
  • a biotin uptake assay was performed, and the results are shown in FIG. 4 .
  • a biotinylated fluorescent dye biotin-flamma 675 dye, BioActs
  • the recombinant strain was fixed on a slide and confirmed with a confocal microscope, as shown in FIGS. 5 and 6 .
  • SDS-PAGE was performed to confirm the expression and activity of mSA of the recombinant strain transformed with the RBS-added plasmid. Specifically, B_p-mSA and B_c-mSA in which the MBP-mSA gene was transferred to the pBAD plasmid, and B_R1.0-p-mSA and B_R1.0-c-mSA plasmids to which the BBa_B0034 sequence was added to improve the expression of the plasmids. 7 shows the results of performing SDS-PAGE on the recombinant strain transformed with .
  • the recombinant strain was loaded on SDS-PAGE to check the protein expression level, and it was confirmed that the mSA protein fused with MBP was overexpressed even in the pBAD plasmid.
  • the B_p-mSA, B_c-mSA, B_R1.0-p-mSA and B_R1.0-c-mSA plasmids into which both the MBP gene and the mSA gene were inserted were MBP It was confirmed that overexpression of mSA protein fused with MBP was higher than that of simple mSA protein not fused with MBP.
  • the present inventors analyzed the RBS sequence of the B_p-mSA plasmid in order to induce increased functional expression of the gene in the recombinant strain, and as in Example 1, B_R01-p-mSA, B_R02-p-mSA, B_R1-p -mSA, B_R11-p-mSA, B_R12-p-mSA, B_R13-p-mSA B_R2-p-mSA, B_R21-p-mSA Plasmids were prepared and then transformed and cultured in the strain. In order to confirm the protein expression level of the recombinant strain, Western blot analysis was performed in the same manner as in Experimental Example 2-2, as shown in FIG. 9 .
  • the recombinant strain containing the M_p-mSA plasmid had a higher expression level of mSA than the recombinant strain containing the B_p-mSA plasmid.
  • the expression of mSA was higher than that of the recombinant strain containing the B_R1-p-mSA and B_R2-p-mSA plasmids.
  • the recombinant strains containing the B_R1-p-mSA and B_R2-p-mSA plasmids showed less secreted protein than the recombinant strains containing the M_p-mSA plasmids, so the B_R1-p-mSA and B_R2-p-mSA mSA expressed in the plasmid was found to stay in the periplasm of the strain.
  • Biotin binding activity is a recombinant strain comprising M_p-mSA, B_R2-p-mSA plasmid
  • the recombinant strain containing the B_R1-p-mSA and B_R2-p-mSA plasmids had significantly higher biotin-binding activity than the recombinant strain containing the pBAD and B-mSA plasmids, and the B_R1- It was confirmed that mSA expressed in the genes of p-mSA and B_R2-p-mSA plasmids had a significant biotin-binding activity compared to mSA expressed in other plasmids. In addition, it was confirmed that the biotin-binding activity is not proportional to the protein expression level, and thus the biotin-binding activity effect cannot be predicted simply by the protein expression level.
  • the cultured strain was fixed on a slide and confirmed with a confocal microscope as shown in FIGS. 12 and 13 .
  • the recombinant strain containing the B_R1-p-mSA and B_R2-p-mSA plasmids showed strong binding of the biotinylated fluorescent dye to the strain compared to the controls B-mSA and B_p-mSA shown in FIG. 13 .
  • the expression of mSA by the B_R2-p-mSA plasmid was optimal for binding to the biotinylated fluorescent dye.
  • in vivo imaging system In Vivo Imaging System; IVIS
  • IVIS In Vivo Imaging System
  • the CT26 cell line was first injected subcutaneously into the flank of Balb/c mice to construct a tumor animal model. 3 days after injecting the recombinant strain into the animal model, biotinylated fluorescent dye was injected, and IVIS imaging was performed 6 hours later, as shown in FIG. 16, and IVIS imaging was performed 9 hours later, as shown in FIG. 17 After 24 hours, IVIS imaging was performed and shown as shown in FIG. 18 .
  • the biotinylated fluorescent dye injected into mice injected with the recombinant strain transformed with B-mSA and B_p-mSA plasmid was injected with the biotinylated fluorescent dye over time. cleared in vivo.
  • the mice injected with the recombinant strain including the B_R2-p-mSA plasmid showed a stronger signal than the control group after injection of the biotinylated fluorescent dye in the cancer tissue, and it was still strongly maintained even after 24 hours after the injection of the biotinylated fluorescent dye. Confirmed.
  • biotinylated fluorescent dye was strongly bound only to the recombinant strain of the present invention in small animals, and in particular, it was confirmed that real-time tumor imaging using a recombinant strain with tumor specificity was possible.
  • cancer tissue was extracted from the tumor animal model and in vivo imaging system (IVIS) imaging was performed. Specifically, 24 hours after the injection of the biotinylated fluorescent dye into the tumor animal model, the tumors of each group were excised and IVIS imaging was performed to confirm the signal of the biotinylated fluorescent dye, as shown in FIG. 19 .
  • IVIS in vivo imaging system
  • the recombinant strain-treated group including the B_R2-p-mSA plasmid maintained strong fluorescence activity compared to other groups.
  • the biotinylated fluorescent dye was strongly bound only when the recombinant strain of the present invention was used in small animals, and in particular, it was confirmed that real-time tumor imaging using a recombinant strain with tumor specificity was possible.
  • an in vivo imaging system (IVIS) was taken. Specifically, the CT26 cell line was first injected subcutaneously into the flank of Balb/c mice to construct a tumor animal model. Three days after the recombinant strain was injected into the tumor animal model, a biotinylated fluorescent dye was first injected. Two days later, a second biotinylated fluorescent dye was injected into the same tumor animal model. IVIS imaging was performed before the primary fluorescent dye injection, 6 hours after injection, and 9 hours after injection, and then IVIS imaging was performed before the second fluorescent dye injection, 6 hours after injection, and 9 hours after injection.
  • the biotinylated fluorescent dye signal was strongly maintained by the recombinant strain of the present invention in cancer tissues over time in the first injected biotinylated fluorescent dye. It was confirmed that the signal of the biotinylated fluorescent dye was strongly maintained in the cancer tissue over time by the secondary injection of the biotinylated fluorescent dye after being erased from it.
  • mSA of the recombinant strain of the present invention it means that the tumor image can be continuously checked even when the biotinylated fluorescent dye is treated multiple times, and that the biotinylated conjugate can be treated separately by controlling the time.
  • the gene construct according to the present invention particularly the monomeric streptavidin (mSA) expressed when it contains the regulatory gene according to the present invention, has excellent stability and can bind strongly to external biotin. , It was confirmed that it is effective even in vivo, and it can be treated with biotinylated fluorescent dye multiple times or by controlling the time.
  • mSA monomeric streptavidin

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 모노머형 스트렙타비딘을 발현하는 유전자 컨스트럭트 및 상기 유 전자 컨스트럭트를 포함하는 재조합 벡터가 도입된 균주에 관한 것으로서, 본 발명 에 따른 유전자 컨스트럭트는 균주를 통해 체내에 주입된 후 스트렙타비딘을 발현 하여, 비오틴화한 진단제로 균주의 위치나 균주가 예비 표적한 암조직을 실시간으 로 모니터링할 수 있을 뿐만 아니라 비오틴화한 항암제의 암 표적 효율을 높일 수 있다.

Description

모노머형 스트렙타비딘을 발현하기 위한 컨스트럭트
본 발명은 모노머형 스트렙타비딘을 발현하기 위한 컨스트럭트 및 상기 컨스트럭트를 포함하는 재조합 벡터가 도입된 숙주 세포에 관한 것이다.
암은 현재 전세계적으로 가장 많은 사망자를 내는 질병 중 하나로서, 평균 수명의 연장과 암 발생 연령이 낮아짐에 의해 암 발생률은 계속적으로 증가되고 있는 추세이다. 한국의 국립 암센터(National Cancer Center)에서 제공하는 2013년 통계 자료에 따르면, 2010년 암 등록 통계과에 등록된 우리 나라 암 발생 환자는 모두 202,053 명이며 계속적으로 증가되는 추세이다.
따라서, 암에 관해서는 세포수준의 기본연구에서부터 전방위적인 항암치료에 대한 연구가 전 세계적으로 추진되어 왔으나, 아직까지 암의 발생기전이 불명확하고, 재발방지 및 완치가 어려워 항암제에 대한 수요가 폭발적으로 늘어나고 있으며, 막대한 연구비가 연구소 및 기업체에 투자되고 있다. 하지만, 고가의 암 진단 및 항암치료 비용은 직접적인 의료비용일 뿐 아니라 발병 이후의 사회 경제활동의 위축, 재활 및 환자 간호에 따른 간접비용이 추가되어 암환자 가족 및 사회 구성원 전체에게 경제적으로 큰 부담이 되고 있으며 저비용의 새로운 기술도입이 요구되고 있는 실정이다.
한편, 스트렙타비딘(streptavidin) 및 아비딘(avidin) 단백질은 비오틴(biotin)에 대하여 높은 결합력을 갖는 단백질이며 비오틴과의 특이적인 상호작용을 이용한다면, 비오틴을 발현하는 종양에 특이적으로 반응하는 항암제 또는 면역 세포를 활용할 수 있는 등, 다양한 생물학적 응용분야에 적용될 수 있다.
그러나 이 단백질의 테트라머 형태는 비오틴 컨쥬게이트의 원치 않는 가교 결합을 초래할 수 있어 비오틴 활성이 유지되는 모노머형 스트렙타비딘 개발이 요구되고 있다. 최근 아비딘 중 하나인 리자비딘에 돌연변이를 도입시켜 모노머화 시키거나 스트렙타비딘과 리자비딘 서열을 융합하여 모노머형 단백질을 개발하는 등 모노머형 아비딘 유사 단백질이 개발되어 보고되고 있다. 그러나 생물학적 응용 분야에 활용하기 위해서는 정제과정을 거쳐 가용성을 담보하는 순도 높은 단백질을 얻어야 한다. 또한 아비딘 유사 단백질은 생체 내 주입시 혈청에서 신속하게 분해되어 임상 연구의 이용이 제한적이게 되는 문제가 있다.
본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 발명의 일 목적은 모노머형 스트렙타비딘(monomeric streptavidin; mSA)을 발현하기 위한 컨스트럭트를 제공하는 것이다.
본 발명의 다른 목적은 상기 컨스트럭트를 포함하는 재조합 벡터 및 이에 의해 형질 전환된 숙주 세포를 제공하는 것이다.
본 발명의 또 다른 목적은 모노머형 스트렙타비딘(monomeric streptavidin; mSA)을 발현하기 위한 유전자 컨스트럭트 제작을 위한 조절 유전자 스크리닝 방법을 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당 업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
이하, 본원에 기재된 다양한 구현예가 도면을 참조로 기재된다. 하기 설명에서, 본 발명의 완전한 이해를 위해서, 다양한 특이적 상세사항, 예컨대, 특이적 형태, 조성물 및 공정 등이 기재되어 있다. 그러나, 특정의 구현예는 이들 특이적 상세 사항 중 하나 이상 없이, 또는 다른 공지된 방법 및 형태와 함께 실행될 수 있다. 다른 예에서, 공지된 공정 및 제조 기술은 본 발명을 불필요하게 모호하게 하지 않게 하기 위해서, 특정의 상세사항으로 기재되지 않는다. "한 가지 구현예" 또는 "구현예"에 대한 본 명세서 전체를 통한 참조는 구현예와 결부되어 기재된 특별한 특징, 형태, 조성 또는 특성이 본 발명의 하나 이상의 구현예에 포함됨을 의미한다. 따라서, 본 명세서 전체에 걸친 다양한 위치에서 표현된 "한 가지 구현예에서" 또는 "구현예"의 상황은 반드시 본 발명의 동일한 구현예를 나타내지는 않는다. 추가로, 특별한 특징, 형태, 조성, 또는 특성은 하나 이상의 구현예에서 어떠한 적합한 방법으로 조합될 수 있다.
본 발명 내 특별한 정의가 없으면 본 명세서에 사용된 모든 과학적 및 기술적인 용어는 본 발명이 속하는 기술분야에서 당업자에 의하여 통상적으로 이해되는 것과 동일한 의미를 가진다.
본 발명의 일 구현 예에 따르면, 모노머형 스트렙타비딘(monomeric streptavidin; mSA)을 코딩하는 유전자; 말토오즈 결합 단백질(maltose-binding protein; MBP)을 코딩하는 유전자; 및 상기 모노머형 스트렙타비딘을 코딩하는 유전자의 발현을 조절하는 조절 유전자;를 포함하는, 유전자 컨스트럭트를 제공한다.
본 발명의 상기 "유전자 컨스트럭트"는, 숙주 균주 또는 세포에 형질 전환을 통해 재조합 내지 도입이 되는 경우 목적하는 단백질 등이 발현될 수 있도록 하는 구조체로서, 목적하는 단백질을 암호화하는 유전자일 뿐 아니라, 상기 유전자가 발현될 수 있도록 작동 가능하게 연결된 필수적인 조절 유전자를 포함하는 것을 의미한다.
본 발명에서 상기 "조절" 내지 "발현 조절"은 특정 유전자의 전사 및 번역이 활성화 또는 억제되는 것을 의미할 수 있다.
본 발명에서 상기 "스트렙타비딘(streptavidin)"은 비오틴(biotin)에 대하여 높은 결합력을 갖는 단백질이며 상기 비오틴과의 특이적인 상호작용을 이용하여 다양한 생물학적 응용분야에 적용되어 왔다. 상기 스트렙타비딘 단백질의 아미노산 서열은 상기 서열번호 1과 같이 나타낼 수 있고, 상기 스트렙타비딘을 코딩하는 유전자는 서열번호 2로 표시되는 것일 수 있으나, 이에 제한되지는 않는다.
본 발명에서 상기 "모노머형 스트렙타비딘(monomeric streptavidin; mSA)"은 상기 스트렙타비딘이 테트라머를 형성하며 바이오틴 컨쥬게이트의 원치 않는 가교 결합을 초래할 수 있도록, 모노머로 존재하는 스트렙타비딘이다.
본 발명에서 상기 "말토오즈 결합 단백질(maltose-binding protein; MBP)"은 대장균의 말토오즈/말토 덱스트린 시스템의 일부로, 말토 덱스트린의 흡수와 효율적인 이화 작용을 담당하는 약 42.5kDa의 단백질이며, 서열번호 3의 아미노산 서열로 나타낼 수 있고, 상기 말토오즈 결합 단백질을 코딩하는 유전자는 서열번호 4로 표시되는 것일 수 있으나, 이에 제한되지는 않는다.
본 발명에서, 상기 조절 유전자는 구조적으로 DNA-의존 RNA 폴리머라제(DNA-dependent RNA polymerase) 결합 위치, 전사 개시 지점 및 전사 인자 결합 지점, 억제 및 활성 단백질 결합 지점 및 당해 기술 분야의 숙련자에게 직접적으로 혹은 간접적으로 전사량 조절에 작용할 수 있다고 알려진 뉴클레오티드의 다른 어떠한 서열을 포함되는 핵산 분획을 나타낼 수 있으나, 이에 제한되지 않는다.
본 발명에서, 상기 조절 유전자는 상기 모노머형 스트렙타비딘을 코딩하는 유전자의 개시코돈의 5' 상류에 작동가능하도록 연결될 수 있다.
본 발명에서, 상기 조절 유전자는 리보솜 결합 부위(Ribosome binding site; RBS), 5'-비 번역 영역(5'-Untransrated Region; 5'-UTR) 및 전사 인자 결합 부위(transcription factor binding site)로 이루어진 군으로부터 선택되는 적어도 하나인 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, 상기 "리보솜 결합 부위(Ribosome-binding site; RBS)"는 유전자의 개시코돈의 상류에서 리보솜의 모집을 담당하여 번역을 진행시킨다. 원핵 생물의 리보솜 결합 부위는 5'-AGGAGG-3' 서열을 가지는 샤인-달가노(Shine-Dalgarno; SD) 서열을 포함한다. 상기 샤인-달가노 서열에 16S rRNA의 3' 말단이 상보적으로 결합하여 번역이 시작되는데, 상기 상보적인 서열인 CCUCCU 서열을 항-샤인-달가노(anti-Shine-Dalgarno; ASD) 서열이라고 한다.
본 발명에서, 상기 "5'-비 번역 영역(5'-Untransrated Region; 5'-UTR)"은 5' 지역에서 mRNA의 아미노산으로 번역되는 부분인 코딩 부분(coding region)의 양 쪽에 위치하는 번역이 되지 않는 부분으로, 진화 과정에서 불필요하게 버려지는 부분(junk)로 여겨졌으나, 유전자 발현 조절에 큰 역할을 하는 것으로 알려졌다.
본 발명에서, 상기 "전사 인자 결합 부위(transcription factor binding site)"는 근처의 특정 유전자를 켜거나 끄는 역할을 하는 DNA 부위이다. 상기 전사 인자 결합 부위는 상기 조절 단백질을 암호화하는 유전자의 프로모터, 인핸서(enhancer) 및 사일렌서(silencer)로 이루어진 군으로부터 선택되는 적어도 하나인 것일 수 있으나, 이에 제한되지는 않는다.
본 발명에서, 상기 조절 유전자는 상기 유전자 컨스트럭트를 포함하는 재조합 벡터가 숙주 세포에 형질 전환되는 경우, 상기 숙주 세포의 주변 세포질로 모노머형 스트렙타비딘이 발현되도록 하는 것이, 상기 숙주 세포의 내부에 머물거나 상기 주변 세포질에 머물지 않고 배출되는 경우보다 발현되는 모노머형 스트렙타비딘의 활용성이 높아 바람직하다.
본 발명에서, 상기 조절 유전자는 서열번호 26 내지 91 중 어느 하나로 표시되는 것일 수 있다.
본 발명에서, 상기 조절 유전자는 총 깁스 자유 에너지 변화량(ΔGtotal)이 0 이하인 것일 수 있다. 상기 "총 깁스 자유에너지 변화량(total Gibbs free energy change; ΔGtotal)"은, 상기 모노머형 스트렙타비딘의 번역 과정에서, 상기 조절 유전자의 mRNA 전사체(transcript)가 리보솜의 30S 서브유닛 복합체 상에 결합하기 전과 후의 깁스 자유 에너지의 차이 값이다. 상기 총 깁스 자유 에너지 변화량(ΔGtotal)이 0 이하인 경우, 상기 모노머형 스트렙타비딘을 코딩하는 유전자의 전사와 번역 능력이 상승할 수 있다. 상기 총 깁스 자유 에너지 변화량(ΔGtotal)은 하기 식 1 및 식 2와 같은 방법으로 계산될 수 있다.
[식 1]
ΔGtotal = (ΔGfinal) - (ΔGinitial)
[식 2]
(ΔGfinal) - (ΔGinitial) = [(ΔGmRNA-rRNA) + (ΔGspacing) + (ΔGstacking) + (ΔGstandby) + (ΔGstart)] - (ΔGmRNA)
상기 식 1 및 식 2에서, 상기 "ΔGfinal"은 리보솜의 30S 서브유닛 복합체가 상기 조절 유전자의 mRNA 전사체 상에 결합한 후의 깁스 자유 에너지 변화량이고; 상기 "ΔGinitial"은 리보솜의 30S 서브유닛 복합체가 상기 조절 유전자의 mRNA 전사체 상에 결합하기 전의 깁스 자유 에너지 변화량이다. 또한, 상기 식 2에서, 상기 "ΔGmRNA-rRNA"는 조절 유전자의 mRNA와 리보솜의 30S 서브유닛의 복합체를 형성하는 반응이 일어날 때의 깁스 자유 에너지 변화량이고, 상기 "ΔGspacing"은 상기 조절 유전자의 mRNA 전사체에서 리보솜의 30S 서브유닛의 복합체를 형성하는 서열과 개시코돈 간의 간격(Spacing)이 최적화 되지 않음으로써 발생하는 대한 깁스 자유 에너지 패널티(penalty)이며, 상기 "ΔGstacking"은 상기 간격(Spacing)의 영역에서 쌓인 뉴클레오티드의 깁스 자유 에너지 변화량이고, 상기 "ΔGstandby"는 상기 조절 유전자의 mRNA 전사체의 대기 부위(Stanby Site)와 리보솜 간 결합 반응이 일어나는 경우 깁스 자유 에너지 패널티, 상기 "ΔGstart"는 mRNA-tRNA 복합체를 형성하는 반응이 일어날 때의 깁스 자유 에너지 변화량, 상기 "ΔGmRNA"는 상기 조절 유전자의 mRNA 전사체가 접힌 복합체 구조물을 형성할 때의 깁스 자유 에너지 변화량이다.
본 발명에서, 상기 각 깁스 자유 에너지 변화량(ΔG)은 NUPACK, ViennaRNA 또는 UNAfold와 같이, 희석된 용액에서 유전자 가닥들의 상호 작용, 농도, 염기쌍의 복잡도, 매듭 구조 등의 변수를 고려하여 계산을 수행하는 소프트웨어에 의해 계산될 수 있으나, 이에 제한되지는 않는다.
본 발명에서, 상기 조절 유전자는 모노머형 스트렙타비딘의 생산량을 극대화할 수 있도록, 번역 개시 속도(Translation Initiation Rate; TIR)가 특정 범위를 갖도록 조절된 것일 수 있다.
본 발명에서 상기 "번역 개시 속도(Translation Initiation Rate; TIR)"는 하기 식 3으로 계산될 수 있으며, 합성 생물학에서 번역 단계는 전체 단백질 생산의 속도를 제한하는 단계이므로 유전자의 발현에 중요한 인자이다.
[식 3]
TIR = exp[k{(ΔGtotal) - (ΔG1total)}]
상기 식 3에서,
TIR의 단위는 au이고;
k는 볼츠만 상수로, 0.4 내지 0.6 mol/kcal일 수 있으며;
ΔGtotal은 상기 식 1에서 정의된 바와 같고;
ΔG1total은 상기 조절 유전자가 포함되지 않은 본 발명의 유전자 컨스트럭트에서의 깁스 자유 에너지 변화량에 해당하고, 바람직하게는 상기 조절 유전자가 포함되지 않고, 나머지 서열은 동일한 유전자 컨스트럭트의 자유 에너지 변화량에 해당할 수 있으나, 이에 제한되지는 않는다. 따라서, 상기 조절 유전자가 포함되지 않을 경우에 번역 개시 속도는 1au에 해당한다.
본 발명에서, 상기 조절 유전자는 번역 개시 속도가 50 내지 45000au, 바람직하게는 900 내지 45000au가 되도록 조절된 것이 형질 전환된 균주가 상기 모노머형 스트렙타비딘을 고효율로 생산할 수 있어 바람직하나, 이에 제한되지는 않는다.
본 발명에서, 상기 조절 유전자의 서열 길이는 15 내지 39bp인 것일 수 있고, 바람직하게는 26 내지 31bp로 이루어 질 수 있으나, 이에 제한되지는 않는다.
본 발명에서, 상기 조절 유전자는 서열번호 5로 표시되는 유전자 서열인 "AGG"를 포함하는 것일 수 있고, 상기 조절 유전자는 서열번호 6으로 표시되는 유전자 서열인 "TAGG"를 포함하는 것일 수 있으며, 상기 조절 유전자는 서열번호 7로 표시되는 유전자 서열인 "ATAGG"을 포함하는 것일 수 있으나, 이에 제한되지는 않는다.
본 발명에서, 상기 조절 유전자는 서열번호 5 내지 7로 표시되는 유전자 서열의 3' 말단에서 개시코돈 까지의 간격(Spacing)이 6 내지 13bp, 바람직하게는 6 내지 10bp인 것일 수 있다. 상기 간격이 6 내지 13bp인 경우, 상기 mRNA 전사체에서 rRNA 복합체를 형성하는 서열과 개시코돈 간의 최적화되지 않은 간격(Spacing)에 대한 깁스 자유 에너지 패널티(ΔGspacing)가 최소화되어, 그 결과 모노머형 스트렙타비딘의 발현 수준을 높일 수 있다.
본 발명의 바람직한 일 예시에서, 상기 조절 유전자는 상기 식 1의 총 깁스 자유 에너지 변화량(ΔGtotal)이 0 이하이고, 번역 개시 속도(TIR)가 900 내지 45000au로 조절된 것으로, 서열 길이는 26 내지 31bp로 이루어진 것이며, 서열번호 5 내지 7 중 어느 하나로 표시되는 유전자 서열을 포함하고, 상기 서열번호 5 내지 7 중 어느 하나로 표시되는 유전자의 3' 말단으로부터 상기 모노머형 스트렙타비딘을 코딩하는 유전자의 개시코돈까지 간격(Spacing)이 6 내지 10bp일 수 있다.
본 발명의 바람직한 다른 일 예시에서, 상기 조절 유전자는 서열번호 32 또는 36으로 표시될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 구현 예에 따르면, 본 발명의 상기 유전자 컨스트럭트를 포함하는 재조합 벡터에 관한 것이다.
본 발명에서, 상기 재조합 벡터는 구성적 발현 벡터(Constitutive Expression Vector)나 유도성 발현 벡터(Inducible Expression Vector) 일 수 있고, 그 예시로 pKD13, pCP20, pMA1, pUC19, pJL, pBAD, pET, pGEX, pMAL, pALTER, pCal, pcDNA, pDUAL, pTrc, pQE, pTet, pProEX HT, pPROLar.A, pPROTet.E, pRSET, pSE280, pSE380, pSE420, pThioHis, pTriEx, pTrxFus, Split GFP Fold 'n' Glow, pACYCDuet-1, pCDF-1b, pCDFDuet-1, pCOLADuet-1, pLysS, pRSF-1b, pRSFDuet-1, pT7-FLAG, T7Select, pCMV, pBluescript, pBac, pAc, pFastBacHT, pFastBac, pAO815, pPIC, pESC, pCas9, pwtCas9-bacteria, pgRNA-bacteria 및 pGRG 플라스미드 또는 에서 선택된 1 이상의 플라스미드에서 유래된 것일 수 있으나, 이에 제한되지는 않는다.
본 발명의 일 예시에서 상기 pKD13은 약 3.4kbp로 이루어져 있고, 베타-락타마제(beta-lactamase), Tn5 네오마이신 포스포트랜스퍼라제(Tn5 neomycin phosphotransferase), 람다 종결자(lambda terminator) 및 R6K 감마 복제 원점(R6K gamma replication origin) 유전자를 포함할 수 있다.
본 발명의 일 예시에서, 상기 pCP20 플라스미드는 약 9.4kbp로 이루어져 있고, EcoRI, cat, Pstl, HindⅢ, Ci857, flp, bamHi, 베타-락타마제(beta-lactamase), mobA, mob2 및 repA101ts 유전자 부위를 포함할 수 있다.
본 발명의 일 예시에서, 상기 pMA1 플라스미드는 Microcystis aeruginosa f. aeruginosa Kutzing에서 유래하고, 약 2.3kbp로 이루어져 있으며, HincⅡ 유전자 부위를 포함하는 것일 수 있다.
본 발명의 일 예시에서, 상기 pJL 플라스미드는 빈 백본을 가지고 RNA 바이러스 기반인 것일 수 있다.
본 발명의 일 예시에서, 상기 pBAD, pCMV 및 pCMV 플라스미드는 포유류 숙주세포에서 발현되고 CMV, 프로모터를 이용하며, 암피실린내성을 가지는 것일 수 있다.
본 발명의 일 예시에서, 상기 pET, pBluescript, pCal 및 pcDNA 플라스미드는 박테리아 숙주세포에서 발현되고 T7 또는 Lac 프로모터를 이용하며, 암피실린 내성을 가지는 것일 수 있다.
본 발명의 일 예시에서, 상기 pMAL 및 pGEX 플라스미드는 박테리아 숙주세포에서 발현되고 Tac 프로모터를 이용하며, 암피실린 내성을 가지는 것일 수 있다.
본 발명의 일 예시에서, 상기 pALTER 플라스미드는 박테리아 숙주세포에서 발현되고 T7 프로모터를 이용하며, 테트라사이클린 내성을 가지는 것일 수 있다.
본 발명의 일 예시에서, 상기 pDUAL 플라스미드는 박테리아 숙주세포에서 발현되고 T7 또는 Lac 프로모터를 이용하며, 카나마이신 내성을 가지는 것일 수 있다.
본 발명의 일 예시에서, 상기 pTrc 플라스미드는 박테리아 숙주세포에서 발현되고 trc 프로모터를 이용하며, 암피실린 내성을 가지는 것일 수 있다.
본 발명의 일 예시에서, 상기 pUC19 플라스미드는 박테리아 숙주세포에서 발현되고, 약 2.6kbp의 원형 이중 가닥 DNA로 이루어져 있으며, pUC18과 MCS 영역이 반대인 벡터이다. 상기 pU19 벡터는 형질 전환을 위하여 가장 널리 사용되는데, 상기 pU19에 의해 외래 DNA가 도입된 숙주 세포는 대조군에 비하여 성장 배지 속 콜로니의 색상이 달라지므로, 구별이 가능하다.
본 발명의 일 예시에서, 상기 pQE 플라스미드는 T5-lac 프로모터를 이용하고, 암피실린 내성을 가지는 것일 수 있다.
본 발명의 일 예시에서, 상기 pTet 플라스미드는 tet 오페론으로부터의 조절 서열의 제어 하에 CMV 프로모터를 포함하고 있어, 트랜스 활성화제인 pTet-tTAk와 공동 형질 감염될 때 독시사이클린이 없는 경우에만 단백질을 발현하는 것일 수 있다.
본 발명의 일 예시에서, 상기 pCas9, pwtCas9-bacteria 및 pgRNA-bacteria 플라스미드는 CRISPR 기술을 사용하여, Cas9 뉴클레아제 gRNA을 발현시키기 위한 것일 수 있다.
본 발명의 다른 구현 예에 따르면, 본 발명의 재조합 벡터가 도입되어 형질 전환된 숙주 세포를 제공한다.
본 발명에서, 상기 숙주 세포에 상기 재조합 벡터를 형질 전환시키는 방법은 당업계의 통상적인 도입 방법에 따라 수행될 수 있고, 구체적인 방법을 특별히 제한하지는 않으나, 예를 들면, 박테리아의 형질 전환 방법, CaCl2 침전법, CaCl2 방법에 환원물질인 DMSO(Dimethyl sulfoxide)를 사용함으로써 효율을 높인 Hanahan 방법, 전기천공법(Electroporation), 인산칼슘 침전법, 원형질 융합법, 실리콘 카바이드 섬유를 이용한 교반법, 아그로 박테리아 매개된 형질 전환법, PEG를 이용한 형질 전환법, 덱스트란 설페이트, 리포펙타민 및 건조/억제 매개된 형질 전환 방법 등을 사용할 수 있다.
본 발명에서, 상기 숙주 세포를 종양이 발병한 개체에 투여하는 경우 암조직에서만 모노머형 스트렙타비딘을 발현할 수 있는 효과가 있다. 따라서, 본 발명에서, 상기 숙주 세포는 종양이 발병한 개체에 투여하였을 때에 암조직에 비하여 정상 조직에서 생존력이 낮은 것이, 정상 조직에서 감염이 없고, 암조직에서만 모노머형 스트렙타비딘을 발현할 수 있어 바람직하다. 여기서, 상기 정상 조직은 폐, 간 및 비장으로 이루어진 군에서 선택되는 장기의 조직일 수 있으나, 이에 제한되지 않는다.
또한, 본 발명에서, 상기 숙주 세포는 포유 동물, 식물, 곤충, 균류 또는 세포성 기원의 세포가 포함될 수 있고, 예를 들면 대장균, 스트렙토미세스 또는 살모넬라(Salmonella) 속 균주 등의 박테리아 세포, 효모 세포, 피치아 파스 토리스 등의 균류 세포; 드로조필라, 스포도프테라 Sf9 세포 등의 곤충 세포, CHO(중국 햄스터 난소 세포, Chinese hamster ovary cells), SP2/0(생쥐 골수종), 인간 림프아구(Human lymphoblastoid), COS, NSO(생쥐 골수종), 293T 세포, 보우 멜라노마 세포, HT-1080 세포, BHK 세포(베이비 햄스터 신장세포, Baby Hamster Kidney cells), HEK 세포(인간 배아신장 세포, Human Embryonic Kidney cells) 또는 PERC.6 세포(인간 망막 세포)와 같은 동물 세포, 및 식물 세포로 구성된 군으로부터 선택되는 적어도 하나일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일 예시에서, 상기 숙주 세포는 박테리아 세포일 수 있고, 바람직하게는 혐기성 균주인 것이, 상기한 숙주 세포를 암 진단 및 치료의 목적으로 인체에 주입하였을 때에, 혈관 형성이 불완전하여 산소가 결핍된 환경인 암조직의 내부를 표적하기 때문에, 이와 같은 균주 내에 실시간으로 이미징이 가능한 리포터 단백질과 항암 단백질이 동시에 균형적으로 발현될 수 있는 재조합 벡터가 도입되어 있는 경우, 비오틴화한 진단제로 균주의 위치나 균주가 예비 표적한 암조직을 실시간으로 모니터링할 수 있을 뿐만 아니라, 비오틴화한 항암제의 암 표적 효율을 높여, 암을 매우 효과적으로 진단과 동시에 치료할 수 있도록 한다.
본 발명의 다른 일 예시에서, 상기 숙주 세포는 살모넬라 속 균주, 클로스트리듐(Clostridium) 속 균주, 비피도박테리움(Bifidobacterium) 속 균주 및 대장균 속 균주로 구성된 군으로부터 선택되는 적어도 하나일 수 있으며, 보다 바람직하게는 살모넬라 티피뮤리움(Salmonella typhimurium), 살모넬라 콜레라수스(Salmonella choleraesuis) 및 살모넬라 엔테리티디스(Salmonella enteritidis)로 구성된 군으로부터 선택되는 적어도 하나인 것일 수 있고, 더욱 바람직하게는 살모넬라 티피뮤리움일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 상기 "살모넬라 티피무륨(Salmonella typhimurium)"은 살모넬라(Salmonella) 속의 장티푸스를 일으키는 원인균이다. 상기 살모넬라 티피무륨은 막대기 모양의 간균으로 편모가 있고 그람 음성이다. 상기 살모넬라 티피무륨은 열에 약하여 60℃에서 20분만에 사멸하며, 가축, 야생 동물, 보균자 등이나 우유, 계란 등에 의해 1차 오염되고 오염된 생육 등에서 2차 감염을 받기 쉬운 샐러드 등도 원인이 되어 식중독의 일종인 살모넬라증(Salmonellosis)을 유발할 수 있다.
본 발명에서 상기 "살모넬라 콜레라수이스(Salmonella choleraesuis)"는 살모넬라(Salmonella)속의 돼지 콜레라균으로 잘 알려져 있는 균으로 사람과 동물 모두에게 감염되는 균이다. 상기 살모넬라 콜레라수이스는 살모넬라에 의한 급성패혈증의 주된 원인균이다. 이 균은 주모(周毛)를 가지고 있어 운동성이 있는 그람 음성의 통성 혐기성 간균이다. 유당 분해력이 없고, 인돌을 형성하지 않으며, 황화수소를 생성하지 않아 대장균과는 구별된다. 발육최적온도는 35~37℃이고, 증식가능 온도범위는 10~43℃이며, 60℃에서 20분간 가열로 사멸한다. 최적 pH는 7.2~7.4이고, 크기는 0.5~0.8Х3~4μm이다.
본 발명에서 상기 "살모넬라 엔테리티디스(Salmonella enteritidis)"는 살모넬라(Salmonella) 속의 세균성 감염형 식중독의 원인균으로 장염균이라고도 한다. 상기 살모넬라 엔테리티디스는 살모넬라의 대표적인 균으로 모든 동물에서 감염을 일으킬 수 있고 숙주 적응력이 매우 높다. 주모(周毛)를 가지고 있어 운동성이 있는 그람 음성의 통성 혐기성 간균이다. 유당 분해력이 없고, 인돌을 형성하지 않으며, 황화수소를 생성하지 않아 대장균과는 구별된다. 발육 최적 온도는 35~37℃이고 증식이 가능한 온도 범위는 10~43℃이며, 60℃에서 20분간 가열로 사멸한다. 최적 pH는 7.2~7.4이고, 크기는 0.5~0.8Х3~4μm이다.
본 발명에서 상기 "살모넬라 인판티스(Salmonella infantis)"는 계란 또는 가금육류에 의해 감염되는 균주이고, 파라티푸스 균(Salmonella paratyphi) 및 장티푸스 균(Salmonella typhi)은 장티푸스의 원인균주이다.
또한, 본 발명에서, 상기 숙주 세포는 개체에 투여 시 경우 독성 및 다른 부작용 등을 감소시킬 수 있도록 약독화된 것일 수 있다.
본 발명의 일 예시에서, 상기 숙주 세포는 그에서 발현되는 aroA, aroC, aroD, aroE, Rpur, htrA, ompR, ompF, ompC, galE, cya, crp, cyp, phoP, phoQ, rfaY, dksA, hupA, sipC, clpB, clpP, clpX, pab, nadA, pncB, pmi, rpsL, hemA, rfc, poxA, galU, cdt, pur, ssa, guaA, guaB, fliD, flgK, flgL, relA, spoA 및 spoT로 이루어진 군으로부터 선택되는 적어도 하나를 코딩하는 유전자가 변형되어 약독화된 것일 수 있다.
본 발명의 다른 일 예시에서, 상기 숙주 세포는 구아노신 다인산 합성능이 결여되어 약독화된 것일 수 있다. 상기 구아노신 다인산은 구아노신-5-이인산-3-이인산(ppGpp)일 수 있고, 상기 숙주 세포는, 구아노신-5-이인산-3-이인산(ppGpp)을 가수분해하는 RelA 또는 구아노신-5-이인산-3-이인산(ppGpp)을 합성하는 spoT 코딩하는 유전자가 변형되어 상기 구아노신-5-이인산-3-이인산(ppGpp)의 합성능이 결여된 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서, 상기 숙주 세포에 유전자에 변형을 가하는 방법은 당업계에 공지된 다양한 유전자의 결실 또는 파괴하는 방법에 의해 수행될 수 있고, 예를 들면, 상기 결실 및 파괴 방법은 상동성 재조합, 화학적 변이유발, 조사 변이유발 또는 트랜스포존 변이유발 등과 같은 방법에 의해 수행될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구현 예에 따르면, 벡터에 모노머형 스트렙타비딘(monomeric streptavidin; mSA)을 코딩하는 유전자 및 후보 조절 유전자를 도입하는 단계; 및 상기 벡터에 의한 발현되는 모노머형 스트렙타비딘을 코딩하는 유전자의 발현 수준을 측정하는 단계를 포함하는, 모노머형 스트렙타비딘 발현 조절용 조절 유전자의 스크리닝 방법을 제공한다.
본 발명에서, 상기 후보 조절 유전자는 총 깁스 자유 에너지 변화량(ΔGtotal)이 0 이하로 조절된 것; 번역 개시 속도가 900 내지 9000au 범위인 것; 서열 길이가 15 내지 39bp인 것; 서열번호 5 내지 7 중 어느 하나로 표시되는 유전자 서열을 포함하는 것; 및 서열번호 5 내지 7 중 어느 하나로 표시되는 유전자 서열을 포함하며, 상기 유전자 서열의 3' 말단에서 개시코돈 까지의 간격(Spacing)이 6 내지 13bp인 것; 중 적어도 하나의 조건을 만족하는 것일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 도입하는 단계 시, 상기 벡터에 말토오즈 결합 단백질(maltose-binding protein; MBP)을 코딩하는 유전자를 더 도입할 수 있다.
본 발명에서, 상기 발현 수준을 측정하는 단계는 상기 모노며형 스트렙타비딘을 코딩하는 유전자 및 상기 후보 조절 유전자가 도입된 벡터에 의해 형질 전환된 숙주 세포로부터 발현되는 모노머형 스트렙타비딘의 발현 수준을 측정하며 수행될 수 있다.
본 발명에서, 상기 측정된 모노머형 스트렙타비딘 발현 수준이 상기 후보 조절 유전자가 도입되기 전에 비하여 증가한 경우, 상기 후보 조절 유전자를 상기 모노머형 스트렙타비딘 발현을 증가시키기 위한 것으로 판단할 수 있다.
또한, 본 발명에서, 상기 발현 수준을 측정하는 단계는 상기 형질 전환된 숙주 세포의 주변 세포질에서 발현되는 모노머형 스트렙타비딘의 발현 수준을 측정하며 수행될 수 있다.
본 발명에서, 상기 형질 전환된 숙주 세포의 주변 세포질에서 상기 모노머형 스트렙타비딘이 발현되는 경우, 상기 후보 조절 유전자를 상기 모노머형 스트렙타비딘 발현을 증가시키기 위한 것으로 판단할 수 있다. 본 발명에서 상기와 같이 상기 형질 전환된 숙주 세포의 주변 세포질에서 모노머형 스트렙타비딘이 발현되는 경우, 상기 숙주 세포의 세포 내부에서 상기 모노머형 스트렙타비딘이 발현되거나 상기 모노머형 스트렙타비딘이 발현 후 주변 세포질에 머물지 않고 배출되는 경우 보다 발현되는 모노머형 스트렙타비딘의 활용성이 높을 수 있다.
본 발명에서, 상기 발현 수준을 측정하는 단계는 상기 형질 전환된 숙주 세포를 배양하는 단계를 더 포함하는 것일 수 있다.
본 발명에서, 상기 배양하는 단계는 항생제를 포함하는 LB 배지(Lysogeny broth)를 이용하여 수행될 수 있고, 상기 LB 배지는 시겔라(Shigella) 속 균주의 성장과 플라크 형성을 최적화하기 주세페 베르타니(Giuseppe Bertani)에 의해 위해 개발되었고, 일반적인 성분에는 펩티드, 카제인 펩톤, 비타민(B 비타민 포함), 미량 원소(질소, 황, 마그네슘), 무기질이 포함되며, 삼투압은 염화 나트륨으로 조절되는 것일 수 있으나, 이에 제한되지는 않는다.
본 발명의 스크리닝 방법에서, 상기 총 깁스 자유 에너지 변화량(ΔGtotal), 번역 개시 속도, 숙주 세포 및 도입에 관한 기재는 앞서 기재된 바와 중복되어 명세서의 과도한 복잡을 피하기 위하여 이하 그 자세한 기재를 생략한다.
본 발명에 따른 유전자 컨스트럭트를 포함하는 제조합 벡터를 숙주 세포 내로 도입하는 경우 상기 숙주 세포 내에서 모노머형 스트렙타비딘이 높은 생산량으로 발현될 수 있다.
또한, 본 발명에 따라 모노머형 스트렙타비딘을 발현하는 숙주 세포를 종양이 발병한 개체에 투여하는 경우, 상기 숙주 세포로부터 발현되는 모노머형 스트렙타비딘은 체내에서 그 기능성을 유지할 수 있다. 따라서, 종양을 타겟으로 하는 숙주 세포와 함께 종양의 진단용 또는 치료용 비오틴화(biotinylated) 약물을 함께 투여하게 되면 상기 비오틴화 약물은 모노머형 스트렙타비딘에 결합하여 암조직에만 선택적으로 작용할 수 있다.
도 1은 실험예 1에서 mSA 유전자를 단독으로 형질 도입시킨 플라스미드의 발현 결과를 나타낸 것이다.
도 2은 실험예 2에서 MBP-mSA 유전자 발현 결과를 나타낸 것이다.
도 3은 실험예 2에서 MBP-mSA 유전자 발현 및 활성 확인을 위한 웨스턴 블롯 결과를 나타낸 것이다.
도 4는 실험예 2에서 재조합 균주의 비오틴 결합을 분석한 결과를 그래프로 나타낸 것이다.
도 5는 실험예 2에서 재조합 균주의 비오틴 결합을 공초점 현미경을 통해 이미지로 나타낸 것이다.
도 6은 실험예 2에서 재조합 균주의 비오틴 결합을 공초점 현미경을 통해 이미지로 나타낸 것이다.
도 7은 실험예 3에서 MBP-mSA 유전자 발현 결과를 나타낸 것이다.
도 8은 실험예 3에서 MBP-mSA 유전자 발현 및 활성 확인을 위한 웨스턴 블롯 결과를 나타낸 것이다.
도 9는 실험예 4에서 MBP-mSA 유전자 발현 확인을 위한 웨스턴 블롯 결과를 나타낸 것이다.
도 10은 실험예 4에서 MBP-mSA 유전자 발현 비교를 위한 웨스턴 블롯 결과를 나타낸 것이다.
도 11은 실험예 4에서 재조합 균주의 비오틴 결합을 분석한 결과를 그래프로 나타낸 것이다.
도 12는 실험예 4에서 재조합 균주의 비오틴 결합을 공초점 현미경을 통해 이미지로 나타낸 것이다.
도 13은 실험예 4에서 재조합 균주의 비오틴 결합을 공초점 현미경을 통해 이미지로 나타낸 것이다.
도 14는 실험예 5에서 재조합 균주의 비오틴 결합 특이성을 분석한 결과를 그래프로 나타낸 것이다.
도 15는 실험예 5에서 재조합 균주의 비오틴 결합 특이성을 분석한 결과를 그래프로 나타낸 것이다.
도 16은 실험예 5에서 종양 동물 모델에서 재조합 균주의 비오틴 결합을 이미지로 나타낸 것이다.
도 17은 실험예 5에서 종양 동물 모델에서 재조합 균주의 비오틴 결합을 이미지로 나타낸 것이다.
도 18은 실험예 5에서 종양 동물 모델에서 재조합 균주의 비오틴 결합을 이미지로 나타낸 것이다.
도 19는 실험예 5에서 적출된 종양에서 재조합 균주의 비오틴 결합을 이미지로 나타낸 것이다.
도 20은 실험예 5에서 종양 동물 모델에서 재조합 균주의 비오틴 결합을 이미지로 나타낸 것이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
[실시예 1] mSA 발현 플라스미드 제작
[1-1] mSA 유전자 삽입 플라스미드 제작
재조합 균주에서 mSA 발현을 위한 플라스미드 제작을 위해 서열번호 2로 표시되는 모노머형 스트렙타비딘(mSA) 유전자를 합성(마크로젠, 한국)하여 증폭한 뒤, 제한효소 EcoRⅠ 및 SalⅠ을 넣어 절단하고 이를 정제하여 유전자 증폭 산물을 얻은 뒤에 이를 동일한 제한효소로 절단한 pBAD24 플라스미드에 클로닝 하여 pBAD-mSA(B-mSA) 플라스미드를 제작하였다.
추가로 mSA 유전자의 발현을 증가시키기 위해 프로모터 하류에 하기 표 1의 리보솜 결합 부위(Ribosome Binding Site; RBS)인 BBa_B0032, BBa_B0030, BBa_B0034를 삽입하여 pBAD_RBS 0.3-mSA(B_R0.3-mSA), pBAD_RBS 0.6-mSA(B_R0.6-mSA), pBAD_RBS 1.0-mSA(B_R1.0-mSA) 플라스미드를 제작하였다.
또한, 유전자의 발현과 가용성을 증가시키기 위해 pBAD-mSA 플라스미드를 주형으로 하여 mSA 유전자를 증폭한 뒤, 제한효소 EcoRⅠ 및 HindⅢ을 넣어 절단하고 이를 정제하여 유전자 증폭 산물을 얻은 뒤에 이를 동일한 제한효소로 절단한 pMAl_p2x, pMAl_c2x 플라스미드에 클로닝 하여 pMAl_p2x-mSA(M_p-mSA), pMAl_c2x-mSA(M_c-mSA) 플라스미드를 제작하였다.
[1-2] mSA-MBP 발현 플라스미드 제작
그 다음, 동물실험에 이용할 수 있도록 M-p-mSA 및 M-c-mSA 플라스미드에, 서열번호 4로 표시되는 말토오즈 결합 단백질(MBP)을 코딩하는 유전자와 서열번호 2로 표시되는 mSA 유전자가 융합된 BBa_B0034 서열을 pBAD24에 다시 클로닝하여 pBAD_p2x-mSA(B_p-mSA), pBAD_c2x-mSA(B_c-mSA), pBAD_RBS1-p2x-mSA(B_R1.0-p-mSA), pBAD_RBS1-c2x-mSA(B_R1.0-c-mSA) 플라스미드를 제작하였다.
[1-3] RBS 치환 플라스미드 제작
mSA 발현 수준 및 기능성을 증가시키기 위해서, 기존 RBS를 신규한 조절 유전자로 치환한 유전자 컨스트럭트를 추가로 제작하였다(하기 표 1). 우선 플라스미드의 RBS 서열을 분석하여 서열 라이브러리를 제작하였다. 다음으로 RBS 계산기(Penn State University) 프로그램을 이용하여 B_p-mSA 플라스미드의 번역 개시 속도(TIR)를 분석한 후, RBS 라이브러리 계산기(RBS Library Calculator)를 통하여 번역 개시 속도의 값 범위가 3.97에서 42889인 조절 유전자 라이브러리를 구축하였다. 상기 라이브러리에 따라 제작된 조절 유전자를 B_p-mSA 플라스미드의 RBS 서열과 치환하여 클로닝한 후 생성된 콜로니를 선별하여 최종 플라스미드 pBAD_R01-p2x-mSA(B_R01-p-mSA), pBAD_R02-p2x-mSA(B_R02-p-mSA), pBAD_R1-p2x-mSA(B_R1-p-mSA), pBAD_R11-p2x-mSA(B_R11-p-mSA), pBAD_R12-p2x-mSA(B_R12-p-mSA), pBAD_R13-p2x-mSA(B_R13-p-mSA), pBAD_R2-p2x-mSA(B_R2-p-mSA), pBAD_R21-p2x-mSA(B_R21-p-mSA)를 제작하였다(하기 표 1 참고).
상기 실시예 [1-1] 내지 [1-3]에서 제작한 각 유전자 컨스트럭트의 명칭, 약자, 기본 플라스미드 및 전체 서열은 하기 표 1에 나타낸 바와 같다.
명칭
(약자)		 기본
플라스미드		 유전자 컨스트럭트
mSA MBP RBS 전체 서열
pBAD-mSA
(B-mSA)		 pBAD24 서열번호 2 미추가 비치환 서열번호 8
pBAD_RBS 0.3-mSA
(B_R0.3-mSA)		 pBAD24 서열번호 2 미추가 서열번호 26 서열번호 9
pBAD_RBS 0.6-mSA
(B_R0.6-mSA)		 pBAD24 서열번호 2 미추가 서열번호 27 서열번호 10
pBAD_RBS 1.0-mSA
(B_R1.0-mSA)		 pBAD24 서열번호 2 미추가 서열번호 28 서열번호 11
pMAl_p2x-mSA
(M_p-mSA)		 pMAl_p2x 서열번호 2 서열번호 4 비치환 서열번호 12
pMAl_c2x-mSA
(M_c-mSA)		 pMAl_c2x 서열번호 2 서열번호 4 비치환 서열번호 13
pBAD_p2x-mSA
(B_p-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 29 서열번호 14
pBAD_c2x-mSA
(B_c-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 29 서열번호 15
pBAD_RBS1-p2x-mSA
(B_R1.0-p-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 28 서열번호 16
pBAD_RBS1-c2x-mSA
(B_R1.0-c-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 28 서열번호 17
pBAD_R01-p2x-mSA
(B_R01-p-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 30 서열번호 18
pBAD_R02-p2x-mSA
(B_R02-p-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 31 서열번호 19
pBAD_R1-p2x-mSA
(B_R1-p-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 32 서열번호 20
pBAD_R11-p2x-mSA
(B_R11-p-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 33 서열번호 21
pBAD_R12-p2x-mSA
(B_R12-p-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 34 서열번호 22
pBAD_R13-p2x-mSA
(B_R13-p-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 35 서열번호 23
pBAD_R2-p2x-mSA
(B_R2-p-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 36 서열번호 24
pBAD_R21-p2x-mSA
(B_R21-p-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 37 서열번호 25
pBAD R-lib-1-1-mSA
(R-lib-1-1-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 65 서열번호 38
pBAD R-lib-1-5-mSA
(R-lib-1-5-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 66 서열번호 39
pBAD R-lib-1-7-mSA
(R-lib-1-7-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 67 서열번호 40
pBAD R-lib-1-10-mSA
(R-lib-1-10-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 68 서열번호 41
pBAD R-lib-1-11-mSA
(R-lib-1-11-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 69 서열번호 42
pBAD R-lib-1-12-mSA
(R-lib-1-12-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 70 서열번호 43
pBAD R-lib-1-13-mSA
(R-lib-1-13-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 71 서열번호 44
pBAD R-lib-1-14-mSA
(R-lib-1-14-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 72 서열번호 45
pBAD R-lib-1-16-mSA
(R-lib-1-16-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 73 서열번호 46
pBAD R-lib-1-17-mSA
(R-lib-1-17-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 74 서열번호 47
pBAD R-lib-1-18-mSA
(R-lib-1-18-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 75 서열번호 48
pBAD R-lib-2-2-mSA
(R-lib-2-2-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 76 서열번호 49
pBAD R-lib-2-3-mSA
(R-lib-2-3-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 77 서열번호 50
pBAD R-lib-2-4-mSA
(R-lib-2-4-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 78 서열번호 51
pBAD R-lib-2-5-mSA
(R-lib-2-5-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 79 서열번호 52
pBAD R-lib-2-6-mSA
(R-lib-2-6-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 80 서열번호 53
pBAD R-lib-2-7-mSA
(R-lib-2-7-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 81 서열번호 54
pBAD R-lib-2-8-mSA
(R-lib-2-8-mSA)		 pBAD24 서열번호 2 서열번호 4 서열번호 82 서열번호 55
pBAD R-lib-2-14-mSA
(R-lib-2-14-mSA		 pBAD24 서열번호 2 서열번호 4 서열번호 83 서열번호 56
pBAD R-lib-2-16-mSA
(R-lib-2-16-mSA		 pBAD24 서열번호 2 서열번호 4 서열번호 84 서열번호 57
pBAD R-lib-2-17-mSA
(R-lib-2-17-mSA		 pBAD24 서열번호 2 서열번호 4 서열번호 85 서열번호 58
pBAD R-lib-3-4-mSA
(R-lib-3-4-mSA		 pBAD24 서열번호 2 서열번호 4 서열번호 86 서열번호 59
pBAD R-lib-3-5-mSA
(R-lib-3-5-mSA		 pBAD24 서열번호 2 서열번호 4 서열번호 87 서열번호 60
pBAD R-lib-3-11-mSA
(R-lib-3-11-mSA		 pBAD24 서열번호 2 서열번호 4 서열번호 88 서열번호 61
pBAD R-lib-3-13-mSA
(R-lib-3-13-mSA		 pBAD24 서열번호 2 서열번호 4 서열번호 89 서열번호 62
pBAD R-lib-3-18-mSA
(R-lib-3-18-mSA		 pBAD24 서열번호 2 서열번호 4 서열번호 90 서열번호 63
pBAD R-lib-3-20-mSA
(R-lib-3-20-mSA		 pBAD24 서열번호 2 서열번호 4 서열번호 91 서열번호 64
[1-4] 조절 유전자 전사체의 총 깁스 자유 에너지 변화량 계산
상기 실시예 [1-3]에서 제작된 리보솜 결합 부위(RBS)의 프로모터로부터 개시코돈 까지의 서열에서, 총 깁스 자유 에너지 변화량(ΔGtotal)에 따른 상기 유전자 컨스트럭트의 mSA 발현 능력을 확인하기 위해, 조절 유전자의 mRNA와 리보솜의 30S 서브유닛의 복합체를 형성하는 반응이 일어날 때의 깁스 자유 에너지 변화량(ΔGmRNA-rRNA), 상기 조절 유전자의 mRNA 전사체에서 리보솜의 30S 서브유닛의 복합체를 형성하는 서열과 개시코돈 간의 간격(Spacing)이 최적화 되지 않음으로써 발생하는 대한 깁스 자유 에너지 패널티(ΔGspacing), 상기 간격(Spacing)의 영역에서 쌓인 뉴클레오티드의 깁스 자유 에너지 변화량(ΔGstacking), 상기 조절 유전자의 mRNA 전사체의 대기 부위(Stanby Site)와 리보솜 간 결합 반응이 일어나는 경우 깁스 자유 에너지 패널티(ΔGstandby), mRNA-tRNA 복합체를 형성하는 반응이 일어날 때의 깁스 자유 에너지 변화량(ΔGstart) 및 상기 조절 유전자의 mRNA 전사체가 접힌 복합체 구조물을 형성할 때의 깁스 자유 에너지 변화량(ΔGmRNA)을 계산하여 총 깁스 자유 에너지 변화량(ΔGtotal)을 계산한 결과를 하기 표 2에 나타내었다. 여기서, 상기 총 깁스 자유 에너지 변화량(ΔGtotal)은 하기 식 1 및 식 2와 같은 방법으로 계산되었다:
[식 1]
ΔGtotal = (ΔGfinal) - (ΔGinitial)
[식 2]
(ΔGfinal) - (ΔGinitial) = [(ΔGmRNA-rRNA) + (ΔGspacing) + (ΔGstacking) + (ΔGstandby) + (ΔGstart)] - (ΔGmRNA)
RBS 단위 kcal/mol
서열번호 ΔGmRNA-rRNA ΔGspacing ΔGstacking ΔGstandby ΔGstart ΔGmRNA ΔGtotal
29 -14.4914 4.992 0 2.41 -2.76 -15.01 4.944348676
30 -6.84135 1.525 0 1.5336 -2.76 -7.76 1.328848924
31 1.158649 0.005326 0 0.4314 -0.42 -3.4 4.641874373
32 -7.05135 0 0 1.0898 -2.76 -5.79 -3.555751381
33 -1.37135 0 0 0.0786 -2.76 -4.17 0.1498488
34 -0.24135 0 0 0.29 -2.76 -6.12 3.239348447
35 -5.39135 0.672 0 4.0728 -2.76 -7.41 3.862748471
36 -9.37135 0.288 0 4.0728 -2.76 -4.61 -3.458051381
37 -7.44135 0 0 4.8986 -2.76 -8.12 2.647948438
65 -7.44135 0 0 4.8986 -2.76 -10.25 4.777948552
66 -13.8614 0.288 0 4.0728 -2.76 -4.62 -7.9380514
67 -7.77135 0.288 0 4.0728 -2.76 -5.98 -0.488051352
68 -5.39135 0.288 0 4.0728 -2.76 -5.98 1.891948643
69 -2.68135 0.288 0 3.3234 -2.76 -4.61 2.482548676
70 -5.39135 0.288 0 4.0728 -2.76 -4.61 0.521948757
71 -2.68135 0.288 0 4.0728 -2.76 -5.37 3.991948428
72 -2.56135 0 0 3.3234 -2.76 -4.61 2.4427488
73 -3.96135 0.288 0 4.8986 -2.76 -6.51 4.67774886
74 -6.95135 0.288 0 4.8986 -2.76 -6.45 1.627748371
75 -7.49135 0.288 0 4.0728 -2.76 -6.78 0.59194881
76 -9.37135 0 0 2.6504 -2.76 -5.68 -4.216651686
77 -7.27135 0 0 2.6504 -2.76 -4.59 -3.283051219
78 -7.27135 0 0 2.6504 -2.76 -4.59 -2.966951219
79 -10.9714 0 0 2.6504 -2.76 -3.99 -7.41975141
80 -8.87135 0 0 2.6504 -2.76 -2.9 -6.510651419
81 -10.9714 0 0 2.6504 -2.76 -3.58 -7.860951495
82 -9.37135 0 0 2.6504 -2.76 -4.59 -5.403751362
83 -8.87135 0 0 2.6504 -2.76 -3.82 -5.729451581
84 -9.37135 0 0 2.6504 -2.76 -2.44 -7.456651457
85 -8.87135 0 0 2.6504 -2.76 -2.31 -7.100651572
86 -7.58135 1.525 0 0.0168 -2.76 -4.78 -4.109751104
87 -5.27135 0 0 0.4314 -2.76 -4.46 -3.219451333
88 -5.27135 0 0 0.4314 -2.76 -4.27 -3.76635139
89 -5.27135 0 0 0.4314 -2.76 -5.47 -2.476551581
90 -5.06135 0.005326 0 0.2168 -2.76 -4.1 -3.800725876
91 -7.75135 1.525 0 0.4314 -2.76 -4.95 -3.695151507
[1-5] 조절 유전자의 번역 개시 속도 계산
상기 조절 유전자의 번역 개시 속도(Translation Initiation Rate; TIR)에 따른 플라스미드의 mSA 발현 능력을 확인하기 위해, 상기와 같이 제작된 조절 유전자 서열에 따른 각 번역 개시 속도를 계산하여 하기 표 3와 같이 나타내었다.
조절 유전자 번역 개시 속도(au)
비치환된 경우 1
서열번호 29 133.266441
서열번호 30 678.2310709
서열번호 31 152.7003477
서열번호 32 6110.586323
서열번호 33 1152.963841
서열번호 34 287.0559877
서열번호 35 216.8312084
서열번호 36 5847.72872
서열번호 37 374.5906748
서열번호 65 143.6296318
서열번호 66 43914.95671
서열번호 67 1536.365645
서열번호 68 526.4033937
서열번호 69 403.5382313
서열번호 70 975.1871797
서열번호 71 204.582929
서열번호 72 410.8314232
서열번호 73 150.2547754
서열번호 74 592.8668512
서열번호 75 944.9445588
서열번호 76 8227.297678
서열번호 77 5404.842895
서열번호 78 4688.141139
서열번호 79 34778.40472
서열번호 80 23100.64943
서열번호 81 42417.31004
서열번호 82 14037.12899
서열번호 83 16253.13229
서열번호 84 35360.78091
서열번호 85 30125.96282
서열번호 86 7840.852282
서열번호 87 5252.334127
서열번호 88 6718.078741
서열번호 89 3759.681518
서열번호 90 6822.815917
서열번호 91 6506.222717
상기 표 3에서 나타낸 바와 같이, 제작된 플라스미드의 조절 유전자 중 서열번호 29 내지 37 및 65 내지 91의 조절 유전자는 번역 개시 속도가 50 내지 45000au 범위에 해당하였고, 그 중 서열번호 32 및 36의 조절 유전자는 번역 개시 속도가 900 내지 9000au 범위에 해당하는 것을 확인하였다.
[1-6] 조절 유전자의 서열 분석
상기 조절 유전자 서열의 AGG, TAGG 또는 ATAGG 서열 포함 여부 및 상기 AGG 서열의 3' 말단에서 개시코돈 까지의 간격(Spacing)에 따른 플라스미드의 mSA 발현 능력을 확인하기 위해, 각 플라스미드에 따른 조절 유전자 서열 및 상기 AGG 서열의 3' 말단에서 개시코돈 까지의 간격(Spacing, 단위 bp)을 하기 표 4와 같이 나타내었다.
조절 유전자 서열 Spacing(bp)
서열번호 26 TCACACAGGAAAG 4
서열번호 27 ATTAAAGAGGAGAAA 5
서열번호 28 AAAGAGGAGAAA 5
서열번호 29 ACCCGTTTTTTGGGCTAACAGGAGGAAGCTAGCGCTAGC 14
서열번호 30 TAGCACTCGTTGACATACGGACGTCAC -
서열번호 31 ACTACTGAGGCTACT 5
서열번호 32 TGGAACAGCTCACGCAAAAATAGGTTTCTT 6
서열번호 33 CGCTTTTTATCGCAACTCTCTACTGTTTCTCCAT -
서열번호 34 TCTGAGAAAGACACGATCTTACTAG -
서열번호 35 TCTAGAGAAAGAGCGGATCCTACCTAG -
서열번호 36 TCTAGAGAAAGATAGGAGAATACTAG 10
서열번호 37 TCTAGAGAAAGAGGCGACGGTACTAG 11
서열번호 65 TCTAGAGAAAGAGGCGAGTGTACTAG 12
서열번호 66 TCTAGAGAAAGATAGGAGGTTACTAG 10
서열번호 67 TCTAGAGAAAGAGGGGACACTACTAG 12
서열번호 68 TCTAGAGAAAGAGCGGAAACTACTAG -
서열번호 69 TTCTAGAGAAAGATTTGAATATACTAG -
서열번호 70 TCTAGAGAAAGAACGGACATTACTAG -
서열번호 71 TCTAGAGAAAGACATGACTATACTAG -
서열번호 72 TCTAGAGAAAGAACTGAAGATACTAG -
서열번호 73 TCTAGAGAAAGAGGCGATCCTACTAG 12
서열번호 74 TCTAGAGAAAGAAGAGAGCCTACTAG -
서열번호 75 TCTAGAGAAAGACTTGAGGCTACTAG 7
서열번호 76 GAACCCTAATACATTAGGAGATCTTCT 9
서열번호 77 GAACCCTAATACATTAGGACATATTCT 9
서열번호 78 GAACCCTAATACATTAGGACATCATCT 9
서열번호 79 GAACCCTAATACATAAGGAGATCATAT 9
서열번호 80 GAACCCTAATACATAAGGACATAATAT 9
서열번호 81 GAACCCTAATACATAAGGAGATTATCT 9
서열번호 82 GAACCCTAATACATTAGGAGATTATAT 9
서열번호 83 GAACCCTAATACATAAGGACATCTTAT 9
서열번호 84 GAACACTAATACATTAGGAGATCTTCT 9
서열번호 85 GAACACTAATACATAAGGACATAATAT 9
서열번호 86 TTAAGTAGTTAAACAGGGTATATAGGGGAAGA 6
서열번호 87 TTAAGTAGTTAAACAGGGTATATAGGACGAGA 6
서열번호 88 TTAAGTAGTTAAACAGGGTATATAGGGCTATA 6
서열번호 89 TTAAGTAGTTAAACAGGGTATATAGGAGGATA 6
서열번호 90 TTAAGTAGTTAAACAGGGTATATAGGGCGATA 6
서열번호 91 TTAAGTAATTAAACAGGGTATATAGGGGAAGA 6
상기 표 4에서 나타낸 바와 같이, 제작된 플라스미드의 조절 유전자 중 서열번호 26, 27, 28, 29, 31, 32, 36, 37, 65, 66, 67, 73, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90 및 91의 조절 유전자는 AGG 서열을 포함하고 있었고, 그 중 서열번호 32 및 36의 조절 유전자는 상기 AGG 서열의 3' 말단에서 개시코돈 까지의 간격(Spacing)이 6 내지 13bp인 것을 확인하였다. 또한 제작된 플라스미드의 조절 유전자 중 서열번호 32,36, 66, 76, 77, 78, 82, 84, 86, 87, 88, 89, 90 및 91의 조절 유전자는 TAGG 또는 ATAGG 서열을 포함하는 것을 확인하였다.
[실시예 2] 숙주 세포의 형질 전환 및 배양
상기 실시예 1에서 제작한 플라스미드를 대장균(E.coli: DH5a 또는 MG1655), 살모넬라(Salmonella: SHJ2037) 균주에 형질 전환 한 뒤, 엠피실린(Ampicillin)이 포함된 LB 고체 배지를 이용하여 상기 형질 전환된 각각의 균주를 밤새 배양하였다. 그 뒤, 생성된 콜로니를 새로 항생제가 포함된 LB 액체 배지를 사용하여 1:100의 비율로 희석하고, 추가 배양을 통해 OD600 값이 0.5 내지 0.7에 도달할 때, 상기 배양액에 최종 농도가 0.1%인 아라비노오스(arabinose)를 첨가하고 200rpm 및 37℃의 조건으로 진탕 배양기에서 배양하였다.
[실험예 1] 재조합 mSA 플라스미드의 mSA 발현 수준 확인
mSA 유전자를 단독으로 삽입한 플라스미드의 발현 수준을 확인하기 위해 상기 실시예 1에서 제작된 플라스미드 B-mSA, B_R0.3-mSA, B_R0.6-mSA, B_R1.0-mSA를 포함하는 재조합 대장균 콜로니를 실시예 2와 같이 배양한 후, 배양된 재조합 대장균을 OD4 기준으로 SDS-PAGE 샘플 버퍼를 첨가하여 95℃에서 10분간 끓인 후 SDS-PAGE에 로딩하여 단백질 발현 정도를 확인하여 도 1에 나타내었다.
도 1에서 나타난 바와 같이, 단백질 발현을 개선하기 위해 BBa_B0032, BBa_B0030, BBa_B0034로 알려진 RBS 서열을 mSA 유전자 서열 앞에 삽입한 플라스미드를 포함한 균주들은 SDS-PAGE 상에서 mSA 단백질 발현을 확인할 수 없었다. 이를 통해서 mSA 유전자를 단독 발현함에 있어서 pBAD 발현 시스템에서는 RBS 서열의 추가는 유전자가 과발현에 영향을 크게 미치지 않음을 알 수 있었다.
[실험예 2] MBP-mSA 플라스미드의 mSA 발현 수준 및 활성 확인
[2-1] SDS-PAGE
mSA의 발현과 가용성을 증대시키기 위해 MBP 유전자를 융합한 MBP-mSA 플라스미드로 형질 전환된 균주의 mSA 발현 수준을 확인하였다. 구체적으로는, MBP 유전자를 융합한 M_p-mSA, M_c-mSA 플라스미드를 상기 실시예 1과 같이 제작한 후, 상기 실시예 2와 같이 형질 전환 및 배양하였다. 배양 중 OD600 값이 0.5 내지 0.7에 도달할 때 상기 배양액에 최종 농도가 0.1 mM인 IPTG(Isopropyl beta-D-1-thiogalactopyranoside)를 첨가하고 200 rpm 및 37℃의 조건으로 진탕 배양기에서 배양하였다. 배양된 재조합 대장균은 OD4 기준으로 SDS-PAGE sample buffer를 첨가하여 95도에서 10분간 끓인 후 SDS-PAGE 로딩 및 단백질 발현 수준을 확인하여 도 2에 나타내었다.
그 결과, 도 2와 같이, MBP와 융합한 mSA 단백질은 겔(gel) 상에서 과발현됨을 확인하였으며 분비 서열이 없는 MBP 유전자를 융합한 mSA 유전자가 분비 서열이 있는 경우 보다 더 과발현됨을 알 수 있었다.
[2-2] 웨스턴 블롯 분석
MBP-mSA 플라스미드로 형질 전환된 재조합 균주의 mSA 발현 수준과 비오틴 결합 활성을 확인하기 위해 웨스턴 블롯 분석을 수행하였다. 구체적으로, 상기 실시예 2의 균주의 배양액을 4 x 107 CFU/ml이 되도록 PBS를 이용하여 희석하고, 13,000rpm에서 5분동안 원심분리 하여 펠렛을 수집하였다. 상기 펠렛 분획을 PBS를 이용하여 세척하고, 0.2% 베타-머캅토에탄올(beta-mercaptoethanol)(카탈로그 번호: EBA-1052, ELPIS BIOTECH)이 포함된 SDS 샘플 완충액과 혼합하여 균주 용해물을 수득하였다. 그런 다음, 12% SDS-PAGE에서 상기 균주 용해물을 전기영동 하고, 상기 겔로부터 니트로 셀룰로스 막에 단백질을 옮긴 뒤 5% 탈지유를 이용하여 상온에서 블로킹 하였다. 이후, his tag 항체를 이용하여 mSA의 발현 수준을 확인하고, 비오틴화된 과산화효소(Biotinylated peroxidase)를 이용하여 mSA의 비오틴 결합 활성을 확인하였다. 수행하여 도 3에 나타내었다.
도 3에서 나타난 바와 같이, MBP 유전자와 mSA 유전자를 모두 삽입한 M_c-mSA 및 M_p-mSA 플라스미드의 MBP와 융합한 mSA 단백질 발현량이 단순 mSA 유전자만 삽입한 B-mSA 플라스미드의 MBP와 융합하지 않은 단순 mSA 단백질 발현량 보다 높았다.
또한, M_c-mSA 플라스미드에서 발현된 단백질이 M_p-mSA 보다 많음에도 불구하고 biotin과의 결합 활성은 분비 서열이 있는 MBP와 융합한 mSA가 더 높음을 확인할 수 있었다.
[2-3] 비오틴 흡수 분석
MBP-mSA 플라스미드로 형질 전환된 재조합 균주의 비오틴 결합 활성을 분석하기 위해 비오틴 흡수 분석(biotin uptake assay)을 수행하여 그 결과를 도 4와 같이 나타내었다. 구체적으로, 배양된 균주에 비오틴화 형광염료(biotinylated fluorescent dye, biotin-flamma 675 dye, BioActs)를 첨가하여 반응한 후, PBS로 세척하여 균주에 결합하지 않는 비오틴화 형광염료를 제거하여 형광 측정 리더기(Infinite m200, Tecan)를 이용하여 재조합 균주에 흡수된 형광염료의 형광값을 측정하였다.
그 결과, 도 4와 같이,B-mSA 플라스미드를 포함하는 균주 를 균주 비오틴 활성이 을 알 수 있었다.
[2-4] 공초점 현미경 관찰
실제 재조합 균주와 비오틴화 형광염료의 결합을 이미지로 확인하기 위해 재조합 균주를 슬라이드에 고정하여 공초점 현미경으로 확인하여 도 5 및 도 6과 같이 나타내었다.
도 5 및 도 6과 같이 비오틴 흡수 분석(biotin uptake assay)의 결과와 달리 MBP 융합 여부와 상관없이 균주에 결합한 비오틴화 형광염료는 매우 적은 수를 보였다. 이를 통해 MBP 유전자 융합을 통해 mSA의 발현이 개선되었으, 유전자의 발현 및 가용성의 변화가 비오틴 결합 활성
[실험예 3] RBS 추가 플라스미드의 mSA 발현 수준 및 활성 확인
[3-1] SDS-PAGE
RBS가 추가된 플라스미드로 형질 전환된 재조합 균주의 mSA의 발현 및 활성을 확인하기 위해 SDS-PAGE를 수행하였다. 구체적으로는, MBP-mSA 유전자를 pBAD 플라스미드에 옮긴 B_p-mSA, B_c-mSA 및 상기 플라스미드의 발현을 개선하기 위해 BBa_B0034 서열을 추가한 B_R1.0-p-mSA, B_R1.0-c-mSA 플라스미드로 형질 전환된 재조합 균주에 대하여 SDS-PAGE를 수행한 결과를 도 7과 같이 나타내었다.
도 7에서 나타난 바와 같이, 상기 재조합 균주를 SDS-PAGE에 로딩하여 단백질 발현 정도를 확인한 결과, pBAD 플라스미드에서도 MBP와 융합한 mSA 단백질은 과발현됨을 확인하였다.
[3-2] 웨스턴 블롯 분석
RBS가 추가된 플라스미드로 형질 전환된 재조합 균주의 mSA의 발현 및 활성을 확인하기 위해 웨스턴 블롯 분석을 수행하였다. MBP-mSA 유전자를 pBAD 플라스미드에 옮긴 B_p-mSA, B_c-mSA와 이 플라스미드의 발현을 개선하기 위해 BBa_B0034 서열을 추가한 B_R1.0-p-mSA, B_R1.0-c-mSA 플라스미드에 대하여 상기 실험예 2-2와 같은 방식으로 웨스턴 블롯 분석을 수행하여 도 8과 같이 나타내었다.
도 8에서 나타난 바와 같이, 웨스턴 블롯 분석을 수행한 결과, MBP 유전자와 mSA 유전자를 모두 삽입한 B_p-mSA, B_c-mSA, B_R1.0-p-mSA 및 B_R1.0-c-mSA 플라스미드는 MBP와 융합한 mSA 단백질을 과발현하는 것을 확인하였으며, 이는 MBP와 융합하지 않은 단순 mSA 단백질 발현량 보다 높았다.
[실험예 4] RBS 치환 플라스미드의 mSA 발현 수준 및 활성 확인
[4-1] 웨스턴 블롯 분석(1)
따라서, 본 발명자는 재조합 균주에서 유전자의 기능성 발현이 증가하게 유도되도록 하기 위해서 B_p-mSA 플라스미드의 RBS 서열을 분석하여 상기 실시예 1과 같이 B_R01-p-mSA, B_R02-p-mSA, B_R1-p-mSA, B_R11-p-mSA, B_R12-p-mSA, B_R13-p-mSA B_R2-p-mSA, B_R21-p-mSA 플라스미드를 제작한 후 균주에 형질 전환 및 배양하였다. 상기 재조합 균주의 단백질 발현 정도를 확인하기 위해 상기 실험예 2-2와 같은 방식으로 웨스턴 블롯 분석을 수행하여 도 9와 같이 나타내었다.
도 9에서 나타난 바와 같이, mSA를 발현하는 균주 중 B_R1-p-mSA와 B_R2-p-mSA 플라스미드로 형질 전환된 재조합 균주가 다른 균주에 비해 mSA 발현 수준이 뛰어난 것을 확인하였다.
[4-2] 웨스턴 블롯 분석(2)
mSA 발현 수준이 높은 B_R1-p-mSA와 B_R2-p-mSA 플라스미드로 형질 전환된 상기 두 균주를 선정하여 추가 실험을 수행하여, 그 결과를 도 10에 나타내었다.
도 10에서 나타난 바와 같이, 대조군에서는 M_p-mSA 플라스미드를 포함하는 재조합 균주가 B_p-mSA 플라스미드를 포함하는 재조합 균주보다 mSA의 발현 수준이 높았다. 실험군에서 B_R1-p-mSA와 B_R2-p-mSA 플라스미드를 포함하는 재조합 균주 보다 mSA의 발현 높음을 확인하였다.
또한 B_R1-p-mSA와 B_R2-p-mSA 플라스미드를 포함하는 재조합 균주가 M_p-mSA 플라스미드를 포함하는 재조합 균주보다 분비된 단백질은 더 적은 것으로 나타나서, 상기 B_R1-p-mSA와 B_R2-p-mSA 플라스미드에서 발현된 mSA는 균주의 주변세포질(periplasm)에 머무는 것을 알 수 있었다. 비오틴 결합 활성은 M_p-mSA, B_R2-p-mSA 플라스미드를 포함하는 재조합 균주
[4-3] 비오틴 흡수 분석
또한, 발현이 개선된 재조합 균주의 비오틴 결합 활성을 분석하기 위해 실험예 2와 같은 방식으로 비오틴 흡수 분석(biotin uptake assay)을 수행하여 그 결과를 도 11과 같이 나타내었다.
도 11에서 나타난 바와 같이, 대조군으로 pBAD와 B-mSA 플라스미드를 포함하는 재조합 균주보다, B_R1-p-mSA와 B_R2-p-mSA 플라스미드를 포함하는 재조합 균주가 비오틴 결합 활성이 현저히 높아, 상기 B_R1-p-mSA와 B_R2-p-mSA 플라스미드의 유전자에서 발현된 mSA가 다른 플라스미드에서 발현된 mSA에 비하여 현저한 비오틴 결합 활성 효과를 가지는 것을 확인하였다. 또한, 비오틴 결합 활성은 단백질 발현량과는 비례하지 않아, 단순히 단백질 발현량 만으로는 비오틴 결합 활성 효과를 예측할 수 없음을 확인하였다.
[4-4] 공초점 현미경 관찰
실제 재조합 균주와 비오틴화 형광염료의 결합을 이미지로 확인하기 위해 상기 배양한 균주를 슬라이드에 고정하여 도 12 및 도 13과 같이 공초점 현미경으로 확인하였다.
도 12에서 나타난 바와 같이, B_R1-p-mSA와 B_R2-p-mSA 플라스미드를 포함하는 재조합 균주는 도 13에 나타난 대조군인 B-mSA 및 B_p-mSA에 비하여 비오틴화 형광염료가 균주에 강하게 결합하는 것을 확인할 수 있었으며, 특히, B_R2-p-mSA 플라스미드에 의한 mSA 발현이 비오틴화 형광염료와 결합하기에 최적의 상태임을 알 수 있었다. 이를 통해 MBP 유전자 융합을 통해 mSA 유전자의 발현이 개선된 균주의 경우에도 외부 비오틴과의 충분한 결합을 하지 못하였으나, mSA 유전자와 함께 MBP 유전자 및 RBS 유전자를 결합시킨 경우 mSA 유전자의 발현이 보다 개선되어 외부 비오틴과 결합능이 매우 향상됨을 알 수 있었다.
[실험예 5] mSA 발현 재조합 균주의 비오틴 결합 확인
[5-1] 비오틴 흡수 분석
상기 제작된 본 발명의 재조합 균주에서 발현된 mSA 유전자가 비오틴(biotin)에 특이성을 갖는지 확인하기 위해 살모넬라(Salmonella) 균주에 pBAD, B-mSA, B_p-mSA, B_R1-p-mSA, B_R2-p-mSA 플라스미드를 실험예 1과 같이 형질 전환 및 배양 후, 상기 실험예 2와 같은 방식으로 비오틴 흡수 분석(biotin uptake assay)을 수행하여 그 결과를 도 14 및 도 15에 나타내었다.
도 14에서 나타난 바와 같이, 비오틴화 형광염료만 처리하였을 때 B_R1-p-mSA 플라스미드를 포함하는 재조합 살모넬라(Salmonella)균주가 가장 높은 비오틴 흡수(biotin uptake)를 보였다. 반면, 도 15에서 나타난 바와 같이, 형광염료가 없는 비오틴을 미리 첨가한 후 비오틴화 형광염료를 처리하였을 때 재조합 균주의 비오틴화 형광염료의 흡수가 감소함을 확인하였다. 상기 도 14와 도 15 간의 차이를 통하여 비오틴화 형광염료를 첨가하기 전에 형광염료가 없는 200 nM의 비오틴을 첨가하는 경우 비오틴화 형광염료와 재조합 균주의 결합 저해할 수 있다는 것을 확인하였고, 이를 통하여 본 발명의 재조합 균주는 비오틴에 특이적으로 결합함을 알 수 있었다.
[5-2] 종양 영상화 분석(1)
본 발명의 재조합 균주에서 비오틴 결합 활성을 확인하기 위해 in vivo 이미지 시스템(In Vivo Imaging System; IVIS) 촬영을 실시하였다. 구체적으로는, 먼저 CT26 세포주를 Balb/c 쥐의 옆구리에 피하 주사하여, 종양 동물 모델을 구축하였다. 상기 동물 모델에 재조합 균주를 주입한 후 3일 뒤, 비오틴화 형광염료를 주입하여, 6시간 후 IVIS 촬영을 실시하여 도 16과 같이 나타내었고, 9시간 후 IVIS 촬영을 실시하여 도 17과 같이 나타내었으며, 24시간 후 IVIS 촬영을 실시하여 도 18과 같이 나타내었다.
도 16 내지 도 18에서 나타난 바와 같이, 대조군으로서 B-mSA, B_p-mSA플라스미드로 형질 전환된 재조합 균주가 주입된 쥐에 주입된 비오틴화 형광염료는 비오틴화 형광염료를 주입 후 시간이 지남에 따라 생체 내에서 소거되었다. 반면, B_R2-p-mSA 플라스미드를 포함한 재조합 균주를 주입한 쥐는 암조직에서 비오틴화 형광염료를 주입 후 대조군에 비하여 강한 시그널을 보였고, 비오틴화 형광염료를 주입 후 24시간이 지난 후에도 여전히 강하게 유지됨을 확인하였다. 이를 통하여, 소동물에서는 본 발명의 재조합 균주에만 비오틴화 형광염료가 강하게 결합됨을 확인하였으며 특히, 종양 특이성이 있는 재조합 균주를 이용한 실시간 종양 영상화가 가능함을 알 수 있었다.
[5-3] 종양 영상화 분석(2)
또한 본 발명의 재조합 균주에서 비오틴 결합 활성을 확인하기 위해 상기 종양 동물 모델에서 암 조직을 적출하여 in vivo 이미지 시스템(In Vivo Imaging System; IVIS) 촬영을 실시하였다. 구체적으로는 상기 종양 동물모델에 비오틴화 형광염료를 주입한지 24시간 이후, 각 그룹의 종양을 적출하여 비오틴화 형광염료의 시그널을 확인하기 위하여 IVIS 촬영을 실시하여 도 19에 나타내었다.
도 19에서 나타난 바와 같이, 다른 그룹에 비해 B_R2-p-mSA 플라스미드를 포함한 재조합 균주 처리군이 강한 형광 활성을 유지하고 있었다. 이를 통하여 소동물에서 본 발명의 재조합 균주를 이용했을 경우에만 비오틴화 형광염료가 강하게 결합됨을 확인하였으며, 특히 종양 특이성이 있는 재조합 균주를 이용한 실시간 종양 영상화가 가능함을 알 수 있었다.
[5-4] 종양 영상화 분석(3)
본 발명의 재조합 균주에서 비오틴 다회 결합을 확인하기 위해 in vivo 이미지 시스템(In Vivo Imaging System; IVIS) 촬영을 실시하였다. 구체적으로는, 먼저 CT26 세포주를 Balb/c 쥐의 옆구리에 피하 주사하여, 종양 동물 모델을 구축하였다. 상기 종양 동물 모델에 재조합 균주를 주입한 후 3일 뒤, 1차로 비오틴화 형광염료를 주입하였다. 이후 2일 뒤 같은 종양 동물 모델에 2차로 비오틴화 형광염료를 주입하였다. 1차 형광염료 주입 전, 주입 6시간 후 및 주입 9시간 후에 IVIS 촬영이 이루어졌고, 이후 2차 형광염료 주입 전, 주입 6시간 후 및 주입 9시간 후에도 IVIS 촬영을 실시하여 도 20에 나타내었다.
도 20에서 나타난 바와 같이, 1차 주입한 비오틴화 형광염료는 시간이 지남에 따라 암조직에서 본 발명의 재조합 균주에 의해 비오틴화 형광염료의 시그널이 강하게 유지됨을 확인하였으며 비오틴화 형광염료가 생채 내에서 소거된 후 다시 2차 주입한 비오틴화 형광염료에 의해 시간이 지남에 따라 암조직에서 비오틴화 형광염료의 시그널이 강하게 유지됨을 확인하였다. 이를 통하여 본 발명의 재조합 균주의 mSA 발현을 조절함으로서 비오틴화 형광염료를 다회 처리하여도 지속적으로 종양 이미지를 확인할 수 있다는 것 및 비오틴화 컨쥬게이트를 시간을 조절하여 구분하여 처리할 수 있음 의미한다.
구체적으로 상기 실험을 통해, 본 발명에 따르는 유전자 컨스트럭트, 특히는 본 발명에 따르는 조절 유전자를 포함하는 경우 발현되는 모노머형 스트렙타비딘(mSA)의 안정성이 뛰어나며 외부 비오틴과 강하게 결합할 수 있고, 이는 생체 내에서도 유효하며, 비오틴화 형광염료를 다회 처리하거나 시간을 조절하여 처리할 수도 있음을 확인하였다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (20)

  1. 모노머형 스트렙타비딘(monomeric streptavidin; mSA)을 코딩하는 유전자;
    말토오즈 결합 단백질(maltose-binding protein; MBP)을 코딩하는 유전자; 및
    상기 모노머형 스트렙타비딘을 코딩하는 유전자의 발현을 조절하는 조절 유전자;를 포함하는, 유전자 컨스트럭트.
  2. 제 1 항에 있어서, 상기 조절 유전자는 상기 모노머형 스트렙타비딘을 코딩하는 유전자의 상류에 작동가능하도록 연결되는 것인, 유전자 컨스트럭트.
  3. 제 1 항에 있어서, 상기 조절 유전자는 리보솜 결합 부위(Ribosome binding site; RBS), 5'-비 번역 영역(5'-Untransrated Region; 5'-UTR) 및 전사 인자 결합 부위(transcription factor binding site)로 이루어진 군으로부터 선택되는 적어도 하나인 것인, 유전자 컨스트럭트.
  4. 제 1 항에 있어서, 상기 조절 유전자는 상기 유전자 컨스트럭트를 포함하는 재조합 벡터가 숙주 세포에 형질 전환되는 경우, 상기 숙주 세포의 주변 세포질로 모노머형 스트렙타비딘이 발현되도록 하는 것인, 유전자 컨스트럭트.
  5. 제 1 항에 있어서, 상기 조절 유전자는 총 깁스 자유 에너지 변화량(ΔGtotal)이 0 이하인 것인, 유전자 컨스트럭트.
  6. 제 1 항에 있어서, 상기 조절 유전자는 번역 개시 속도(Translation Initiation Rate; TIR)가 특정 범위를 갖도록 조절된 것인, 유전자 컨스트럭트.
  7. 제 6 항에 있어서, 상기 조절 유전자의 번역 개시 속도는 900 내지 45000au 인 것인, 유전자 컨스트럭트.
  8. 제 1 항에 있어서, 상기 조절 유전자의 서열 길이는 15 내지 39bp인 것인, 유전자 컨스트럭트.
  9. 제 1 항에 있어서, 상기 조절 유전자는 서열번호 5 내지 7 중 어느 하나로 표시되는 유전자 서열을 포함하는 것인, 유전자 컨스트럭트.
  10. 제 9 항에 있어서, 상기 조절 유전자에서, 상기 서열번호 5 내지 7 중 어느 하나로 표시되는 유전자 서열의 3’ 말단에서 상기 모노머형 스트렙타비딘을 코딩하는 유전자의 개시코돈 까지의 간격이 6 내지 13bp인, 유전자 컨스트럭트.
  11. 제 1항 내지 제 10항 중 어느 한 항의 유전자 컨스트럭트를 포함하는 재조합 벡터.
  12. 제 11항의 재조합 벡터가 도입되어 형질 전환된 숙주 세포.
  13. 벡터에 모노머형 스트렙타비딘(monomeric streptavidin; mSA)을 코딩하는 유전자 및 후보 조절 유전자를 도입하는 단계; 및
    상기 모노머형 스트렙타비딘을 코딩하는 유전자의 발현 수준을 측정하는 단계를 포함하는, 모노머형 스트렙타비딘 발현 조절용 조절 유전자의 스크리닝 방법.
  14. 제 13 항에 있어서, 상기 후보 조절 유전자는 총 깁스 자유 에너지 변화량(ΔGtotal)이 0 이하로 조절된 것;
    번역 개시 속도가 900 내지 45000au 범위인 것;
    서열 길이가 15 내지 39bp인 것;
    서열번호 5 내지 7 중 어느 하나로 표시되는 유전자 서열을 포함하는 것; 및
    서열번호 5 내지 7 중 어느 하나로 표시되는 유전자 서열을 포함하며, 상기 유전자 서열의 3’ 말단에서 개시코돈 까지의 간격(Spacing)이 6 내지 13bp인 것; 중 적어도 하나의 조건을 만족하는 것인, 스크리닝 방법.
  15. 제 13 항에 있어서, 상기 도입하는 단계 시, 상기 벡터에 말토오즈 결합 단백질(maltose-binding protein; MBP)을 코딩하는 유전자를 더 도입하는, 스크리닝 방법.
  16. 제 13 항에 있어서, 상기 발현 수준을 측정하는 단계는 상기 벡터에 의해 형질 전환된 숙주 세포로부터 발현되는 모노머형 스트렙타비딘의 발현 수준을 측정하며 수행되는, 스크리닝 방법.
  17. 제 16 항에 있어서, 상기 숙주 세포의 모노머형 스트렙타비딘 발현 수준이 상기 후보 조절 유전자가 도입되기 전에 비하여 증가한 경우, 상기 후보 조절 유전자를 상기 모노머형 스트렙타비딘 발현을 증가시키기 위한 것으로 판단하는, 스크리닝 방법.
  18. 제 16 항에 있어서, 상기 발현 수준을 측정하는 단계는 상기 형질 전환된 숙주 세포의 주변 세포질에서 발현되는 모노머형 스트렙타비딘의 발현 수준을 측정하며 수행되는, 스크리닝 방법.
  19. 제 18 항에 있어서, 상기 형질 전환된 숙주 세포의 상기 주변 세포질에서 상기 모노머형 스트렙타비딘이 발현되는 경우, 상기 후보 조절 유전자를 상기 모노머형 스트렙타비딘 발현을 증가시키기 위한 것으로 판단하는, 스크리닝 방법.
  20. 제 16 항에 있어서, 상기 발현 수준을 측정하는 단계는 상기 형질 전환된 숙주 세포를 배양하는 단계를 더 포함하는, 스크리닝 방법.
PCT/KR2021/015406 2020-10-30 2021-10-29 모노머형 스트렙타비딘을 발현하기 위한 컨스트럭트 WO2022092885A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US18/251,176 US20230407292A1 (en) 2020-10-30 2021-10-29 Construct for expressing monomeric streptavidin

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2020-0143486 2020-10-30
KR20200143486 2020-10-30

Publications (1)

Publication Number Publication Date
WO2022092885A1 true WO2022092885A1 (ko) 2022-05-05

Family

ID=81384276

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/015406 WO2022092885A1 (ko) 2020-10-30 2021-10-29 모노머형 스트렙타비딘을 발현하기 위한 컨스트럭트

Country Status (3)

Country Link
US (1) US20230407292A1 (ko)
KR (1) KR102679923B1 (ko)
WO (1) WO2022092885A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240086790A (ko) * 2022-12-06 2024-06-19 충남대학교산학협력단 strep-tag 결합물질에 대한 결합능을 가지는 융합단백질을 암호화하는 유전자 구조물 및 이를 함유하는 발현벡터, 재조합 균주 및 항암 조성물

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180010136A1 (en) * 2014-05-30 2018-01-11 John Francis Hunt, III Methods for Altering Polypeptide Expression
WO2018022618A1 (en) * 2016-07-25 2018-02-01 The Research Foundation For The State University Of New York Monomeric streptavidin mutants, methods of using the same and processes of manufacturing proteins
WO2018138385A1 (en) * 2017-01-30 2018-08-02 Kws Saat Se Repair template linkage to endonucleases for genome engineering

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180010136A1 (en) * 2014-05-30 2018-01-11 John Francis Hunt, III Methods for Altering Polypeptide Expression
WO2018022618A1 (en) * 2016-07-25 2018-02-01 The Research Foundation For The State University Of New York Monomeric streptavidin mutants, methods of using the same and processes of manufacturing proteins
WO2018138385A1 (en) * 2017-01-30 2018-08-02 Kws Saat Se Repair template linkage to endonucleases for genome engineering

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DANIEL DEMONTE, CHRISTOPHER M. DUNDAS, SHELDON PARK: "Expression and purification of soluble monomeric streptavidin in Escherichia coli", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 98, no. 14, 1 July 2014 (2014-07-01), Berlin/Heidelberg, pages 6285 - 6295, XP055457564, ISSN: 0175-7598, DOI: 10.1007/s00253-014-5682-y *
WANG BO, ECKERT CARRIE, MANESS PIN-CHING, YU JIANPING: "A Genetic Toolbox for Modulating the Expression of Heterologous Genes in the Cyanobacterium Synechocystis sp. PCC 6803", ACS SYNTHETIC BIOLOGY, vol. 7, no. 1, 19 January 2018 (2018-01-19), Washington DC ,USA , pages 276 - 286, XP055926601, ISSN: 2161-5063, DOI: 10.1021/acssynbio.7b00297 *

Also Published As

Publication number Publication date
KR102679923B1 (ko) 2024-07-02
US20230407292A1 (en) 2023-12-21
KR20220058460A (ko) 2022-05-09

Similar Documents

Publication Publication Date Title
Russmann et al. Protection against murine listeriosis by oral vaccination with recombinant Salmonella expressing hybrid Yersinia type III proteins
Brugirard‐Ricaud et al. Site‐specific antiphagocytic function of the Photorhabdus luminescens type III secretion system during insect colonization
CA2102105A1 (en) Recombinant dna-derived cholera toxin subunit analogs
WO2011025310A2 (ko) 돼지의 병원성 대장균의 부착인자가 형질전환된 약독화 살모넬라균 변이주 및 이를 포함하는 돼지의 병원성 대장균증 및 살모넬라균증의 예방 및 치료용 백신 조성물
WO2022092885A1 (ko) 모노머형 스트렙타비딘을 발현하기 위한 컨스트럭트
WO1998044120A1 (en) METHODS OF PRODUCING AND USING VIRULENCE ATTENUATED poxR MUTANT BACTERIA
WO2010137900A9 (ko) 선택적 경색 조직 타겟팅 박테리아 및 그의 용도
WO2012036391A2 (ko) 돼지 써코바이러스２(ｐｃｖ２) 유전자의 표면발현용 벡터 및 이로 형질전환된 살모넬라 백신 균주
WO2013027977A2 (ko) L-아스파라기나아제를 포함하는 l-아스파라긴 분해용 조성물, 및 l-아스파라기나아제의 생산 방법
Miyoshi-Akiyama et al. DNA sequencing of the gene encoding a bacterial superantigen, Yersinia pseudotuberculosis-derived mitogen (YPM), and characterization of the gene product, cloned YPM.
WO2019139227A1 (en) Gene expression cassette and expression vector including the same
Tang et al. High-level expression, purification and antibacterial activity of bovine lactoferricin and lactoferrampin in Photorhabdus luminescens
KR101765394B1 (ko) 돼지 유행성설사 바이러스의 에피토프 단백질, 이를 암호화하는 유전자를 포함하는 재조합 벡터, 이를 발현하는 형질전환체 및 이를 포함하는 돼지 유행성설사 바이러스 예방 또는 치료용 조성물
Marais et al. Characterization of the recA gene regions of Spiroplasma citri and Spiroplasma melliferum
JP2001526533A (ja) λ様プロモーターを有する遺伝子の誘導性発現のための調節系
Chun et al. The effect of single amino acid substitution in SecA2 on protein translocation and pathogenicity of Listeria monocytogenes
EP3464332A1 (en) Methods for increasing proliferation of mammalian cells
Sun et al. Intramammary expression and therapeutic effect of a human lysozyme-expressing vector for treating bovine mastitis
Troxell Salmonella enterica serovar Typhimurium utilizes the ClpPX and Lon proteases for optimal fitness in the ceca of chickens
WO2022098213A1 (ko) 암의 예방 및 치료용 살모넬라 균주 및 이의 용도
CN1175110C (zh) 一种酰胺化重组多肽及其制备方法
CN118165125B (zh) 一种重组猪干扰素λ1、猪干扰素γ和猪SA的融合蛋白及其应用
WO2024025297A1 (ko) 인터루킨-21의 분비를 위한 재조합 발현 벡터 및 이로 형질전환된 약독화 살모넬라 균주
WO2022260468A1 (ko) 신규 fgf21 변이체 개발 및 이의 생산기법과 용도
KR20230013025A (ko) 엔테로신 및 이를 사용하는 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21886879

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21886879

Country of ref document: EP

Kind code of ref document: A1