WO2022076693A1 - Engineered probiotics for expression of fiber-synthesizing enzymes in gut - Google Patents

Engineered probiotics for expression of fiber-synthesizing enzymes in gut Download PDF

Info

Publication number
WO2022076693A1
WO2022076693A1 PCT/US2021/053983 US2021053983W WO2022076693A1 WO 2022076693 A1 WO2022076693 A1 WO 2022076693A1 US 2021053983 W US2021053983 W US 2021053983W WO 2022076693 A1 WO2022076693 A1 WO 2022076693A1
Authority
WO
WIPO (PCT)
Prior art keywords
fiber
synthase
subject
carbohydrate
synthesizing enzyme
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2021/053983
Other languages
English (en)
French (fr)
Inventor
Zachary D. ABBOTT
John William Kidder OLIVER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zbiotics Co
Original Assignee
Zbiotics Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zbiotics Co filed Critical Zbiotics Co
Priority to JP2023521480A priority Critical patent/JP2023546022A/ja
Priority to GB2306208.6A priority patent/GB2616358A/en
Priority to KR1020237012697A priority patent/KR20230088715A/ko
Priority to MX2023003972A priority patent/MX2023003972A/es
Priority to US18/030,658 priority patent/US20230372453A1/en
Priority to AU2021358080A priority patent/AU2021358080A1/en
Priority to CA3194677A priority patent/CA3194677A1/en
Priority to EP21878541.8A priority patent/EP4225338A4/en
Priority to CN202180069035.9A priority patent/CN116528880A/zh
Publication of WO2022076693A1 publication Critical patent/WO2022076693A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/45Transferases (2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • A61K35/741Probiotics
    • A61K35/742Spore-forming bacteria, e.g. Bacillus coagulans, Bacillus subtilis, clostridium or Lactobacillus sporogenes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • A61K35/741Probiotics
    • A61K35/744Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • A61K35/741Probiotics
    • A61K35/744Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • A61K35/745Bifidobacteria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • A61K35/741Probiotics
    • A61K35/744Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • A61K35/747Lactobacilli, e.g. L. acidophilus or L. brevis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • A61K38/47Hydrolases (3) acting on glycosyl compounds (3.2), e.g. cellulases, lactases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1048Glycosyltransferases (2.4)
    • C12N9/1051Hexosyltransferases (2.4.1)
    • C12N9/1055Levansucrase (2.4.1.10)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90Isomerases (5.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y204/00Glycosyltransferases (2.4)
    • C12Y204/01Hexosyltransferases (2.4.1)
    • C12Y204/0101Levansucrase (2.4.1.10)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y504/00Intramolecular transferases (5.4)
    • C12Y504/99Intramolecular transferases (5.4) transferring other groups (5.4.99)
    • C12Y504/99011Isomaltulose synthase (5.4.99.11)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/10Plasmid DNA
    • C12N2800/101Plasmid DNA for bacteria
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/01Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/07Bacillus
    • C12R2001/125Bacillus subtilis ; Hay bacillus; Grass bacillus

Definitions

  • the microbiome is a complex collection of microbes that together impact many aspects of organismal health and function.
  • the microbiome can impact immunity, metabolism, and a variety of diseases.
  • Microbes of the microbiome interact with host organisms through a variety of mechanisms, including microbial signaling, metabolite consumption, and small molecule production. Accordingly, the types and proportions of microbes and metabolites in the microbiome can have important impacts on health.
  • compositions that modify the microbiome can have important impacts on human health.
  • the present disclosure provides solutions to various challenges in health and/or microbiome engineering.
  • one challenge in human health is that many individuals consume daily diets that include carbohydrate such as monosaccharides and/or disaccharides, e.g., in excess of individual metabolic need. These consumed monosaccharides and/or disaccharides can have deleterious health effects in the gut (e.g., on the microbiome) and/or after digestion.
  • many individuals consume daily diets that include too little fiber.
  • the present disclosure provides, among other things, bacteria engineered for expression of a fiber-synthesizing enzyme, e.g., for expression of the enzyme in the gut (e.g., in intestine, e.g., in the small intestine and/or large intestine).
  • the present disclosure provides bacteria engineered for expression of a fiber-synthesizing enzyme that consumes carbohydrate in the process of synthesizing fiber, e.g., in the gut.
  • gut include at least one or both of the small intestine and/or large intestine, as do references to intestine herein.
  • the present disclosure further provides, among other things, formulations for oral delivery of fiber-synthesizing enzymes, e.g., for delivery of fiber-synthesizing enzyme to gut (e.g., to intestine, e.g., to small intestine and/or large intestine).
  • the present disclosure provides a pill or sachet including isolated fiber-synthesizing enzyme.
  • the present disclosure provides a method of decreasing the amount or concentration of a carbohydrate in the gut of a subject comprising administering to the subject a bacterium engineered to express a heterologous nucleic acid sequence encoding a fiber-synthesizing enzyme, wherein the fiber-synthesizing enzyme synthesizes fiber from a carbohydrate substrate.
  • the present disclosure provides a method of increasing the amount or concentration of a fiber in the gut of a subject comprising administering to the subject a bacterium engineered to express a heterologous nucleic acid sequence encoding a fibersynthesizing enzyme, wherein the fiber-synthesizing enzyme synthesizes fiber from a carbohydrate substrate.
  • the present disclosure provides a method of treating a subject in need of decreased amount or concentration of a carbohydrate in the gut or increased amount or concentration of a fiber in the gut comprising administering to the subject a bacterium engineered to express a heterologous nucleic acid sequence encoding a fiber-synthesizing enzyme, wherein the fiber-synthesizing enzyme synthesizes fiber from a carbohydrate substrate.
  • the subject is suffering from a condition positively correlated or associated with consumption of carbohydrate.
  • the subject is suffering from a condition negatively correlated or associated with consumption of fiber.
  • the subject is suffering from a condition selected from cardiovascular disease, heart disease, high blood pressure, high blood cholesterol, high blood glucose, diabetes, obesity, dysbiosis of the gut, inflammatory bowel disease, irritable bowel syndrome (IBS), diverticulitis, colorectal cancer, intestinal cancer, bloating, cramping, gas, hemorrhoids, and diarrhea.
  • a condition selected from cardiovascular disease, heart disease, high blood pressure, high blood cholesterol, high blood glucose, diabetes, obesity, dysbiosis of the gut, inflammatory bowel disease, irritable bowel syndrome (IBS), diverticulitis, colorectal cancer, intestinal cancer, bloating, cramping, gas, hemorrhoids, and diarrhea.
  • a condition selected from cardiovascular disease, heart disease, high blood pressure, high blood cholesterol, high blood glucose, diabetes, obesity, dysbiosis of the gut, inflammatory bowel disease, irritable bowel syndrome (IBS), diverticulitis, colorectal cancer, intestinal cancer, bloating, cramping, gas, hemorrhoids
  • the fiber is a soluble fiber.
  • the synthesized fiber comprises glucose, fructose, galacturonic acid, N-acetyl-D-glucosamine, and/or galactose monomers.
  • the carbohydrate substrate is selected from one or more of UDP-glucose, UDP -galactose, UDP-fucose, ADP-a-D-glucose, UDP -galacturonic acid, UDP-N-acetyl-alpha-D-glucosamine, galactinol, lactose, glucose, and sucrose and/or wherein the carbohydrate decreased in amount or concentration in the gut is selected from one or more of glucose, galactose, sucrose, fructose, and/or lactose.
  • the synthesized fiber is a fructooligosaccharide and/or is selected from laminaribiose, callose, curdlan, oat betaglucan, laminarin, pleuran, lentinan, yeast beta glucan, trehalulose, trehalose, inulin, kestose, nystose, levan, raffinose, stachyose, verbascose, globotriose, human milk oligosaccharides (HMOs), cellobiose, cellulose, microcellulose, cotton, maltose, amylose, starch, glycogen, amylopectin, pectin, chitin.
  • HMOs human milk oligosaccharides
  • the fiber-synthesizing enzyme is selected from a sucrase, an inulosucrase, a levansucrase, a 1,3 -beta-glucan synthase, a l,3;l,4-beta-D- glucan synthase, a 1,6-beta-glucan synthase, a sucrose isomerase, a 1,6-alpha- galactosyltransferase, a trehalulose synthase, a trehalose-6-phosphate synthase, an a-1,4- galactosyltransferase, an alpha- 1,2-fucosyltransferase, a beta-galactosidase, a b-D-Galactosidase, a cellulose synthase, a maltose synthase, a starch synthase, a starch-bran
  • the bacterium is a spore-forming bacterium and/or is in a spore form.
  • the bacterium is a probiotic bacterium.
  • the bacterium is of a genus selected from Bacillus, Bifidobacterium, Enterococcus, Escherichia, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and Streptococcus, optionally wherein the bacterium is of the genus Bacillus, optionally wherein the bacterium is of the species B. subtilis.
  • the bacterium is of a strain characterized in that it does not colonize the gut.
  • the method comprises administering the engineered bacterium to a subject that has consumed carbohydrate and/or the carbohydrate substrate within a preceding period, wherein the preceding period is a period of 24 hours 12 hours, 6 hours, 3 hours, or 1 hour.
  • the method comprises administering the engineered bacterium to a subject that has not consumed carbohydrate and/or the carbohydrate substrate.
  • the method comprises administering the engineered bacterium to a subject that has not consumed carbohydrate and/or the carbohydrate substrate within a preceding period, wherein the preceding period is a period of 24 hours 12 hours, 6 hours, 3 hours, or 1 hour.
  • the subject consumes carbohydrate and/or the carbohydrate substrate during a period subsequent to administration of the engineered bacterium, wherein the subsequent period is a period of 24 hours 12 hours, 6 hours, 3 hours, or 1 hour.
  • the method prevents accumulation of sugar in the colon of the subject.
  • fiber-synthesizing enzymes and/or enzymes encoded by heterologous nucleic acid sequences comprised by the engineered bacterium consist of the fibersynthesizing enzyme.
  • the administration comprises oral administration of a composition comprising the engineered bacterium. In various embodiments, the administration comprises administration of about 10 4 to about 10 12 colony forming units of the engineered bacterium.
  • the nucleic acid sequence encoding the expression product is operatively linked with a constitutive promoter.
  • the nucleic acid sequence encoding the expression product is operatively linked with a flagellin gene promoter.
  • the flagellin gene promoter comprises a mutation in a CsrA binding site, wherein the mutation in the CsrA binding site inhibits binding of CsrA to mRNA transcripts encoding the fiber-synthesizing enzyme but does not preclude expression of the fibersynthesizing enzyme.
  • the engineered bacterium comprises a mutation of an endogenous flgM gene that reduces inhibition of a sigma factor by FlgM.
  • the flagellin gene promoter is a B. subtilis hag promoter.
  • the mutation in the CsrA binding site is a mutation in a B. subtilis hag promoter CsrA binding site selected from binding site 1 (BS1) and binding site 2 (BS2).
  • the mutation in the CsrA binding site is a mutation in the stem of the stem-loop secondary structure of BS1 or in the stem of the stem-loop secondary structure of BS2.
  • the mutation in the CsrA binding site is a mutation in the CsrA BS1 recognition sequence having the sequence AGGA.
  • the mutation in the CsrA binding site is a BS1 mutation according to SEQ ID NO: 29 or a BS2 mutation according to SEQ ID NO: 30. In various embodiments, the mutation in the CsrA binding site does not disrupt the Shine-Dalgamo sequence of the B. subtilis hag promoter. In various embodiments, the mutation of the endogenous flgM gene comprises deletion of all or a portion of the flgM gene. In various embodiments, the mutation of the endogenous flgM gene comprises a mutation in the sequence encoding the active site of flgM.
  • the mutation of the endogenous flgM gene comprises a mutation in the sequence encoding an amino acid that participates in binding of FlgM to SigD.
  • the mutation of the endogenous flgM gene alters a sequence that encodes an amino acid in the 3 rd helix or 4 th helix of FlgM at the C-terminal end of the FlgM protein.
  • the bacterium is of the species B. subtilis .and the mutation of the endogenous flgM gene alters the amino acid sequence encoded by SEQ ID NO: 31 at an amino acid selected from 1-58, K-62, 1-65, G-68, D-73, and A-78.
  • the bacterium is of the species B. subtilis. and the mutation of the endogenous flgM gene alters the amino acid sequence encoded by SEQ ID NO: 31 at an amino acid selected from 1-3, G-7, S-10, V-l l, A-40, K-41, M43, 1-58, L-61, K-62, 1-65, Y-70, K-71, V-72, D-73, A-74, H-76, 1-77, A-78, N-80, M-81, 1-82, N-83, F-84, Y-85, and K-86.
  • the mutation of the endogenous flgM gene reduces or eliminates FlgM biological activity.
  • the sigma factor is SigD.
  • the present disclosure provides a bacterium engineered to express a heterologous nucleic acid sequence encoding a fiber-synthesizing enzyme, wherein the fiber-synthesizing enzyme synthesizes fiber from a carbohydrate substrate.
  • the fiber is a soluble fiber.
  • the synthesized fiber comprises glucose, fructose, galacturonic acid, N-acetyl-D-glucosamine, and/or galactose monomers.
  • the carbohydrate substrate is selected from one or more of UDP-glucose, UDP-galactose, UDP-fucose, ADP-a-D-glucose, UDP-galacturonic acid, UDP-N- acetyl-alpha-D-glucosamine, galactinol, lactose, glucose, and sucrose and/or wherein the carbohydrate decreased in amount or concentration in the gut is selected from one or more of glucose, galactose, sucrose, fructose, and/or lactose.
  • the synthesized fiber is a fructooligosaccharide and/or is selected from laminaribiose, callose, curdlan, oat betaglucan, laminarin, pleuran, lentinan, yeast beta glucan, trehalulose, trehalose, inulin, kestose, nystose, levan, raffinose, stachyose, verbascose, globotriose, human milk oligosaccharides (HMOs), cellobiose, cellulose, microcellulose, cotton, maltose, amylose, starch, glycogen, amylopectin, pectin, chitin.
  • HMOs human milk oligosaccharides
  • the fiber-synthesizing enzyme is selected from a sucrase, an inulosucrase, a levansucrase, a 1,3 -beta-glucan synthase, a l,3;l,4-beta-D- glucan synthase, a 1,6-beta-glucan synthase, a sucrose isomerase, a 1,6-alpha- galactosyltransferase, a trehalulose synthase, a trehalose-6-phosphate synthase, an a-1,4- galactosyltransferase, an alpha- 1,2-fucosyltransferase, a beta-galactosidase, a b-D-Galactosidase, a cellulose synthase, a maltose synthase, a starch synthase, a starch-bran
  • the fiber-synthesizing enzyme is operatively linked with a secretion polypeptide.
  • the bacterium is a spore-forming bacterium and/or is in a spore form.
  • the bacterium is a probiotic bacterium.
  • the bacterium is of a genus selected from Bacillus, Bifidobacterium, Enterococcus, Escherichia, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and Streptococcus, optionally wherein the bacterium is of the genus Bacillus, optionally wherein the bacterium is of the species B. subtilis.
  • the bacterium is of a strain characterized in that it does not colonize the gut.
  • fiber-synthesizing enzymes and/or enzymes encoded by heterologous nucleic acid sequences comprised by the engineered bacterium consist of the fiber-synthesizing enzyme.
  • the nucleic acid sequence encoding the expression product is operatively linked with a constitutive promoter.
  • the nucleic acid sequence encoding the expression product is operatively linked with a flagellin gene promoter.
  • the flagellin gene promoter comprises a mutation in a CsrA binding site, wherein the mutation in the CsrA binding site inhibits binding of CsrA to mRNA transcripts encoding the fiber-synthesizing enzyme but does not preclude expression of the fibersynthesizing enzyme.
  • the engineered bacterium comprises a mutation of an endogenous lgM gene that reduces inhibition of a sigma factor by FlgM.
  • the flagellin gene promoter is a B. subtilis hag promoter.
  • the mutation in the CsrA binding site is a mutation in a B. subtilis hag promoter CsrA binding site selected from binding site 1 (BS1) and binding site 2 (BS2).
  • the mutation in the CsrA binding site is a mutation in the stem of the stem-loop secondary structure of BS1 or in the stem of the stem-loop secondary structure of BS2.
  • the mutation in the CsrA binding site is a mutation in the CsrA BS1 recognition sequence having the sequence AGGA.
  • the mutation in the CsrA binding site is a BS1 mutation according to SEQ ID NO: 29 or a BS2 mutation according to SEQ ID NO: 30. In various embodiments, the mutation in the CsrA binding site does not disrupt the Shine-Dalgamo sequence of the B. subtilis hag promoter. In various embodiments, the mutation of the endogenous flgM gene comprises deletion of all or a portion of the flgM gene. In various embodiments, the mutation of the endogenous flgM gene comprises a mutation in the sequence encoding the active site of flgM.
  • the mutation of the endogenous flgM gene comprises a mutation in the sequence encoding an amino acid that participates in binding of FlgM to SigD.
  • the mutation of the endogenous flgM gene alters a sequence that encodes an amino acid in the 3 rd helix or 4 th helix of FlgM at the C-terminal end of the FlgM protein.
  • the bacterium is of the species B. subtilis .and the mutation of the endogenous flgM gene alters the amino acid sequence encoded by SEQ ID NO: 31 at an amino acid selected from 1-58, K-62, 1-65, G-68, D-73, and A-78 .
  • the bacterium is of the species B. subtilis. and the mutation of the endogenous flgM gene alters the amino acid sequence encoded by SEQ ID NO: 31 at an amino acid selected from 1-3, G-7, S-10, V-l l, A-40, K-41, M43, 1-58, L-61, K-62, 1-65, Y-70, K-71, V-72, D-73, A-74, H-76, 1-77, A-78, N-80, M-81, 1-82, N-83, F-84, Y-85, and K-86.
  • the mutation of the endogenous flgM gene reduces or eliminates FlgM biological activity.
  • the sigma factor is SigD.
  • the present disclosure provides a composition comprising the engineered bacterium of the present disclosure.
  • the composition is formulated for oral administration.
  • the formulation comprises about 10 4 to about 10 12 colony forming units of the engineered bacterium.
  • the composition comprises a physiologically acceptable carrier.
  • the physiologically acceptable carrier is selected from a lactic acid fermented food, fermented dairy product, resistant starch, dietary fiber, carbohydrate, protein, glycosylated protein, water, capsule filler, and gummy material.
  • the present disclosure provides a bacterial cell culture comprising the engineered bacterium of the present disclosure.
  • the present disclosure provides a method of decreasing the amount or concentration of a carbohydrate in the gut of a subject comprising administering to the subject a composition comprising a fiber-synthesizing enzyme, wherein the fibersynthesizing enzyme synthesizes fiber from a carbohydrate substrate.
  • the fiber synthesizing enzyme is an isolated fiber-synthesizing enzyme.
  • the present disclosure provides a method of increasing the amount or concentration of a fiber in the gut of a subject comprising administering to the subject a composition comprising a fiber-synthesizing enzyme, wherein the fiber-synthesizing enzyme synthesizes fiber from a carbohydrate substrate.
  • the fiber synthesizing enzyme is an isolated fiber-synthesizing enzyme.
  • the present disclosure provides a method of treating a subject in need of decreased amount or concentration of a carbohydrate in the gut or increased amount or concentration of a fiber in the gut comprising administering to the subject a composition comprising a fiber-synthesizing enzyme, wherein the fiber-synthesizing enzyme synthesizes fiber from a carbohydrate substrate.
  • the fiber synthesizing enzyme is an isolated fiber-synthesizing enzyme.
  • the subject is suffering from a condition positively correlated or associated with consumption of carbohydrate.
  • the subject is suffering from a condition negatively correlated or associated with consumption of fiber.
  • the subject is suffering from a condition selected from cardiovascular disease, heart disease, high blood pressure, high blood cholesterol, high blood glucose, diabetes, obesity, dysbiosis of the gut, inflammatory bowel disease, irritable bowel syndrome (IBS), diverticulitis, colorectal cancer, intestinal cancer, bloating, cramping, gas, hemorrhoids, and diarrhea.
  • the fiber is a soluble fiber.
  • the synthesized fiber comprises glucose, fructose, galacturonic acid, N-acetyl-D-glucosamine, and/or galactose monomers.
  • the carbohydrate substrate is selected from one or more of UDP-glucose, UDP -galactose, UDP-fucose, ADP-a-D-glucose, UDP -galacturonic acid, UDP-N-acetyl-alpha-D-glucosamine, galactinol, lactose, glucose, and sucrose and/or wherein the carbohydrate decreased in amount or concentration in the gut is selected from one or more of glucose, galactose, sucrose, fructose, and/or lactose.
  • the synthesized fiber is a fructooligosaccharide and/or is selected from laminaribiose, callose, curdlan, oat betaglucan, laminarin, pleuran, lentinan, yeast beta glucan, trehalulose, trehalose, inulin, kestose, nystose, levan, raffinose, stachyose, verbascose, globotriose, human milk oligosaccharides (HMOs), cellobiose, cellulose, microcellulose, cotton, maltose, amylose, starch, glycogen, amylopectin, pectin, chitin.
  • HMOs human milk oligosaccharides
  • the fiber-synthesizing enzyme is selected from a sucrase, an inulosucrase, a levansucrase, a 1,3 -beta-glucan synthase, a l,3;l,4-beta-D- glucan synthase, a 1,6-beta-glucan synthase, a sucrose isomerase, a 1,6-alpha- galactosyltransferase, a trehalulose synthase, a trehalose-6-phosphate synthase, an a-1,4- galactosyltransferase, an alpha- 1,2-fucosyltransferase, a beta-galactosidase, a b-D-Galactosidase, a cellulose synthase, a maltose synthase, a starch synthase, a starch-bran
  • the method comprises administering the composition to a subject that has consumed carbohydrate and/or the carbohydrate substrate within a preceding period, wherein the preceding period is a period of 24 hours 12 hours, 6 hours, 3 hours, or 1 hour. In various embodiments, the method comprises administering the composition to a subject that has not consumed carbohydrate and/or the carbohydrate substrate. In various embodiments, the method comprises administering the composition to a subject that has not consumed carbohydrate and/or the carbohydrate substrate within a preceding period, wherein the preceding period is a period of 24 hours 12 hours, 6 hours, 3 hours, or 1 hour.
  • the subject consumes carbohydrate and/or the carbohydrate substrate during a period subsequent to administration of the composition , wherein the subsequent period is a period of 24 hours 12 hours, 6 hours, 3 hours, or 1 hour.
  • the method prevents accumulation of sugar in the colon of the subject.
  • fiber-synthesizing enzymes comprising the composition and/or enzymes comprising the composition consist of the fiber-synthesizing enzyme.
  • the administration comprises oral administration of the composition.
  • the present disclosure provides a composition comprising a fiber synthesizing enzyme, where the fiber-synthesizing enzyme synthesizes fiber from a carbohydrate substrate and the composition is formulated for oral administration.
  • the fiber is a soluble fiber.
  • the synthesized fiber comprises glucose, fructose, galacturonic acid, N-acetyl-D-glucosamine, and/or galactose monomers.
  • the carbohydrate substrate is selected from one or more of UDP-glucose, UDP-galactose, UDP-fucose, ADP-a-D-glucose, UDP-galacturonic acid, UDP-N- acetyl-alpha-D-glucosamine, galactinol, lactose, glucose, and sucrose and/or wherein the carbohydrate decreased in amount or concentration in the gut is selected from one or more of glucose, galactose, sucrose, fructose, and/or lactose.
  • the synthesized fiber is a fructooligosaccharide and/or is selected from laminaribiose, callose, curdlan, oat betaglucan, laminarin, pleuran, lentinan, yeast beta glucan, trehalulose, trehalose, inulin, kestose, nystose, levan, raffinose, stachyose, verbascose, globotriose, human milk oligosaccharides (HMOs), cellobiose, cellulose, microcellulose, cotton, maltose, amylose, starch, glycogen, amylopectin, pectin, chitin.
  • HMOs human milk oligosaccharides
  • the fiber-synthesizing enzyme is selected from a sucrase, an inulosucrase, a levansucrase, a 1,3 -beta-glucan synthase, a l,3;l,4-beta-D- glucan synthase, a 1,6-beta-glucan synthase, a sucrose isomerase, a 1,6-alpha- galactosyltransferase, a trehalulose synthase, a trehalose-6-phosphate synthase, an a-1,4- galactosyltransferase, an alpha- 1,2-fucosyltransferase, a beta-galactosidase, a b-D-Galactosidase, a cellulose synthase, a maltose synthase, a starch synthase, a starch-bran
  • fiber-synthesizing enzymes comprising the composition and/or enzymes comprising the composition consist of the fiber-synthesizing enzyme.
  • the composition comprises a physiologically acceptable carrier.
  • the physiologically acceptable carrier is selected from a lactic acid fermented food, fermented dairy product, resistant starch, dietary fiber, carbohydrate, protein, glycosylated protein, water, capsule filler, and gummy material.
  • an element discloses embodiments of exactly one element and embodiments including more than one element.
  • Administration typically refers to administration of a composition to a subject or system to achieve delivery of an agent that is, or is included in, the composition.
  • Two events or entities are “associated” with one another, as that term is used herein, if the presence, level and/or form of one is correlated with that of the other.
  • a particular entity e.g., polypeptide, genetic signature, metabolite, microbe, etc.
  • two or more entities are physically “associated” with one another if they interact, directly or indirectly, so that they are and/or remain in physical proximity with one another.
  • two or more entities that are physically associated with one another are covalently linked to one another; in some embodiments, two or more entities that are physically associated with one another are not covalently linked to one another but are non-covalently associated, for example by means of hydrogen bonds, van der Waals interaction, hydrophobic interactions, magnetism, and combinations thereof.
  • the term “between” refers to content that falls between indicated upper and lower, or first and second, boundaries, inclusive of the boundaries.
  • Binding refers to a non-covalent association between or among two or more agents. “Direct” binding involves physical contact between agents; indirect binding involves physical interaction by way of physical contact with one or more intermediate agents. Binding between two or more agents can occur and/or be assessed in any of a variety of contexts, including where interacting agents are studied in isolation or in the context of more complex systems (e.g., while covalently or otherwise associated with a carrier agents and/or in a biological system or cell).
  • a first element e.g., a protein, such as a transcription factor, or a nucleic acid sequence, such as promoter
  • a second element e.g., a protein or a nucleic acid encoding an agent such as a protein
  • Control of expression or activity can be substantial control or activity, e.g., in that a change in status of the first element can, under at least one set of conditions, result in a change in expression or activity of the second element of at least 10% (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2- fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold) as compared to a reference control.
  • a change in status of the first element can, under at least one set of conditions, result in a change in expression or activity of the second element of at least 10% (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2- fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold) as compared to a reference control.
  • corresponding to may be used to designate the position/identity of a structural element in a compound or composition through comparison with an appropriate reference compound or composition.
  • a monomeric residue in a polymer e.g., an amino acid residue in a polypeptide or a nucleic acid residue in a polynucleotide
  • corresponding to a residue in an appropriate reference polymer.
  • residues in a provided polypeptide or polynucleotide sequence are often designated (e.g., numbered or labeled) according to the scheme of a related reference sequence (even if, e.g., such designation does not reflect literal numbering of the provided sequence).
  • a reference sequence includes a particular amino acid motif at positions 100-110
  • a second related sequence includes the same motif at positions 110-120
  • the motif positions of the second related sequence can be said to “correspond to” positions 100-110 of the reference sequence.
  • corresponding positions can be readily identified, e.g., by alignment of sequences, and that such alignment is commonly accomplished by any of a variety of known tools, strategies, and/or algorithms, including without limitation software programs such as, for example, BLAST, CS-BLAST, CUDASW++, DIAMOND, FASTA, GGSEARCH/GL SEARCH, Genoogle, HMMER, HHpred/HHsearch, IDF, Infernal, KLAST, USEARCH, parasail, PSI-BLAST, PSI-Search, ScalaBLAST, Sequilab, SAM, SSEARCH, SWAPHI, SWAPHI-LS, SWIMM, or SWIPE.
  • software programs such as, for example, BLAST, CS-BLAST, CUDASW++, DIAMOND, FASTA, GGSEARCH/GL SEARCH, Genoogle, HMMER, HHpred/HHsearch, IDF, Infernal, KLAST, USEARCH, parasail, PSI
  • Dosage form or unit dosage form may be used to refer to a physically discrete unit of an agent (e.g., a therapeutic or diagnostic agent) for administration to a subject.
  • agent e.g., a therapeutic or diagnostic agent
  • each such unit contains a predetermined quantity of agent.
  • such quantity is a unit dosage amount (or a whole fraction thereof) appropriate for administration in accordance with a dosing regimen that has been determined to correlate with a desired or beneficial outcome when administered to a relevant population (i.e., with a therapeutic dosing regimen).
  • the total or free amount of a therapeutic composition or agent administered to a particular subject is determined by one or more attending physicians and may involve administration of multiple dosage forms.
  • Dosing regimen can refer to a set of one or more same or different unit doses administered to a subject, typically including a plurality of unit doses administration of each of which is separated from administration of the others by a period of time.
  • one or more or all unit doses of a dosing regimen may be the same or can vary (e.g., increase over time, decrease over time, or be adjusted in accordance with the subject and/or with a medical practitioner’s determination).
  • one or more or all of the periods of time between each dose may be the same or can vary (e.g., increase over time, decrease over time, or be adjusted in accordance with the subject and/or with a medical practitioner’s determination).
  • a given therapeutic agent has a recommended dosing regimen, which can involve one or more doses.
  • at least one recommended dosing regimen of a marketed drug is known to those of skill in the art.
  • a dosing regimen is correlated with a desired or beneficial outcome when administered across a relevant population (i.e., is a therapeutic dosing regimen).
  • engineered refers to the aspect of having been manipulated by the hand of man.
  • a polynucleotide is considered to be “engineered” when two or more sequences, that are not linked together in that order in nature, are manipulated by the hand of man to be linked to one another in the engineered polynucleotide.
  • an “engineered” nucleic acid or amino acid sequence can be a recombinant nucleic acid or amino acid sequence.
  • an engineered polynucleotide includes a coding sequence and/or a regulatory sequence that is found in nature operably linked with a first sequence but is not found in nature operably linked with a second sequence, which is in the engineered polynucleotide and operably linked in with the second sequence by the hand of man.
  • a cell or organism is considered to be “engineered” if it has been manipulated so that its genetic information is altered (e.g., new genetic material not previously present has been introduced, for example by transformation, mating, somatic hybridization, transfection, transduction, or other mechanism, or previously present genetic material is altered or removed, for example by substitution, deletion, or mating).
  • progeny or copies, perfect or imperfect, of an engineered polynucleotide or cell are typically still referred to as “engineered” even though the direct manipulation was of a prior entity.
  • Excipient refers to a non-therapeutic agent that may be included in a pharmaceutical composition, for example to provide or contribute to a desired consistency or stabilizing effect.
  • suitable pharmaceutical excipients may include, for example, starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol, or the like.
  • Expression refers individually and/or cumulatively to one or more biological process that result in production from a nucleic acid sequence of an encoded agent, such as a polypeptide. Expression specifically includes either or both of transcription and translation.
  • fragment refers a structure that is or includes a discrete portion of a reference agent (sometimes referred to as the “parent” agent). In some embodiments, a fragment lacks one or more moieties found in the reference agent. In some embodiments, a fragment is or includes one or more moieties found in the reference agent. In some embodiments, the reference agent is a polymer such as a polynucleotide or polypeptide.
  • a fragment of a polymer is or includes at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more monomeric units (e.g., residues) of the reference polymer.
  • monomeric units e.g., residues
  • a fragment of a polymer is or includes at least about 5%, 10%, 15%, 20%, 25%, 30%, 25%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of the monomeric units (e.g., residues) found in the reference polymer.
  • a fragment of a reference polymer is not necessarily identical to a corresponding portion of the reference polymer.
  • a fragment of a reference polymer can be a polymer having a sequence of residues having at least about 5%, 10%, 15%, 20%, 25%, 30%, 25%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity to the reference polymer.
  • a fragment may, or may not, be generated by physical fragmentation of a reference agent. In some instances a fragment is generated by physical fragmentation of a reference agent. In some instances, a fragment is not generated by physical fragmentation of a reference agent and can be instead, for example, produced by de novo synthesis or other means.
  • the term “gene” refers to a DNA sequence that is or includes coding sequence (i.e., a DNA sequence that encodes an expression product, such as an RNA product and/or a polypeptide product), optionally together with some or all of regulatory sequences that control expression of the coding sequence.
  • a gene includes non-coding sequence such as, without limitation, introns.
  • a gene may include both coding (e.g., exonic) and non-coding (e.g., intronic) sequences.
  • a gene includes a regulatory sequence that is a promoter.
  • a gene includes one or both of a (i) DNA nucleotides extending a predetermined number of nucleotides upstream of the coding sequence in a reference context, such as a source genome, and (ii) DNA nucleotides extending a predetermined number of nucleotides downstream of the coding sequence in a reference context, such as a source genome.
  • the predetermined number of nucleotides can be 500 bp, 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 10 kb, 20 kb, 30 kb, 40 kb, 50 kb, 75 kb, or 100 kb.
  • a “transgene” refers to a gene that is not endogenous or native to a reference context in which the gene is present or into which the gene may be placed by engineering.
  • expression product generally refers to an RNA transcribed from the gene (pre-and/or postprocessing) or a polypeptide (pre- and/or post-modification) encoded by an RNA transcribed from the gene.
  • Heterologous As used herein, a first nucleic acid sequence is “heterologous” to a second nucleic acid sequence if the first nucleic acid sequence is not operatively linked with the second nucleic acid sequence in nature. By extension, a polypeptide is “heterologous” to an expression control sequence if it is encoded by nucleic acid sequence heterologous the promoter.
  • Identity refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules.
  • Calculation of the percent identity of two nucleic acid or polypeptide sequences can be performed by aligning the two sequences (or the complement of one or both sequences) for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes).
  • the nucleotides or amino acids at corresponding positions are then compared. When a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, then the molecules are identical at that position.
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, optionally taking into account the number of gaps, and the length of each gap, which may need to be introduced for optimal alignment of the two sequences.
  • the comparison of sequences and determination of percent identity between two sequences can be accomplished using a computational algorithm, such as BLAST (basic local alignment search tool).
  • Isolated can refer to a substance and/or entity that has been (a) separated from at least some of the components with which it was associated when initially produced (whether in nature and/or in an experimental setting), and/or (b) designed, produced, prepared, and/or manufactured by the hand of man. Isolated substances and/or entities may be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% of the other components with which they were initially associated.
  • isolated substances and/or entities are at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure.
  • a substance and/or entity is “pure” if it is substantially free of other components.
  • a substance and/or entity may still be considered “isolated” or “pure” after having been combined with certain other components such as, for example, one or more carriers or excipients (e.g., buffer, solvent, water, etc.); in such embodiments, percent isolation or purity of the substance and/or entity is calculated without including such carriers or excipients.
  • carriers or excipients e.g., buffer, solvent, water, etc.
  • a biological polymer such as a polypeptide or polynucleotide that occurs in nature can be referred to as“isolated” when, (a) by virtue of its origin or source of derivation is not associated with some or all of the components with which it was associated in its native state in nature; (b) it is substantially free of other polypeptides or nucleic acids of the same species from the species that produces it in nature; (c) is expressed by or is otherwise in association with components from a cell or other expression system that is not of the species that produces it in nature.
  • a polypeptide that is chemically synthesized or is synthesized in a cellular system different from that which produces it in nature is considered to be an ''isolated' polypeptide.
  • a polypeptide that has been subjected to one or more purification techniques may be considered to be an ''isolated' polypeptide to the extent that it has been separated from other components (a) with which it is associated in nature; and/or (b) with which it was associated when initially produced.
  • nucleic acid refers to any compound and/or substance that is or can be incorporated into an oligonucleotide chain.
  • a nucleic acid is a compound and/or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester linkage.
  • nucleic acid refers to an individual nucleic acid residue (e.g., a nucleotide and/or nucleoside), and in some embodiments refers to an polynucleotide chain including a plurality of individual nucleic acid residues.
  • a nucleic acid can be or include DNA, RNA, or a combinations thereof.
  • a nucleic acid can include natural nucleic acid residues, nucleic acid analogs, and/or synthetic residues.
  • a nucleic acid includes natural nucleotides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxy guanosine, and deoxycytidine).
  • a nucleic acid is or includes of one or more nucleotide analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3 -methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5- propynyl-uridine, C5 -propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7- deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 0(6)-methylguanine, 2- thiocytidine, methylated bases, intercalated bases, and
  • a nucleic acid has a nucleotide sequence that encodes a functional gene product such as an RNA or protein.
  • a nucleic acid includes one or more introns.
  • a nucleic acid includes one or more genes.
  • nucleic acids are prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), reproduction in a recombinant cell or system, and chemical synthesis.
  • a nucleic acid analog differs from a nucleic acid in that it does not utilize a phosphodiester backbone.
  • a nucleic acid can include one or more peptide nucleic acids, which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone.
  • a nucleic acid has one or more phosphorothioate and/or 5'-N-phosphoramidite linkages rather than phosphodiester bonds.
  • a nucleic acid includes one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) as compared with those in natural nucleic acids.
  • a nucleic acid is or includes at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues.
  • a nucleic acid is partly or wholly single stranded, or partly or wholly double stranded.
  • a nucleic acid has a sequence including at least one element that encodes, or is the complement of a sequence that encodes, a polypeptide.
  • a nucleic acid has enzymatic activity.
  • operably linked refers to the association of at least a first element and a second element such that the component elements are in a relationship permitting them to function in their intended manner.
  • a nucleic acid regulatory sequence is "operably linked" to a nucleic acid coding sequence if the regulatory sequence and coding sequence are associated in a manner that permits control of expression of the coding sequence by the regulatory sequence.
  • an "operably linked" regulatory sequence is directly or indirectly covalently associated with a coding sequence (e.g., in a single nucleic acid).
  • a regulatory sequence controls expression of a coding sequence in trans and inclusion of the regulatory sequence in the same nucleic acid as the coding sequence is not a requirement of operable linkage.
  • composition as disclosed herein, means that each component must be compatible with the other ingredients of the composition and not deleterious to the recipient thereof.
  • composition refers to a pharmaceutically-acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, that facilitates formulation of an agent (e.g., a pharmaceutical agent), modifies bioavailability of an agent, or facilitates transport of an agent from one organ or portion of a subject to another.
  • an agent e.g., a pharmaceutical agent
  • materials which can serve as pharmaceutically-acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline;
  • composition refers to a composition in which a therapeutic agent is formulated together with one or more pharmaceutically acceptable carriers.
  • Polypeptide refers to any polymeric chain of amino acids.
  • a polypeptide has an amino acid sequence that occurs in nature.
  • a polypeptide has an amino acid sequence that does not occur in nature.
  • a polypeptide has an amino acid sequence that is engineered in that it is designed and/or produced through action of the hand of man.
  • a polypeptide may be or include of natural amino acids, non-natural amino acids, or both.
  • a polypeptide may be or include only natural amino acids or only non-natural amino acids.
  • a polypeptide can include D-amino acids, L-amino acids, or both.
  • a polypeptide may include only L-amino acids.
  • a polypeptide may include one or more pendant groups or other modifications, e.g., one or more amino acid side chains, e.g., at the polypeptide’s N-terminus, at the polypeptide’s C-terminus, at non-terminal amino acids, or at any combination thereof.
  • such pendant groups or modifications may be selected from acetylation, amidation, lipidation, methylation, phosphorylation, glycosylation, glycation, sulfation, mannosylation, nitrosylation, acylation, palmitoylation, prenylation, pegylation, etc., including combinations thereof.
  • a polypeptide may be cyclic, and/or may include a cyclic portion.
  • polypeptide may be appended to a name of a reference polypeptide, activity, or structure to indicate a class of polypeptides that share a relevant activity or structure.
  • a member of a polypeptide class or family shows significant sequence homology or identity with, shares a common sequence motif (e.g., a characteristic sequence element) with, and/or shares a common activity (in some embodiments at a comparable level or within a designated range) with a reference polypeptide of the class.
  • a member polypeptide shows an overall degree of sequence homology or identity with a reference polypeptide that is at least about 30-40%, and is often greater than about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more and/or includes at least one region (e.g., a conserved region that can in some embodiments be or include a characteristic sequence element) that shows very high sequence identity, often greater than 90% or even 95%, 96%, 97%, 98%, or 99%.
  • a conserved region that can in some embodiments be or include a characteristic sequence element
  • a conserved region usually encompasses at least 3-4 and in some instances up to 20 or more amino acids; in some embodiments, a conserved region encompasses at least one stretch of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more contiguous amino acids.
  • a relevant polypeptide can be or include a fragment of a parent polypeptide.
  • a useful polypeptide may be or include a plurality of fragments, each of which is found in the same parent polypeptide in a different spatial arrangement relative to one another than is found in the polypeptide of interest (e.g., fragments that are directly linked in the parent may be spatially separated in the polypeptide of interest or vice versa, and/or fragments may be present in a different order in the polypeptide of interest than in the parent), so that the polypeptide of interest is a derivative of its parent polypeptide.
  • Prevent or prevention refers to reducing the risk of developing the disease, disorder, or condition; delaying onset of the disease, disorder, or condition; delaying onset of one or more characteristics or symptoms of the disease, disorder, or condition; and/or to reducing the frequency and/or severity of one or more characteristics or symptoms of the disease, disorder, or condition.
  • Prevention can refer to prevention in a particular subject or to a statistical impact on a population of subjects. Prevention can be considered to have occurred when onset of a disease, disorder, or condition has been delayed for a period of time that is predefined or understood by those of skill in the art.
  • promoter can be a DNA regulatory region that directly or indirectly (e.g., through promoter-bound proteins or substances) participates in initiation and/or processivity of transcription of a coding sequence.
  • a promoter may, under suitable conditions, initiate transcription of a coding sequence upon binding of one or more transcription factors and/or regulatory moieties with the promoter.
  • a promoter that participates in initiation of transcription of a coding sequence can be “operably linked” to the coding sequence.
  • a promoter can be or include a DNA regulatory region that extends from a transcription initiation site (at its 3’ terminus) to an upstream (5’ direction) position such that the sequence so designated includes one or both of a minimum number of bases or elements necessary to initiate a transcription event.
  • a promoter may be, include, or be operably associated with or operably linked to, expression control sequences such as enhancer and repressor sequences.
  • reference refers to a standard or control relative to which a comparison is performed.
  • an agent, sample, sequence, subject, animal, or individual, or population thereof, or a measure or characteristic representative thereof is compared with a reference, an agent, sample, sequence, subject, animal, or individual, or population thereof, or a measure or characteristic representative thereof.
  • a reference is a measured value.
  • a reference is an established standard or expected value.
  • a reference is a historical reference.
  • a reference can be quantitative of qualitative. Typically, as would be understood by those of skill in the art, a reference and the value to which it is compared represents measure under comparable conditions.
  • an appropriate reference may be an agent, sample, sequence, subject, animal, or individual, or population thereof, under conditions those of skill in the art will recognize as comparable, e.g., for the purpose of assessing one or more particular variables (e.g., presence or absence of an agent or condition), or a measure or characteristic representative thereof.
  • a regulatory sequence is a nucleic acid sequence that controls expression of a coding sequence.
  • a regulatory sequence can control or impact one or more aspects of gene expression (e.g., cell-type-specific expression, inducible expression, etc.).
  • Risk refers to the qualitative or quantitative probability (whether expressed as a percentage or otherwise) that a particular individual will develop the disease, disorder, or condition. In some embodiments, risk is expressed as a percentage.
  • a risk is a qualitative or quantitative probability that is equal to or greater than 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100%.
  • risk is expressed as a qualitative or quantitative level of risk relative to a reference risk or level or the risk of the same outcome attributed to a reference.
  • relative risk is increased or decreased in comparison to the reference sample by a factor of 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7,. 1.8, 1.9, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more.
  • Subject refers to an organism, typically a mammal (e.g., a human, rat, or mouse).
  • a subject is suffering from a disease, disorder or condition.
  • a subject is susceptible to a disease, disorder, or condition.
  • a subject displays one or more symptoms or characteristics of a disease, disorder or condition.
  • a subject is not suffering from a disease, disorder or condition.
  • a subject does not display any symptom or characteristic of a disease, disorder, or condition.
  • a subject has one or more features characteristic of susceptibility to or risk of a disease, disorder, or condition.
  • a subject is a subject that has been tested for a disease, disorder, or condition, and/or to whom therapy has been administered.
  • a human subject can be interchangeably referred to as a “patient” or “individual.”
  • an individual who is “susceptible to” a disease, disorder, or condition is at risk for developing the disease, disorder, or condition.
  • an individual who is susceptible to a disease, disorder, or condition does not display any symptoms of the disease, disorder, or condition.
  • an individual who is susceptible to a disease, disorder, or condition has not been diagnosed with the disease, disorder, and/or condition.
  • an individual who is susceptible to a disease, disorder, or condition is an individual who has been exposed to conditions associated with, or presents a biomarker status (e.g., a methylation status) associated with, development of the disease, disorder, or condition.
  • a risk of developing a disease, disorder, and/or condition is a population-based risk (e.g., family members of individuals suffering from the disease, disorder, or condition).
  • Symptoms are reduced: According to the present invention, “symptoms are reduced” when one or more symptoms of a particular disease, disorder or condition is reduced in magnitude (e.g., intensity, severity, etc. and/or frequency. For the avoidance of doubt, a delay in the onset of a particular symptom is considered one form of reducing the frequency of that symptom.
  • therapeutically effective amount refers to an amount that produces the desired effect for which it is administered. In some embodiments, the term refers to an amount that is sufficient, when administered to a population suffering from or susceptible to a disease, disorder, and/or condition in accordance with a therapeutic dosing regimen, to treat the disease, disorder, and/or condition. In some embodiments, a therapeutically effective amount is one that reduces the incidence and/or severity of, and/or delays onset of, one or more symptoms of the disease, disorder, and/or condition. Those of ordinary skill in the art will appreciate that a therapeutically effective amount does not necessarily achieve successful treatment in every particular treated individual.
  • a therapeutically effective amount may be that amount that provides a particular desired pharmacological response in a significant number of subjects when administered to patients in need of such treatment.
  • reference to a therapeutically effective amount may be a reference to an amount as measured in one or more specific tissues (e.g., a tissue affected by the disease, disorder or condition) or fluids (e.g., blood, saliva, serum, sweat, tears, urine, etc.).
  • tissue e.g., a tissue affected by the disease, disorder or condition
  • fluids e.g., blood, saliva, serum, sweat, tears, urine, etc.
  • a therapeutically effective agent may be formulated and/or administered in a plurality of doses, for example, as part of a dosing regimen.
  • treatment also “treat” or “treating” refers to administration of a therapy that partially or completely alleviates, ameliorates, relieves, inhibits, delays onset of, reduces severity of, and/or reduces incidence of one or more symptoms, features, and/or causes of a particular disease, disorder, or condition, or is administered for the purpose of achieving any such result.
  • such treatment can be of a subject who does not exhibit signs of the relevant disease, disorder, or condition and/or of a subject who exhibits only early signs of the disease, disorder, or condition. Alternatively or additionally, such treatment can be of a subject who exhibits one or more established signs of the relevant disease, disorder and/or condition. In some embodiments, treatment can be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and/or condition. In some embodiments, treatment can be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, or condition.
  • Unit dose refers to an amount administered as a single dose and/or in a physically discrete unit of a pharmaceutical composition.
  • a unit dose contains a predetermined quantity of an therapeutic agent.
  • a unit dose contains an entire single dose of the agent.
  • more than one unit dose is administered to achieve a total single dose.
  • administration of multiple unit doses is required, or expected to be required, in order to achieve an intended effect.
  • a unit dose can be, for example, a volume of liquid (e.g., an acceptable carrier) containing a predetermined quantity of one or more therapeutic agents, a predetermined amount of one or more therapeutic agents in solid form, a sustained release formulation or drug delivery device containing a predetermined amount of one or more therapeutic agents, etc. It will be appreciated that a unit dose can be present in a formulation that includes any of a variety of components in addition to the therapeutic agent(s). For example, acceptable carriers (e.g., pharmaceutically acceptable carriers), diluents, stabilizers, buffers, preservatives, etc., can be included.
  • acceptable carriers e.g., pharmaceutically acceptable carriers
  • a total appropriate daily dosage of a particular therapeutic agent can include a portion, or a plurality, of unit doses, and can be decided, for example, by a medical practitioner within the scope of sound medical judgment.
  • the specific effective dose level for any particular subject or organism can depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of specific therapeutic agent employed; specific composition employed; age, body weight, general health, sex and diet of the subject; time of administration, and rate of excretion of the specific therapeutic agent employed; duration of the treatment; drugs and/or additional therapies used in combination or coincidental with specific compound(s) employed, and like factors well known in the medical arts.
  • Fig. 1 The rate of production of levan (mg/dL over time (minutes)) in a culture of bacteria (strain ZB423) engineered to express levansucrase. Levan is calculated from glucose release and verified in batch culture by HPAEC and NMR (see Figures 3-7).
  • Fig. 2 is an SDS-PAGE gel showing accumulation of secreted levansucrase enzyme in supernatant.
  • Lanes 1 and 2 are cell pellet lysates from strains not encoding SacB (PY79) or engineered to encode SacB (ZB423) respectively.
  • Lanes 6 and 7 are cell culture supernatant from strains not encoding SacB (PY79) or engineered to encode SacB (ZB423) respectively.
  • Lanes 3, 4, and 5 are supernatant from other Bacillus subtilis strains not relevant to this study.
  • Lane 8 contains cell culture media only as a control reference.
  • Lane 9 contains the protein ladder with bands corresponding to 10, 15, 20, 25, 37, 50, 75, 100, 150, 250 kDa from bottom to top. The supernatant fraction of ZB423 clearly shows a band adjacent to the 50 kDa ladder marker, matching the expected size of 52.99 kDa for SacB protein.
  • HPAEC High Performance Anion Exchange Chromatography
  • Fig. 4 1H-NMR spectra of Levan isolated from ZB423 culture.
  • the spectra shows a solvent peak at 4.78 ppm; a doublet at 4.18, 4.16 ppm (integral: 1); a triplet at 4.09, 4.07, 4.06 ppm (integral: 1), two peaks with amorphous splitting at 3.93, 3.91, 3.88, 3.87 ppm (integral: 2), a doublet at 3.76, 3.74 ppm; a doublet at 3.67, 3.64 ppm; and a triplet at 3.55, 3.53, 3.52 ppm.
  • Solvent was D2O.
  • FIG. 5 13C-NMR Spectra of Levan isolated from ZB423 culture. The spectra shows peaks at 59.96, 104.25, 76.35, 75.24, 80.31, 63.42 ppm.
  • Fig. 6 HSQC-NMR Spectra of Levan isolated from ZB423 culture. This spectra shows the associations between 13C atoms and 1H NMR peaks. The result matches that analyzed previously for Levan from plant sources.
  • Fig. 8 Lactose degradation during transgalactosylation reactions in a culture of B. subtilis engineered with beta-galactosidase LacZ. Lactose is calculated from released glucose. The direct correlation between glucose accumulation and Lactose degradation is confirmed in control samples using purified lactase to effect complete Lactose degradation and correlating to released glucose.
  • Fig. 9 Trehalulose production from cell supernatant (testing activity of secreted enzyme) isolated from culture broth of engineered strains of Bacillus subtilis PY79 with mutB (ZS459) or without mutB (ZS161) operably linked to the hag promoter in the expression locus.
  • Trehalulose is calculated as the reduction in total sucrose. The theoretical limit is equal to the amount of sucrose added to the cell supernatant during the assay.
  • Fig. 10 Trehalulose production from whole cell broth (testing combined activity of intracellular and secreted enzyme) containing engineered strains of Bacillus subtilis PY79 with mutB (ZS459) or without mutB (ZS161) operably linked to the hag promoter in the expression locus.
  • Trehalulose is calculated as the reduction in total sucrose. The theoretical limit is equal to the amount of sucrose added to the cell supernatant during the assay.
  • Metabolism and nutrition are complex areas in which many challenges have been identified. Functions of the gut (e.g., human gut) and gut microbiome (e.g., human gut microbiome) have been increasingly recognized, presenting new challenges in metabolism and nutrition. Certain of these challenges relate to the role of carbohydrates in human metabolism and nutrition. For instance, one function of the gut and/or gut microbiome is to digest carbohydrates, often into monosaccharides such as glucose, fructose, and galactose. Diets high in carbohydrates have been linked to, e.g., high blood pressure, heart disease, obesity, diabetes, high blood glucose and other health problems. Another important metabolic and nutritional challenge relates to soluble fiber.
  • Soluble fiber can improve, e.g., gut health, and improve or reduce the risk of conditions such as high blood cholesterol, heart disease, obesity, diabetes, high blood glucose, and other health problems.
  • Gut carbohydrates and gut soluble fiber can beneficially (e.g., therapeutically) or detrimentally impact the composition of the gut microbiome (e.g., the types and concentrations or amounts of the various microbes of the gut microbiome).
  • modem diets typically include concentrations and/or amounts of carbohydrate (e.g., monosaccharides and/or disaccharides and/or complex carbohydrate) that are in excess of nutritional requirements.
  • Excess monosaccharides and/or disaccharides can in various instances result from consumption of monosaccharides, disaccharides, or complex carbohydrates, any and/or all of which are common in many modem diets. For instance, according to certain estimates, 5% of consumed sucrose can traverse the small intestine without being degraded and digested. Thus, from a typical carbohydrate source such as a can of soda, containing, e.g., 30g of sucrose, as much as 1.5g of sucrose can pass through the stomach and small intestine to reach the colon). Furthermore, sucrose in the intestine can be cleaved into glucose and fructose.
  • glucose can be rapidly absorbed through the intestinal lining, fructose is absorbed more slowly, resulting in accumulation of fructose in the colon.
  • agents that can increase certain generally beneficial microbiome processes, activities, and/or types of microbes, that can decrease certain generally deleterious microbiome processes, activities, and/or types of microbes, or that can promote a beneficial overall microbiome composition are needed.
  • modem diets typically include concentrations and/or amounts of fiber (e.g., soluble fiber) that are lower than the concentrations and/or amounts optimal for human health. Consumption of fiber (e.g., a high-fiber diet, e.g., a high-soluble fiber diet) helps maintain gut health. Fiber is commonly classified as soluble fiber, which can be dissolved in water to form a gel-like material, or insoluble fiber, which cannot be dissolved in water.
  • Consumption of fiber (particularly soluble fiber) can help to maintain healthy body weight (e.g., to reduce or stabilize body weight), and/or to decrease risk of developing diabetes, heart disease, and/or some types of cancer (e.g., colorectal cancer and/or other gut or intestinal cancers).
  • Consumption of fiber (particularly soluble fiber) can decrease risk of dying from cardiovascular disease and all cancers, causing and/or permitting increased longevity.
  • Consumption of fiber (particularly soluble fiber) can decrease risk of developing hemorrhoids and/or small pouches in your colon (diverticular disease).
  • Consumption of fiber (particularly soluble fiber) can decrease blood pressure and inflammation.
  • Consumption of fiber can slow absorption of glucose into blood and/or cause a decrease in blood glucose levels and/or stabilize blood glucose levels (e.g., decrease variation in blood glucose levels over time), e.g., in diabetic subjects.
  • Soluble fiber can help decrease blood cholesterol (e.g., total blood cholesterol concentration or amount), e.g., by decreasing low- density lipoprotein levels.
  • the gut microbiome typically includes trillions of microbes that contribute to, e.g., metabolism, nutrient and mineral absorption, synthesis of enzymes, vitamins and amino acids, and production of short-chain fatty acids (SCFAs).
  • SCFAs short-chain fatty acids
  • Microbes of the gut microbiome have tremendous potential to impact health (e.g., contribute to wellbeing or to disease) and/or physiology.
  • Microbes of the gut microbiome can have metabolic activities that impact health of a host organism, protect a host organism against pathogens, educate the immune system of a host organism, and/or directly or indirectly affect many physiologic functions.
  • the gut microbiome includes a variety of different types of microbes (e.g., a variety of different bacterial phyla, classes, orders, families, genera, species, and/or strains), each of which can be characterized by different metabolic characteristics.
  • different types of microbes may demonstrate increased or decreased growth under any of a variety of conditions, e.g., in the presence of carbohydrates or in the presence of fiber.
  • certain microbes are considered to be beneficial, certain microbes are considered to be harmful, and the overall composition of the gut microbiome (e.g., the relative amounts of different microbes in the gut microbiome) is considered to be an important factor in health.
  • Carbohydrate consumption and/or gut carbohydrate can adversely impact the gut microbiome and/or cause various conditions associated with excess carbohydrate.
  • Insufficient soluble fiber in the gut can also adversely impact the gut microbiome (e.g., gut microbiome composition and/or activity) and/or cause various conditions associated with insufficient fiber.
  • Soluble fiber can also promote growth of health-promoting bacteria.
  • carbohydrate consumption and/or insufficient fiber consumption can cause a disruption of the balance of microbiome strains (dysbiosis) of the gut microbiome, e.g., of the large intestine, e.g., by increasing the concentration or amount of Proteobacteria, decreasing the concentration or amount of Bacteroidetes, and/or causing an increase the ratio of Proteobacteria to Bacteroidetes.
  • Dysbiosis of gut microbiota is associated with the pathogenesis of intestinal conditions (e.g. inflammatory bowel disease, and irritable bowel syndrome (IBS)), and extra-intestinal conditions (e.g, allergy, asthma, metabolic syndrome, cardiovascular disease, and obesity).
  • intestinal conditions e.g. inflammatory bowel disease, and irritable bowel syndrome (IBS)
  • extra-intestinal conditions e.g, allergy, asthma, metabolic syndrome, cardiovascular disease, and obesity.
  • Dysbiosis can include and/or present symptoms including bloating, cramping, gas, and diarrhea. Additionally, concentration and/or amount of Proteobacteria and/or Bacteroidetes, and/or the ratio thereof, can contribute to maintenance of immunological homeostasis and/or epithelial integrity in the intestinal mucosa.
  • the genus Bacteroidetes has been associated with numerous health benefits, including the downregulation of inflammatory responses in the gut. Further to these impacts on the composition of the gut microbiome and functions thereof, sucrose and gut cleavage products glucose and fructose are known to have direct effects in silencing certain health-beneficial functions of gut microbiome bacteria such as bacteroides.
  • the present disclosure therefore recognizes a variety of distinct gut conditions (e.g., characterized by concentration or amount of one or more metabolites, e.g., increased or decreased relative to a reference) that benefit health and/or the gut microbiome.
  • These target gut conditions that benefit health and/or the gut microbiome can include any of one or more of (i) decrease in the concentration or amount of monosaccharides and/or disaccharides in the gut as compared to a reference and/or (ii) increase in the concentration or amount of gut fiber (e.g., gut soluble fiber) as compared to a reference, e.g., where the reference is a concentration or amount in the same subject at an earlier time, a concentration or amount identified as normal or healthy, a concentration or amount identified as abnormal or unhealthy, a concentration or amount representative of typical or healthy subjects, a concentration or amount representative of atypical or unhealthy subjects.
  • gut fiber e.g., gut soluble fiber
  • the present disclosure further provides that decreasing the concentration or amount monosaccharides and/or disaccharides in the gut can be achieved, e.g., by competitive uptake of monosaccharides and/or disaccharides (e.g., sucrose) in the gut (e.g., in the small intestine and/or colon) by an alternative and/or beneficial process, and/or by removal of fructose produced from sucrose degradation in the gut (e.g., in the small intestine).
  • the present disclosure further provides that the concentration or amount of gut fiber (e.g., gut soluble fiber) can be increased by synthesis in the gut of soluble fiber.
  • the present disclosure further provides that these target gut nutrient conditions of reduced carbohydrate and increased fiber provide synergistic benefits to health and/or the gut microbiome, at least because monosaccharides and/or disaccharides can inhibit beneficial growth of the microbiome and/or of microbes thereof while soluble fiber promotes positive growth of the microbiome and/or of microbes thereof, and separately or additionally in some instances because low carbohydrate and high fiber can together modulate, decrease, and/or stabilize blood glucose levels.
  • methods and compositions of the present disclosure surprisingly and synergistically achieve both target gut nutrient conditions of decreased concentration or amount of gut monosaccharides and/or disaccharides and increased concentration or amount of fiber.
  • the present disclosure recognizes, among other things, at least two forms of synergy between carbohydrates (such as monosaccharides and/or disaccharides, including without limitation monosaccharides produced by digestion of complex carbohydrates) and soluble fiber: first, that soluble fiber in the gut can slow the digestion of carbohydrate (e.g., monosaccharides and/or disaccharides), and second that both carbohydrates (e.g., monosaccharides and/or disaccharides) and soluble fiber have profound impacts on the gut microbiome, the present disclosure including that reducing gut monosaccharides and/or disaccharides and increasing gut soluble fiber are independently and synergistically beneficial.
  • carbohydrates such as monosaccharides and/or disaccharides, including without limitation monosaccharides produced by digestion of complex carbohydrates
  • soluble fiber in the gut can slow the digestion of carbohydrate (e.g., monosaccharides and/or disaccharides)
  • both carbohydrates e.g., monosaccharides and/or disacc
  • compositions such as engineered bacteria, and methods of using the same, that benefit health by decreasing concentration and/or amount of gut monosaccharides and/or disaccharides and increasing gut soluble fiber, e.g., by enzymatic synthesis of fiber from substrates including carbohydrate (e.g., monosaccharides and/or disaccharides).
  • carbohydrate e.g., monosaccharides and/or disaccharides
  • Various methods and compositions of the present disclosure include an engineered bacterium, such as a probiotic bacterium, that decreases amount and/or concentration of monosaccharides and/or disaccharides in the gut and increases amount and/or concentration of soluble fiber in the gut by enzymatically converting carbohydrate (e.g., monosaccharides and/or di saccharides) to soluble fiber.
  • Enzymatic reactions that perform this function include but are not limited to oligofructose-synthases, which cleave sucrose and seclude fructose into a growing oligo-fructose chain which is not digestible by human enzymes in the intestinal tract.
  • a composition or method of the present disclosure degrades sucrose and incorporates fructose into a fiber molecule.
  • an engineered bacterium processes monosaccharides and/or disaccharides to produce levan fiber (e.g., by incorporating carbohydrate moieties into soluble fiber molecules).
  • compositions and methods of the present disclosure that decrease concentration or amount of gut carbohydrate (monosaccharides and/or disaccharides) and increase concentration or amount of gut fiber (e.g., soluble fiber) include enzymes that convert carbohydrate to fiber and further include engineered bacteria that encode and/or express enzymes that convert carbohydrate to fiber.
  • the present disclosure includes the inventors’ recognition that certain plant and bacterial enzymes participate in, catalyze, and/or cause reactions in which soluble indigestible fiber molecules are synthesized (e.g., directly) from substrates including one or more carbohydrates, e.g., by incorporating carbohydrate moieties into fiber molecules.
  • the present disclosure includes engineered nucleic acids (transgenes) that encode and/or express a variety of exemplary enzymes that synthesize fiber from substrates including carbohydrate (fiber-synthesizing enzymes).
  • fiber-synthesizing enzymes are known in the art, e.g., from studies of the conversion of carbohydrates to fibers in microorganisms (e.g., for use in a controlled fermentation context).
  • various fiber-synthesizing enzymes have been characterized, e.g., for sequence and/or fiber production characteristics in laboratory settings and systems such as E. coli.
  • fiber-synthesizing enzymes of the present disclosure utilize a carbohydrate substrate selected from one or more of UDP-glucose, UDP-galactose, UDP-fucose, ADP-a-D-glucose, UDP-galacturonic acid, UDP-N-acetyl-alpha-D-glucosamine, galactinol, lactose, glucose, and sucrose and/or wherein the carbohydrate decreased in amount or concentration in the gut is selected from one or more of glucose, galactose, sucrose, fructose, and/or lactose as a substrate in synthesizing a fiber that includes glucose, fructose, galacturonic acid, N-acetyl-D-glucosamine, and/or galactose monomers, e.g., wherein synthesized fibers include one or more of laminaribiose, callose, curdlan, oat
  • fiber-synthesizing enzymes of the present disclosure utilize UDP-glucose as a substrate in synthesizing fiber including glucose monomers, e.g., where synthesized fibers are or include one or more of laminaribiose, callose, curdlan, oat beta-glucan, laminarin, pleuran, lentinan, yeast beta glucan, and/or trehalulose.
  • fiber-synthesizing enzymes of the present disclosure utilize sucrose as a substrate in synthesizing fiber including fructose monomers, e.g., where synthesized fibers are or include inulin, kestose, nystose, and/or levan.
  • fiber-synthesizing enzymes of the present disclosure utilize sucrose and UDP-galactose as a substrate in synthesizing fiber including galactose monomers, e.g., where synthesized fibers are or include raffinose, stachyose, and/or verbascose.
  • fiber-synthesizing enzymes include a 1,3 -beta-glucan synthase (e.g., 1,3 -beta-glucan synthase component FKS1 or callose synthase 1), a l,3;l,4-beta- D-glucan synthase (e.g., probable mixed-linked glucan synthase 6), a 1,6-beta-glucan synthase (e.g., Cell wall synthesis protein KRE9) a sucrose isomerase, a levansucrase, or a 1,6-alpha- galactosyltransferase (e.g., galactinol— sucrose galactosyltransferase).
  • a 1,3 -beta-glucan synthase e.g., 1,3 -beta-glucan synthase component FKS1 or callose synthase 1
  • fiber-synthesizing enzymes include Levanosucrase (sucrose 6-fructosyltransferase; beta-2, 6- fructosyltransferase; beta-2, 6-fructan:D-glucose 1-fructosyltransferase; EC 2.4.1.10); inulosucrase (sucrose:2,l-beta-D-fructan 1-beta-D-fructosyltransf erase; sucrose 1- fructosyltransf erase; EC 2.4.1.9); fructosy Itransferase (2,l-fructan:2,l-fructan 1- fructosyltransferase; 1,2-beta-D-fructan l(F)-fructosyltransferase; l,2-beta-D-fructan:l,2-beta-D- fructan l(F)-bettan
  • a probiotic organism is engineered with a 2,1 beta fructosyltransferase (inulosucrase) to enable the synthesis of fructooligosaccharides (inulin, 1- kestose, 1-nystose) from consumed sucrose in the digestive tract.
  • a probiotic organism is engineered with a 2,6 beta fructosyltransferase (levanosucrase) to enable the synthesis of fructooligosaccharides (levan, 6-kestose, 6-nystose) from consumed sucrose in the digestive tract.
  • a probiotic organism is engineered with a galactosyltransferase specific to lactose (such as P(l— >4) galactosyltransferase) to enable the synthesis of lactose terminal galactooligosaccharides (human milk oligosaccharides, galactooligosaccharides) from consumed lactose in the digestive tract.
  • a galactosyltransferase specific to lactose such as P(l— >4) galactosyltransferase
  • a probiotic organism is engineered with a galactosyltransferase specific to galactinol (such as (al— >6) galactosyltransferase) to enable the synthesis of sucrose terminal galactooligosaccharides (raffinose, stachyose, verbascose) from consumed sucrose and glucose in the digestive tract, optionally with galactinol synthase, galactose isomerase, and membrane transporters to increase precursors and improve synthesis rates.
  • a galactosyltransferase specific to galactinol such as (al— >6) galactosyltransferase
  • sucrose terminal galactooligosaccharides raffinose, stachyose, verbascose
  • galactinol synthase galactose isomerase
  • membrane transporters to increase precursors and improve synthesis rates.
  • a probiotic organism is engineered with a P(l— >3) glucan synthase (1,3 -Beta-glucan synthase) to enable the synthesis of beta-glucans (laminaribiose, callose, curdlan, oat beta-glucan) from consumed glucose or glucose produced from consumed sucrose in the digestive tract, optionally including fructose isomerase to enable synthesis from consumed fructose, optionally including a 1,4-beta-glucosyltransferase to enable synthesis of crosslinked polymers with improved prebiotic qualities from consumed sucrose and glucose in the digestive tract.
  • glucan synthase (1,3 -Beta-glucan synthase)
  • beta-glucans laminaribiose, callose, curdlan, oat beta-glucan
  • fructose isomerase to enable synthesis from consumed fructose
  • 1,4-beta-glucosyltransferase to enable synthesis of cross
  • a probiotic organism is engineered with a P(l— >3) glucan synthase (1,3 -Beta-glucan synthase) is further engineered with a P(1 — 6) glucan synthase (1,6-Beta-glucan synthase) to create rare crosslinked prebiotic fibers (Laminarin/Pleuran/Lentinan/Yeast beta glucan) from consumed sucrose and glucose in the digestive tract.
  • a probiotic organism is engineered with a a(l— >1) sucrose isomerase (trehalulose synthase) to enable the synthesis of rare prebiotic disaccharides (Trehalulose) from consumed glucose and fructose in the digestive tract.
  • a probiotic organism is engineered with the pectin biosynthesis pathway to enable the synthesis of pectin and pectin-like polymers from consumed glucose and sucrose in the digestive tract.
  • an FKS1 fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 1 (UniProt Accession No. P38631).
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 1, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 1.
  • the present disclosure further includes nucleic acid sequences encoding an FKS1 fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding an FKS1 fiber-synthesizing enzyme is a sequence engineered for expression in B. subtilis, e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 2., e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 2.
  • a CALS1 fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 3 (UniProt Accession No. Q9AUE0).
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 3, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 3.
  • the present disclosure further includes nucleic acid sequences encoding a CALS1 fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding a CALS1 fiber-synthesizing enzyme is a sequence engineered for expression in B.
  • subtilis e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 4., e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 4.
  • a CSLF6 fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 5 (UniProt Accession No. Q84UP7).
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 5, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 5.
  • the present disclosure further includes nucleic acid sequences encoding a CSLF6 fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding a CSLF6 fiber-synthesizing enzyme is a sequence engineered for expression in B.
  • subtilis e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 6., e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 6.
  • a KRE9 fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 7 (UniProt Accession No. P39005).
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 7, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 7.
  • the present disclosure further includes nucleic acid sequences encoding a KRE9 fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding a KRE9 fiber-synthesizing enzyme is a sequence engineered for expression in B.
  • subtilis e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 8, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 8.
  • a MutB fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 9 (UniProt Accession No. Q2PS28).
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 9, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 9.
  • the present disclosure further includes nucleic acid sequences encoding a MutB fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding a MutB fiber-synthesizing enzyme is a sequence engineered for expression in B.
  • subtilis e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 10, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 10.
  • a otsA fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 33 (UniProt Accession No. P31677).
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 33, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 33.
  • the present disclosure further includes nucleic acid sequences encoding a MutB fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding a MutB fiber-synthesizing enzyme is a sequence engineered for expression in B.
  • subtilis e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 34, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 34.
  • an InuJ fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 11 (UniProt Accession No. Q74K42).
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 11, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 11.
  • the present disclosure further includes nucleic acid sequences encoding an InuJ fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding an InuJ fiber-synthesizing enzyme is a sequence engineered for expression in B.
  • subtilis e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 12, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 12.
  • an RFS fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 13 (UniProt Accession No. Q5VQG4).
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 13, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 13.
  • the present disclosure further includes nucleic acid sequences encoding an RFS fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding an RFS fiber-synthesizing enzyme is a sequence engineered for expression in B.
  • subtilis e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 14, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 14.
  • a IgtC fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 35 (UniProt Accession No. Q8KHJ3).
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 35, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 35.
  • the present disclosure further includes nucleic acid sequences encoding a IgtC fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding a IgtC fiber-synthesizing enzyme is a sequence engineered for expression in B. subtilis, e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 36, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 36.
  • a tll0994 fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 37 (UniProt Accession No. Q8DK72).
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 37, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 37.
  • the present disclosure further includes nucleic acid sequences encoding a tll0994 fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding a tll0994 fiber-synthesizing enzyme is a sequence engineered for expression in B. subtilis, e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 38, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 38.
  • a BgaB fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 39 (UniProt Accession No. P19668).
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 39, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 39.
  • the present disclosure further includes nucleic acid sequences encoding a BgaB fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding a BgaB fiber-synthesizing enzyme is a sequence engineered for expression in B. subtilis, e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 40, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 40.
  • a Bga fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 41 (UniProt Accession No. E5RWQ2).
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 41, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 41.
  • the present disclosure further includes nucleic acid sequences encoding a Bga fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding a Bga fiber-synthesizing enzyme is a sequence engineered for expression in B.
  • subtilis e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 42, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 42.
  • a ScsAB fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 43 (UniProt Accession No. P0CW87).
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 43, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 43.
  • the present disclosure further includes nucleic acid sequences encoding a ScsAB fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding a ScsAB fiber-synthesizing enzyme is a sequence engineered for expression in B.
  • subtilis e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 44, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 44.
  • a Ssl fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 45 (UniProt Accession No. 049064).
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 45, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 45.
  • the present disclosure further includes nucleic acid sequences encoding a Ssl fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding a Ssl fiber-synthesizing enzyme is a sequence engineered for expression in B.
  • subtilis e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 46, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 46.
  • a SBE3 fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 47 (UniProt Accession No. D2WL32).
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 47, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 47.
  • the present disclosure further includes nucleic acid sequences encoding a SBE3 fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding a SBE3 fiber-synthesizing enzyme is a sequence engineered for expression in B.
  • subtilis e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 48, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 48.
  • a HlgA fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 49 (UniProt Accession No. P39125).
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 49, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 49.
  • the present disclosure further includes nucleic acid sequences encoding a HlgA fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding a HlgA fiber-synthesizing enzyme is a sequence engineered for expression in B. subtilis, e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 50, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 50.
  • a GAUT1 fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 51 (UniProt Accession No. Q9LE59).
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 51, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 51.
  • the present disclosure further includes nucleic acid sequences encoding a GAUT1 fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding a GAUT1 fiber-synthesizing enzyme is a sequence engineered for expression in B.
  • subtilis e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 52, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 52.
  • a NodC fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 53 (UniProt Accession No. Q07755).
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 53, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 53.
  • the present disclosure further includes nucleic acid sequences encoding a NodC fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding a NodC fiber-synthesizing enzyme is a sequence engineered for expression in B.
  • subtilis e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 54, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 54.
  • a levansucrase fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 15 (UniProt Accession No. Q43998), a levansucrase enzyme expressed by Acetobacter diazotrophicus, and/or a levansucrase enzyme encoded by Acetobacter diazotrophicus IsdA.
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 15, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 15.
  • a levansucrase fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 16 (UniProt Accession No. P0DJA3), a levansucrase enzyme expressed by Zymomonas mobilis subsp. Mobilis, and/or a levansucrase enzyme encoded by Zymomonas mobilis subsp. mobilis sacB.
  • a fibersynthesizing enzyme has at least 80% identity to SEQ ID NO: 16, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 16.
  • a levansucrase fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 17 (UniProt Accession No. Q97I81), a levansucrase enzyme expressed by Clostridium acetobutylicum, and/or a levansucrase enzyme encoded by Clostridium acetobutylicum sacB.
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 17, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 17.
  • a levansucrase fiber-synthesizing enzyme has an amino acid sequence according to SEQ ID NO: 18 (UniProt Accession No. P05655), a levansucrase enzyme expressed by Bacillus Subtilis natto or Bacillus Subtilis PY79, and/or a levansucrase enzyme encoded by Bacillus Subtilis natto sacB and/or Bacillus Subtilis PY79 sacB.
  • a fiber-synthesizing enzyme has at least 80% identity to SEQ ID NO: 18, e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 18.
  • the present disclosure further includes nucleic acid sequences encoding a levansucrase fiber-synthesizing enzyme.
  • a nucleic acid sequence encoding a levansucrase fiber-synthesizing enzyme is a sequence engineered for expression in B. subtilis, e.g., a nucleic acid sequence having at least 80% identity to SEQ ID NO: 19., e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 19.
  • fiber-synthesizing enzymes of the present disclosure are effective to produce fiber when provided with enzyme substrate as disclosed herein.
  • fiber-synthesizing enzymes of the present disclosure can directly utilize gut carbohydrate and in certain embodiments can utilize modified and/or processed forms.
  • fiber produced by a composition or method of the present disclosure is soluble levan fiber.
  • Levan is a naturally occurring fructan present in certain plant and microorganism species. Rare fibers such as levan can favor a healthy and/or healthily balanced microbiome or microbiome composition, e.g., by stimulating the growth and/or increasing the concentration and/or amount of various beneficial types of gut microbiome constituent microbes such as Bifidobacteria, Roseburia, and/or Eubacterium rectale. For at least these reasons, increasing levan can increase the concentration or amount of beneficial molecules such as butyrate and propionate. Fructans such as levan can be synthesized from sucrose.
  • Levan is known to be abundantly produced when the bacterium Bacillus subtilis sp. Natto (B.s. Natto) is cultured on soy beans and B.s. natto can be used to make the food ‘Natto’ (for which the bacterial strain is named). B.s. natto likely originated from the soil and is not a commensal of the human gut.
  • Levan fiber polymer is made up of fructose, a monosaccharide, conjugated in 2,6 beta glycosidic linkages.
  • levan fiber is enzymatically synthesized by a process and/or enzyme that utilizes a fructose molecule liberated by enzymatic digestion of sucrose (which includes two monosaccharide moieties, one glucose and one fructose).
  • the present disclosure includes a levansucrase enzyme that synthesizes levan from sucrose.
  • a levansucrase enzyme can cleave sucrose into constituent monosaccharide moieties and incorporate the fructose monosaccharide moiety into levan.
  • a levansucrase enzyme can convert 50% of the carbohydrate biomass and/or monosaccharide moieties, and/or 100% of the fructose biomass and/or fructose moieties, generated by levansucrase cleavage of sucrose to soluble fiber.
  • a fiber-synthesizing enzyme of the present disclosure can synthesize fiber from substrates including carbohydrate (e.g., monosaccharides and/or di saccharides) within or across a pH range of (e.g., in an environment characterized by a pH that is in the range of) 5.7 to 8.5
  • a fiber-synthesizing enzyme of the present disclosure can synthesize fiber at pH 5.7, pH 6.0, pH 7.4, and/or pH 8.5.
  • a fiber-synthesizing enzyme of the present disclosure can synthesize fiber within or across a pH range of 5.7 to 6.0, 6.0 to 7.4, and/or 7.4 to 8.5, or within or across a range having a lower bound selected from about 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 and an upper bound selected from about 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, or 8.5.
  • the human gastrointestinal tract pH typically gradually increases in the small intestine from about pH 6 to about pH 7.4 in the terminal ileum, drops to about 5.7 in the caecum, and again gradually increases through the colon, reaching about pH 6.7 in the rectum.
  • a fiber-synthesizing enzyme of the present disclosure is secluded and/or protected within a fiber matrix that prevents larger peptidases from engaging in degradation of the enzyme (while still allowing agents for fiber synthesis, such as carbohydrate, e.g., sucrose, to contact the enzyme).
  • coding sequences encoding a fibersynthesizing enzyme of the present disclosure can be modified to reflect codon usage of a cell in which the enzyme is expressed.
  • a polypeptide of the present disclosure e.g., an enzyme, e.g., a levansucrase enzyme
  • a secretion polypeptide is operably linked with a secretion polypeptide.
  • Identification of secretion polypeptides is common in the art, e.g., by synthesis of a fusion polypeptides including signaling polypeptides of interest and screening the fusion polypeptides for secretion from an exemplary cell.
  • Exemplary signal sequences can include, without limitation, those provided in Table 2.
  • Export by the Sec pathway can be achieved by inclusion in a polypeptide of a a hydrophobic secretion polypeptide at the N- terminus of the secreted polypeptide, which secretion polypeptide can be about 20 amino acids in length and can include, in some examples, 3 regions: a positively charged amino terminal, a hydrophobic core, and a polar carboxyl-terminal.
  • a commercial kit (Takara Bio) is available to test with limited effort 173 distinct secretion polypeptides.
  • a fusion polypeptide includes a levansucrase enzyme operatively linked to a secretion polypeptide derived from a sequence naturally associated with SacB.
  • a fiber-synthesizing enzyme engineered to include a secretion polypeptide can result in secretion of the enzyme (e.g., secretion from cells including a transgene encoding the fiber-synthesizing enzyme, e.g., into gut of a subject to which the cells were administered).
  • secretion of the enzyme e.g., secretion from cells including a transgene encoding the fiber-synthesizing enzyme, e.g., into gut of a subject to which the cells were administered.
  • the present disclosure includes the recognition that, in various embodiments, synthesis of fiber from carbohydrate in the gut can advantageously occur extracellularly with respect to administered engineered cells of the present disclosure.
  • extracellular synthesis of fiber by a fiber-synthesizing enzyme delivered to the gut by engineered cells of the present disclosure can obviate the need to import sucrose across the cell membrane into the cytosol of engineered cells, resulting in higher enzyme activity than would be achieved by intracellular expression of enzyme, and therefore faster and/or greater consumption of sugar and/or synthesis of fiber.
  • sucrose concentrations can cause production of comparatively higher molecular weight fiber molecules
  • synthesis of fiber in the gut where carbohydrate concentration is maximal can increase average fiber molecular weight.
  • a secretion polypeptide for pairing e.g., fusing or otherwise operably linking
  • a polypeptide or nucleic acid sequence encoding the polypeptide For example, various commercial kits such as that from Takara Bio (3380 - B. Subtilis Secretory Protein Expression System) are available for rapid screening of secretion polypeptides.
  • fusion polypeptides that include a fiber-synthesizing enzyme of the present disclosure and a secretion polypeptide, where the variants can have increased stability and/or expression as compared to a reference fusion polypeptide (e.g., fusion polypeptide prior to section or evolution).
  • a secretion polypeptide of the present disclosure can be selected based on the cell type in which an engineered polypeptide (e.g., a fusion polypeptide) is expressed.
  • a fiber-synthesizing enzyme of the present disclosure is not secreted.
  • a fiber-synthesizing enzyme is engineered for secretion such that the enzyme acts directly on substrates present in the gut, and in some embodiments a fiber-synthesizing enzyme is engineered such that it is not secreted and acts on substrates internalized by a cell that expresses a fiber-synthesizing enzyme.
  • Exemplary secreted enzymes can include a sucrose isomerase, trehalulose synthase, inulinsucrase, levanosucrase, beta-galactosidas, or b-D-Galactosidase.
  • certain such secreted fiber-synthesizing enzymes can utilize substrate present in gut and decrease the concentration or amount of that substrate in gut (e.g., the substrate sucrose for sucrose isomerase, trehalulose synthase, inulinsucrase, or levanosucrase, or the substrate lactose for beta-galactosidas, or b-D- Galactosidase).
  • substrate sucrose for sucrose isomerase trehalulose synthase, inulinsucrase, or levanosucrase
  • the substrate lactose for beta-galactosidas e.g., beta-galactosidas, or b-D- Galactosidase
  • Exemplary fiber-sythensizing enzymes that in various embodiments are not secreted and synthesize fiber at or in cells of the present disclosure (e.g., through cytosolic or membrane activity) can include a 1,3 -beta-glucan synthase, l,3;l,4-beta-D-glucan synthase, 1,3- beta-glucan synthase, 1,6-beta-glucan synthase, Trehalose-6-phosphate synthase, 1,6-alpha- galactosyltransf erase, a-l,4-galactosyltransferase, Alpha- 1,2-fucosyltransf erase, cellulose synthase, maltose synthase, starch synthase, Starch-branching enzyme, Glycogen synthase, galacturonosyltransferase, or Chitinoligosaccharide synthase.
  • various non-secreted fiber-synthesizing enzymes present in the cytosol or membranes of cells of the present disclosure can act on substrates internalized by cells and optionally modified by cells prior to use as a substrate in fiber synthesis by the enzyme.
  • Fiber-synthesizing enzymes such as 1,3 -beta-glucan synthase, 1,3; 1,4-beta-D-glucan synthase, 1,3 -beta-glucan synthase, 1,6-beta-glucan synthase, Trehalose-6-phosphate synthase, cellulose synthase, maltose synthase, starch synthase, and Starch-branching enzyme can utilize UDP-glucose as a substrate where activity of the enzyme decreases the amount or concentration of glucose, sucrose, and/or fructose in gut, in that glucose, sucrose, and/or fructose carbohydrates taken up by cells are naturally converted to UDP-glucose that provide a substrate for the fiber-synthesizing enzyme.
  • Fiber-synthesizing enzymes such as Glycogen synthase can utilize ADP-a-D-glucose as a substrate where activity of the enzyme decreases the amount or concentration of glucose, sucrose, and/or fructose in gut, in that glucose, sucrose, and/or fructose carbohydrates taken up by cells are naturally converted to ADP-a-D- glucose that provides a substrate for the fiber-synthesizing enzyme.
  • Fiber-synthesizing enzymes such as a-l,4-galactosyltransferase can utilize UDP-galactose as a substrate where activity of the enzyme decreases the amount or concentration of lactose in gut, in that lactose carbohydrates taken up by cells are naturally converted to UDP-galactose that provides a substrate for the fibersynthesizing enzyme.
  • Fiber-synthesizing enzymes such as Alpha- 1,2-fucosyltransferase can utilize UDP-galactose and/or UDP-fucose as a substrate where activity of the enzyme decreases the amount or concentration of lactose in gut, in that lactose carbohydrates taken up by cells are naturally converted to utilize UDP-galactose and/or UDP-fucose that provide a substrate for the fiber-synthesizing enzyme.
  • Fiber-synthesizing enzymes such as 1,6-alpha-galactosyltransf erase can utilize lactose and/or galactinol as a substrate where activity of the enzyme decreases the amount or concentration of lactose in gut, in that lactose carbohydrates taken up by cells are naturally converted to lactose and/or galactinol that provide a substrate for the fiber-synthesizing enzyme.
  • Fiber-synthesizing enzymes such galacturonosyltransferase can utilize various molecules as a substrate where activity of the enzyme decreases the amount or concentration of glucose, sucrose, and/or fructose in gut, in that glucose, sucrose, and/or fructose carbohydrates taken up by cells are naturally converted to substrates of the fiber-synthesizing enzyme.
  • Fibersynthesizing enzymes such Chitinoligosaccharide synthase can utilize UDP-N-acetyl-alpha-D- glucosamine as a substrate where activity of the enzyme decreases the amount or concentration of glucose, sucrose, and/or fructose in gut, in that glucose, sucrose, and/or fructose carbohydrates taken up by cells are naturally converted to UDP-N-acetyl-alpha-D-glucosamine that provide sa substrate for the fiber-synthesizing enzyme.
  • the present disclosure generally includes, among other things, the innovation of administering to a subject an engineered cells that encodes and/or expresses a fiber-synthesizing enzyme of the present disclosure.
  • a nucleic acid sequence encoding a fiber-synthesizing enzyme of the present disclosure can be operably linked with a regulatory nucleic acid sequence that controls expression of the enzyme in the cell.
  • regulatory nucleic acid sequences for operable linkage to coding sequences and/or for expression of encoded polypeptides are known in the art.
  • a regulatory nucleic acid can be a constitutive promoter and/or cause constitutive expression of a polypeptide encoded by an operably linked coding sequence, e.g., in bacteria (e.g., in A. subtilis).
  • a regulatory nucleic acid can be a conditional promoter and/or cause conditional expression of a polypeptide encoded by an operably linked coding sequence, e.g., in bacteria (e.g., in A. subtilis).
  • a bacterial regulatory nucleic acid sequence can be a promoter selected from T7, T71ac, Sp6, araBAD, trp, lac, Ptac, or pL.
  • a regulatory nucleic acid sequence can be a B. subtilis promoter is selected from Pveg, PserA, PymdA, PfbaA. Pzwf PfoleA, Ppgi, PlepA, or PrelA, e.g., as set forth in Guiziou (2016 NucL Acids Res. 44(15): 7495- 7508), which is herein incorporated by reference with respect to B. subtilis promoters and in its entirety.
  • an exemplary regulatory nucleic acid can be based on regulator nucleic acid sequence(s) associated with expression of, e.g., flagellar machinery.
  • Such regulatory nucleic acid sequences have been previously adapted for constitutive and/or robust expression of polypeptide encoded by an operably linked coding nucleic acid sequence.
  • Various bacteria e.g., B. subtilis
  • regulate expression of a flagellin gene locus in some systems referred to as hag
  • a regulatory system that includes positive and negative control. Removal and/or reduction of negative regulation of flagellin gene locus expression and/or addition of or increased positive regulation of flagellin gene locus expression can be utilized to increase expression from a flagellin promoter.
  • flagellin gene locus is positively controlled by a sigma factor, SigD, which is repressed by the FlgM protein. Deletion of flgM and/or reduction of FlgM expression significantly enhances expression and/or activity of SigD, and consequently results in increased and/or constitutive expression of the flagellin gene locus.
  • expression of flagellar subunits can be negatively, post-transcriptionally controlled by binding of a protein referred to as CsrA to a ribosome binding site present in flagellin gene locus transcripts.
  • Deletion of csrA and/or reduction of CsrA expression significantly enhances expression of flagellar subunits.
  • Deletion and/or reduction of one or more CsrA binding sites in flagellin gene regulatory nucleic acid sequence(s) can additionally or laternatively significantly increases expression of flagellar subunits.
  • certain point mutations in a CsrA binding site can reduce and/or abrogate negative control of flagellar subunit expression by CsrA.
  • expression of a nucleic acid operably linked with a flagellin gene regulatory nucleic acid sequence can be increased by either or both of (i) deleting the flgM gene and/or (ii) a point mutation in the CsrA-binding site, e.g., in B. subtilis.
  • the coding nucleic acid sequence of the flagellin gene is replaced with a nucleic acid sequence encoding a fiber-synthesizing enzyme (e.g., a levansucrase enzyme) such that the fiber-synthesizing enzyme is operably linked to flagellin gene regulatory sequence(s) (e.g., including the hag promoter), the fiber-synthesizing enzyume can be expressed at high and/or constitutive levels.
  • the fiber-synthesizing enzyme includes a secretion polypeptide.
  • a transgene of the present disclosure includes a nucleic acid sequence that encodes a levansucrase enzyme operably linked with a flagellin gene regulatory nucleic acid sequence, e.g., a flagellin gene promoter.
  • a transgene of the present disclosure can include a nucleic acid sequence that encodes a levansucrase enzyme is operably linked with a hag promoter.
  • the levansucrase enzyme includes a secretion polypeptide.
  • endogenous sacB loci can include regulatory elements that repress sacB expression in the absence of sucrose.
  • residence time of digesta can be shorter than the time required for induction of expression by consumed carbohydrate (e.g., sucrose), as the residence time can be less than 20 minutes.
  • endogenous gut enzymes can also breakdown carbohydrates.
  • the present disclosure therefore includes embodiments in which fiber-synthesizing enzyme is constitutively expressed to increase the overlap of digesta residence in gut and fiber-synthesizing enzyme activity in gut. Constitutive expression of fiber-synthesizing enzyme in gut can result in accumulation of fibersynthesizing enzyme available for synthesis of fiber from carbohydrate, e.g., digestion during consumption and digestion.
  • the present disclosure further includes nucleic acid vectors that include transgenes of the present disclosure.
  • vectors such as plasmids
  • plasmids are available for introduction of heterologous nucleic acids into target cells, e.g., bacterial target cells disclosed herein, e.g., with integration of a heterologous nucleic acid sequence into the genome of target cells.
  • Exemplary vectors can include plasmids and viral vectors.
  • vectors include a selectable marker and/or counter- selectable marker.
  • a vector is engineered for integration of heterologous nucleic acid sequence into a target cell genome by homologous recombination.
  • a vector is engineered for unstable integration of a heterologous nucleic acid sequence into a target cell genome (e.g., in some embodiments, by production of merodiploid cells).
  • a vector is engineered to integrate into a host cell genome by a single crossover event subsequently resolved by subsequent double-crossover resulting in loss of plasmid DNA, such as those made from pminiMAD or pMAD plasmids.
  • the present disclosure includes cells (e.g., spores) that include a heterologous nucleic acid sequence that includes a transgene that encodes and/or expresses a fibersynthesizing enzyme of the present disclosure (such cells referred to herein as engineered cells).
  • engineered cells e.g., spores
  • a composition e.g., for administration to a subject, e.g., a human subject.
  • engineered cells of the present disclosure can be vegetative cells and/or non-spore forming.
  • Common examples of nonspore forming cells that can be administered as vegetative cells include lactobacilli and bifidobacteria. Lactobacillus cells are commonly used.
  • non-spore forming cells that can be administered as vegetative cells include but are not limited to members of the Bacteroidetes family (e.g.
  • Lactobacillus paracasei Lactobacillus brevis
  • Lactobacillus casei Lactobacillus delbrueckii
  • Lactobacillus gasseri Lactobacillus rhamnosus
  • cells of the present disclosure include commensal bacteria such as Lactobacilli, clostridia, or bacteroides, or other cells recognized as edible in live form, such as Saccharomyces cerevisiae.
  • a cell is a probiotic microorganism that is safe for ingestion by an animal, e.g., a human.
  • Probiotic microorganisms include, without limitation, from Bacillus, Bifidobacterium, Enterococcus, Escherichia coli, Lactobacillus, Leuconostoc, Pediococcus and Streptococcus.
  • the present disclosure includes use of bacteria of the genus Bacillus, e.g.,, B. subtilis.
  • the microorganism is not a eukaryote.
  • the microorganism is not a eukaryote used for fermentation of alcoholic beverages, such as Saccharomyces.
  • a cell is a bacterial cell that can form a spore.
  • a spore can be a resilient form of a cell.
  • Bacterial spores can be dormant living forms that can exist in a desiccated and/or dehydrated state for significant periods of time and/or indefinitely.
  • the natural life cycle of various spore forming bacteria can includes germination of the spore in the presence of environmental nutrients and/or factors, proliferation of germinated cells, and re-sporulation in the event of environmental nutrient exhaustion.
  • a spore can germinate and/or proliferate after administration to a subject, e.g., in the gut of a subject, e.g., in the intestine of a subject.
  • Various spore-forming bacteria are known in the art and can be engineered to include, e.g., a heterologous nucleic acid including a transgene of the present disclosure.
  • an engineered cell is a cell that is in a spore state.
  • Exemplary engineered spores of the present disclosure include engineered spores of Bacillus species, e.g., for administration to a subject.
  • a spore can be a useful cell form in the context of the present disclosure at least in part because spores can retain ability to germinate and/or porliferate after a period of storage, e.g., a long period of storage, e.g., at room temperature, and for at least this reason spores are considered to have a long useful shelf life. Shelf-life can be an important factor in safety, satisfaction, and price point for consumer products making it a valuable asset both for the provider and consumer. Additionally, the resilient spore form allows the live organism to traverse the environment of the stomach which is widely known to inactivate enzymes and active molecules not otherwise formulated to withstand traversal of the stomach. Spore form therefore enables formulation of engineered cells in forms that are pleasing to consumers.
  • compositions and methods for extended release of a therapeutic agent in the gut where the composition includes an engineered cell, e.g., a spore form of an engineered cell. Due to their small size and resilience to heat, spores can also facilitate and/or enable lyophilization at a faster rate than comparable non-spore cells could be lyophilized with a comparable cell survival.
  • germination from spores can follow exponential decay, e.g., modelled by a constant percentage of spores germinating per minute and defined by the availability of nutrient triggers. Germination can results in a steady release of active live cells over a number of hours, which can further contribute to the period of time over which a dose is effective and/or delivers fiber-synthesizing enzyme to gut. Furthermore, active cells can re-enter a spore state in the absence of sufficient nutrients. Properties of germination and re-sporulation individual and together can allow administered cells to reside in the gut in a resilient spore form until contacted with digesta.
  • Spore forming bacteria and spores thereof include, for example, Bacillus subtilis PY79 and spores thereof.
  • Other spore forming microbes and spores thereof include but are not limited to Bacillus subtilis group members (e.g. Bacillus subtilis subsp. subtilis str. 168, and Bacillus subtilis subsp. Natto), Bacillus group members (e.g. Bacillus coagulans, Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus sp., Bacillus megatarium, and Bacillus subtilis subsp. Spizizenii).
  • Bacillus subtilis group members e.g. Bacillus subtilis subsp. subtilis str. 168, and Bacillus subtilis subsp. Natto
  • Bacillus group members e.g. Bacillus coagulans, Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus sp.
  • Clostridiaceae family members e.g., Clostridium butyricum, Clostridium acetobutylicum, Clostridium arbusti, Clostridium aurantibutyricum, Clostridium beijerinckii, Clostridium cellulovorans, Clostridium cellulolyticum, Clostridium thermocellum, Clostridium thermobutyricum, Clostridium pasteurianum, Clostridium kluyveri, Clostridium novyi, Clostridium saccharobutylicum, Clostridium thermosuccinogenes, Clostridium thermopalmarium, Clostridium saccharolyticum, Clostridium saccharoperbutylacetonicum, Clostridium tyrobutyricum, Clostridium tetanomorphum, Clostridium magnum, Clostridium ljungdahlii, Clostridium autoethanogenum, Clostridium
  • Bacillus subtilis strain DY Bacillus subtilis subsp. amylosacchariticus, Bacillus subtilis subsp. chungkookjang, Bacillus subtilis subsp. endophyticus, Bacillus subtilis subsp. globigii, Bacillus subtilis subsp. inaquosorum, Bacillus subtilis subsp. inaquosorum KCTC 13429, Bacillus subtilis subsp. krictiensis, Bacillus subtilis subsp. lactipan, Bacillus subtilis subsp. natto, Bacillus subtilis subsp. natto BEST195, Bacillus subtilis subsp.
  • Bacillus subtilis subsp. niger Bacillus subtilis subsp. qingdao, Bacillus subtilis subsp. sadata, Bacillus subtilis subsp. spizizenii, Bacillus subtilis subsp. spizizenii ATCC 6633, Bacillus subtilis subsp. spizizenii DV1-B-1, Bacillus subtilis subsp. spizizenii JCM 2499, Bacillus subtilis subsp. spizizenii RFWG1A3, Bacillus subtilis subsp. spizizenii RFWG1A4, Bacillus subtilis subsp.
  • Bacillus subtilis A29, Bacillus subtilis Abs3, Bacillus subtilis AP254, Bacillus subtilis At2, Bacillus subtilis B2, Bacillus subtilis B7-s, Bacillus subtilis BEST7003, Bacillus subtilis BEST7613, Bacillus subtilis BSn5 , Bacillus subtilis El, Bacillus subtilis gtP20b, Bacillus subtilis Hall, Bacillus subtilis HJ5, Bacillus subtilis J22, Bacillus subtilis J23, Bacillus subtilis J24, Bacillus subtilis J25, Bacillus subtilis J26, Bacillus subtilis J27, Bacillus subtilis KCTC 1028 ATCC 6051a, Bacillus subtilis LX-8, Bacillus subtilis MB73/2, Bacillus subtilis Miyagi -4, Bacillus subtilis Miyagi-4100, Bacillus subtilis PRO 1, Bacillus subtilis PS216, Bacillus subtilis PTS-394, Bacillus subtilis PY79, Bacillus subtilis
  • Bacillus subtilis strain DY Bacillus subtilis subsp. amylosacchariticus, Bacillus subtilis subsp. chungkookjang, Bacillus subtilis subsp. endophyticus, Bacillus subtilis subsp. globigii, Bacillus subtilis subsp. inaquosorum, Bacillus subtilis subsp. inaquosorum KCTC 13429, Bacillus subtilis subsp. krictiensis, Bacillus subtilis subsp. lactipan, Bacillus subtilis subsp. natto, Bacillus subtilis subsp. natto BEST195, Bacillus subtilis subsp.
  • Bacillus subtilis subsp. niger Bacillus subtilis subsp. qingdao, Bacillus subtilis subsp. sadata, Bacillus subtilis subsp. spizizenii, Bacillus subtilis subsp. spizizenii ATCC 6633, Bacillus subtilis subsp. spizizenii DV1-B-1, Bacillus subtilis subsp. spizizenii JCM 2499, Bacillus subtilis subsp. spizizenii RFWG1 A3, Bacillus subtilis subsp. spizizenii RFWG1A4, Bacillus subtilis subsp.
  • Bacillus subtilis subsp. subtilis str. BAB-1 Bacillus subtilis subsp. subtilis str. BSP1
  • Bacillus subtilis subsp. subtilis str. JH642 Bacillus subtilis subsp. subtilis str. MP11, Bacillus subtilis subsp. subtilis str. MP9, Bacillus subtilis subsp. subtilis str. OH 131.1, Bacillus subtilis subsp. subtilis str. RO 179, Bacillus subtilis subsp. subtilis str. RO-NN-1, Bacillus subtilis subsp. subtilis str. SC-8, Bacillus subtilis subsp. subtilis str.
  • Bacillus subtilis TO-A Bacillus subtilis TPK 210909, Bacillus subtilis UCMB5014, Bacillus subtilis XF-1, Bacillus subtilis YF001, Bacillus tequilensis, Bacillus tequilensis KCTC 13622, Bacillus vallismortis, Bacillus vallismortis DV1-F-3, Bacillus vallismortis NRRL B- 14890, Bacillus sp. AB01, Bacillus sp. AP102, Bacillus sp. AP143, Bacillus sp. AP183, Bacillus sp. AP189, Bacillus sp.
  • Bacillus sp. AP215 Bacillus sp. AP218, Bacillus sp. AP219, Bacillus sp. AP295, Bacillus sp. AP301, Bacillus sp. AP303, Bacillus sp. AP305, Bacillus sp. AP71, Bacillus sp. AP77, Bacillus sp. AP79, Bacillus sp. DI 0(2019), Bacillus sp. D9(2019), Bacillus sp. GeS7V, Bacillus sp. LiF4a, Bacillus sp. LJF-10, Bacillus sp.
  • spore forming microbes and spores thereof include but are not limited to a Lactobacillus bacterium, optionally selected from Lactobacillus paracasei, Lactobacillus brevis, Lactobacillus casei, Lactobacillus delbrueckii, Lactobacillus gasseri, Lactobacillus rhamnosus, Lactobacillus reuteri, Lactobacillus plantarum, and Lactobacillus johnsonii.
  • a Lactobacillus bacterium optionally selected from Lactobacillus paracasei, Lactobacillus brevis, Lactobacillus casei, Lactobacillus delbrueckii, Lactobacillus gasseri, Lactobacillus rhamnosus, Lactobacillus reuteri, Lactobacillus plantarum, and Lactobacillus johnsonii.
  • spore forming microbes and spores thereof include but are not limited to a Lactobacillus bacterium, optionally selected from Lactobacillus paracasei (Lactobacillus paracasei ATCC 334, Lactobacillus paracasei COM0101, Lactobacillus paracasei N1115, Lactobacillus paracasei NRIC 0644, Lactobacillus paracasei NRIC 1917, Lactobacillus paracasei NRIC 1981, Lactobacillus paracasei subsp. paracasei, Lactobacillus paracasei subsp. paracasei 8700:2, Lactobacillus paracasei subsp. paracasei ATCC 25302, Lactobacillus paracasei subsp.
  • Lactobacillus paracasei Lactobacillus paracasei ATCC 334, Lactobacillus paracasei COM0101, Lactobacillus paracasei N1115, Lactobacillus paracasei NRIC 0644, Lactobacillus paracasei
  • paracasei Lppl23 Lactobacillus paracasei subsp. paracasei Lppl25, Lactobacillus paracasei subsp. paracasei Lppl26, Lactobacillus paracasei subsp. paracasei Lppl4, Lactobacillus paracasei subsp. paracasei Lppl7, Lactobacillus paracasei subsp. paracasei Lppl89, Lactobacillus paracasei subsp. paracasei Lpp219, Lactobacillus paracasei subsp. paracasei Lpp22, Lactobacillus paracasei subsp. paracasei Lpp221, Lactobacillus paracasei subsp.
  • Lactobacillus paracasei subsp. paracasei Lpp7 Lactobacillus paracasei subsp. paracasei Lpp70,
  • Lactobacillus casei T71499 Lactobacillus casei UCD174, Lactobacillus casei UW1, Lactobacillus casei UW4, Lactobacillus casei W56
  • Lactobacillus johnsonii (Lactobacillus johnsonii 135-1-CHN, Lactobacillus johnsonii 16, Lactobacillus johnsonii ATCC 33200, Lactobacillus johnsonii DPC 6026, Lactobacillus johnsonii FI9785, Lactobacillus johnsonii N6.2, Lactobacillus johnsonii NCC 533, and Lactobacillus johnsonii pfOl.
  • Cells administered to a subject can express and/or deliver a fibersynthesizing enzyme to the subject.
  • a cell administered to a subject expresses a fiber-synthesizing enzyme in and/or delivers a fiber-synthesizing enzyme to ascending colon, traverse colon, and/or descending colon.
  • a cell administered to a subject colonizes the gut.
  • a cell administered to a subject expresses a fiber-synthesizing enzyme in gut and/or delivers a fiber-synthesizing enzyme to gut before, during, and/or after the cell has colonized the gut.
  • a cell administered to a subject is non-colonizing and can pass through the entire digestive tract, e.g., while expressing and/or delivering a fiber-synthesizing enzyme of the present disclosure.
  • an engineered cell is a cell that is able to pass through a subject’s gastrointestinal tract without persisting in the microbiome of the subject (orthogonal to the microbiome), optionally wherein the cell is an engineered B. subtilis cell.
  • the engineered cell is of a cell type that has been designated by a governmental regulatory authority, such as the United States Food and Drug Administration or an equivalent body of another country, as safe, or is a cell of a cell type that is otherwise known to be or regarded as safe by those of skill in the art.
  • a cell of the present disclosure is a cell that can be fermented in large batches, e.g., using minimal media, e.g., in a 30-3, 000L fermenter.
  • a cell of the present disclosure is a cell that can be purified as a biomass product including vegetative cells or spores, optionally wherein the cells of the biomass product can be readily purified and/or wherein the biomass product can be stabilized (e.g., by filtering and/or lyophilization, e.g., to facilitate shipping).
  • rapid spore formation upon nutrient starvation enables large fermentation batches to convert to spores at the end of growth. Spores can be readily stored, transported and/or purified from vegetative cells by heating the growth medium and removing the supernatant.
  • spores e.g., Bacillus subtilis spores
  • spores can be prepared by a technique that includes growing cells to high density in a nutrient limited medium to stimulate sporulation, followed by a step of purifying spores.
  • cells can be grown in Difco Sporulation Medium (0.8% Nutrient Broth, 0.1% KC1, 0.012% MgSO4 «7H 2 O, 0.5 mM NaOH, 1 mM Ca(NCh)2 0.01 mM MnCh, 1 uM FeSCh) at 37°C for 24-48 hours, with 250 rpm shaking to provide oxygen.
  • the resulting mixture of cell debris and spores can be heated to 80°C to kill and lyse vegetative cells followed by pelleting and rinsing three times with distilled water to remove cell debris and purify the spore layer. Spores prepared in this manner can be stable in water for more than a year.
  • a transgene of the present disclosure is introduced into a cell that includes a sequence having significant homology to the transgene, e.g., where the transgene has at least 80% identity (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with a sequence of the cell (e.g., a sequence of at least 50 nucleotides, e.g., at least 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 1,000, 2,000, 3,000, 4,000, or 5,000 nucleotides).
  • a sequence having significant homology to the transgene e.g., where the transgene has at least 80% identity (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity) with a sequence of the cell (e.g., a sequence of at least 50 nucleotides, e.
  • homology-based interaction of the cell nucleic acid sequence and transgene can compete for and/or inhibit integration of the transgene at a different target locus.
  • integration of the transgene e.g., at a target locus not homologous to the transgene
  • a homologous endogenous nucleic acid sequence of a cell is modified or deleted from the cell genome (e.g., by knockout) prior to introduction of the transgene nucleic acid sequence.
  • the present disclosure includes isolated fibersynthesizing enzymes and compositions including the same.
  • isolated fiber-synthesizing enzymes of the present disclosure need not be derived, isolated from such cells.
  • the present disclosure includes fiber-synthesizing enzymes isolated from any source.
  • a fiber-synthesizing enzyme of the present disclosure is produced by and/or isolated from a plant or bacterium in which the fiber-synthesizing enzyme is naturally expressed.
  • a fiber-synthesizing enzyme of the present disclosure is produced by and/or isolated from a plant, bacterium, or animal (e.g., a rat, mouse, cow, pig, or horse) engineered to express a fiber-synthesizing enzyme of the present disclosure, e.g., using standard techniques of molecular biology known to those of skill in the art.
  • Fiber-synthesizing enzymes of the present disclosure can be isolated by any means known to those of skill in the art. Those of skill in the art will appreciate that isolation of proteins is a well-established practice with a wide variety of known techniques at the disposal of those of skill in the art for that purpose. Methods of isolating fiber-synthesizing enzymes can include, e.g., expressing fiber-synthesizing enzymes in cell culture (e.g., bacterial cell culture or mammalian cell culture, e.g., E.
  • cell culture e.g., bacterial cell culture or mammalian cell culture, e.g., E.
  • isolated fiber-synthesizing enzyme can be processed, e.g., by lyophilization or ultrafiltration.
  • the present disclosure includes fiber-synthesizing enzyme formulations, e.g., where the fiber-synthesizing enzyme formulation can be or include one or more engineered cells of the present disclosure (e.g., in a spore form) and/or isolated fiber-synthesizing enzyme of the present disclosure.
  • Enzymes e.g., isolated fiber-synthesizing enzymes
  • cells of the present disclosure can be delivered to a subject in any of a variety of formulations.
  • the present disclosure includes, for example, formulation of isolated fiber-synthesizing enzymes and/or engineered cells of the present disclosure in any manner known for use in administration of probiotics.
  • the present disclosure includes administration of a fiber-synthesizing enzyme formulation to a subject.
  • the present disclosure includes pharmaceutically acceptable fiber-synthesizing enzyme formulations that include a pharmaceutically acceptable carrier or excipient.
  • a fiber-synthesizing enzyme formulation can be formulated as a dietary supplements. In some embodiments, a fiber-synthesizing enzyme formulation can be formulated in a freeze-dried powder form. In some embodiments, a fibersynthesizing enzyme formulation can be formulated as a powder in stick packaging or sachets. [0147] In some embodiments, a fiber-synthesizing enzyme formulation can be formulated in an oral dosage form such as a capsule or tablet (e.g., chewable tablets ). In some embodiments, a fiber-synthesizing enzyme formulation can be formulated as a gummy (e.g., including ingredients such as one or more of sugar and gelatin). The present disclosure includes administration of a fiber-synthesizing enzyme formulation formulated in a delayed release oral dosage form, e.g., an enterically coated oral dosage form.
  • a fiber-synthesizing enzyme formulation including without limitation chocolate, crackers, cereal, yogurt, natto, kombucha, or flour.
  • the present disclosure includes a fibersynthesizing enzyme formulation formulated in or as a food product and/or food ingredient such as chocolate, crackers, cereal, yogurt, natto, kombucha, or flour.
  • a fiber-synthesizing enzyme formulation is formulated in or as a food product or food ingredient that is a liquid such as a juice or drink.
  • spores can be formulated in a suspension.
  • a unit dose or dosage form of a food product or food ingredient of the present disclosure has volume of between about 0.05 mL and 500 mL, e.g., between about 0.5 mL and about 50 mL or between about 2.5 mL and 15 mL.
  • a unit dose or dosage form of a food product or food ingredient of the present disclosure has volume that has a lower bound of, e.g., 0.05 mL, 0.5 mL, 1 mL, 10 mL, 15 mL, 20 mL, 25 mL, 50 mL, or 100 mL and an upper bound of, e.g., 50 mL, 100 mL, 150 mL, 200 mL, 250 mL, 300 mL, 350 mL, 400 mL, 450 mL, or 500 mL.
  • a lower bound of e.g., 0.05 mL, 0.5 mL, 1 mL, 10 mL, 15 mL, 20 mL, 25 mL, 50 mL, or 100 mL and an upper bound of, e.g., 50 mL, 100 mL, 150 mL, 200 mL, 250 mL, 300 mL, 350 mL, 400
  • the present disclosure further includes a fiber-synthesizing enzyme formulation that is a sachet including one or more engineered cells of the present disclosure (e.g., in a spore form) and/or isolated fiber-synthesizing enzyme of the present disclosure.
  • a sachet is formulated for use of the one or more engineered cells of the present disclosure (e.g., in a spore form) and/or isolated fiber-synthesizing enzyme of the present disclosure with a food product for consumption, e.g., by combination of the food product with the fiber-synthesizing enzyme formulation, e.g., by mixing with the food product and/or distribution onto or into the food product (e.g., by sprinkling).
  • a fiber-synthesizing enzyme formulation is included in or added to a food product (e.g., a food ingredient) prior to administration to and/or consumption of the food product by a subject.
  • a food product is a food product for human consumption.
  • the food product is a food for animals, such as animal feed or biscuits.
  • a fiber-synthesizing enzyme formulation is included for activity after administration and/or consumption of the food product and/or food ingredient, e.g., in the gut of a subject, monosaccharides and/or disaccharides and increase concentration or amount of fiber in the food product and/or food ingredient prior to consumption by a subject.
  • Various formulations can be stored at ambient conditions for extend periods of time, e.g., at least 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 6 months, or 1 year, e.g., up to 1 month, 2 months, 3 months, 6 months, or 1 year.
  • a unit dose or dosage form of a formulation that includes an engineered cell of the present disclosure includes a number of colony-forming units (CFU) that is between 1E+04 and 1E+14 (e.g., about 1E+04, 1E+05, 1E+06, 1E+07, 1E+08, 1E+09, 1E+10, 1E+11, 1E+12, 1E+13, or 1E+14 CFU, or within a range having a lower bound of about 1E+04, 1E+05, 1E+06, 1E+07, 1E+08, 1E+09, or 1E+10 CFU and an upper bound of about 1E+08, 1E+09, 1E+10, 1E+11, 1E+12, 1E+13, or 1E+14 CFU).
  • CFU colony-forming units
  • a unit dose or dosage form includes 1E+11 CFU of engineered cells (e.g., spores).
  • engineered cells e.g., spores
  • Various examples of live cell formulation administration are known in the art.
  • 2.25E+11 CFU was found to be a tolerable dose with no observable adverse effects.
  • Natto a food made through fermentation with bacillus subtilis can contain as much as 1E+09 CFU per gram and a typical consumed portion of natto ( ⁇ 90-100g) can include 1E+11 CFU.
  • Some recommendations for consumption of Bacillus coagulans recommend a daily dosage of 1E+11 - 2E+11 CFU.
  • Animal studies support safety and efficacy of CFU dosage levels provided herein, e.g., demonstrating that 7E+12 and 9E+12 as a safe dosages, e.g., for a 70kg human.
  • a fiber-synthesizing enzyme formulation of the present disclosure is administered to a subject in need thereof.
  • administration of a fiber-synthesizing enzyme formulation of the present disclosure causes production (e.g., in a 1, 3, 6, 12 or 24 hour period) of at least 1g soluble fiber, e.g., at least 1g, 2g, 3g, 4g, 5g, 10g, 15g, 20g, 25g, 30g, 35g, or 40g.
  • administration of a fiber-synthesizing enzyme formulation of the present disclosure causes production (e.g., in a 1, 3, 6, 12 or 24 hour period) of at least 5g soluble fiber.
  • administration of a fibersynthesizing enzyme formulation of the present disclosure causes production (e.g., in a 1, 3, 6, 12 or 24 hour period) of at least 10g soluble fiber.
  • administration of a fiber-synthesizing enzyme formulation of the present disclosure causes production (e.g., in a 1, 3, 6, 12 or 24 hour period) of an amount of soluble fiber that is in a range having a lower bound of 1g, 2g, 3g, 4g, or 5g and an upper bound of 5g, 10g, 15g, 20g, 25g, 30g, 35g, or 40g.
  • production of fiber is caused by administration of a single dose or dosage form of a fiber-synthesizing enzyme formulation of the present disclosure.
  • a recommended total amount of daily fiber e.g., by consumption and/or synthesis by isolated fiber-synthesizing enzymes and/or engineered cells of the present disclosure is 25 to 30g per day, including 6g to 8g per day soluble fiber (about 14 total fiber).
  • administration of a fiber-synthesizing enzyme formulation of the present disclosure causes incorporation into fiber (e.g., in a 1, 3, 6, 12 or 24 hour period) of at least 1g carbohydrate, e.g., at least 1g, 2g, 3g, 4g, 5g, 10g, 15g, 20g, 25g, 30g, 35g, or 40g.
  • administration of a fiber-synthesizing enzyme formulation of the present disclosure causes incorporation into fiber (e.g., in a 1, 3, 6, 12 or 24 hour period) of at least 5g carbohydrate.
  • administration of a fiber-synthesizing enzyme formulation of the present disclosure causes incorporation into fiber (e.g., in a 1, 3, 6, 12 or 24 hour period) of at least 10g carbohydrate.
  • administration of a fiber-synthesizing enzyme formulation of the present disclosure causes incorporation into fiber (e.g., in a 1, 3, 6, 12 or 24 hour period) of an amount of carbohydrate that is in a range having a lower bound of 1g, 2g, 3g, 4g, or 5g and an upper bound of 5g, 10g, 15g, 20g, 25g, 30g, 35g, or 40g.
  • production of fiber is caused by administration of a single dose or dosage form of a fiber-synthesizing enzyme formulation of the present disclosure.
  • typical daily consumption of carbohydrates can include, e.g., about 45g-77g sucrose.
  • administration of a fiber-synthesizing enzyme formulation of the present disclosure causes cleavage of (e.g., in a 1, 3, 6, 12 or 24 hour period) of at least 1g substrate carbohydrate, e.g., at least 1g, 2g, 3g, 4g, 5g, 10g, 15g, 20g, 25g, 30g, 35g, or 40g.
  • administration of a fiber-synthesizing enzyme formulation of the present disclosure causes cleavage of (e.g., in a 1, 3, 6, 12 or 24 hour period) of at least 5g substrate carbohydrate.
  • administration of a fiber-synthesizing enzyme formulation of the present disclosure causes cleavage of (e.g., in a 1, 3, 6, 12 or 24 hour period) of at least 10g substrate carbohydrate.
  • administration of a fibersynthesizing enzyme formulation of the present disclosure causes cleavage of (e.g., in a 1, 3, 6, 12 or 24 hour period) of an amount of substrate carbohydrate that is in a range having a lower bound of 1g, 2g, 3g, 4g, or 5g and an upper bound of 5g, 10g, 15g, 20g, 25g, 30g, 35g, or 40g.
  • a fiber-synthesizing enzyme formulation of the present disclosure that includes an engineered cell of the present closure can dramatically impact ratio of substrate carbohydrate to a synthesized fiber type in gut.
  • sucrose is utilized as a substrate for fiber synthesis by a fibersynthesizing enzyme expressed by an engineered cell, such that 5g of fiber (e.g., levan) is produced, the total simple sugar content is decreased to 55g and the total soluble fiber is increased to 9g, fiber: sucrose ratio becomes 16%. It is likely that many consumers have an intake of soluble fiber significantly lower than 4 g a day which would make the impact of administration of a fiber-synthesizing enzyme formulation of the present disclosure even more dramatic.
  • carbohydrate e.g., consumed and/or gut carbohydrate, e.g., monosaccharides and/or disaccharides
  • fiber e.g., consumed and/or gut fiber
  • carbohydrate e.g., consumed and/or gut carbohydrate, e.g., monosaccharides and/or disaccharides
  • fiber e.g., consumed and/or gut fiber
  • carbohydrate e.g., consumed and/or gut carbohydrate, e.g., monosaccharides and/or disaccharides
  • fiber e.g., consumed and/or gut fiber
  • synthesis of fiber from fructose generated by cleavage of sucrose can be measured by cognate release of glucose.
  • engineered cells are cultured in growth media together with sucrose and change in the amount of glucose in media can be quantified, e.g., by a variety of enzymatic assays and/or by direct high pressure liquid chromatography measurement.
  • Other methods include detection of fibersynthesizing enzyme in stool, e.g., where the fiber-synthesizing enzyme is secreted in gut by engineered cells. Samples can be derived from excrement or through invasive or other means.
  • Another method of measuring soluble fiber production includes chromatography and/or NMR of stool. This method can be particularly effective for rarely consumed fibers such as levan.
  • Microbiome composition itself can also provide an indication of fiber-synthesizing enzyme activity.
  • Microbiome composition can be routinely measured by metagenomics. A decrease in number or ratio of strains associated with simple sugar dysbiosis and/or an increase in strains associated with healthy gut function from a high fiber diet demonstrate therapeutic efficacy.
  • a fiber-synthesizing enzyme formulation is administered in a therapeutically effective amount and/or delivers a therapeutically effective amount of fiber- synthesizing enzyme.
  • isolated fiber-synthesizing enzymes are administered in a therapeutically effective amount (e.g., a therapeutically effective number of cells) and/or deliver a therapeutically effective amount of fiber-synthesizing enzyme.
  • engineered cells are administered in a therapeutically effective amount (e.g., a therapeutically effective number of cells) and/or deliver a therapeutically effective amount of fiber-synthesizing enzyme.
  • the engineered cells are non-colonizing cells.
  • the engineered cells are spore-forming cells.
  • the engineered cells germinate in the gut of a subject, e.g., the gut of a human subject, following administration to the subject.
  • engineered cells administered to a subject germinate transiently in the gut of the subject.
  • engineered cells administered to a subject secrete fiber-synthesizing enzyme in the gut of the subject.
  • engineered cells of a single administered dose of a fiber-synthesizing enzyme formulation, fiber-synthesizing enzyme produced by engineered cells of a single administered dose of a fiber-synthesizing enzyme formulation, and/or isolated fibersynthesizing enzyme delivered by a single administered dose of a fiber-synthesizing enzyme formulation can be detected in the gut of the subject, e.g., for a period of at least 6 hours (e.g., at least 6, 12, 18, 24, 48, or 72 hours, e.g., for a period of time having a lower bound of 6, 12, 18, or 24 hours and an upper bound of 12, 24, 48, 72, 96, or 120 hours).
  • a fiber-synthesizing enzyme formulation the present disclosure is administered to a subject, before (e.g., up to 1, 2, 3, 4, 5, 6, 12, 24, or 48 hours prior to), during, or after (e.g, up to ., up to 1, 2, 3, 4, 5, 6, 12, 24, or 48 hours after) consumption of food by the subject, optionally wherein the food includes carbohydrates (e.g., monosaccharides and/or disaccharides, e.g., sucrose).
  • carbohydrates e.g., monosaccharides and/or disaccharides, e.g., sucrose
  • a fibersynthesizing enzyme formulation the present disclosure is administered in a dosage regimen, e.g., where a subject is administered a single daily dose, multiple daily doses (e.g., two or three daily doses), or one dose for each period of a certain number of days, e.g., 1, 2, 3, 4, 5, 6, or 7 days.
  • a certain number of days e.g. 1, 2, 3, 4, 5, 6, or 7 days.
  • the present inventors have determined one tablet a day is preferred by consumers and, among other things, is particularly preferable to to taking a tablet or other form of administration with each meal. This is partly driven by enabling privacy, wherein meals can be enjoyed under any circumstances without drawing attention to the use of the supplement.
  • efficacy in a single dose is achieved by delivering the active enzyme in Bacillus subliHs. which traverses the intestinal tract in a manner different to that of formulated supplements.
  • the present disclosure includes the recognition that, in various embodiments, it can be beneficial for the expected time passage of a composition of the present disclosure through a subject’s gastrointestinal tract to be longer than the expected time for passage of typical foods through the gastrointestinal tract of the subject, which can be referred to herein as slow passage.
  • slow passage is that a single administration of a composition provided herein can express an enzyme of the present disclosure in the subject for a period of time that includes multiple meals and/or a period of time that is at least 3 hours (e.g., at least 3, 6, 9, 12, 18, or 24 hours, e.g., a period of time that is at least 3 to 6 hours, 3 to 9 hours, 3 to 12 hours, 3 to 18 hours, 3 to 24 hours, 6 to 9 hours, 6 to 12 hours, 6 to 18 hours, 6 to 24 hours, 12 to 18 hours, or 12 to 24 hours).
  • slow passage can be characteristic of compositions that transiently adhere to the lining of the intestine.
  • purified enzymes delivered e.g., using various slow release formulations
  • the present disclosure includes the recognition that, in various embodiments, it can be beneficial for a composition of the present disclosure to pass through the stomach of a subject without significant loss of cells (e.g., survival of cells) or cell viability (e.g., capacity to germinate and/or proliferate). In various embodiments, loss of cells or cell viability is less than 50%, e.g., less than 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, or 1%.
  • the present disclosure includes the recognition that, in various embodiments, it can be beneficial for a composition of the present disclosure to pass through the stomach of a subject without significant loss of isolated fiber-synthesizing enzyme activity.
  • loss of fibersynthesizing enzyme activity is less than 50%, e.g., less than 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, or 1%.
  • the present disclosure includes the recognition that, in various embodiments, it can be beneficial for a composition of the present disclosure to pass through the gut within a limited timeframe (gut residency time).
  • Agents that include protective layers can be subject to passage times that vary with the activity of the intestinal tract, which, for example, can increase or decrease depending on eating behaviors of the subject and content consumed.
  • Agents that colonize the gut can provide long-term delivery of an expressed transgene product, but the extended residency of colonizing bacteria can allow time for mutations in the bacteria, e.g., mutations that reduce transgene expression, and proliferation or population size can be difficult to monitor, stabilize, and/or control. An inflammatory and/or immune response against a colonizing bacteria could also arise over time. Colonization can also impact the composition of the microbiome with respect to other microbes, e.g., by causing loss of a similar strain present in the microbiome prior to administration of an agent of the present disclosure. Extended residency associated with colonization can also reveal unexpected characteristics, such as the discovered carcinogenic effects of colibactin produced by the colonizing probiotic E.
  • gut residency time of a composition of the present disclosure is less than 10 days, e.g., less than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 days. In various embodiments, residency time is measured from administration of a dose of a fiber-synthesizing enzyme formulation of the present disclosure to a time at which the subject includes a number of cells administered with or derived from the cell composition that is no more than 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, 0.01%, 0.005%, or 0.001% the total number of cells administered in the dose.
  • clearance is measured as the inability to detect DNA characteristic of administered cells in DNA samples of the subject, e.g., isolated from stool of the subject.
  • DNA samples of the subject e.g., isolated from stool of the subject.
  • a cell composition administered in repeated doses can therefore be advantageous as compared to a colonizing cell composition, e.g., where individual doses have a limited residency time and a plurality of doses over time can be used to extend duration of treatment.
  • cells of the present disclosure are cells that lack one or more functions required for survival in and/or colonization of the gut, including but not limited to, reliance on oxygen as an electron acceptor, susceptibility to defenses of host microbes, inability to participate in the cross-feeding ecosystem of the established microbiome, and/or lack of offensive self-preservation against host microbiome strains.
  • a fibersynthesizing enzyme formulation before, during, or after consumption of carbohydrate e.g., monosaccharides and/or disaccharides, e.g., sucrose
  • carbohydrate e.g., monosaccharides and/or disaccharides, e.g., sucrose
  • administration to a subject of a fibersynthesizing enzyme formulation before, during, or after consumption of carbohydrate can decrease concentration or amount of monosaccharides and/or disaccharides in the gut of the subject and/or decrease the rate or amount of fructose absorbed by the intestine of the subject and/or decrease the rate or amount of monosaccharides and/or disaccharides processed by microbiome cells of the subject, and also increase the production of fiber.
  • administration of a fiber-synthesizing enzyme formulation in need thereof can treat a condition associated with or caused by consumption of carbohydrate (e.g., monosaccharides and/or disaccharides), e.g., high blood pressure, heart disease, obesity, diabetes, high blood glucose and other health problems.
  • administration of a fiber-synthesizing enzyme formulation of the present disclosure to a subject in need thereof can treat a condition associated with or caused by low soluble fiber consumption, e.g., high blood cholesterol, heart disease, obesity, diabetes, high blood glucose, and other health problems.
  • administration of a fibersynthesizing enzyme formulation of the present disclosure to a subject in need thereof can provide health benefits associated with consumption of soluble fiber, including without limitation reduced risk of high blood cholesterol, heart disease, obesity, diabetes, high blood glucose, and other health problems.
  • a fiber-synthesizing enzyme formulation is administered to a subject in need thereof, wherein the subject has, has been diagnosed as having, or is at risk of developing one or more of a condition associated with or caused by consumption of carbohydrate (e.g., monosaccharides and/or di saccharides), caused by low soluble fiber consumption, or preventable by soluble fiber consumption, e.g., where the condition is selected from high blood pressure, heart disease, obesity, diabetes, high blood glucose and other health problems.
  • carbohydrate e.g., monosaccharides and/or di saccharides
  • a fiber-synthesizing enzyme formulation is administered to a subject for weight management, e.g., for dieting and/or for treatment of obesity.
  • the subject is overweight or obese.
  • obesity refers to a condition of having a body mass index equal to or greater than 30.
  • overweight refers to a condition of having a body mass index equal to or greater than 25.
  • a fiber-synthesizing enzyme formulation of the present disclosure can also be used by an individual who is neither overweight nor obese (body mass index below 25) for purposes of weight management or for any other purposes provided herein, e.g., for gut health.
  • a fiber-synthesizing enzyme formulation is administered to a subject having consumed in the preceding 24 hours an amount of carbohydrate (e.g., an amount of total carbohydrate or monosaccharides and/or disaccharides) that is equal to or greater than about 45g (e.g., at least about 45g, 50g, 55g, 60g, 65g, 70g, 80g, 85g, 90g, 95g, 100g, 105g, 110g, 115g, 120g, 125g, 130g, 135g, 140g, 145g, 150g, 155g, 160g, 165g, 170g, 175g, 180g, 185g, 190g, 195g, 200g, or more).
  • carbohydrate e.g., an amount of total carbohydrate or monosaccharides and/or disaccharides
  • about 45g e.g., at least about 45g, 50g, 55g, 60g, 65g, 70g, 80g, 85g
  • a fiber-synthesizing enzyme formulation is administered to a subject having consumed in the preceding 24 hours an amount of fiber that is equal to or less than about 50g (e.g., less than about 50g, 45g, 40g, 35g, 30g, 25g, 20g, 15g, 10g, 5g, or 1g).
  • a fiber-synthesizing enzyme formulation is administered to a subject having consumed in the preceding 24 hours an amount of soluble fiber that is equal to or less than about 20g (e.g., less than about 20g, 15g, 10g, 9g, 8g, 7g, 6g, 5g, 4g, 3g, 2g, or 1g).
  • a fiber-synthesizing enzyme formulation is administered to a subject having consumed during at least about 10% (e.g., at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) of the preceding 5 or more days (e.g., 5, 7, 10, 14, 28, 42, 50, 100, 150, 200, 250, 300, 350, or 365 days) an amount of carbohydrate (e.g., an amount of total carbohydrate or monosaccharides and/or disaccharides) that is equal to or greater than about 45g (e.g., at least about 45g, 50g, 55g, 60g, 65g, 70g, 80g, 85g, 90g, 95g, 100g, 105g, 110g, 115g, 120g, 125g, 130g, 135g, 140g, 145g, 150g, 155g, 160g, 165g, 170g, 175g, 180g, 185g, 190g,
  • carbohydrate e.
  • a fiber-synthesizing enzyme formulation is administered to a subject having consumed during at least about 10% (e.g., at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) of the preceding 5 or more days (e.g., 5, 7, 10, 14, 28, 42, 50, 100, 150, 200, 250, 300, 350, or 365 days) an amount of fiber that is equal to or less than about 50g (e.g., less than about 50g, 45g, 40g, 35g, 30g, 25g, 20g, 15g, 10g, 5g, or 1g).
  • a fiber-synthesizing enzyme formulation is administered to a subject having consumed during at least about 10% (e.g., at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) of the preceding 5 or more days (e.g., 5, 7, 10, 14, 28, 42, 50, 100, 150, 200, 250, 300, 350, or 365 days) an amount of soluble fiber that is equal to or less than about 20g (e.g., less than about 20g, 15g, 10g, 9g, 8g, 7g, 6g, 5g, 4g, 3g, 2g, or 1g).
  • a fiber-synthesizing enzyme formulation is administered to a subject that is a human.
  • a fiber-synthesizing enzyme formulation is administered to a subject that is an animal, e.g., a domestic animal (e.g., a cat, dog, or other domestic animal), a livestock animal (e.g., a horse, cow, sheep, goat, pig, or other livestock animal), or a zoo animal (e.g., a non-human primate, elephant, hippopotamus, rhinoceros, bear, or other zoo animal).
  • a domestic animal e.g., a cat, dog, or other domestic animal
  • a livestock animal e.g., a horse, cow, sheep, goat, pig, or other livestock animal
  • a zoo animal e.g., a non-human primate, elephant, hippopotamus, rhinoceros, bear, or other zoo animal.
  • treatment achieved by administration of a fibersynthesizing enzyme formulation is advantageous as compared to direct consumption of fiber.
  • direct consumption of fiber does not prevent an overabundance of purified sugars in the colon.
  • a single daily dose of fiber only mediates one bolus passing through the digestive tract and may not affect other food portions containing sugar consumed throughout the day.
  • Large doses of fiber also have physicochemical and biochemical properties that are abnormal for food, leading to changes in osmotic pressure and blooms in bacterial growth with associated negative experiences. Ingesting a large amount of fiber quickly can promote intestinal gas, abdominal bloating and cramping.
  • engineered cells temporarily adhere to and/or reside within the mucus layer lining the wall of the intestine.
  • the proximity of the mucus layer to passing digesta allows for rapid interaction of engineered cells and/or fiber-synthesizing enzyme with passing digesta.
  • Engineered bacterial spores and other live cells are known to transit the intestine over a period of greater than 9 hours, allowing for interaction of engineered cells and/or fibersynthesizing enzyme produced thereby with multiple meals (e.g., two meals consumed within a period of 9 hours).
  • Bacterial spores are extremely robust, with demonstrated ability to survive intact through the environment of the stomach. We were further able to identify, in particular embodiments, a microbial spore former that is active in the intestinal environment but does not colonize the intestine long term. This microbe, Bacillus subtilis. has a long history of being consumed in food as an active reagent in fermentation of soy beans, producing the food natto, and is considered food safe. For at least these reasons, administration of an engineered cell of the present disclosure can provide longer lasting activity than ingestion of purified enzyme. Engineered cells (e.g. spores) of the present disclosure can pass safely pass through the stomach and subsequently express fiber-synthesizing enzyme in intestine.
  • Engineered cells (e.g. spores) of the present disclosure can pass safely pass through the stomach and subsequently express fiber-synthesizing enzyme in intestine.
  • subtilis is a preferred candidate engineered cell at least in part because, when administered to a subject, it becomes caught in the mucosa (sticky ball model).
  • B. subtilis is therefore exemplary of the limited set of delivery vectors that are food safe, non-colonizing (orthogonal to the microbiome), and spore forming.
  • the present Examples demonstrate the construction of transgenes that encode a fiber-synthesizing enzyme.
  • the present Examples further demonstrate production of engineered cells that include and express a transgene encoding fiber-synthesizing enzyme.
  • engineered cells of the present disclosure are suitable for administration to subjects, including human subjects, and express fiber-synthesizing enzyme. Accordingly, the present Examples illustrate engineered cells representative of compositions disclosed herein and suitable for various applications provided herein, including without limitation applications that include administration to a human subject.
  • a transgene was constructed for expression of a fiber-synthesizing enzyme.
  • the transgene was produced using standard techniques of molecular biology.
  • the transgene included nucleic acid sequences encoding a fiber-synthesizing enzyme that included a secretion polypeptide.
  • the present example utilizes SacB levansucrase enzyme.
  • the nucleic acid encoding the fiber-synthesizing enzyme was derived from B.s.
  • Natto sacB has the following sequence, with the secretion polypeptide encoding sequence bolded and underlined: atgaacatcaaaaagtttgcaaaacaagcaacagtattaacctttactaccgcactgctggcaggaggcgcaactcaag cgtttgcgaaagaaacgaaccaaaagccatataaggaaacatacggcatttcccatattacacgccatgatatgctgcaaatccctgaacag caaaaaaatgaaaatatcaagttcctgaattcgattcgtccacaattaaaaatatctcttctgcaaaaggcctggacgtttgggacagctggc cattacaaaaacgctttgggacaaactatcacggctaccacatcgtc
  • the protein product SacB has the following amino acid sequence, with the secretion polypeptide sequence bolded and underlined:
  • the nucleic acid sequence encoding fiber-synthesizing enzyme derived from B.s. Natto was operably linked with a nucleic acid sequence encoding a secretion polypeptide, such that the encoded fiber-synthesizing enzyme was a fusion polypeptide including a secretion polypeptide.
  • the nucleic acid sequence encoding the fusion polypeptide was analyzed for secondary structure, at least in part because significant secondary structure can cause translation termination and poor expression. Base pairs that significantly contributed to secondary structure in the nucleic acid sequence were modified by silent modifications of nucleic acid sequence (e.g., non-coding and/or synonymous modifications of nucleic acid sequence) that reduced the contribution to secondary structure.
  • the nucleic acid sequence encoding the fiber-synthesizing enzyme was transformed into B. subtilis PY79 cells and operably linked to hag promoter by homologous recombination at the endogenous hag locus of B. subtilis PY79 genome with the addition of a modifying mutation in the promoter sequence by homologous integration as described in US 16/048,147 (published as US 2019/0076489) and PCT/US 18/50957 (published as WO 2019/055707) herein incorporated by reference in their entirety and with respect to regulatory sequences and systems disclosed therein.
  • Fiber-synthesizing enzymatic activity was measured by the following assay. Because levansucrase cleavage of sucrose releases glucose, accumulation of glucose provides a measure of fiber-synthesizing enzyme activity. Accumulation of glucose is directly proportional to the cleavage of sucrose and formation of fructooligosaccharides.
  • Various glucose meters are known in the art and can be standardized for measurement of glucose concentrations in bacterial media. Engineered bacteria of the present Example were cultured in media together with a defined concentration of sucrose. After culture for a defined period, bacteria were pelleted by centrifugation (21xg for 2 minutes) and remaining supernatant was contacted with a glucose meter testing strip. Levan production (mg/dL over time) is shown in Fig. 1.
  • Fructose polymer formation was confirmed by addition of xylose isomerase to collected supernatant.
  • Xylose isomerase can convert glucose to fructose, and addition of xylose isomerase equilibrates free, non-polymerized fructose with free glucose. If fructooligosaccharide fibers have formed, then the level of free, non-polymerized fructose would be significantly lower than glucose, such that xylose isomerase would catalyze conversion of glucose into fructose causing the glucose level of the supernatant to drop.
  • fructooligosaccharides have not formed, then the level of free, non-polymerized fructose would be comparable or higher than that of glucose, in which case xylose isomerase would not catalyze conversion of glucose to fructose and the level of glucose would rise or remain unchanged. Results demonstrated that addition of xylose isomerase catalyzed conversion of glucose into fructose causing the glucose level of the supernatant to drop, indicative of fructooligosaccharide fiber formation.
  • the present Example demonstrated that transgene encoding a fiber-synthesizing enzyme derived from Fl-sacB of B. subtilis sp. natto expressed a highly active fiber-synthesizing enzyme.
  • the present disclosure further includes the recognition that levansucrase (SacB) derived from B.s. Natto has certain exemplary qualities that confirm the utility of SacB expression in gut.
  • the optimum pH range for levansucrase activity of sacB is 6-7 which matches that of the small intestine. SacB enzyme is naturally secreted and therefore stable outside of the engineered cell, amenable to secretion through a gram positive cell envelope.
  • the present Example demonstrated engineering of target cells to increase the efficiency of transformation of the target cells with a transgene including a nucleic acid sequence encoding a fiber-synthesizing enzyme, where the nucleic acid sequence that encodes the fibersynthesizing enzyme has at least 80% identity to an endogenous sequence of a target cell type.
  • the present Example provides in particular a transgene as set forth in Example 1, encoding Fl- SacB, and target cells that are B. subtilis PY79 cells.
  • the transgene was flanked by homology regions (often referred to as “homology arms”) of about 800 bp designed to target the transgene for integration at the B. subtilis PY79 hag locus by homologous recombination.
  • the transgene included a sequence of about 1400 bp having significant (greater than 80%) identity with B. subtilis PY79 sacB gene. Because of the 1400 bp region of significant identity between the transgene and the endogenous sacB gene, homologous recombination between the transgene and the endogenous sacB gene can complete with homologous recombination between the homology arms and the endogenous hag locus. Due it’s large size, the 1400 bp region may be more likely to recombine with the endogenous genome than the desired homology arms. To reduce and/or obviate recombination between the transgene and the endogenous SacB gene, the corresponding sequence of the endogenous sacB gene was knocked out by deletion using standard molecular biology techniques.
  • Example 3 Engineered Cells for Constitutive Expression of Fiber-Synthesizing Enzyme
  • the present Example provides an exemplary demonstration of cells engineered for constitutive expression of a transgene-encoded fiber-synthesizing enzyme.
  • the present Example includes a transgene that includes a flagellin gene promoter operably linked to a nucleic acid sequence encoding a fibersynthesizing enzyme.
  • Many bacteria have a flagellin gene homolog. Flagellin genes go by many names, some examples of which are: hag in B. subtilis; fliC in Escherichia coH.
  • flagellin gene expression system disclosed herein is merely one of many expression systems available for expression (e.g., constitutive expression) of coding sequences in in bacteria, and that the flagellin system disclosed herein was used as a matter of experimental convenience based on available reagents.
  • flagellar regulatory machinery of B. subtilis was adapted to accomplish constitutive and robust expression of a fiber-synthesizing enzyme, levansucrase.
  • Various bacteria, including B. subtilis regulate motility, at least in part, by a sophisticated system involving several positive and negative regulators.
  • the constitutive expression strategy of this Example includes removing negative regulators of the highly expressed B. subtilis flagellin gene, called hag.
  • the gene encoding the flagellar subunit of B. subtilis flagellin is hag, and the protein it encodes is expressed in hundreds of thousands of copies in a single bacterium in the right conditions, using a transcriptional promoter and a ribosome binding site that are both robust. Transcription is mediated by a sigma factor, SigD, which is repressed by the FlgM protein. Inactivation (e.g., by deletion or mutation) of flgM expression greatly enhances constitutive expression and activity of SigD, and consequently results in higher and more constitutive transcription of the flagellar operon and specifically the hag gene.
  • SigD sigma factor
  • transcripts generated from the hag gene is enabled by a highly robust ribosome binding site that is bound and repressed post-transcriptionally by a protein called CsrA.
  • CsrA a protein that is bound and repressed post-transcriptionally by a protein called CsrA.
  • a single point mutation in the CsrA binding site abrogates its binding and results in increased constitutive translation of the Hag protein.
  • bacteria include a point mutation in the binding site of CsrA in combination with a mutation that inactivates flgM expression.
  • constitutive expression from any SigD-based or flagellin promoter system is increased.
  • mutation of a CsrA binding site is distinct from simple deletion of CsrA because CsrA is a pluripotent regulator in many bacterial species and its deletion could have many other potentially undesirable phenotypic effects on a cell.
  • the mutation reduces or precludes CsrA repression of the hag promoter specifically and/or uniquely, rather than removing CsrA repression from any other targets it may have.
  • Certain nucleic acids disclosed herein thus include a transgene comprising a flagellin gene transcription regulatory sequence (e.g., a flagellin gene promoter, e.g., a hag promoter) operatively linked with a heterologous nucleic acid sequence encoding a fibersynthesizing enzyme.
  • the hag promoter comprises genetic alterations such that, upon transcription of an mRNA from the hag promoter, CsrA inhibition of mRNA translation is reduced or repressed compared to a reference with wild-type or canonical CsrA binding sites.
  • the flagellin gene promoter is a hag gene promoter.
  • the flagellin homolog is hag in Bacillus, e.g., B. subtilis.
  • the flagellin gene promoter is native to the cell in which the subject protein is to be expressed. For example, this can be the case when the expression construct is located in a bacterial chromosome.
  • Hag can refer to the protein (or gene encoding such protein) annotated as “Hag” in B. subtilis or any homolog in the same or other genus, species, or strain, which is the structural subunit also known more generically as “flagellin” used to assemble a flagellum. It is known by several other names in other genera, species, and strains.
  • subtilis Hag is encoded by the following sequence: atgagaattaaccacaatattgcagcgcttaacacactgaaccgtttgtcttcaaacaacagtgcgagccaaaagaacatggaga aactttcttcaggtcttcgcatcaaccgtgcgggagatgacgcagcaggtcttgcgatctctgaaaaatgagaggacaaatcagaggtctt gaaatggcttctaaaaactctcaagacggaatctctctttatccaaacagctgagggtgcattaactgaaactcatgcgatccttcaacgtgtttc gtgtttc gtgagctagttgttcaagctggaaacactggaactcaggacaaagcaactgatttgcaattat
  • hag promoter refers to a naturally occurring flagellin gene promoter cognate from genus Bacillus and promoters having sequences substantially identical (e.g., at least 80%, e.g., 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical) thereto or hybridizing specifically thereto.
  • sequences substantially identical e.g., at least 80%, e.g., 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical
  • the hag promoter is comprised in a 273 base-pair sequence 5' of the start codon of the hag gene, having the nucleic acid sequence: ggaattgacgccccaaagcatattgatattcacaggaaagaaatttacttgaccattcaggaagaaaataaccgtgcagcagcgttatccag cgatgtgatctccgcattatcctcacaaaaaaagtgaggatttttttttgtattaacaaaatcagagacaatccgatattaatgatgtag ccgggaggaggcgcaaaagactcagccagttacaaaataagggcacaaggacgtgccttaacaacatattcagggaggaggacaaca(ATG) (SEQ ID NO: 23) (where “ATG” represents the start codon of hag).
  • ATG represents
  • hag promoter includes a SigD recognition sequence defined by a “ttaa” sequence (underlined), which is the -35 SigD RNA polymerase binding site and a “tccgatat” sequence (underlined), which is the -10 SigD RNA polymerase binding site.
  • hag has two CsrA binding sites defined by the sequences “gcacaaggacgf ’ (SEQ ID NO: 24) (high-affinity binding site 1, or “BS1”) (underlined) and “attcagggaggaa” (SEQ ID NO: 25) (low-affinity binding site 2, or “BS2”) (underlined).
  • the hag promoter also includes a Shine- Dalgarno sequence: agggagga (SEQ ID NO: 26).
  • CsrA Carbon storage regulator A
  • CsrA protein binds to a stem-loop RNA motif having the consensus sequence AGGA in the loop, thereby inhibiting translation into polypeptide of a nucleic acid sequence incorporated in an mRNA comprising the consensus sequence.
  • CsrA can inhibit expression of an mRNA transcribed from the hag promoter either directly by binding to the RNA and preventing translation or indirectly by binding to another RNA that encodes a protein that otherwise regulates flagellar expression.
  • CsrA is encoded in B.
  • subtilis by the sequence: atgctagttttatcgcggaaaataaacgaagcgattcaaataggtgctgatattgaagtaaagtgattgcggttgaaggggatcaagtgaag cttggaattgacgccccaaagcatattgatattcacaggaaagaaatttacttgaccattcaggaagaaaataaccgtgcagcagcgttatcc agcgatgtgatctcgcattatcctcacaaaaaaagtga (SEQ ID NO: 27).
  • transgenes of the present disclosure include genetic modifications in a flagellin gene promoter that, upon transcription from the promoter into a transcript, such as mRNA, reduce and/or repress CsrA inhibition of mRNA translation.
  • the present disclosure contemplates several genetic modifications to a flagellin gene promoter, and, in particular, to a hag promoter, to reduce and/or repress CsrA inhibition of mRNA translation.
  • genetic modifications to hag to inhibit CsrA repression of translation can comprise an alteration of a stem and loop structure in either or both of BS1 or BS2.
  • the genetic modification is an insertion or a deletion of one or more nucleotides.
  • a genetic modification can include one or more point mutations to CsrA BS1 (binding site IP.
  • BS1 can be modified by altering one or a plurality (e.g., two, three, or four) nucleotides in the CsrA recognition sequence, AGGA.
  • the AGGA binding motif of BS1 can be modified to AGAA.
  • the genetic modification can include one or more mutations in the 12-base-pair BS1 binding site or in the surrounding bases on either side of the nucleotides that form the stem of the stem-loop secondary structure of BS1.
  • a genetic modification can disrupt the stem and loop structure of BS1 by eliminating complementarity that allows hydrogen bonding.
  • Such alterations can be made as one or a plurality of mutations in the sequence taagggcacaaggacgtgcctta (SEQ ID NO: 28) involved in hydrogen bonding, for example, to eliminate one, two, three, four or more hydrogen bond pairs.
  • the modified BS1 has the nucleotide sequence GCACAAGAACGT (SEQ ID NO: 29).
  • a genetic modification can also or alternatively include one or more point mutations to CsrA BS2 (binding site 2). This includes, for example, modification of one or a plurality of nucleotides (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 nucleotides) of the 13 -base-pair BS2 binding site or in the surrounding bases on either side of the binding site that form the stem of the stem-loop secondary structure of BS2.
  • nucleotides e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, or at least 13 nucleotides
  • a genetic modification can disrupt the stem and loop structure of BS2 by eliminating complementarity that allows hydrogen bonding.
  • the modified BS2 can have the nucleotide sequence ATTTAGGGAGGAA (SEQ ID NO: 30).
  • the modification does not include an alteration of nucleotides in the Shine-Dalgarno sequence agggagga (SEQ ID NO: 26).
  • FlgM can refer to the protein (or the gene encoding such protein) annotated as “FlgM” in B. subtilis, or any homolog in another genus or species, which inhibits the sigma factor responsible for recruiting RNA polymerase to late flagellar genes for transcription. This inhibited sigma factor is called SigD in B. siibilHs. FliA in E. coH. or potentially other names such as sigma 28 in other genera and species in which said sigma factor has a homolog. FlgM is defined in B.
  • subtilis by the sequence: atgaaaatcaatcaatttggaacacaatccgttaatccatatcaaaaaattatgataagcaagcggtgcaaaaactgttgcacaacctcaag ataaaattgaaatttcatcacaggctaaagaaatgcaacatgcatccgacgcagtcactggttcacgacaggaaaaaattgcgcagcttaaa gcgcaaattgaaaacgggtcatacaaagtagacgcaaatcatattgcgaaaaatatgattaattttttataaaaagcaataa (SEQ ID NO: 31).
  • SigD can refer to the sigma factor (or the gene encoding it) in B. subtilis responsible for, among other things, recruiting the RNA polymerase to late flagellar genes for transcription. “SigD” furthermore refers to homologs in other species, such as FliA in E. colt, or the broader denotation of sigma-28 in several species. SigD is defined in B.
  • subtilis by the sequence: atgcaatccttgaattatgaagatcaggtgctttggacgcgctggaaagagtggaaagatcctaaagccggtgacgacttaatgc gccgttacatgccgcttgtcacatatcatgtaggcagaatttctgtcggactgccgaaatcagtgcataaagacgatcttatgagccttggtatg cttggtatg cttggtttatatgatgcccttgaaaaatttgaccccagccgggacttaaaatttgatacctacgcctcgtttagaattcgcggcgcaatcataga cgggcttcgtaaagaagattggctgcccagaacctcgcgcgtaaagaagattgg
  • FlgM can bind to SigD via several residues, the majority of which are located in the 4th helix at the C-terminal end of the FlgM protein.
  • Targets for inactivation would be mutation of the highly conserved residues in the 3rd and 4th helices corresponding to 1-58, K-62, 1-65, G-68, D-73, A-78 of the B. subtilis FlgM. More broadly, any one or combination of the 26 residues directly involved in binding to SigD (as identified in PMID: 15068809) could be mutated to potentially generate a protein with reduced or null activity.
  • any mutation or combination of mutations that disrupted the secondary or tertiary structure — in particular the 4 helices that define the secondary structure — could potentially successfully reduce or attenuate the ability of FlgM to inhibit SigD.
  • a cell includes a genetic modification that reduces the ability FlgM to inhibit SigD activity.
  • one such genetic modification can be partial or complete deletion of the FlgM gene to reduce or eliminate its biological activity. Partial deletion can include deletion of part of the gene encoding at least 25% of the C-terminus of the protein.
  • FlgM frameshift mutations producing an inactive FlgM protein, or disruption of the FlgM promoter.
  • FlgM could be rendered inactive by a point mutation that renders it functionally inactive or otherwise inhibits its ability to bind to or otherwise repress SigD.
  • FlgM could be disrupted by making it insensitive to activators such as ComK or DegU, or by making it overly sensitive to repressors such as ScoC or proteases Epr and Wpr.
  • a heterologous nucleic acid sequence such as a transgene encoding a fibersynthesizing enzyme can be operably linked with a flagellin promoter by any method known in the art.
  • a heterologous nucleic acid sequence can be integrated into the bacterial chromosome.
  • a heterologous nucleic acid sequence can be attached to a flagellin promoter in a plasmid that is introduced into the microorganism.
  • a heterologous nucleic acid sequence can be targeted to the hag promoter by, for example, homologous recombination, as described, for example, in PMID: 4994568.
  • Another useful method involves transposon technology. Transposons can target specific sequences in a chromosome and insert an attached nucleic acid sequence at a target locus. Various transposon systems are known in the art.
  • the present Example provides engineered cells that express a fiber-synthesizing enzyme, where the cells are PY79 strain cells that include an inactivation deletion of flgM (AflgM), a deletion of endogenous sacB (AsacB), and a modified hag promoter (“Pso3”) engineered to reduce binding of CsrA to transcripts (Ahag, the engineering including a mutation referred to alternatively as“sow3” or “so3”) operably linked to a nucleic acid sequence encoding a fiber-synthesizing enzyme, where the nucleic acid sequence encoding the fiber-synthesizing enzyme has the following structure: Pso3::nucleic acid sequence encoding secretion polypeptide: mucleic acid sequence encoding sacB.
  • Transgenes and bacterial strains were produced using standard techniques of molecular biology. Each transgene included a nucleic acid sequence encoding a lactose-degrading/oligosaccharide-synthesizing enzymes. In particular, four engineered strains, each including a distinct transgene, were produced. The strains respectively included transgenes for expression of LacZ (E. coli), YesZ (Bacillus subtilis), GanA (Bacillus subtilis), and LacZ (Bacillus coagulans) beta-galactosidase enzymes in accordance with the following sequence information:
  • LacZ E. colt amino acid sequence (encoded by SEQ ID NO: 71):
  • GanA Bacillus subtilis amino acid sequence (encoded by SEQ ID NO: 75):
  • heterologous nucleic acid sequence encoding polar linked lacY transporter
  • the heterologous nucleic acid sequence including the following sequence: atgtactatttaaaaaacacaaacttttggatgttcggtttattcttttttttacttttttatcatgggagcctacttcccgtttttccgatt tggctacatgacatcaaccatatcagcaaaagtgatacgggtattatttttgccgctatttctctgttctcgctattattccaaccgctgtttggtctg cttctgacaaactcgggctgcgcaaatacctgctgtggattattaccggcatgttagtgatgttttgcgcgttcttttttattttatattttatatattttt
  • heterologous nucleic acid sequence lacY (B. megatarium)
  • the heterologous nucleic acid sequence including the following sequence: atgaaaagtagtaagtcactctactggaagctttctgcgtatttcttttttcttttacctggagctctagttactctctgttttccattt ggttgggacaggagataaagctgaatggctcagccacggggctcatatttagtgtcaacgccatattcgctctttgtatgcaaccattatacgg atatatctccgacagaatcggcctcaagaagcatattttattttttttataagttgccttttttttgttgggccattctacatatttgtgtatgggcc
  • subtilis engineered to express LacZ was capable of degrading Lactose at a rate of 163 uM/min, 13 -fold faster than probiotic Lactobacillus acidophilus (Fig. 8).
  • Example 5 Construction and Experimental Validation of Engineered Cells that Express an Enzyme for Synthesis of Soluble Trehalulose Fiber from Carbohydrate Substrate [0216]
  • a transgene was constructed for expression of a trehalulose disaccharide fibersynthesizing enzyme. The transgene was produced using standard techniques of molecular biology. The transgene included nucleic acid sequences encoding a fiber-synthesizing enzyme that included a secretion polypeptide.
  • the present example utilizes mutB trehalulose synthase enzyme.
  • the nucleic acid encoding the fiber-synthesizing enzyme was derived from Pseudomonas mesoacidophila and has the following sequence, with the secretion polypeptide encoding sequence bolded and underlined: atgaacattaagaagttcgccaagcaagcaacggtgttaacgtttacaacagcactgctggcaggcggagcgacacag gctttgcattgatgaaaagattgttcgcggcctcattaatgctcgcgttctcctctgtgtcgttcgcggaagaggccgtgaagccg ggagcaccatggtggaaatctgctgtgttttatcaggtgtacccgcggt
  • the nucleic acid sequence encoding fiber-synthesizing enzyme derived from P. mesoacidophila was operably linked with a nucleic acid sequence encoding a secretion polypeptide, such that the encoded fiber-synthesizing enzyme was a fusion polypeptide including a secretion polypeptide.
  • the nucleic acid sequence encoding the fusion polypeptide was analyzed for secondary structure, at least in part because significant secondary structure can cause translation termination and poor expression. Base pairs that significantly contributed to secondary structure in the nucleic acid sequence were modified by silent modifications of nucleic acid sequence (e.g., non-coding and/or synonymous modifications of nucleic acid sequence) that reduced the contribution to secondary structure.
  • the nucleic acid sequence encoding the fiber-synthesizing enzyme was transformed into B. subtilis PY79 cells and operably linked to hag promoter by homologous recombination at the endogenous hag locus of B. subtilis PY79 genome with the addition of a modifying mutation in the promoter sequence by homologous integration as described in US 16/048,147 (published as US 2019/0076489) and PCT/US 18/50957 (published as WO 2019/055707) herein incorporated by reference in their entirety and with respect to regulatory sequences and systems disclosed therein.
  • Fiber-synthesizing enzymatic activity was measured by the following assay.
  • trehalulose synthase rearranges sucrose into trehalulose it renders the sucrose inaccessible for sucrase.
  • the accumulation of glucose after treatment with sucrase reveals remaining sucrose only, as trehalulose is not cleaved and does not release glucose.
  • the glucose released by sucrase is directly proportional to the amount of sucrose remaining, which when subtracted from the amount of sucrose at the beginning of the reaction, yields the amount of trehalulose synthesized.
  • Various glucose meters are known in the art and can be standardized for measurement of glucose concentrations in bacterial media. Engineered bacteria of the present Example were cultured in media to a defined density of 1E9 cells per ml (Optical Density of 1).
  • the cells were then removed by centrifugation (21xg for 2 minutes) and the supernatant, containing secreted enzyme, was assayed by the addition of a defined amount of sucrose.
  • the level of sucrose in the reaction was measured by cleavage to glucose using sucrase and the difference in sucrose concentration relative to a control strain lacking trehalulose synthase is directly proportional to trehalulose produced.
  • Trehalulose production (g/L) using supernatant containing secreted enzyme or using whole cell broth is shown in Fig. 9 and Fig. 10.
  • the present Example demonstrated that a transgene encoding a fiber-synthesizing enzyme derived from Fl-mutB of P. mesoacidophila expressed a highly active fiber-synthesizing enzyme.
  • the present disclosure further includes the recognition that trehalulose synthase (mutB) derived from P. mesoacidophila has certain exemplary qualities that confirm the utility of MutB expression in gut.
  • the optimum pH range for trehalulose synthase activity of MutB is 5.5-6.5 which matches that of the small intestine.
  • MutB enzyme is naturally secreted and therefore stable outside of the engineered cell, amenable to secretion through a gram positive cell envelope.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Biotechnology (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Mycology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)
PCT/US2021/053983 2020-10-08 2021-10-07 Engineered probiotics for expression of fiber-synthesizing enzymes in gut Ceased WO2022076693A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
JP2023521480A JP2023546022A (ja) 2020-10-08 2021-10-07 腸内での繊維合成酵素の発現のための操作されたプロバイオティクス
GB2306208.6A GB2616358A (en) 2020-10-08 2021-10-07 Engineered probiotics for expression of fiber-synthesizing enzymes in gut
KR1020237012697A KR20230088715A (ko) 2020-10-08 2021-10-07 장에서 섬유 합성 효소의 발현을 위한 조작된 프로바이오틱스
MX2023003972A MX2023003972A (es) 2020-10-08 2021-10-07 Probióticos diseñados para la expresión de enzimas sintetizadoras de fibra en el intestino.
US18/030,658 US20230372453A1 (en) 2020-10-08 2021-10-07 Engineered probiotics for expression of fiber-synthesizing enzymes in gut
AU2021358080A AU2021358080A1 (en) 2020-10-08 2021-10-07 Engineered probiotics for expression of fiber-synthesizing enzymes in gut
CA3194677A CA3194677A1 (en) 2020-10-08 2021-10-07 Engineered probiotics for expression of fiber-synthesizing enzymes in gut
EP21878541.8A EP4225338A4 (en) 2020-10-08 2021-10-07 Engineered probiotics for expression of fiber-synthesizing enzymes in gut
CN202180069035.9A CN116528880A (zh) 2020-10-08 2021-10-07 用于在肠道中表达纤维合成酶的工程化益生菌

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202063089334P 2020-10-08 2020-10-08
US63/089,334 2020-10-08

Publications (1)

Publication Number Publication Date
WO2022076693A1 true WO2022076693A1 (en) 2022-04-14

Family

ID=81125541

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/053983 Ceased WO2022076693A1 (en) 2020-10-08 2021-10-07 Engineered probiotics for expression of fiber-synthesizing enzymes in gut

Country Status (10)

Country Link
US (1) US20230372453A1 (https=)
EP (1) EP4225338A4 (https=)
JP (1) JP2023546022A (https=)
KR (1) KR20230088715A (https=)
CN (1) CN116528880A (https=)
AU (1) AU2021358080A1 (https=)
CA (1) CA3194677A1 (https=)
GB (1) GB2616358A (https=)
MX (1) MX2023003972A (https=)
WO (1) WO2022076693A1 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12539317B2 (en) 2017-09-13 2026-02-03 ZBiotics Company Gene expression system for probiotic microorganisms

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992018631A1 (en) * 1991-04-22 1992-10-29 Cetus Oncology Corporation Methods and nucleic acid sequences for the expression of the cellulose synthase operon
DE10106163B4 (de) * 2000-12-21 2007-03-29 Südzucker AG Mannheim/Ochsenfurt Verfahren zur Herstellung von Kohlenhydraten
US20170267981A1 (en) * 2014-12-05 2017-09-21 Danisco Us Inc. Compositions and methods comprising the use of a bacillus agaradhaerens inulosucrase (inuo)
US20190076489A1 (en) * 2017-09-13 2019-03-14 ZBiotics Company Gene expression system for probiotic microorganisms

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8734814B2 (en) * 2012-03-02 2014-05-27 Asis Datta Recombinant microorganisms and uses thereof
JP2022512639A (ja) * 2018-10-09 2022-02-07 セカンド ゲノム インコーポレイテッド 上皮バリア機能障害の治療に有効なタンパク質を送達するためのラクトコッカス・ラクティス発現系
ES2966260T3 (es) * 2020-08-10 2024-04-19 Inbiose Nv Producción de una mezcla de oligosacáridos neutros no fucosilados por una célula

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1992018631A1 (en) * 1991-04-22 1992-10-29 Cetus Oncology Corporation Methods and nucleic acid sequences for the expression of the cellulose synthase operon
DE10106163B4 (de) * 2000-12-21 2007-03-29 Südzucker AG Mannheim/Ochsenfurt Verfahren zur Herstellung von Kohlenhydraten
US20170267981A1 (en) * 2014-12-05 2017-09-21 Danisco Us Inc. Compositions and methods comprising the use of a bacillus agaradhaerens inulosucrase (inuo)
US20190076489A1 (en) * 2017-09-13 2019-03-14 ZBiotics Company Gene expression system for probiotic microorganisms

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BAI ET AL.: "Engineered butyrate-producing bacteria prevents high fat diet-induced obesity in mice", MICROBIAL CELL FACTORIES, vol. 19, no. 94, 25 April 2020 (2020-04-25), pages 1 - 13, XP055870672 *
See also references of EP4225338A4 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12539317B2 (en) 2017-09-13 2026-02-03 ZBiotics Company Gene expression system for probiotic microorganisms

Also Published As

Publication number Publication date
AU2021358080A9 (en) 2024-08-01
EP4225338A4 (en) 2024-11-06
JP2023546022A (ja) 2023-11-01
GB2616358A (en) 2023-09-06
US20230372453A1 (en) 2023-11-23
AU2021358080A1 (en) 2023-05-04
CA3194677A1 (en) 2022-04-14
GB202306208D0 (en) 2023-06-14
KR20230088715A (ko) 2023-06-20
EP4225338A1 (en) 2023-08-16
MX2023003972A (es) 2023-06-19
CN116528880A (zh) 2023-08-01

Similar Documents

Publication Publication Date Title
Bron et al. Genetic characterization of the bile salt response in Lactobacillus plantarum and analysis of responsive promoters in vitro and in situ in the gastrointestinal tract
Lee et al. Genomic insights into bifidobacteria
Rattanaprasert et al. Genes involved in galactooligosaccharide metabolism in Lactobacillus reuteri and their ecological role in the gastrointestinal tract
O'Connell Motherway et al. Metabolism of a plant derived galactose‐containing polysaccharide by Bifidobacterium breve UCC2003
JP5199995B2 (ja) ガラクトース転移活性を有するβ−ガラクトシダーゼ
Jung et al. The presence of resistant starch-degrading amylases in Bifidobacterium adolescentis of the human gut
Rios-Covian et al. Different metabolic features of Bacteroides fragilis growing in the presence of glucose and exopolysaccharides of bifidobacteria
US10165788B2 (en) Methods and compositions for improved digestion of milk oligosaccharides
JP6669703B2 (ja) 改変されたグラム陽性菌及びその使用
US20200345055A1 (en) Activation of conditionally-expressed oligosaccharide pathways during fermentation of probiotic strains
CN101379186A (zh) 具有α-半乳糖基转移酶活性的半乳糖苷酶
US8741622B2 (en) Stress tolerant Bifidobacteria
Lee et al. Lactobacillus casei low-temperature, dairy-associated proteome promotes persistence in the mammalian digestive tract
WO2020205528A1 (en) Probiotic bacteria capable of adaptive response to pomegranate extract and methods of production and use thereof
JP6117212B2 (ja) 改変されたグラム陽性菌及びその使用
Zhang et al. Milk fat globule membrane protects Bifidobacterium longum ssp. infantis ATCC 15697 against bile stress by modifying global transcriptional responses
US20230372453A1 (en) Engineered probiotics for expression of fiber-synthesizing enzymes in gut
Wang et al. Unraveling the mechanism of raffinose utilization in Ligilactobacillus salivarius Ren by transcriptomic analysis
EP2287299A1 (en) Gene that imparts oxygen resistance and application thereof
Levantovsky et al. Nutritional requirements of bifidobacteria
Ficoseco et al. Genomic characterisation of Limosilactobacillus fermentum CRL2085 unveiling probiotic traits for application in cattle feed
JP5248324B2 (ja) 製品及び方法
Goh Genetic characterization of fructooligosaccharides metabolism by Lactobacillus paracasei 1195
Silvestri Engineered strains of Lactococcus lactis envisioning to deliver exogenous β-galactosidases for relieving lactose intolerance symptoms
Keung Novel Insoluble Yeast Glucan Utilization Pathway in Bifidobacterium breve-a Mechanistic Study by Forward Genetics

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21878541

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3194677

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 202180069035.9

Country of ref document: CN

Ref document number: 2023521480

Country of ref document: JP

ENP Entry into the national phase

Ref document number: 202306208

Country of ref document: GB

Kind code of ref document: A

Free format text: PCT FILING DATE = 20211007

WWE Wipo information: entry into national phase

Ref document number: 2306208.6

Country of ref document: GB

ENP Entry into the national phase

Ref document number: 2021358080

Country of ref document: AU

Date of ref document: 20211007

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021878541

Country of ref document: EP

Effective date: 20230508

WWP Wipo information: published in national office

Ref document number: 2306208.6

Country of ref document: GB