WO2022092775A1 - Abt263을 유효성분으로 포함하는 디스크 질환 예방 또는 치료용 조성물 - Google Patents

Abt263을 유효성분으로 포함하는 디스크 질환 예방 또는 치료용 조성물 Download PDF

Info

Publication number
WO2022092775A1
WO2022092775A1 PCT/KR2021/015130 KR2021015130W WO2022092775A1 WO 2022092775 A1 WO2022092775 A1 WO 2022092775A1 KR 2021015130 W KR2021015130 W KR 2021015130W WO 2022092775 A1 WO2022092775 A1 WO 2022092775A1
Authority
WO
WIPO (PCT)
Prior art keywords
abt263
preventing
pharmaceutical composition
plga
disc disease
Prior art date
Application number
PCT/KR2021/015130
Other languages
English (en)
French (fr)
Inventor
김병수
한인보
임송현
Original Assignee
의료법인 성광의료재단
서울대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 의료법인 성광의료재단, 서울대학교산학협력단 filed Critical 의료법인 성광의료재단
Publication of WO2022092775A1 publication Critical patent/WO2022092775A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5375—1,4-Oxazines, e.g. morpholine
    • A61K31/5377—1,4-Oxazines, e.g. morpholine not condensed and containing further heterocyclic rings, e.g. timolol
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/06—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite
    • A61K47/08—Organic compounds, e.g. natural or synthetic hydrocarbons, polyolefins, mineral oil, petrolatum or ozokerite containing oxygen, e.g. ethers, acetals, ketones, quinones, aldehydes, peroxides
    • A61K47/10—Alcohols; Phenols; Salts thereof, e.g. glycerol; Polyethylene glycols [PEG]; Poloxamers; PEG/POE alkyl ethers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/32—Macromolecular compounds obtained by reactions only involving carbon-to-carbon unsaturated bonds, e.g. carbomers, poly(meth)acrylates, or polyvinyl pyrrolidone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
    • A61K47/34—Macromolecular compounds obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyesters, polyamino acids, polysiloxanes, polyphosphazines, copolymers of polyalkylene glycol or poloxamers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/30—Other Organic compounds

Definitions

  • the present invention relates to a composition for preventing and treating disc disease comprising ABT263 as an active ingredient.
  • a disc, intervertebral disc, or intervertebral disc is an elastic support that connects two bones with a fibrocartilaginous joint. There are 23 intervertebral discs in the human waist. Mechanically, the disc stabilizes the connection between the two vertebral bodies while allowing movement between them.
  • Such disc damage is an inevitable disease acquired by humans while walking on two legs, and conservative therapies such as drugs and physical therapy are used to treat it.
  • conservative therapy such as drugs and physical therapy are used to treat it.
  • surgical treatment such as disc removal, spinal fusion, or artificial disc implantation may be considered.
  • surgical treatment has the effect of reducing pain for a short period of time, in the long term, degenerative changes may worsen, and back pain may worsen due to spinal instability.
  • One aspect provides a pharmaceutical composition for preventing and treating disc disease comprising ABT263 as an active ingredient.
  • Another aspect provides a health functional food composition for preventing and improving disc disease comprising ABT263 as an active ingredient.
  • Another aspect provides a method for preventing or treating disc disease, comprising administering to an individual a pharmaceutical composition comprising ABT263 as an active ingredient.
  • Another aspect provides the use of a pharmaceutical composition comprising ABT263 as an active ingredient for use in the manufacture of a medicament for the prevention or treatment of disc disease.
  • One aspect is to provide a pharmaceutical composition for preventing and treating disc disease comprising ABT263 as an active ingredient.
  • ABT263 or Navitoclax (CAS 923564-51-6 ) is a compound with the molecular formula C 47 H 55 Cl F 3 N 5 O 6 S 3 and a molecular weight of 974.61.
  • the compound may be represented by the following formula (1).
  • ABT263 was previously known only for its use as an anti-cancer agent through the inhibitory effect of anti-apoptotic BCL-2 protein, but in the present invention, its use for preventing and treating disc disease was newly discovered.
  • the compound may be derived from nature or may be synthesized using a known organic synthesis method. or non-protein compounds, peptides, extracts of plant-derived tissues or cells, or products obtained by culturing microorganisms (eg bacteria or fungi, and in particular yeast).
  • ABT263 may also cause systemic toxic side effects.
  • the drug was locally released only to the disc diseased site by injection into the disc disease site.
  • ABT263 In order to obtain the appropriate therapeutic efficacy of ABT263, ABT263 must be injected into the patient repeatedly over time. Repeated injections into the disc can cause inflammation and aggravate disc disease. In order to prevent this problem in the present invention, ABT263 was encapsulated in the drug release system and then injected into the disc disease site to release the drug in a sustained release form.
  • the term “disc” may refer to a tissue, such as cartilage, that exists between bones.
  • the disc includes, but is not limited to, a lumbar disc, a neck disc, a jaw disc, etc., which are joint parts of the body.
  • the composition may include a biocompatible polymer as an additional active ingredient.
  • biocompatible polymer refers to a polymer that has secured in vivo safety that does not induce high cytotoxicity and inflammatory reaction when administered in vivo, and is also referred to simply as a polymer in the present specification.
  • biocompatible polymer include polyethylene glycol, fatty acids, cholesterol, albumin and fragments thereof, albumin binding substances, polymers of repeating units of specific amino acid sequences, antibodies, antibody fragments, FcRn binding substances, in vivo connective tissue or derivatives thereof, nucleotides, fibronectin, transferrin, saccharide, or high molecular polymer, but is not limited thereto.
  • the physical properties of the drug, the dosage of the drug, the physicochemical compatibility of the drug and the polymer, and the solubility of the drug in the organic solvent should be considered, and all of the above factors should be considered. Even so, the drug release pattern of the manufactured dosage form is different according to the manufacturing method and the process variables according to each manufacturing method.
  • the present invention has invented a composition that exhibits a remarkable effect on disc disease by limiting factors that can specify the intrinsic release pattern and collection efficiency of these biocompatible polymers and drugs.
  • the biocompatible polymer is polyethylene glycol, polypropylene glycol, ethylene glycol-propylene glycol copolymer, polyoxyethylated polyol, polysaccharide, dextran, polyvinyl ethyl ether, PLA (polylactic acid), polyvinyl Alcohol (PVA), poly(p-xylylene) polymer, poly( ⁇ -caprolactone) (PCL), poly(valerolactone) (PVL), poly( ⁇ -decalactone) (PDL), poly(1) ,4-dioxane-2,3-dione), poly(1,3-dioxan-2-one), poly(para-dioxanone) (PDS), poly(hydroxybutyric acid) (PHB), poly (hydroxyvaleric acid) (PHV), ethylene vinyl acetate and poly( ⁇ -malic acid) (PMLA) and PLGA (polylactic-glycolic acid) may be at least one selected from the group consisting
  • the combination of ABT263 and biocompatible polymer is prepared by solvent evaporation method, spray drying method, solvent extraction method, or microfluidic method. it could be More specifically, it may be prepared by solvent evaporation, but is not limited thereto.
  • the diameter of the binder may be 200 nm to 2 ⁇ m. More specifically, it may be 200 to 1500 nm, 200 to 1000 nm, 200 to 800 nm, or 200 to 500 nm, but is not limited thereto. Particles with a diameter of 2 ⁇ m or less do not easily contact macrophages, so phagocytosis is not active. Therefore, the diameter of the conjugate has a technical effect that the possibility of phagocytosis by macrophages after injection into the disc tissue is low.
  • the drug collection efficiency of the conjugate may be 40 to 70%. More specifically, it may be 40 to 60%, 50 to 70%, 55 to 70%, but is not limited thereto.
  • the mixing weight ratio of the biocompatible polymer and ABT263 is 7 to 1: 5 to 1, 7 to 2: 5 to 1, 6 to 2: 5 to 2, 6 to 2: 4 to 2, 5 to 2: 4 to 2, 5 to 3: may be 4 to 2.
  • the disc disease may be a herniated disc, back pain, infection, or chordoma. More specifically, it may be degenerative disc herniation.
  • the composition may reduce the expression of Mmp13, Adamts4, Cox2, iNos and Ngf.
  • the gene or protein whose expression is reduced may be a Senescence Associated Secretary Phenotype (SASP), which is interleukin-6 (IL-6), interleukin-8 (IL-8), interleukin-1 ⁇ / ⁇ ( IL-1 ⁇ / ⁇ ), ECM catabolic enzymes, and pro-inflammatory cytokines such as nitric oxide.
  • SASP Senescence Associated Secretary Phenotype
  • the pharmaceutical composition may have an effect of removing senescent cells in the disc.
  • prevention refers to any action that suppresses or delays the onset of a disease by administration of the composition.
  • treatment refers to, to a subject suffering from or at risk of developing a disease, ameliorating the condition (eg, one or more symptoms) of the subject, delaying the progression of the disease, delaying the onset of symptoms or treating the symptoms of the disease. means any form of treatment that provides an effect including blunting and the like. Accordingly, the terms “treatment” and “prevention” are not intended to mean cure or complete elimination of symptoms.
  • the pharmaceutical composition may include an active ingredient alone, or may be provided as a pharmaceutical composition including one or more pharmaceutically acceptable carriers, excipients or diluents.
  • the carrier may be, for example, a colloidal suspension, powder, saline, lipid, liposome, microspheres or nanospherical particles. They may form complexes with or be associated with a vehicle and are known in the art such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation reagents, polysaccharides, polyamino acids, dendrimers, saponins, adsorption enhancing substances or fatty acids. It can be delivered in vivo using known delivery systems.
  • Solid preparations for oral administration may include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in the composition, for example, starch, calcium carbonate, sucrose ) or lactose, gelatin, etc. can be mixed and prepared.
  • lubricants such as magnesium stearate and talc may also be used.
  • Liquid formulations for oral use include suspensions, solutions, emulsions, syrups, etc., and various excipients such as wetting agents, sweetening agents, fragrances, preservatives, etc. in addition to water and liquid paraffin, which are commonly used simple diluents, may be included.
  • Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories.
  • Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.
  • witepsol macrogol, tween 61, cacao butter, laurin, glycero geratin, etc.
  • well-known diluents or excipients may be used when preparing in the form of eye drops. there is.
  • the pharmaceutical composition may be administered in combination with an existing therapeutic agent for disc disease, that is, mixed with a conventionally known composition for preventing or treating disc disease may be provided.
  • the pharmaceutical composition may be administered in parallel with a known composition having a preventive or therapeutic effect on disc disease, may be administered simultaneously, separately, or sequentially, and may be administered single or multiple. Taking all of the above factors into consideration, it is important to administer an amount capable of obtaining the maximum effect with a minimum amount without side effects, which can be easily determined by those skilled in the art.
  • administration means introducing a predetermined substance to an individual by an appropriate method
  • individual means any living organism, including humans, mice, mice, livestock, etc. that can have infertility or infertility. As a specific example, it may be a mammal including a human.
  • the route of administration of the pharmaceutical composition is, but is not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or rectal.
  • the composition may be administered orally or parenterally, and when administered parenterally, an injection method for external application or intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection or intrathoracic injection may be selected.
  • an injection method for external application or intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection or intrathoracic injection may be selected.
  • it may be administered in the form of an application applied to the skin outside the body organ where the disc exists, and may be directly injected into the disc itself in the form of injection.
  • the pharmaceutical composition may be directly injected into the disk in the form of injection.
  • the pharmaceutical composition is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level depends on the type, severity, activity of the drug, and the drug. It can be determined according to factors including sensitivity to, administration time, administration route and excretion rate, duration of treatment, concurrent drugs, and other factors well known in the medical field.
  • the administration may be administered once a day, or may be administered in several divided doses.
  • the effective amount of the pharmaceutical composition may vary depending on the patient's age, condition, weight, absorption of the active ingredient into the body, inactivation rate, excretion rate, disease type, and drugs used in combination, and the route of administration, the severity of obesity , may be increased or decreased according to gender, weight, age, etc.
  • Another aspect is to provide a method for preventing or treating a disc disease, comprising administering the pharmaceutical composition to an individual having a disc-related disease.
  • Another aspect is to provide a health functional food composition for preventing and improving disc disease comprising ABT263 as an active ingredient.
  • the term “improvement” may refer to any action that at least reduces the severity of a parameter, eg, a symptom, associated with the condition being treated.
  • the health functional food may be used simultaneously with or separately from a medicament for treatment before or after the onset of the quality of the disease in order to prevent or improve disc disease.
  • the active ingredient may be added to food as it is or used together with other food or food ingredients, and may be appropriately used according to a conventional method.
  • the mixing amount of the active ingredient may be appropriately determined depending on the purpose of its use (for prevention or improvement).
  • the health functional food may be added in an amount of specifically about 15% by weight or less, more specifically about 10% by weight or less, based on the raw material.
  • the amount may be less than or equal to the above range.
  • the health functional food may be formulated into one selected from the group consisting of tablets, pills, powders, granules, powders, capsules, and liquid formulations, further including one or more of carriers, diluents, excipients and additives.
  • Foods to which the compound according to an aspect can be added include various foods, powders, granules, tablets, capsules, syrups, beverages, gums, teas, vitamin complexes, and health functional foods.
  • carrier examples include lactose, dextrose, sucrose, sorbitol, mannitol, erythritol, starch, gum acacia, calcium phosphate, alginate, gelatin, calcium phosphate, calcium silicate, microcrystalline cellulose , polyvinylpyrrolidone, cellulose, polyvinylpyrrolidone, methylcellulose, water, sugar syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. It may be at least one selected from.
  • the health functional food may contain other ingredients as essential ingredients without any particular limitation in addition to containing the active ingredient.
  • various flavoring agents or natural carbohydrates may be contained as additional ingredients.
  • natural carbohydrates include monosaccharides such as glucose, fructose and the like; disaccharides such as maltose, sucrose and the like; and polysaccharides, for example, conventional sugars such as dextrin, cyclodextrin, and the like, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • natural flavoring agents such as taumatine, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.)
  • synthetic flavoring agents sacharin, aspartame, etc.
  • the ratio of the natural carbohydrate may be appropriately determined by the selection of those skilled in the art.
  • the health functional food includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and salts thereof , alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like. These components may be used independently or in combination, and the proportion of these additives may also be appropriately selected by those skilled in the art.
  • Another aspect is to provide the use of a composition comprising ABT263 as an active ingredient for use in preventing or treating disc disease.
  • Another aspect provides the use of a pharmaceutical composition comprising ABT263 as an active ingredient for use in the manufacture of a medicament for the prevention or treatment of disc disease.
  • Another aspect is to provide the use of ABT263 for use in preventing or treating disc disease.
  • Another aspect provides a method for preventing or treating disc disease, comprising administering to an individual a pharmaceutical composition comprising ABT263 as an active ingredient.
  • the administering may be administering an effective amount of a composition comprising ABT263 as an active ingredient to an individual having disc disease.
  • ABT263 or nabitoclax can reduce the expression of Mmp13, Adamts4, Cox2, iNos and Ngf, and remove senescent cells in the disc. Accordingly, it can be used for prevention, improvement, or treatment of a disk-related disease, which is a new pharmaceutical use.
  • 1a is a view confirming the form of PLGA-ABT.
  • Figure 2a is a view confirming the change in the ratio of HMGB1-positive cells according to the treatment of ABT263.
  • Figure 2b is a view confirming the removal of senescent cells according to the treatment of ABT263.
  • 2c and 2d are diagrams confirming the increase in annexin V + cells and the decrease in PI + annexin V- cells according to the treatment of ABT263.
  • Figure 2e is a diagram confirming the increase in the expression level of cleaved caspase 3.
  • Figure 2f is a diagram confirming the change in the ratio of HMGB1-positive cells according to the treatment of ABT263.
  • Figure 3a is a diagram confirming the effective concentration of ABT263 for AF cells.
  • 3b and 3c are diagrams confirming the effective concentration of ABT263 for NP cells.
  • Figure 4a is a view confirming the degradation of PLGA-ABT with time in a buffer at 37 °C in vitro.
  • Figure 4b is a view confirming the release of ABT263 collected in PLGA-ABT over time.
  • Figure 4c is a diagram showing the change in the ratio of HMGB1-positive cells in the medium conditioned with PLGA-ABT.
  • 5a is a result confirming the durability of PLGA-ABT in the IVDD mouse model.
  • 5B is a result confirming the toxicity of PLGA-ABT in the IVDD mouse model.
  • Figure 6a is a diagram showing the process of confirming the effect of removing senescent cells in the IVDD mouse model of PLGA-ABT.
  • 6b is a result confirming the effect of PLGA-ABT on removing senescent cells in the IVDD mouse model.
  • 6c is a diagram showing a decrease in p16INK4a expression upon PLGA-ABT treatment in an IVDD mouse model.
  • 6d is a diagram showing an increase in the expression of HMGB1 upon PLGA-ABT treatment in an IVDD mouse model.
  • FIG. 7A is a diagram showing a decrease in Mmp13 expression upon PLGA-ABT treatment in an IVDD mouse model.
  • Figure 7b is a diagram confirming the decrease in the mRNA expression of Adamts4, Cox2, iNos and Ngf when PLGA-ABT treatment in the IVDD mouse model.
  • 8A is a diagram illustrating a process for determining whether PLGA-ABT induces apoptosis in normal disc cells.
  • Figure 8b is a view confirming the increase in NP cell apoptosis (apoptosis) in mice treated with PLGA-ABT and the induction of IVDD due to IVD damage through TUNEL-positive cell analysis.
  • FIG. 9A is a diagram illustrating a magnetic resonance imaging (MRI) scan result of a rat tail spine.
  • MRI magnetic resonance imaging
  • 9b is a diagram confirming the increase in PCNA-positive cells in NP tissues treated with PLGA-ABT.
  • 9c is a diagram showing an increase in the type II collagen-positive region when PLGA-ABT is treated within a single disc.
  • 9d is a diagram showing an increase in the safranin-O positive region when PLGA-ABT is treated within a single disc.
  • 9e is a diagram showing an increase in histological score in a tissue treated with PLGA-ABT.
  • IVD tissue was obtained from 4 male and 2 female patients who underwent lumbar disc resection and posterior trunk fusion for lumbar disc hernia and lumbar spinal stenosis. The mean age of the patients was 48.0 ⁇ 23.4 years (21-86 years). Pfirrmann's grading system was used to determine the degree of disc degeneration at the index level. Three patients were grade 3 and three patients were grade 4. Senescent annulus fibrosus (AF) and nucleus pulposus (NP) cells were isolated from the patient's lumbar disc. This study was approved by the Bundang CHA Hospital System Ethics Review Committee (approval number 2019-04-049-002), and written consent was obtained from all patients. Rat IVD tissues were obtained from the tail discs of healthy 6-week-old female Sprague-Dawley rats (Orient Bio Inc, Korea).
  • Human or rat IVD tissues were washed three times with HBSS solution (Sigma-Aldrich, USA) supplemented with 100 U ml -1 penicillin and 100 ug ml -1 streptomycin (P/S; Gibco, USA). Tissues were separated into NP and AF according to the different anatomical features of the two sites, cut into small pieces and filtered through a 40 ⁇ m strainer (SPL, Korea) to remove impurities. The remaining tissue on top of the strainer was collected and digested on a shaker for 1 h at 37 °C with 1.5% (w/v) protease in F12 supplemented with 5% fetal bovine serum and P/S.
  • the specimens were collected and washed three times with HBSS solution containing P/S. After washing, the samples were digested again with 0.012% (w/v) collagenase II in F12 supplemented with 5% FBS and 1% P/S in a shaker at 37°C for 16 h. After digestion, the samples were passed through a 70 ⁇ m strainer and centrifuged at 2,000 rpm for 5 min to collect cells. The cell pellet was resuspended in RBC lysis buffer (Biolegend, USA), left for 10 min, and then centrifuged at 2,000 rpm for 5 min to collect cells. The collected cell pellet was washed and incubated with F12 supplemented with 10% FBS and P/S. Senescent annulus fibroblasts and nucleus pulposus cells isolated from each human and mouse were used separately for experiments.
  • An IVDD mouse model was prepared as follows. Six-week-old female Sprague-Dawley rats (220-240 g, Orient Bio Inc., Korea) were anesthetized by intraperitoneal injection of Zoletil® (50 mg kg-1) and Rompun® (10 mg kg-1). The tail skin was sterilized with 70% alcohol and povidone iodine, and a dorsal midline skin incision was made to reveal IVD. The caudal discs (Co6/7 and Co7/8) were punctured with a 20 gauge sterile needle from dorsal to ventral to the tail. The needle was placed perpendicular to the skin so that it was inserted centered at the level of the disc into the NP through AF.
  • the needle was limited to a depth of 5 mm, rotated 360 degrees twice and held for 30 s.
  • the temperature of the rectal area was maintained at 37°C by a temperature-controlled heating pad.
  • the skin was sutured and disinfected.
  • All animals were housed on a heating pad and injected subcutaneously with 0.9% saline (5 ml).
  • Antibiotics (Cefazolin, CKD Pharmaceuticals, South Korea) and analgesics (Ketoprofen, SCD Pharm. Co. Ltd, South Korea) were administered prophylactically for 3 days after surgery.
  • PLGA nanoparticles (PLGA-NP; PLGA-nanoparticles) were synthesized and prepared as follows to be used as a carrier for ABT263 delivery, and the results were confirmed.
  • PLGA 1% w/v
  • the polymer-drug solution was added dropwise to an aqueous poly(vinyl alcohol) solution (0.5%, w/v) and sonicated three times every 10 s to form an oil-in-water emulsion.
  • the solution with the emulsion was stirred for 3 hours and left overnight. It was centrifuged at 17,000 g for 15 minutes, washed three times with distilled water, and then lyophilized to remove residual solvent.
  • the morphology of PLGA-ABT and PLGA-NP was observed with a scanning electron microscope (JSM-7800F Prime, JEOL Ltd, Japan).
  • the size and size distribution of PLGA-ABT and PLGA-NP were measured by dynamic light scattering (Zeta-sizer Nano ZS, Malvern Instruments, UK).
  • PLGA-ABT and PLGA-NP were dispersed in an aqueous poly(vinyl alcohol) solution (0.1%, w/v).
  • FIG. 1A the morphology of PLGA-ABT was confirmed as a sphere by scanning electron microscopy.
  • Dynamic light scattering analysis showed that the average diameter of PLGA-ABT was 494 nm (Fig. 1B).
  • AF senescent annulus fibrosus
  • NP nucleus pulposus
  • Human AF and NP cells were seeded at a density of 2 ⁇ 10 4 cells cm ⁇ 2 and incubated at 37° C. with 5% CO 2 .
  • a SA- ⁇ -gal staining kit (#9860, Cell Signaling Technology, USA) was used according to the manufacturer's instructions. Cells were fixed in the fixative solution for 15 min and incubated in a dry incubator overnight with ⁇ -galactosidase staining solution adjusted to pH 6. Stained cells were imaged under a light microscope (IX71, Olympus, Japan).
  • AF and NP cells isolated from IVDD patients were treated with various concentrations of ABT263 for 24 h.
  • FIG. 3 As a result, as shown in FIG. 3 , AF cells exhibited an effect of removing senescent cells when the ABT263 concentration was 0.3125 ⁇ M or higher, confirming that 0.3125 ⁇ M was an effective concentration ( FIG. 3A ). Also, as shown in FIG. 3 , in the case of NP cells, an apoptosis-inducing effect appeared when the ABT263 concentration was 15 ⁇ M or more, confirming that 15 ⁇ M was an effective concentration ( FIGS. 3B and 3C ).
  • Human or mouse AF and NP cells of Preparation Example 1 were inoculated at a density of 2 x 10 4 cells cm -2 and incubated at 37° C. with 5% CO 2 .
  • Human AF cells were treated with 0.625 (immunocytochemical analysis and SA- ⁇ -gal staining) or 1.25 ⁇ M (flow cytometry) ABT263 (MedChemExpress, USA), and human NP cells were treated with 15 ⁇ M ABT263.
  • Rat AF and NP cells were treated with 0.625 ⁇ M ABT263.
  • for quantification of caspase 3 protein cleaved in human NP cells after treatment with 500 ⁇ M H 2 O 2 for 6 hours, they were exposed to ABT263 for 3 hours.
  • Cell lysis buffer was prepared by adding 10x cell lysis buffer (Cell Signaling Technology, USA) and 100x PMSF (Thermo Scientific, USA) to RNAse-free water (Thermofisher, USA). The cultured cells were washed with PBS and then treated with a cell lysis buffer to extract proteins from the cultured cells. The buffer was collected in a tube and placed on ice for 15 min. After centrifugation at 2,000 rpm for 5 min, the supernatant was transferred to a new tube. A cleaved caspase 3 ELISA kit was used according to the manufacturer's instructions to determine the amount of cleaved caspase 3 in a sample.
  • ABT263 treatment on AF and NP cells isolated from healthy IVD tissues of mice did not affect the proportion of HMGB1-positive cells, and senescence by ABT263 treatment by SA- ⁇ -gal staining. It was confirmed that the cells were removed (Fig. 2B).
  • ABT263 selectively eliminates senescent cells by activating the intrinsic apoptosis pathway, and does not significantly affect normal cells.
  • Example 1 The human or murine AF and NP cells of Example 1 were inoculated at a density of 2 x 10 4 cells cm -2 and incubated at 37° C. with 5% CO 2 . To test the effect of repeated exposure to ABT263 on human AF cells, 1.25 ⁇ M ABT263 was treated on days 0 and 2.
  • a 0.1 M citric acid solution pH 5.5 was used as a buffer to simulate the acidic environment of regressed IVDs.
  • Three separate PLGA-ABT samples were used for drug release testing. Each sample was resuspended in buffer and stirred on a shaker (Labogene, USA) in an incubator at 37°C. 1 ml of samples were taken at various time points and subjected to 3 centrifugation at 17,000 g for 15 min, 1 wash in distilled water, 1 wash in 5% Tween 20 (v/v), and finally 3 washes in distilled water.
  • the washed PLGA-ABT was freeze-dried for 2 days, the sample was dissolved in DMSO (Sigma, USA), and the ABT263 amount of PLGA-ABT was measured by HPLC.
  • the sequences of primers used in HPLC are shown in Table 1 below.
  • the HPLC system (HPLC 9100 series, 270 nm, Young In Chromass, Korea) is as follows. Water containing acetonitrile and 1% trifluoroacetic acid was filtered through a 0.45 ⁇ m filter and then used as the mobile phase and gradient elution was used. A C18 column (Sunfire® C18 5.0 um, 4.6 mm x 150 mm, Waters, USA) was used at a flow rate of 1 ml min ⁇ 1 , and 50 ⁇ l of sample was used each time. Chromatographs were analyzed with Autochro 3000 program.
  • PLGA-ABT was slowly degraded in a buffer at 37 °C in vitro (Fig. 4A). It could be confirmed that about 80% of the ABT263 entrapped in PLGA-ABT was released in vitro during the first 2 days and ⁇ 15% of the encapsulated drug was released during the next 19 days (Fig. 4B).
  • ABT263 delivery system of PLGA-ABT has a strong effect on senescent cells at an early stage, followed by a relatively weak but steady effect on senescent cells for several weeks thereafter.
  • PLGA-ABT was incubated in the medium at 37 °C with 5% CO 2 for 24 h.
  • Media conditioned with PLGA-ABT was collected after removal of PLGA-ABT via centrifugation at 17,000 g for 15 min.
  • the conditioned medium was filtered through a 0.22 ⁇ M filter (Millipore, USA) and then used for human AF cell culture.
  • the conditioned medium contained ABT263 equivalent to the daily release amount of PGLA-ABT, and was replaced daily to maintain only the daily release amount of ABT without accumulation.
  • HMGB1-positive cells in human AF cells isolated from IVDD patients was significantly increased when in vitro treatment for 1 day in a medium conditioned with PLGA-ABT, and treatment for 7 days increased additionally (Fig. 4C).
  • PLGA-ABT can be a suitable alternative to treatment by repeated drug infusion.
  • FIG. 5 a prominent fluorescence signal was observed in the entire tail disc immediately after injection ( FIG. 5A ).
  • the fluorescence intensity of PLGA-ABT was maintained in the tail disc.
  • the fluorescence signal remained in the tail disc, but decreased slightly.
  • PLGA-ABT was injected into the damaged disc of the mouse model of Preparation Example 2 (13 ⁇ g ABT263 per damaged disc).
  • 5 rats received an intradisc injection of PBS.
  • Blood samples were collected from rats 1 and 3 weeks after injection to evaluate in vivo toxicity. Blood samples were centrifuged at 3,500 rpm for 15 min at 4 °C to obtain serum. Serum concentrations of platelets, ALT, AST, BUN and creatinine were analyzed using an automated biochemical analyzer (AU680, Beckman coulter, US).
  • the level was in the normal range (685-1436 x 103 cells/ ⁇ L for platelets, 54-298 U/L for AST, 35-80 U/L for ALT, 10 for BUN) -21 mg/dl), and there was no significant difference between the PLGA-ABT group and the PBS group (FIG. 5B).
  • SA- ⁇ -gal ⁇ -galactosidase
  • the rat coccyx was dissected and fixed in 0.2% glutaraldehyde at 4 °C for 1 day and decalcified in 10% EDTA for 3–4 days. After extensive washing, samples were infiltrated overnight with 30% sucrose solution, embedded in Tissue Tek OCT (Sakura Finetek USA, Torrance, CA) and cut into 3 ⁇ m thick sections. Rinse the sections with PBS and overnight at 37 °C with SA- ⁇ -gal staining solution (1 mg/mL 5-bromo-4-chloro-3-indolyl- ⁇ -D-galactopyranoside, 40 mM citric acid/sodium phosphate).
  • Immunostaining for p16INK4a and HMGB1 was performed as follows to confirm that PLGA-ABT injection removes senescent cells from damaged IVD tissues.
  • IVD tissues were collected and stored in 4% PFA solution. Dewaxing, rehydrating and dewaxing and rehydrating lesion-site portions of IVDs with a thickness of 5 to 10 ⁇ m, followed by Type 2 collagen (1: 1,000, Abcam, UK), p16INK4a (1: 400, Abcam, UK), MMP13 (1: 1600, Abcam, UK). ), PCNA (1: 10000, Abcam, UK) and HMGB1 (1: 1,600, Abcam, UK).
  • MMP13 expression was increased in both protein ( FIG. 7A ) and mRNA ( FIG. 7B ) in the degenerative disc of the mouse model.
  • Single intradisc injection of PLGA-ABT significantly reduced Mmp13 expression compared to Veh or PLGA-NP injection.
  • PLGA-ABT injection significantly reduced the mRNA expression of Adamts4, Cox2, iNos and Ngf (Fig. 7B and Table 1).
  • PLGA-ABT injection can reduce SASP expression in damaged IVD through the removal of senescent cells.
  • TUNEL analysis was done as follows. IVD tissues were collected and stored in 4% paraformaldehyde (PFA) for 24 h, provided by the TUNEL assay kit (TACS®2 TdT-DAB from R&D Systems, Situ Apoptosis Detection kit, USA). protocol was used. Histological sections (10 ⁇ m) were deparaffinized, dehydrated, and incubated in Protinase K solution for 1 h. Incubate the sections in the quenching solution for 10 min, followed by immersion in 1X TdT labeling buffer for 5 min. TUNEL reaction mixture (Labeling Reaction Mix) was added to the sections and the sections were incubated at 37°C for 1 hour.
  • PFA paraformaldehyde
  • the sections were then incubated with Streptavidin-HRP solution at 37°C in a humidity chamber. Next, the sections were immersed in 3,3-Diaminobenzidine (DAB) solution for 7 min, after which the sections were counterstained with 1% methyl green. Sections were mounted and scanned using an OLYMPUS C-mount camera adapter (U-TVO.63XC, Japan).
  • DAB 3,3-Diaminobenzidine
  • Rat tail IVDs were scanned using a 9.4 T MRI spectrometer (Bruker BioSpec, USA) and custom MR coils for sagittal and axial T2-weighted MRI scans using the following settings.
  • Each condition of the sagittal plane and coronal plane is as follows.
  • Regions of high signal intensity in the mid-sagittal plane of the T2 image were defined as the contours of the NPs and regions of interest (ROIs) were measured using Image J software (National Institutes of Health, Bethesda, MD, USA). The signal intensity area and ROI ratios of damaged discs were compared with those of Co8/9 (intact) discs. It was measured by two independent, random observers.
  • Safranin-O staining was performed as follows. IVD tissues were fixed in 10% neutral buffered formalin, then dehydrated and embedded in paraffin. Sections 6 mm thick were obtained, dewaxed, rehydrated, and stained with Safranin-O (Sigma, USA) to determine the distribution and amount of proteoglycans. All samples were subjectively assessed for tissue morphology and structure by a pathologist unaware of sample information.
  • FIG. 8 it was shown that apoptosis of NP cells, which is an indicator of IVDD damage, was significantly increased, and it was confirmed through TUNEL analysis that IVD damage induced IVDD.
  • TUNEL-positive cells did not differ from normal group on day 7, indicating that PLGA-ABT did not induce apoptosis in normal disc cells.
  • FIG. 9 As shown in FIG. 9 , as a result of magnetic resonance imaging (MRI) scan of the rat tail spine, a bright signal intensity of the disc was observed in a normal healthy disc (Co8/9). Significant loss in both signal intensity regions and signal intensity ratios was found in injured IVDs (Co6/7 and Co7/8) administered with Veh or PLGA-NP. In contrast, the area and ratio of signal intensity in the PLGA-ABT treatment group were significantly increased (Fig. 9a).
  • MRI magnetic resonance imaging
  • PLGA-ABT treatment can activate a progenitor-like population that is quiescent for IVD regeneration.
  • Histological scoring system was used for safranin-O staining to evaluate the extent of IVDD according to structure, cellularity and morphology, NP and AF, and after 6 weeks of treatment, as shown in Figure 9, PLGA-ABT-treated IVD tissues showed better histological scores compared to Inj, Veh or PLGA-treated IVD tissues ( FIG. 9E ).
  • PLGA-ABT treatment can restore IVD structure after damage-induced disc degeneration by inhibiting IVDD progression and eliminating senescent cells and SASPs from damaged IVD.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Inorganic Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Mycology (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Physics & Mathematics (AREA)
  • Biomedical Technology (AREA)
  • Nanotechnology (AREA)
  • Optics & Photonics (AREA)
  • Immunology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Rheumatology (AREA)
  • Physical Education & Sports Medicine (AREA)

Abstract

본 발명은 ABT263을 유효성분으로 포함하는 디스크 질환 예방 및 치료용 약학적 조성물에 관한 것으로서, 상기 ABT263 또는 나비토클락스는 Mmp13, Adamts4, Cox2, iNos 및 Ngf의 발현을 감소시키고, 디스크 내의 노화세포를 제거할 수 있다. 이에 따라, 새로운 의약 용도인 디스크 관련 질환의 예방, 개선 또는 치료 용도로 이용할 수 있다.

Description

[규칙 제37.2조에 의해 ISA가 부여한 발명의 명칭]　ABT263을 유효성분으로 포함하는 디스크 질환 예방 또는 치료용 조성물
본 출원은 2020년 10월 28일 출원된 대한민국 특허출원 제10-2020-0141574호를 우선권으로 주장하고, 상기 명세서 전체는 본 출원의 참고문헌이다.
본 발명은 ABT263을 유효성분으로 포함하는 디스크 질환 예방 및 치료용 조성물에 관한 것이다.
디스크, 추간판 또는 척추사이원반은 두 뼈의 사이를 섬유연골관절로 이어주는 탄력 있는 받침으로서, 사람의 허리에는 23개의 척추사이원반이 존재한다. 역학적으로 디스크는 두 척추뼈몸통 사이의 운동을 가능하게 하면서 두 척추뼈몸통이 연결되도록 안정시킨다.
이러한 디스크의 손상은 인간이 이족 보행을 하면서 얻게 된 필연적인 질환으로서, 이를 치료하기 위하여 약물과 물리 치료 등의 보존적 요법이 사용되고 있다. 보존적 요법이 효과가 없는 경우에 추간판 제거술, 척추 유합술, 인공 추간판 삽입술과 같은 수술적 치료가 고려될 수 있다. 수술적 치료를 통해 짧은 기간 통증이 감소되는 효과는 있지만, 장기적으로는 퇴행성 변화가 악화되고, 척추 불안정증 유발로 요통이 더욱 심해지는 결과를 초래할 수 있다.
이러한 배경기술 하에, ABT 263의 항암제로서의 용도는 확인되었으나(EP 3066101 B1), 디스크 관련 질환의 예방 및 치료 용도에 관하여는 연구가 미비한 실정이다.
일 양상은 ABT263을 유효성분으로 포함하는 디스크 질환 예방 및 치료용 약학적 조성물을 제공한다.
다른 양상은 ABT263을 유효성분으로 포함하는 디스크 질환 예방 및 개선용 건강기능식품 조성물을 제공한다.
다른 양상은 ABT263을 유효성분으로 포함하는 약학적 조성물을 개체에 투여하는 단계를 포함하는 디스크 질환을 예방 또는 치료하는 방법을 제공한다.
다른 양상은 디스크 질환의 예방 또는 치료용 의약의 제조에 사용하기 위한 ABT263을 유효성분으로 포함하는 약학적 조성물의 용도를 제공한다.
본 출원의 다른 목적 및 이점은 첨부한 청구범위 및 도면과 함께 하기의 상세한 설명에 의해 보다 명확해질 것이다. 본 명세서에 기재되지 않은 내용은 본 출원의 기술 분야 또는 유사한 기술 분야 내 숙련된 자이면 충분히 인식하고 유추할 수 있는 것이므로 그 설명을 생략한다.
본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
일 양상은 ABT263을 유효성분으로 포함하는 디스크 질환 예방 및 치료용 약학적 조성물을 제공하는 것이다.
용어 “ABT263” 또는 나비토클락스(Navitoclax, CAS 923564-51-6)는 분자식 C47H55ClF3N5O6S3이고, 분자량 974.61인 화합물이다. 상기 화합물은 하기 화학식 1 로 표시될 수 있다. ABT263은 기존에 항아폽토시스 BCL-2 단백질의 억제 효과를 통한 항암제로서의 용도만 공지되어 있었으나, 본 발명에서 디스크 질환 예방 및 치료 용도를 새로이 발견하였다. 상기 화합물은 천연으로부터 유래될 수도 있고, 공지의 유기 합성 방법을 이용하여 합성될 수도 있다. 또는 비단백질 화합물, 펩티드, 식물 유래 조직이나 세포의 추출물, 미생물(예를 들어 세균류 또는 진균류, 그리고 특히 효모)의 배양으로 얻어진 생산물일 수 있다.
[화학식 1]
Figure PCTKR2021015130-appb-I000001
.
ABT263은 전신 독성 부작용을 유발할 수도 있다. 본원 발명에서 이러한 부작용을 방지하기 위해서, 약물방출시스템에 ABT263을 봉입시킨 후 디스크 질환 부위에 주사하여 질환 부위인 디스크에만 약물을 국소적으로 방출시켰다.
ABT263의 적절한 치료 효능을 얻기 위해서는 ABT263가 시간을 두고 반복적으로 환자에게 주사 되어야 한다. 디스크에 반복적 주사는 염증을 유발하여 디스크 질환을 악화시킬 수 있다. 본 발명에서 이 문제를 방지하기 위해서, 약물방출시스템에 ABT263을 봉입시킨 후 디스크 질환 부위에 주사하여 약물을 서방형으로 방출시켰다.
용어 “디스크”란 뼈와 뼈 사이에 존재하는 연골 등의 조직을 의미할 수 있다. 상기 디스크는 체내의 관절 부위인 허리 디스크, 목 디스크, 턱 디스크 등 종류가 있으며, 이에 한정되는 것은 아니다.
일 구체예에 있어서, 상기 조성물은 생체적합성 고분자를 추가적인 유효성분으로 포함할 수 있다.
용어, "생체적합성 고분자(biocompatible polymer)"는 생체 내에 투여하였을 때 높은 세포독성 및 염증반응 등을 유발하지 않는 생체 내 안전성이 확보된 고분자를 의미하며, 본 명세서에서 단순히 고분자로 지칭되기도 한다. 상기 생체적합성 고분자의 예로 폴리에틸렌 글리콜, 지방산, 콜레스테롤, 알부민 및 이의 단편, 알부민 결합물질, 특정 아미노산 서열의 반복 단위의 중합체, 항체, 항체 단편, FcRn 결합물질, 생체 내 결합조직 혹은 그 유도체, 뉴클레오타이드, 파이브로넥틴, 트랜스페린(transferrin), 당류(saccharide), 혹은 고분자 중합체를 들 수 있으나, 이에 제한되지 않는다.
이와 같은 생체적합성 고분자와 약효를 나타내는 약물을 결합한 제형을 개발하기 위해서는 약물의 물성, 약물의 투여량, 약물과 고분자의 물리화학적 적합성, 약물의 유기 용매상 용해도가 고려되어야 하며, 상기 요인들을 모두 고려하더라도 제조하는 방법과 각 제조 방법에 따른 공정변수에 따라 제조되는 제형의 약물 방출 패턴이 상이하다. 본 발명은 이러한 생체적합성 고분자와 약물의 고유한 방출 패턴 및 포집 효율 등을 특정할 수 있는 요인들을 한정하여, 디스크 질환에 현저한 효과를 나타내는 조성물을 발명하였다.
일 구체예에 있어서, 상기 생체적합성 고분자는 폴리에틸렌글리콜, 폴리프로필렌 글리콜, 에틸렌 글리콜-프로필렌 글리콜 공중합체, 폴리옥시에틸화폴리올, 다당류, 덱스트란, 폴리비닐에틸에테르, PLA(polylactic acid), 폴리비닐 알코올(PVA), 폴리(p-크실릴렌) 고분자, 폴리(ε-카프로락톤)(PCL), 폴리(발레로락톤)(PVL), 폴리(ε-데카락톤)(PDL), 폴리(1,4-디옥산-2,3-디온), 폴리(1,3-디옥산-2-온), 폴리(파라-디옥산온)(PDS), 폴리(하이드록시부티르산)(PHB), 폴리(하이드록시발레산)(PHV), 에틸렌 비닐 아세테이트 및 폴리(β-말산)(PMLA) 및 PLGA(polylactic-glycolic acid)로 이루어진 군에서 선택된 1 이상일 수 있다.
일 구체예에 있어서, 상기 ABT263과 생체적합성 고분자의 결합체는 용매증발법(solvent evaporation method), 분무건조법(spray drying method), 용매추출법(solvent extraction method) 또는 미세유체법(microfluidic method)으로 제조된 것일 수 있다. 보다 구체적으로 용매증발법으로 제조될 수 있으나, 이에 제한되는 것은 아니다.
일 구체예에 있어서, 상기 결합체의 직경은 200 nm 내지 2 μm인 것일 수 있다. 보다 구체적으로는, 200 내지 1500nm, 200 내지 1000nm, 200 내지 800nm, 200 내지 500nm일 수 있으나 이에 제한되는 것은 아니다. 직경이 2 μm 이하인 입자는 대식세포와 용이하게 접촉하기 어렵기 때문에 식균작용이 활발하지 않다. 따라서 상기 결합체의 직경은 디스크 조직에 주입된 후 대식세포에 의한 식균 작용의 가능성이 낮다는 기술적 효과가 있다.
일 구체예에 있어서, 상기 결합체의 약물 포집 효율은 40 내지 70%인 것일 수 있다. 보다 구체적으로는, 40 내지 60%, 50 내지 70%, 55 내지 70%일 수 있으나 이에 제한되는 것은 아니다.
일 구체예에 있어서, 상기 생체적합성 고분자와 ABT263의 혼합 중량비는 7 내지 1: 5 내지 1, 7 내지 2: 5 내지 1, 6 내지 2: 5 내지 2, 6 내지 2: 4 내지 2, 5 내지 2: 4 내지 2, 5 내지 3: 4 내지 2일 수 있다.
일 구체예에 있어서, 상기 디스크 질환은 추간판 탈출증, 요통, 감염, 척색종일 수 있다. 보다 구체적으로는, 퇴행성 추간판 탈출증일 수 있다.
일 구체예에 있어서, 상기 조성물은 Mmp13, Adamts4, Cox2, iNos 및 Ngf의 발현을 감소시키는 것일 수 있다. 상기 발현이 감소되는 유전자 또는 단백질은 노화 관련 분비 표현형(SASP: Senescence Associated Secretary Phenotype)일 수 있으며, 이는 인터루킨-6 (IL-6), 인터루킨-8 (IL-8), 인터루킨 -1α / β (IL-1α / β), ECM 이화 효소 및 산화 질소와 같은 전염증성 사이토카인을 포함한다. 퇴행성 디스크 질환이 발생한 디스크의 경우, 디스크에 염증 및 퇴행이 발생하여 노화 관련 분비 표현형인 유도성 산화 질소 신타제 (iNOS), 시클로 옥시게나제 -2 (COX2) 및 신경 성장 인자 (NGF)의 발현이 증가하는 것을 확인할 수 있다.
일 구체예에 있어서, 상기 약학적 조성물은 디스크 내의 노화세포를 제거하는 효과가 있는 것일 수 있다.
용어, “예방”은 상기 조성물의 투여로 질병의 발병을 억제 또는 지연시키는 모든 행위를 의미한다.
용어, “치료”는 질병을 앓거나 또는 질병이 발병할 위험이 있는 개체에게, 상기 개체의 상태(예를 들면, 하나 이상의 증상)의 개선, 질병 진행의 지연, 증상 발생의 지연 또는 증상 진행의 둔화 등을 포함한 효과를 제공하는 임의의 형태의 치료를 의미한다. 따라서, 상기 “치료” 및 “예방”은 증상의 치유 또는 완전한 제거를 의미하도록 의도되지 않는다.
상기 약학적 조성물은 유효성분을 단독으로 포함하거나, 하나 이상의 약학적으로 허용 가능한 담체, 부형제 또는 희석제를 포함하여 약학적 조성물로 제공될 수 있다.
구체적으로, 상기 담체는 예를 들어, 콜로이드 현탁액, 분말, 식염수, 지질, 리포좀, 미소구체(microspheres) 또는 나노 구형입자일 수 있다. 이들은 운반 수단과 복합체를 형성하거나 관련될 수 있고, 지질, 리포좀, 미세입자, 금, 나노입자, 폴리머, 축합 반응제, 다당류, 폴리아미노산, 덴드리머, 사포닌, 흡착 증진 물질 또는 지방산과 같은 당업계에 공지된 운반 시스템을 사용하여 생체 내 운반될 수 있다.
상기 약학적 조성물이 제제화될 경우에는 통상적으로 사용하는 윤활제, 감미제, 향미제, 유화제, 현탁제, 보존제, 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 경구투여를 위한 고형 제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함될 수 있고, 이러한 고형제제는 상기 조성물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calciumcarbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제될 수 있다. 또한 단순한 부형제 이외에 마그네슘 스테아레이트, 탈크 같은 윤활제들도 사용될 수 있다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 있으며, 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함될 수 있다. 비수성용제, 현탁제로는 프로필렌글리콜 (propyleneglycol), 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로 제라틴 등이 사용될 수 있고, 점안제 형태로 제조 시 공지의 희석제 또는 부형제 등이 사용될 수 있다.
또한, 상기 약학적 조성물은 기존 디스크질환 치료제와 병용 투여 즉, 종래에 알려져 있는 디스크 질환 예방 또는 치료용 조성물과 혼합하여 제공될 수도 있다.
상기 약학적 조성물은 디스크 질환 예방 또는 치료 효과를 가지는 공지의 조성물과 병행하여 투여할 수 있고, 동시에, 별도로, 또는 순차적으로 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
상기 용어 "투여"란 적절한 방법으로 개체에게 소정의 물질을 도입하는 것을 의미하며, "개체"란 난임 또는 불임증을 보유할 수 있는 인간을 포함한 쥐, 생쥐, 가축 등의 모든 생물을 의미한다. 구체적인 예로, 인간을 포함한 포유동물일 수 있다.
일 양상에 있어서, 약학적 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장이 포함된다.
상기 조성물은 경구 또는 비경구 투여할 수 있으며, 비경구 투여시 피부 외용 또는 복강내주사, 직장내주사, 피하주사, 정맥주사, 근육내 주사 또는 흉부내 주사 주입방식을 선택할 수 있다. 구체적으로는 외용으로서 디스크가 존재하는 신체 기관 외부의 피부에 바르는 도포 형태로 투여할 수 있고, 디스크 자체에 주사의 형태로 직접 주입하는 것일 수 있다. 보다 구체적으로 상기 약학적 조성물은 디스크에 주사의 형태로 직접 주입하는 것일 수 있다.
상기 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 상기 용어, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 환자의 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 상기 투여는 하루에 한 번 투여되는 것일 수도 있고, 수 회 나누어 투여되는 것일 수도 있다.
구체적으로, 상기 약학적 조성물의 유효량은 환자의 연령, 상태, 체중, 체내에 활성 성분의 흡수도, 불활성율, 배설 속도, 질병 종류, 병용되는 약물에 따라 달라질 수 있으며, 투여 경로, 비만의 중증도, 성별, 체중, 연령 등에 따라 증감될 수 있다.
다른 양상은 상기 약학적 조성물을 디스크 관련 질환을 보유한 개체에 투여하는 단계를 포함하는 디스크 질환의 예방 또는 치료 방법을 제공하는 것이다.
상기 “약학적 조성물”, “디스크 질환”, “개체”, “투여”, “예방” 또는 “치료” 등의 용어들의 의미는 전술한 범위 내일 수 있다.
또 다른 양상은, ABT263을 유효성분으로 포함하는 디스크 질환 예방 및 개선용 건강기능식품 조성물을 제공하는 것이다.
상기 건강기능식품 조성물에 대한 설명에서 언급된 용어 또는 요소 중 이미 언급된 것과 동일한 것은 상술한 바와 같다.
용어 "개선"이란 치료되는 상태와 관련된 파라미터, 예를 들어, 증상의 정도를 적어도 감소시키는 모든 행위를 의미할 수 있다. 이때, 상기 건강기능식품은 디스크 질환의 예방 또는 개선을 위하여 해당 질의 발병 단계 이전 또는 발병 후, 치료를 위한 약제와 동시에 또는 별개로서 사용될 수 있다.
상기 건강기능식품에서, 유효성분은 식품에 그대로 첨가하거나 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효 성분의 혼합량은 그의 사용 목적(예방 또는 개선용)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조시에 상기 건강기능식품은 원료에 대하여 구체적으로 약 15 중량% 이하, 보다 구체적으로 약 10 중량% 이하의 양으로 첨가될 수 있다. 그러나, 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 양은 상기 범위 이하일 수 있다.
상기 건강기능식품은 담체, 희석제, 부형제 및 첨가제 중 하나 이상을 더 포함하여 정제, 환제, 산제, 과립제, 분말제, 캡슐제 및 액제 제형으로 이루어진 군에서 선택된 하나로 제형될 수 있다. 일 양상에 따른 화합물을 첨가할 수 있는 식품으로는, 각종 식품류, 분말, 과립, 정제, 캡슐, 시럽제, 음료, 껌, 차, 비타민 복합제, 건강기능성 식품류 등이 있다.
상기 담체, 부형제, 희석제 및 첨가제의 구체적인 예로는 락토즈, 덱스트로즈, 슈크로즈, 솔비톨, 만니톨, 에리스리톨, 전분, 아카시아 고무, 인산칼슘, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 미세결정성 셀룰로즈, 폴리비닐피롤리돈, 셀룰로즈, 폴리비닐피롤리돈, 메틸셀룰로즈, 물, 설탕시럽, 메틸셀룰로즈, 메틸 하이드록시 벤조에이트, 프로필하이드록시 벤조에이트, 활석, 스테아트산 마그네슘 및 미네랄 오일로 이루어진 군으로부터 선택되는 적어도 하나일 수 있다.
상기 건강기능식품은 상기 유효성분을 함유하는 것 외에 특별한 제한없이 다른 성분들을 필수 성분으로서 함유할 수 있다. 예를 들어, 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스 등; 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비톨, 에리트리톨 등의 당 알코올일 수 있다. 상술한 것 이외의 향미제로서 천연 향미제 (타우마틴, 스테비아 추출물 (예를 들어, 레바우디오시드 A, 글리시르히진 등)) 및 합성 향미제 (사카린, 아스파르탐 등)를 유리하게 사용할 수 있다. 상기 천연 탄수화물의 비율은 당업자의 선택에 의해 적절하게 결정될 수 있다.
상기 외에도, 일 양상에 따른 건강기능식품은 여러 가지 영양제, 비타민, 광물 (전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제 (치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있으며, 이러한 첨가제의 비율 또한 당업자에 의해 적절히 선택될 수 있다.
다른 양상은 디스크 질환 예방 또는 치료에 사용하기 위한 ABT263을 유효성분으로 포함하는 조성물의 용도를 제공하는 것이다.
다른 양상은 디스크 질환의 예방 또는 치료용 의약의 제조에 사용하기 위한 ABT263을 유효성분으로 포함하는 약학적 조성물의 용도를 제공한다.
다른 양상은 디스크 질환 예방 또는 치료에 사용하기 위한 ABT263의 용도를 제공하는 것이다.
다른 양상은 ABT263을 유효성분으로 포함하는 약학적 조성물을 개체에 투여하는 단계를 포함하는 디스크 질환을 예방 또는 치료하는 방법을 제공한다.
일 실시예에서 상기 투여하는 단계는 디스크 질환을 가진 개체에 ABT263을 유효성분으로 포함하는 조성물을 유효한 양으로 투여하는 것일 수 있다.
상기 “약학적 조성물”, “디스크 질환”, “개체”, “투여”, “예방” 또는 “치료” 등의 용어들의 의미는 전술한 범위 내일 수 있다.
ABT263 또는 나비토클락스는 Mmp13, Adamts4, Cox2, iNos 및 Ngf의 발현을 감소시키고, 디스크 내의 노화세포를 제거할 수 있다. 이에 따라, 새로운 의약 용도인 디스크 관련 질환의 예방, 개선 또는 치료 용도로 이용할 수 있다.
도 1a는 PLGA-ABT의 형태를 확인한 도이다.
도 1b는 PLGA-ABT의 크기를 확인한 결과이다.
도 2a는 ABT263의 처리에 따른 HMGB1 양성 세포의 비율의 변화를 확인한 도이다.
도 2b는 ABT263의 처리에 따른 노화 세포의 제거를 확인한 도이다.
도 2c 및 2d는 ABT263의 처리에 따른 annexin V + 세포의 증가 및 PI + annexin V- 세포의 감소를 확인한 도이다.
도 2e는 절단된 카스파제 3의 발현량의 증가를 확인한 도이다.
도 2f는 ABT263의 처리에 따른 HMGB1 양성 세포의 비율 변화를 확인한 도이다.
도 3a는 AF 세포에 대한 ABT263의 유효 농도를 확인한 도이다.
도 3b 및 3c는 NP 세포에 대한 ABT263의 유효 농도를 확인한 도이다.
도 4a는 시험관내 37 ℃의 완충액에서 시간에 따른 PLGA-ABT의 분해를 확인한 도이다.
도 4b는 시간에 따른 PLGA-ABT에 포집된 ABT263의 방출을 확인한 도이다.
도 4c는 PLGA-ABT로 조절된 배지에서의 HMGB1- 양성 세포의 비율의 변화를 나타낸 도이다.
도 5a는 PLGA-ABT의 IVDD 마우스 모델 내 지속력을 확인한 결과이다.
도 5b는 PLGA-ABT의 IVDD 마우스 모델 내 독성을 확인한 결과이다.
도 6a는 PLGA-ABT의 IVDD 마우스 모델 내 노화세포 제거 효과 확인 프로세스를 나타낸 도이다.
도 6b는 PLGA-ABT의 IVDD 마우스 모델 내 노화세포 제거 효과를 확인한 결과이다.
도 6c는 IVDD 마우스 모델에서 PLGA-ABT 처리시 p16INK4a의 발현 감소를 나타낸 도이다.
도 6d는 IVDD 마우스 모델에서 PLGA-ABT 처리시 HMGB1의 발현 증가를 나타낸 도이다.
도 7a는 IVDD 마우스 모델에서 PLGA-ABT 처리시 Mmp13 발현의 감소를 나타낸 도이다.
도 7b는 IVDD 마우스 모델에서 PLGA-ABT 처리시 Adamts4, Cox2, iNos 및 Ngf의 mRNA 발현의 감소를 확인한 도이다.
도 8a는 정상 디스크 세포에서의 PLGA-ABT의 세포사멸 유도 여부를 확인 프로세스를 나타낸 도이다.
도 8b는 PLGA-ABT를 처리한 마우스에서 NP 세포의 세포 사멸(apoptosis)의 증가 확인 및 TUNEL 양성 세포 분석을 통한 IVD 손상에 의한 IVDD를 유도를 확인한 도이다.
도 9a는 쥐 꼬리 척추의 자기 공명 영상 (MRI) 스캔 결과를 나타낸 도이다.
도 9b는 PLGA-ABT를 처리한 NP 조직에서 PCNA 양성 세포의 증가를 확인한 도이다.
도 9c는 PLGA-ABT를 단일 디스크 내 처리한 경우 II 형 콜라겐 양성 영역의 증가를 나타낸 도이다.
도 9d는 PLGA-ABT를 단일 디스크 내 처리한 경우 사프라닌-O 양성 영역의 증가를 나타낸 도이다.
도 9e는 PLGA-ABT를 처리한 조직에서 조직학적 점수의 증가를 나타낸 도이다.
[제조예]
제조예 1: 노화 섬유륜 세포 및 수핵 세포의 분리
퇴행된 IVD(Intervertebral disc) 조직은 요추 추간판 탈장 및 요추 척추 협착으로 인해 요추 추간판 절제술 및 후 체간 유합술을 받은 4 명의 남성과 2 명의 여성 환자로부터 얻었다. 환자의 평균 연령은 48.0 ± 23.4 세 (21-86 세)였다. Pfirrmann의 등급 시스템을 사용하여 인덱스 수준의 디스크 퇴화 정도를 확인했다. 3 명의 환자는 3 등급이었고 3 명의 환자는 4 등급이었다. 환자의 요추 디스크에서 노화 섬유륜 세포(annulus fibrosus; AF) 및 수핵 세포(nucleus pulposus; NP)를 분리했다. 분당 차병원 제도 윤리 심의위원회에서 본 연구를 승인했으며(승인 번호 2019-04-049-002), 모든 환자로부터 서면 동의를 얻었다. 쥐의 IVD 조직은 건강한 6 주령 암컷 Sprague-Dawley 쥐 (Orient Bio Inc, Korea)의 꼬리 디스크에서 얻었다.
인간 또는 쥐의 IVD 조직을 100 U ml-1 페니실린 및 100 ug ml-1 스트렙토마이신 (P / S; Gibco, USA)이 보충 된 HBSS 용액 (Sigma-Aldrich, USA)으로 3 회 세척 하였다. 두 부위의 다른 해부학적 특징에 따라 조직을 NP와 AF로 분리하고, 작은 조각으로 자르고 40 μm 스트레이너 (SPL, 한국)를 통해 여과하여 불순물을 제거했다. 스트레이너 윗면에 남아있는 조직을 수집하고 5 % 소 태아 혈청 및 P / S가 보충 된 F12에서 1.5 % (w / v) 프로테아제로 37 ° C에서 1 시간 동안 쉐이커에서 소화시켰다. 소화 후 검체를 채취하여 P / S를 첨가 한 HBSS 용액으로 3 회 세척 하였다. 세척 후, 시료를 37° C 에서 16 시간 동안 쉐이커에서 5 % FBS 및 1 % P / S가 보충 된 F12의 0.012 % (w / v) 콜라게나아제 II로 다시 분해하였다. 소화 후 시료를 70 μm 스트레이너에 통과시키고 2,000 rpm에서 5 분 동안 원심 분리하여 세포를 수집 하였다. 세포 펠렛을 RBC 용해 완충액 (Biolegend, USA)에 재현탁하고 10 분 동안 방치 한 다음 2,000rpm에서 5 분 동안 원심 분리하여 세포를 수집했다. 수집 된 세포 펠렛을 세척하고 10 % FBS 및 P / S가 첨가 된 F12로 배양 하였다. 각 인간 및 쥐로부터 분리된 노화 섬유륜 세포 및 수핵 세포는 실험을 위해 별도로 사용되었다.
제조예 2: IVDD 마우스 모델의 제조
IVDD 마우스 모델은 하기와 같이 제조되었다. 6 주령 암컷 Sprague-Dawley 쥐 (220-240g, Orient Bio Inc., Korea)를 Zoletil® (50mg kg-1)과 Rompun® (10mg kg-1)을 복강 내 주사하여 마취했다. 꼬리 피부는 70 % 알코올과 포비돈 요오드로 살균되었으며, IVD를 나타내기 위해 등쪽 중간 선 피부 절개가 이루어졌다. 꼬리 디스크 (Co6 / 7 및 Co7 / 8)는 등쪽에서 꼬리의 배쪽까지 20 게이지 멸균 바늘로 천공되었다. 바늘은 AF를 통해 NP로 디스크 수준의 중앙에 삽입되도록 피부에 수직으로 배치되었다. 바늘은 깊이 5mm로 제한되고 360도 두 번 회전하고 30 초 동안 유지되었다. 직장 부위의 온도는 온도 조절 식 가열 패드에 의해 37℃로 유지되었다. 피부를 봉합하고 소독했다. 저체온증을 예방하기 위해 모든 동물을 가열 패드에 보관하고 0.9 % 생리 식염수 (5ml)를 피하 주사 하였다. 수술 후 3 일 동안 항생제 (Cefazolin, CKD Pharmaceuticals, South Korea)와 진통제 (Ketoprofen, SCD Pharm. Co. Ltd, South Korea)를 예방적으로 투여 받았다. 모든 동물은 온도가 22 ± 1℃, 상대 습도가 50 % ± 1 %, 생활 / 암주기가 12/12 시간 인 환경에 보관되었다. 동물 연구 절차는 분당 차병원 (IACUC180167)의 기관 동물 관리 및 사용위원회 (IACUC)의 승인을 받았다.
제조예 3: PLGA-ABT(PLGA-ABT263)의 제조
PLGA 나노 입자(PLGA-NP;PLGA-nanoparticles)를 합성하여 ABT263 전달을 위한 담체로 사용하기 위해 하기와 같이 제조 후, 그 결과를 확인하였다
PLGA (LA: GA = 85:15, Sigma-Aldrich, USA)를 사용하여 에멀젼 용매 증발법으로 나노 입자를 제조 하였다. PLGA (1 % w / v) 및 ABT263을 메틸렌 클로라이드 (폴리머: 약물 = 4: 3)에 용해시켰다. 중합체-약물 용액을 수성 폴리 (비닐 알코올) 용액 (0.5 %, w / v)에 적가하고 10 초마다 3 회 초음파 처리하여 수중유 에멀젼을 형성 하였다. 에멀젼이 있는 용액을 3 시간 동안 교반하고 밤새 방치 하였다. 17,000g에서 15 분간 원심 분리하여 증류수로 3 회 세척 한 후 동결 건조하여 잔류 용매를 제거 하였다. ABT263이 없는 대조군 PLGA-NP를 만들기 위해 약물을 추가하지 않고 동일한 절차를 사용했다. 약물 대신 Cy5.5-NHS (폴리머: Cy5.5-NHS = 120: 1, Thermo Fisher Scientific, USA)를 사용하여 생체 내 머무름을 테스트하기 위한 나노 입자를 준비했다. PLGA-ABT와 PLGA-NP의 형태는 주사 전자 현미경 (JSM-7800F Prime, JEOL Ltd, Japan)으로 관측되었다. PLGA-ABT와 PLGA-NP의 크기와 크기 분포는 동적 광산란 (Zeta-sizer Nano ZS, Malvern Instruments, UK)에 의해 측정되었다. PLGA-ABT와 PLGA-NP는 수성 폴리 (비닐 알코올) 용액 (0.1 %, w / v)에 분산되었다.
그 결과 도 1에 나타난 바와 같이, PLGA-ABT의 형태는 주사 전자 현미경에 의해 구체로 확인되었다 (도 1A). 동적 광산란 분석 결과 PLGA-ABT의 평균 직경은 494nm로 나타났다 (도 1B).
[실험예]
실험예 1: 퇴행성 디스크 내 노화 세포의 확인
인간 IVDD 환자의 노화 섬유륜(annulus fibrosus; AF) 및 수핵(nucleus pulposus; NP) 세포 조직에 노화 세포가 존재하는지 여부를 확인하기 위하여 하기와 같은 in vitro 실험을 수행하였다.
인간 AF 및 NP 세포를 2 x 104 세포 cm-2의 밀도로 접종하고 5 % CO2로 37℃에서 배양했다. 노화 세포를 염색하기 위해 SA-β-gal 염색 키트 (# 9860, Cell Signaling Technology, USA)를 제조업체의 지침에 따라 사용했다. 세포를 15 분 동안 고정 용액에 고정하고 pH 6으로 조정 된 β-갈락토시다아제 염색 용액으로 밤새 건조 배양기에서 배양했다. 염색된 세포는 광학 현미경 (IX71, Olympus, Japan) 하에서 이미지화되었다.
그 결과 도 2에 나타난 바와 같이, 쥐의 건강한 IVD 조직에서 분리된 AF 및 NP 세포는 대부분이 비노화 세포 마커인 HMGB1로 염색되었지만 IVDD 환자로부터 분리된 AF 및 NP 세포는 0 내지 34 %만이 HMGB1로 염색되었음을 확인하였다 (도 2A).
이는 곧, IVDD 환자의 AF 및 NP 조직에 노화 세포가 다수 존재함을 의미한다.
실험예 2: ABT263의 AF 및 NP 세포에 대한 유효 농도의 확인
ABT263의 AF 및 NP 세포에 대한 유효 농도를 확인하기 위하여 하기와 같은 실험을 실시하였다.
ABT263의 유효 농도를 결정하기 위해 IVDD 환자로부터 분리된 AF 및 NP 세포를 다양한 농도의 ABT263으로 24 시간 동안 처리했다.
그 결과 도 3에 나타난 바와 같이, AF 세포는 ABT263 농도가 0.3125 μM 이상일 때 때 노화 세포 제거 효과를 나타난 바, 0.3125 μM 이 유효 농도임을 확인하였다(도 3A). 또한 도 3에 나타난 바와 같이, NP 세포의 경우, ABT263 농도가 15 μM 이상일 때 아폽토시스 유도 효과가 나타난 바, 15 μM 가 유효 농도임을 확인하였다(도 3B, 3C).
실험예 3: ABT263에 의한 노화 섬유륜(annulus fibrosus; AF) 및 수핵(nucleus pulposus; NP) 세포 제거 효과의 확인
ABT263에 의한 노화 섬유륜 및 수핵 세포 제거 효과를 확인하기 위하여 하기와 같은 실험을 실시하였다.
제조예 1의 인간 또는 쥐의 AF 및 NP 세포를 2 x 104 세포 cm-2의 밀도로 접종하고 5 % CO2로 37℃에서 배양했다. 인간 AF 세포는 0.625 (면역 세포 화학 분석 및 SA-β-gal 염색) 또는 1.25 μM (유세포 분석) ABT263 (MedChemExpress, USA)으로 처리되었으며, 인간 NP 세포는 15 μM ABT263으로 처리되었다. 쥐 AF 및 NP 세포는 0.625 μM ABT263로 처리되었다. 또한 인간 NP 세포에서 절단 된 caspase 3 단백질의 정량화를 위해, 6 시간 동안 500 μM H2O2를 처리한 후, ABT263에 3 시간 동안 노출시켰다. 10x 세포 용해 완충액 (Cell Signaling Technology, USA) 및 100x PMSF (Thermo Scientific, USA)를 RNAse가 없는 물 (Thermofisher, USA)에 넣어 세포 용해 완충액을 만들었다. 배양 된 세포를 PBS로 세척 한 후 세포 용해 완충액을 처리하여 배양 된 세포에서 단백질을 추출 하였다. 완충액을 튜브에 수집하고 15 분 동안 얼음 위에 놓았다. 2,000rpm에서 5 분간 원심 분리 한 후 상청액을 새 튜브로 옮겼다. 절단 된 카스파제 3 ELISA 키트는 샘플에서 절단 된 카스파제 3의 양을 측정하기 위해 제조업체의 지침에 따라 사용되었다.
그 결과 도 2에 나타난 바와 같이 ABT263의 처리는 HMGB1 양성 세포의 비율을 상당히 증가시켰음을 확인하였다 (도 2A).
또한 도 2에 나타난 바와 같이, 쥐의 건강한 IVD 조직에서 분리된 AF 및 NP 세포에 대한 ABT263 처리는 HMGB1 양성 세포의 비율에 영향을 미치지 않았으며, SA-β-gal 염색에 의하여 ABT263 처리에 의해 노화 세포의 제거됨을 확인했다 (도 2B).
또한 도 2에 나타난 바와 같이, Propidium iodide (PI) -Annexin V 염색은 24 시간 동안 ABT263 처리 후 증가 된 annexin V + 세포와 병행하여 감소 된 PI + annexin V- 세포를 나타냈다. (도 2c 및 도 2d)
또한 도 2에 나타난 바와 같이, 절단 된 카스파제 3의 발현량이 증가함을 확인하였다. (도 2e)
이는 곧, ABT263은 고유 세포 사멸 경로를 활성화함으로써 노화 세포를 선택적으로 제거하고, 정상 세포에 유의미한 영향을 미치지 않음을 의미한다.
실험예 4: ABT263의 반복처리에 의한 노화 섬유륜(annulus fibrosus; AF) 및 수핵(nucleus pulposus; NP) 세포 제거 효과의 확인
ABT263의 반복처리에 의한 노화 섬유륜(annulus fibrosus; AF) 및 수핵(nucleus pulposus; NP) 세포 제거 효과를 확인하기 위하여 하기와 같은 실험을 실시했다.
실시예 1의 인간 또는 쥐의 AF 및 NP 세포를 2 x 104 세포 cm-2의 밀도로 접종하고 5 % CO2로 37℃에서 배양했다. 인간 AF 세포에 대한 ABT263에 대한 반복적 노출의 효과를 테스트하기 위해 1.25 μM ABT263을 0 일, 2 일에 처리했다.
그 결과 도 2에 나타난 바와 같이, IVDD 환자로부터 분리된 AF 세포를 ABT263으로 1 회 처리했을 때, 건강한 (HMGB1- 양성) 세포의 비율은 치료 1 일 후에 증가했지만 치료 3 일 후에는 현저하게 감소함을 확인했다 (도 2f).
이와 대조적으로, ABT263을 사용한 다중 치료는 3 일째에 건강한 (HMGB1- 양성) 세포의 증가 된 비율을 유지하는 것을 확인했다.
이는 곧, 퇴행 된 IVD 조직에서 노화 세포를 효과적으로 제거하려면 ABT263으로 반복적인 치료가 필요함을 의미한다.
실험예 5: PLGA-ABT의 약물 포집 효율 및 약물 방출량의 확인
*100PLGA-ABT의 약물 포집 효율 및 약물 방출량을 확인하기 위하여 하기와 같은 실험을 실시하였다.
PLGA-ABT에 로딩 된 ABT263의 양을 측정하기 위해, ABT263이 로딩 된 PLGA-ABT 1mg을 디메틸 설폭사이드 (Sigma, USA) 1ml에 용해시켰다. 용액을 0.45μm 주사기 필터 (Millipore, USA)를 통해 여과하고 ABT263의 농도를 HPLC로 측정 하였다. 약물 포집 효율은 약물 포집 (%) = (PLGA-NP에 포획 된 ABT263의 중량 / PLGA-ABT의 중량) x 100으로 계산되었다. ABT263 포집 효율은 측정 된 고성능 액체 크로마토그래프 (HPLC)에서 57 %였다.
시험관 내에서 PLGA-ABT에서 방출 된 ABT263의 양을 확인하기 위해 0.1M 시트르산 용액 (pH 5.5)을 퇴행 된 IVD의 산성 환경을 시뮬레이션하기 위한 완충액으로 사용했다. 약물 방출 테스트를 위해 3 개의 개별 PLGA-ABT 샘플을 사용했다. 각 샘플을 완충액에 재현탁하고 37℃ 인큐베이터 내의 쉐이커 (Labogene, USA)에서 교반했다. 다양한 시점에서 샘플 1ml를 취하여 17,000g에서 15 분 동안 원심 분리 3 회, 증류수 세척 1 회, 5 % Tween 20 (v / v)세척 1회, 마지막으로 증류수 세척 3 회를 실시했다. 세척 된 PLGA-ABT를 2 일 동안 동결 건조 시켰으며, 샘플을 DMSO (Sigma, USA)에 용해시키고 PLGA-ABT의 ABT263 양을 HPLC로 측정했다. HPLC에 사용된 프라이머의 서열은 하기 표 1과 같다.
Gene (Rat) Forward primer (5'-3') Reverse primer (5'-3')
Adamts4 CGTGGTGTGTGTGTGTGT AGAGGAAAGTAGGGCAGGT
Cox2 TGTATGCTACCATCTGGCTTCGG GTTTGGAACAGTCGCTCGTCATC
Mmp13 TGGTCCCTGCCCCTTCCCTA CCGCAAGAGTCACAGGATGGTAGTA
iNos CTGCAGGTCTTTGACGCTCGGAG GTGGAACACAGGGGTGATGCTCC
Ngf CATCGCTCTCCTTCACAGAGTT ACACTGAGGTGAGCTTGGGT
Gapdh AGACAGCCGCATCTTCTTGT TGATGGCAACAATGTCCACT
HPLC 시스템 (HPLC 9100 시리즈, 270nm, Young In Chromass, 대한민국)은 다음과 같다. 아세토니트릴과 1 % 트리플루오로아세트산이 함유된 물을 0.45 μm 필터를 통해 여과 한 후 이동상으로 사용하고 구배 용출을 사용했다. C18 컬럼 (Sunfire® C18 5.0 um, 4.6 mm x 150 mm, Waters, USA)은 1ml min-1의 유속으로 사용되었으며, 50μl의 샘플이 매번 사용되었다. 크로마토 그래프는 Autochro 3000 프로그램으로 분석되었다.
그 결과 도 4에 나타난 바와 같이 PLGA-ABT는 시험 관내 37 ℃의 완충액에서 천천히 분해되었다 (도 4A). PLGA-ABT에 포집된 ABT263의 약 80 %가 처음 2 일 동안 시험관 내에서 방출되었고 캡슐화 된 약물의 ~ 15 %가 다음 19 일 동안 방출되었음을 확인할 수 있었다 (도 4B).
이는 곧, PLGA-ABT의 ABT263 전달 시스템은 초기 단계에서 노화 세포에 강한 영향을 미치고, 그 이후 몇 주 동안 상대적으로 약하지만 꾸준한 효과가 노화 세포에 나타난다는 것을 의미한다.
실험예 6: PLGA-ABT의 시험관 내 노화세포 제거 효과의 확인
PLGA-ABT 전달 시스템이 시험관 내에서 노화 세포를 효과적으로 제거할 수 있는지 여부를 확인하기 위하여 하기와 같은 실험을 수행하였다.
PLGA-ABT는 37 ℃에서 5 % CO2와 함께 24 시간 동안 배지에서 배양되었다. PLGA-ABT로 조절 된 배지는 15 분 동안 17,000g에서 원심 분리를 통해 PLGA-ABT를 제거한 후 수집되었다. 조절된 배지는 0.22 μM 필터 (Millipore, USA)를 통해 여과된 후 인간 AF 세포 배양에 사용되었다. 조절된 배지는 PGLA-ABT의 일일 방출량만큼의 ABT263을 포함하고 있으며, 축적되지 않고 일일 방출량만큼의 ABT만을 유지하기 위하여 매일 교체되었다.
그 결과, 도 4에 나타난 바와 같이, IVDD 환자로부터 분리된 인간 AF 세포에서 HMGB1- 양성 세포의 비율은 PLGA-ABT로 조절된 배지에서 1 일 동안 시험관 내 처리할 때 유의하게 증가했으며 7 일동안 처리시 추가적으로 증가했다(도 4C). 이는 곧, PLGA-ABT는 반복적인 약물 주입에 의한 치료에 대한 적절한 대안이 될 수 있다는 것을 의미한다.
실험예 6: PLGA-ABT의 IVDD 마우스 모델 내 지속력의 확인
PLGA-ABT의 IVDD 마우스 모델 내 노화세포 제거 효과의 지속력을 확인하기 위하여 하기와 같은 실험을 실시했다.
제조예 2의 IVDD 마우스 모델에 Cy5.5-NHS 4μl로 표시된 PLGA-ABT를 꼬리 IVD에 주입했다. 주사 후 30분, 7일 및 14일 후에 형광 여부를 조사하였다. 형광은 IVIS SpectrumCT in vivo 이미징 시스템 (Xenogen, USA)으로 측정되었다. 주사하지 않은 그룹과 PLGA-ABT 주사 그룹 사이에서 형광 여부를 비교했다.
그 결과 도 5에 나타난 바와 같이, 주사 직후 전체 꼬리 디스크에서 눈에 띄는 형광 신호가 관찰되었다 (도 5A). 주사 1 주 후, PLGA-ABT의 형광 강도는 꼬리 디스크에서 유지되었다. 주사 후 2 주에 형광 신호가 꼬리 디스크에 남아 있었지만 약간 감소했다.
실험예 7: PLGA-ABT의 IVDD 마우스 모델 내 독성의 확인
PLGA-ABT의 생체 내 독성을 평가하기 위해 하기와 같은 실험을 실시했다.
PLGA-ABT를 제조예 2의 마우스 모델의 손상된 디스크에 주사했다 (손상된 디스크 당 13 ㎍ ABT263). 대조군으로 5 마리의 쥐가 PBS의 디스크 내 주사를 받았다. 생체 내 독성을 평가하기 위해 주사 후 1 주 및 3 주에 쥐에서 혈액 샘플을 수집했다. 혈액 샘플을 3,500rpm에서 15 분 동안 4 ℃에서 원심 분리하여 혈청을 얻었다. 혈소판, ALT, AST, BUN 및 크레아티닌의 혈청 농도는 자동 생화학 분석기 (AU680, Beckman coulter, US)를 사용하여 분석되었다.
그 결과 도 5에 나타난 바와 같이, 수치는 정상 범위 (혈소판의 경우 685-1436 x 103 세포/μL, AST의 경우 54-298 U/L, ALT의 경우 35-80 U/L, BUN의 경우 10-21 mg/dl) 내로 확인되었으며, PLGA-ABT 그룹과 PBS 그룹간에 유의미한 차이가 없었다 (도 5B).
이는 곧, PLGA-ABT가 생체 내에서 독성이 없음을 의미한다.
실험예 8: PLGA-ABT의 IVDD 마우스 모델 내 노화세포 제거 효과의 확인
PLGA-ABT의 IVDD 마우스 모델 내 노화세포 제거 효과를 확인하기 위하여 하기와 같은 실험을 실시했다.
바늘 천자 (Co 6-7 및 Co 7-8)를 사용하여 쥐에서 미측 IVD 변성을 유도했다. 2 주 후, PBS (Veh), PLGA 나노 입자 (PLGA-NP) 또는 PLGA-ABT를 퇴화 된 IVD (Co 6-7 및 Co 7-8)에 주입했다 (도 6A). 또한 Veh와 PLGA-ABT를 손상되지 않은 정상 IVD (Co 5-6)에 주입했다.
PLGA-ABT 주사가 손상된 IVD의 NP 및 AF 조직에서 노화 세포를 제거하는지 확인하기 위해 β - 갈락토시다제 (SA-β-gal) 염색을 하기와 같이 수행했다.
쥐의 미골을 절개하고 0.2 % 글루타르알데히드에 4 ℃에서 1 일 동안 고정하고 10 % EDTA에서 3 ~ 4 일 동안 석회질을 제거했다. 광범위하게 세척 한 후 샘플을 30 % 수 크로스 용액으로 밤새 침윤시키고 Tissue Tek OCT (Sakura Finetek USA, Torrance, CA)에 포함시키고 3μm 두께의 섹션으로 잘랐다. 절편을 PBS로 헹구고 밤새 37 ℃에서 SA- β -gal 염색 용액(1 mg / mL 5-브로모-4-클로로-3-인돌릴-β-D-갈락토피 라노시드, 40mM 시트르산 / 인산 나트륨 (pH 6.0), 150mM NaCl, 2mM MgCl2, 5mM 칼륨 페로시아나이드, 5mM 칼륨 페리 시안화물)에서 배양했다. PBS로 3 회 세척 한 후, 섹션을 증류수로 잠깐 세척하고 5 분 동안 Nuclear Fast Red (NFR, Biomeda Foster City, CA)로 대조 염색했다. SA-β-gal- 양성 세포의 백분율은 ImageJ (미국 메릴랜드 주 베데스다에 있는 국립 보건원)를 사용하여 결정되었다.
그 결과 도 6에 나타난 바와 같이, 손상 2주 후에, 손상이 없는 경우 (손상되지 않은 정상 IVD, Nor)보다 NP 및 AF 조직에서 SA-β-gal 양성 세포를 증가시켰으며, PLGA-ABT를 디스크 내에 직접적으로 주입하는 것은 Veh 또는 PLGA-NP를 주입하는 경우보다, 주입 후 1 주일째 손상된 IVD의 NP 및 AF 조직에서 SA-β-gal 양성 세포를 유의하게 감소 시킴을 확인했다(도 6B). 또한 PLGA-ABT 주사는 손상되지 않은 정상 IVD 그룹의 SA-β-gal 양성 세포의 수에 영향을 미치지 않았다.
이는 곧, PLGA-ABT 주사가 AF 및 NP 조직 모두에서 노화 세포를 선택적으로 제거하고 정상 세포에는 영향을 미치지 않음을 의미한다.
PLGA-ABT 주사가 손상된 IVD 조직에서 노화 세포를 제거하는지 확인하기 위해 하기와 같이 p16INK4a 및 HMGB1에 대한 면역 염색을 수행했다.
IVD 조직을 수집하여 4 % PFA 용액에 보관했다. 두께가 5 ~ 10μm 인 IVD의 병변 부위 부분을 탈랍, 재수 화 및 Type 2 콜라겐 (1: 1,000, Abcam, UK), p16INK4a (1: 400, Abcam, UK), MMP13 (1: 1600, Abcam, UK), PCNA (1: 10000, Abcam, UK) 및 HMGB1 (1: 1,600, Abcam, UK)에 대한 항체로 염색했다. 24 시간 후, 섹션을 PBS로 세척하고 DISCOVERY UltraMap anti-Ms HRP, DISCOVERY UltraMap anti-Rb HRP (Roche Diagnostics Ltd, Switzerland) 및 Alexa 488-conjugated 2 차 항체 (Invitrogen, USA)와 함께 배양했다. 세척 후 표본을 DAPI (1: 500, Abcam, UK)로 10 분 동안 염색하였다. 섹션을 장착하고 형광 현미경 (Zeiss 880, 독일 및 Leica SP5, 독일)을 사용하여 검사했다.
그 결과 도 6에 나타난 바와 같이, 치료 6 주 후 p16INK4a 및 HMGB1에 대한 면역 염색은 PLGA-ABT 주사가 Veh 또는 PLGA-NP 주사에 비해 NP 및 AF 세포에서 p16INK4a의 발현을 감소시키고 HMGB1의 발현을 증가시켰음을 보여 주었다 (도 6C, 6D).
이는 곧, PLGA-ABT의 디스크 내 직접 주사가 손상된 IVD에서 노화 세포를 효과적으로 제거 할 수 있음을 의미한다.
실험예 8: PLGA-ABT의 IVDD 마우스 모델 내 SASP 발현 감소 효과의 확인
PLGA-ABT의 IVDD 마우스 모델 내에서 SASP(senescence-associated secretory phenotype) 발현을 감소시키는 효과를 확인하기 위한 실험을 실시하였다.
바늘 천자 (Co 6-7 및 Co 7-8)를 사용하여 쥐에서 미측 IVD 변성을 유도했다. 2 주 후, PBS (Veh), PLGA 나노 입자 (PLGA-NP) 또는 PLGA-ABT를 퇴화 된 IVD (Co 6-7 및 Co 7-8)에 주입했다 (도 6A). 또한 Veh와 PLGA-ABT를 손상되지 않은 정상 IVD (Co 5-6)에 주입했다.
SASP 관련 인자의 발현은 하기와 같이 측정되었다. IVD 조직에서 RNA를 추출하기 위해 먼저 조직을 균질화했다. QIAzol (Qiagen, Germany)을 사용하여 샘플에서 전체 RNA를 추출했다. 추출 된 RNA는 제조사의 프로토콜을 사용하여 RT premix (Bioneer, South Korea)를 사용하여 cDNA로 역전사되었다. qRT-PCR은 Adamts4, Cox2, Mmp13, Ngf 및 Nos에 대한 제조업체의 프로토콜을 사용하여 TOPreal ™ qPCR 2X PreMIX와 함께 StepOnePlus Real-Time PCR 시스템을 사용하여 수행되었다. 상대 유전자 발현은 표적 유전자의 발현 수준을 GAPDH 발현 수준으로 정규화하는 2-△△Ct 방법으로 계산되었다.
그 결과 도 7에 나타난 바와 같이, MMP13 발현은 단백질 (도 7A)과 mRNA (도 7B) 모두에서 마우스 모델의 퇴행성 디스크에서 증가했다. PLGA-ABT의 단일 디스크 내 주사는 Veh 또는 PLGA-NP 주사에 비해 Mmp13 발현을 유의하게 감소시켰다. 또한, PLGA-ABT 주입은 Adamts4, Cox2, iNos 및 Ngf의 mRNA 발현을 현저하게 감소시켰다 (도 7B 및 표 1).
이는 곧, PLGA-ABT 주사가 노화 세포의 제거를 통해 손상된 IVD에서 SASP 발현을 감소시킬 수 있음을 의미한다.
실험예 9: PLGA-ABT의 IVDD 마우스 모델 내 IVDD 억제 및 IVD 구조 복원 효과의 확인
PLGA-ABT의 IVDD 마우스 모델 내에서의 IVDD 억제 및 IVD 구조 복원 효과를 확인하기 위하여, 세포사멸 인자에 대한 발현량 분석, MRI 및 사프라닌-O 염색을 수행하였다.
TUNEL 분석은 하기와 같이 이루어졌다. IVD 조직을 수집하여 24 시간 동안 4 % 파라 포름 알데히드 (PFA)에 보관한 후, TUNEL 분석 키트 (미국 R & D Systems, R & D Systems, Situ Apoptosis Detection kit의 TACS®2 TdT-DAB)에서 제공하는 프로토콜을 사용했다. 조직학적 절편 (10 μm)을 파라핀을 제거하고 탈수한 다음 Protinase K 용액에서 1 시간 동안 배양했다. 절편을 담금질 용액에서 10 분 동안 인큐베이션한 다음 1X TdT 라벨링 버퍼에 5 분 동안 담근다. TUNEL 반응 혼합물 (Labeling Reaction Mix)을 섹션에 첨가하고 섹션을 37℃에서 1 시간 동안 배양했다. 그 후 섹션을 습도 챔버에서 37℃에서 Streptavidin-HRP 용액과 함께 배양했다. 다음으로, 섹션을 3,3-Diaminobenzidine (DAB) 용액에 7 분 동안 담근 후, 섹션을 1 % 메틸 그린으로 대조 염색했다. OLYMPUS C- 마운트 카메라 어댑터 (U-TVO.63XC, 일본)를 사용하여 섹션을 마운트하고 스캔했다.
MRI 분석 및 촬영은 하기와 같이 이루어졌다. 쥐 꼬리 IVD는 9.4 T MRI 분광계 (Bruker BioSpec, USA)와 다음 설정을 사용하여 시상 및 축 T2 가중치 MRI 스캔을 위한 맞춤형 MR 코일을 사용하여 스캔되었다. 시상면과 관상면의 각 조건은 하기와 같다.
(1) 시상면; 5,000 밀리 초 (ms)의 반복 시간 (TR), 반향 시간 (TE) 50ms, 200 수평 Х 600 수직 매트릭스; 시야각 20 수평 Х 60 수직, 각 슬라이스 사이의 간격이 0mm 인 0.8mm 슬라이스
(2) 관상면; TR 5,000ms, TE 30ms, 150 수평 Х 150 수직 매트릭스; 시야각 15 수평 Х 15 수직, 각 슬라이스 사이의 간격이 0mm 인 0.5mm 슬라이스.
T2 이미지의 중간 시상면에서 높은 신호 강도 영역을 NP의 윤곽선으로 정의하고 Image J 소프트웨어 (미국 메릴랜드 주 베데스다 국립 보건원)를 사용하여 관심 영역 (ROI)을 측정했다. 손상된 디스크의 신호 강도 영역과 ROI 비율은 Co8 / 9 (온전한) 디스크의 값과 비교되었다. 이것은 무작위의 독립적인 관찰자 2명에 의해 측정되었다.
사프라닌-O 염색은 하기와 같이 수행되었다. IVD 조직은 10 % 중성 완충 포르말린에 고정된 후, 탈수되어 파라핀에 묻혔다. 6mm 두께의 절편을 얻고, 탈왁스 처리하고, 재수화하고, Safranin-O (Sigma, USA)로 염색하여 프로테오글리칸의 분포와 양을 결정했다. 모든 샘플은 샘플 정보를 알지 못하는 병리학자에 의해 조직 형태 및 구조에 대해 주관적으로 평가되었다.
그 결과 도 8에 나타난 바와 같이, IVDD의 손상 지표인 NP 세포의 세포 사멸(apoptosis)을 유의하게 증가시켰음을 보여주었고, IVD 손상이 IVDD를 유도했음을 TUNEL 분석을 통하여 확인하였다. PLGA-ABT를 정상 IVD에 주사한 지 1 주일 후, TUNEL 양성 세포는 7 일째에 정상 그룹과 다르지 않았으며 이는 PLGA-ABT가 정상 디스크 세포에서 세포 사멸을 유도하지 않았음을 의미한다.
도 9에 나타난 바와 같이, 쥐 꼬리 척추의 자기 공명 영상 (MRI) 스캔 결과, 디스크의 밝은 신호 강도는 정상적인 건강한 디스크 (Co8/9)에서 관찰되었다. Veh 또는 PLGA-NP를 투여한 손상된 IVD (Co6 / 7 및 Co7 / 8)에서 신호 강도 영역과 신호 강도 비율 모두에서 상당한 손실이 확인되었다. 이와 대조적으로 PLGA-ABT 치료군의 신호 강도 면적과 비율은 유의하게 증가했다 (도 9a).
이는 곧, PLGA-ABT의 디스크 내 주입이 손상으로 인한 퇴행성 디스크의 수분 함량을 회복시킬 수 있음을 의미한다.
또한 도 9에 나타난 바와 같이 건강한 IVD는 증식하는 세포와 전구 세포의 비율이 높으며, IVDD는 감소된 세포 증식 능력과 관련이 있음을 확인하였다. NP 조직에서 PLGA-ABT를 일회 주입시 PCNA 양성 세포 수가 상당히 증가하였으며 이는 정상 IVD와 유사했다 (도 9b).
이는 곧, PLGA-ABT 처리가 IVD 재생을 위해 정지 된 전구 유사 집단을 활성화 할 수 있음을 의미한다.
또한 도 9에 나타난 바와 같이, IVD의 II 형 콜라겐 (도 9c)과 safranin O 염색 (도 9d)에 대한 결과에 Nor 그룹 대 Inj 그룹)는 손상으로 인한 디스크 변성이 IVD ECM(도 9c 및 9d)에서 0 일 (= 손상 후 2 주)의 상당한 저하를 초래했음을 확인했다. PLGA-ABT의 단일 디스크 내 주사는 6 주에 Veh 또는 PLGA 그룹과 0 일에 Inj 그룹에 비해 II 형 콜라겐 양성 영역과 사프라닌-O 양성 영역을 크게 증가시켰다.
조직 학적 채점 시스템은 구조, 세포성 및 형태, NP 및 AF에 따른 IVDD의 정도를 평가하기 위해 사프라닌-O 염색에 사용되었으며, 도 9에 나타난 바와 같이 치료 6 주 후, PLGA-ABT 처리된 IVD 조직은 Inj, Veh 또는 PLGA 처리된 IVD 조직에 비해 더 나은 조직학적 점수를 나타냈다 (도 9e).
이는 곧, PLGA-ABT 치료가 IVDD 진행을 억제하고 손상된 IVD에서 노화 세포와 SASP를 제거함으로써 손상 유발 디스크 변성 후 IVD 구조를 복원 할 수 있음을 의미한다.

Claims (16)

  1. ABT263을 유효성분으로 포함하는 디스크 질환 예방 및 치료용 약학적 조성물.
  2. 청구항 2에 있어서, 상기 조성물은 생체적합성 고분자를 추가적인 유효성분으로 포함하는 디스크 질환 예방 및 치료용 약학적 조성물.
  3. 청구항 2에 있어서, 상기 생체적합성 고분자는 폴리에틸렌글리콜, 폴리프로필렌 글리콜, 에틸렌 글리콜-프로필렌 글리콜 공중합체, 폴리옥시에틸화폴리올, 다당류, 덱스트란, 폴리비닐에틸에테르, PLA(polylactic acid), 폴리비닐 알코올(PVA), 폴리(p-크실릴렌) 고분자, 폴리(ε-카프로락톤)(PCL), 폴리(발레로락톤)(PVL), 폴리(ε-데카락톤)(PDL), 폴리(1,4-디옥산-2,3-디온), 폴리(1,3-디옥산-2-온), 폴리(파라-디옥산온)(PDS), 폴리(하이드록시부티르산)(PHB), 폴리(하이드록시발레산)(PHV), 에틸렌 비닐 아세테이트 및 폴리(세테말산)(PMLA), PGA(glycolic acid) 및 PLGA(polylactic-glycolic acid)로 이루어진 군에서 선택된 1 이상인 것인 디스크 질환 예방 및 치료용 약학적 조성물.
  4. 청구항 2에 있어서, 상기 ABT263과 생체적합성 고분자의 결합체는 용매증발법(solvent evaporation method), 분무건조법(spray drying method), 용매추출법(solvent extraction method) 또는 미세유체법(microfluidic method)으로 제조된 것인 디스크 질환 예방 및 치료용 약학적 조성물.
  5. 청구항 4에 있어서, 상기 결합체의 직경은 200 nm 내지 2 μm 인 것인 디스크 질환 예방 및 치료용 약학적 조성물.
  6. 청구항 4에 있어서, 상기 결합체의 약물 포집 효율은 40 내지 70%인 것인 디스크 질환 예방 및 치료용 약학적 조성물.
  7. 청구항 4에 있어서, 상기 생체적합성 고분자와 ABT263의 혼합 중량비는 7 내지 1: 5 내지 1인 것인 디스크 질환 예방 및 치료용 약학적 조성물.
  8. 청구항 1에 있어서, 상기 디스크 질환은 추간판 탈출증, 요통, 감염, 척색종인 것인 디스크 질환 예방 및 치료용 약학적 조성물.
  9. 청구항 1에 있어서, 상기 조성물은 Mmp13, Adamts4, Cox2, iNos 및 Ngf의 발현을 감소시키는 것인 디스크 질환 예방 및 치료용 약학적 조성물.
  10. 청구항 1에 있어서, 상기 약학적 조성물은 디스크 내의 노화세포를 제거하는 효과가 있는 것인 디스크 질환 예방 및 치료용 약학적 조성물.
  11. 청구항 4에 있어서, 상기 ABT263 과 생체적합성 고분자의 결합체는 ABT263을 서방형으로 방출하기 위한 것인 디스크 질환 예방 및 치료용 약학적 조성물.
  12. 청구항 4에 있어서, 상기 ABT263 과 생체적합성 고분자의 결합체는 디스크에 직접 ABT263을 방출시키는 것인 디스크 질환 예방 및 치료용 약학적 조성물.
  13. ABT263을 유효성분으로 포함하는 디스크 질환 예방 및 개선용 건강기능식품 조성물.
  14. 청구항 1의 약학적 조성물을 개체에 투여하는 단계를 포함하는 디스크 질환을 예방 또는 치료하는 방법.
  15. 디스크 질환의 예방 또는 치료용 의약의 제조에 사용하기 위한 청구항 1의 조성물의 용도.
  16. 디스크 질환 예방 또는 치료에 사용하기 위한 ABT263의 용도.
PCT/KR2021/015130 2020-10-28 2021-10-26 Abt263을 유효성분으로 포함하는 디스크 질환 예방 또는 치료용 조성물 WO2022092775A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200141574A KR20220056730A (ko) 2020-10-28 2020-10-28 Abt263을 유효성분으로 포함하는 디스크 질환 예방 및 치료용 조성물
KR10-2020-0141574 2020-10-28

Publications (1)

Publication Number Publication Date
WO2022092775A1 true WO2022092775A1 (ko) 2022-05-05

Family

ID=81382789

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2021/015130 WO2022092775A1 (ko) 2020-10-28 2021-10-26 Abt263을 유효성분으로 포함하는 디스크 질환 예방 또는 치료용 조성물

Country Status (2)

Country Link
KR (2) KR20220056730A (ko)
WO (1) WO2022092775A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160117519A (ko) * 2014-01-28 2016-10-10 버크 인스티튜트 포 리서치 온 에이징 노화 세포를 사멸시키고 노화 관련 질환 및 장애를 치료하기 위한 방법 및 조성물
KR20190125432A (ko) * 2017-03-10 2019-11-06 칼리테라 바이오사이언시즈, 인코포레이티드 글루타미나제 억제제를 사용하는 병용 요법
US20200041492A1 (en) * 2017-03-09 2020-02-06 Rijksuniversiteit Groningen Biomarkers for cellular senescence
EP3705109A1 (en) * 2019-03-05 2020-09-09 Greenaltech, S.L. Carotenoids in the treatment of senescence-related diseases

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160117519A (ko) * 2014-01-28 2016-10-10 버크 인스티튜트 포 리서치 온 에이징 노화 세포를 사멸시키고 노화 관련 질환 및 장애를 치료하기 위한 방법 및 조성물
US20200041492A1 (en) * 2017-03-09 2020-02-06 Rijksuniversiteit Groningen Biomarkers for cellular senescence
KR20190125432A (ko) * 2017-03-10 2019-11-06 칼리테라 바이오사이언시즈, 인코포레이티드 글루타미나제 억제제를 사용하는 병용 요법
EP3705109A1 (en) * 2019-03-05 2020-09-09 Greenaltech, S.L. Carotenoids in the treatment of senescence-related diseases

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LIM SONG-HYEON, KIM BYUNG-SOO : "2PS-173 Controlled delivery of senolytic drug inhibits disc degeneration and restores disc structure", KOREAN POLYMER ASSOCIATION SPRING CONFERENCE 2021 RESEARCH PAPERS, VOLUME 46, NO. 1, KOREAN POLYMER ASSOCIATION, KOREA, 1 April 2021 (2021-04-01) - 9 April 2021 (2021-04-09), Korea, pages 95 - 95, XP055926557 *
SCHMID D, JARVIS G E, FAY F, SMALL D M, GREENE M K, MAJKUT J, SPENCE S, MCLAUGHLIN K M, MCCLOSKEY K D, JOHNSTON P G, KISSENPFENNIG: "Nanoencapsulation of ABT-737 and camptothecin enhances their clinical potential through synergistic antitumor effects and reduction of systemic toxicity", CELL DEATH & DISEASE, NATURE PUBLISHING GROUP, GB, vol. 5, no. 10, 1 October 2014 (2014-10-01), GB , pages e1454 - e1454, XP055926552, ISSN: 2041-4889, DOI: 10.1038/cddis.2014.413 *

Also Published As

Publication number Publication date
KR20240046147A (ko) 2024-04-08
KR20220056730A (ko) 2022-05-06

Similar Documents

Publication Publication Date Title
Zhou et al. Vascular endothelial cell-derived exosomes protect neural stem cells against ischemia/reperfusion injury
Zhou et al. Activating adiponectin signaling with exogenous AdipoRon reduces myelin lipid accumulation and suppresses macrophage recruitment after spinal cord injury
Li et al. Agnuside alleviates synovitis and fibrosis in knee osteoarthritis through the inhibition of HIF-1α and NLRP3 inflammasome
WO2021230487A1 (ko) 양막상피세포 유래 엑소좀을 유효성분으로 함유하는 안구질환 예방 또는 치료용 조성물
WO2021223346A1 (zh) 山药蛋白提取物在制备治疗勃起功能障碍的药物中的应用
WO2022092775A1 (ko) Abt263을 유효성분으로 포함하는 디스크 질환 예방 또는 치료용 조성물
WO2019031729A2 (ko) 줄기세포 유래의 엑소좀을 유효성분으로 포함하는 조성물의 비알콜성 단순 지방간 또는 비알콜성 지방간염의 개선 용도
Li et al. Hydroxycamptothecin induces apoptosis of fibroblasts and prevents intraarticular scar adhesion in rabbits by activating the IRE-1 signal pathway
WO2015160181A1 (ko) 황칠 추출물을 포함하는 혈관 평활근세포 이상 증식 및 이동성 질환 또는 혈관 내막증식 질환의 예방 또는 치료용 조성물
KR20230028992A (ko) 편도 중간엽 줄기세포 유래 엑소좀을 포함하는 근육 감소 관련 질환 치료용 조성물
WO2021033995A1 (ko) 초과 추출물을 함유하는 근육 감소 관련 질병의 예방, 개선, 또는 치료용 조성물
WO2021066425A1 (ko) 생강 유래 세포외 소포체 및 이의 용도
US20220339230A1 (en) Composition comprising bilberry extract as active ingredient for preventing or treating sensorineural hearing impairment
CN114010631A (zh) 含笑内酯及其衍生物在创伤性颅脑损伤治疗中的应用
Xu et al. Congrong Shujing Granule-Induced GRP78 Expression Reduced Endoplasmic Reticulum Stress and Neuronal Apoptosis in the Midbrain in a Parkinson’s Disease Rat Model
El-Ghawet et al. Cinnamon and ginger combined extract improved diabetic induced developmental defects of inner ear and teeth of rat fetuses
Bayar et al. Effects of anti-NGF on apoptosis in rats with experimentally induced sepsis model
Fu et al. Establishment of a miR-31 transgenic mouse and its expression in tissues and organs
WO2023204640A1 (ko) 헬리코박터 파일로리에 의한 위 점막 손상 관련 질환의 예방 또는 치료용 약학적 조성물 및 헬리코박터 파일로리 감염의 예방 또는 치료용 유효성분의 스크리닝 플랫폼
KR102210501B1 (ko) 근육질환 예방 또는 치료용 조성물
KR101581508B1 (ko) 코엔자임 ｑ１０을 유효성분으로 포함하는 염증성 질환 또는 면역거부질환의 예방 또는 치료용 조성물
WO2024090922A1 (ko) 줄기세포 배양액 및 상기로부터 분리된 세포외소포를 유효성분으로 포함하는 뇌신경계 질환의 예방 또는 치료용 약학적 조성물
Ma et al. Conditioned medium of epidermal neural crest stem cells improved functional recovery and tissue repairing after spinal cord injury by suppressing neuronal apoptosis through the PI3K/AKT signaling pathway
TWI681774B (zh) 一種縞瓣屬二甲亞碸萃取物或級分之新穎用途
Huang et al. The Reactive Astrocytes After Surgical Brain Injury Potentiates the Migration, Invasion, and Angiogenesis of C6 Glioma

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21886769

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 21886769

Country of ref document: EP

Kind code of ref document: A1