WO2022067269A2 - Anticorps contre le sars-cov-2 - Google Patents

Anticorps contre le sars-cov-2 Download PDF

Info

Publication number
WO2022067269A2
WO2022067269A2 PCT/US2021/052481 US2021052481W WO2022067269A2 WO 2022067269 A2 WO2022067269 A2 WO 2022067269A2 US 2021052481 W US2021052481 W US 2021052481W WO 2022067269 A2 WO2022067269 A2 WO 2022067269A2
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
antigen
binding fragment
cov
sars
Prior art date
Application number
PCT/US2021/052481
Other languages
English (en)
Other versions
WO2022067269A3 (fr
Inventor
Davide Corti
Anna De Marco
Matteo Samuele PIZZUTO
Barbara GUARINO
Florian LEMPP
Alex Chen
Laura ROSEN
Original Assignee
Humabs Biomed Sa
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Humabs Biomed Sa filed Critical Humabs Biomed Sa
Priority to EP21806447.5A priority Critical patent/EP4217385A2/fr
Priority to BR112023005684A priority patent/BR112023005684A2/pt
Priority to CA3194162A priority patent/CA3194162A1/fr
Priority to JP2023544186A priority patent/JP2023545322A/ja
Publication of WO2022067269A2 publication Critical patent/WO2022067269A2/fr
Publication of WO2022067269A3 publication Critical patent/WO2022067269A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1002—Coronaviridae
    • C07K16/1003—Severe acute respiratory syndrome coronavirus 2 [SARS‐CoV‐2 or Covid-19]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A61K2039/507—Comprising a combination of two or more separate antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/52—Constant or Fc region; Isotype
    • C07K2317/526—CH3 domain
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/71—Decreased effector function due to an Fc-modification
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

Definitions

  • Figures 1A-1C show binding of certain antibodies of the present disclosure to SARS-CoV-2 Domain A.
  • Human monoclonal antibodies isolated from donors were expressed recombinantly and were tested for binding by ELISA.
  • the boxes on the right side of each figure indicate the calculated EC50 value (ng/mL) for the indicated antibody.
  • Figure 2A shows frequency of antibodies specific for SARS CoV-2 RBD, Spike protein (non-RBD), or Domain A from sera of three donors.
  • Figure 2B shows percent identity to IGHV germline sequence of certain antibodies.
  • Figure 2C shows percent identity to IGLV germline sequence of certain antibodies.
  • Figures 3A-3E show additional functional characterization of certain antibodies.
  • Figures 4A-4B show neutralization by antibodies 418 1 (4A) and 418_5 (4B) against authentic SARS-CoV-2 virus. Other antibodies were used as comparators.
  • Figures 5A-5C show results from epitope binning studies using biolayer interferometry (BLI).
  • 5B RBD-specific antibodies (top) were used as comparators.
  • Figures 6A and 6B relate to binding of certain antibodies of the present disclosure to transiently transfected ExpiCHO cells expressing various sarbecoviruses (Clade 2, Clade 1, or Clade 3), embecoviruses, merbecovirus, or mock.
  • Antibody S2X259 was included as a comparator in Figure 6A (flow cytometry study).
  • Figures 7A-7D show neutralization of infection by certain antibodies expressed as recombinant Fab or full IgG.
  • Figure 7E shows results from binding on binding assays using ACE2 (left) or spike (bottom, right). In the bottom panel, data from comparator antibodies S309, S2E12, and S2M11 is also shown.
  • Figures 8A and 8B show effector functions of certain antibodies of the present disclosure, along with a comparator antibody.
  • Figure 8C shows antibody-mediated shedding of CoV-2 SI protein from infected cells.
  • antibodies S309, S2E12, and S2M1 Ivl were used as comparators.
  • FIGS 9A-9C show data from neutralization experiments testing antibody combinations with antibody 418 4 and another antibody (S309, S2E12, or S2M11) against MLV pseudotype with SARS-CoV2.
  • Figures 10A and 10B show binding of certain antibodies of the present disclosure to SARS-CoV-2 Domain A, as measured by ELISA.
  • Figure 11 shows data from neutralization experiments using certain antibodies of the present disclosure and SARS-CoV-2 pseudoparticles.
  • Figure 12 shows binding of certain antibodies of the present disclosure to to SARS-CoV-2 Domain A, as measured by ELISA.
  • Figure 13 shows neutralization of SARS CoV-2 pseudoparticles by certain antibodies of the present disclosure.
  • Figures 14A-14C show binding of certain antibodies of the present disclosure to SARS-CoV-2 Domain A, as measured by ELISA.
  • Figures 15A and 15B shows data from neutralization experiments using certain antibodies of the present disclosure and SARS CoV-2 pseudoparticles.
  • Figures 16A-16C show binding of certain antibodies of the present disclosure to SARS-CoV-2 spike protein and to SARS-CoV-2 Domain A, as measured by ELISA.
  • Figures 17A-17C show kinetics of binding by three antibodies of the present disclosure to SARS-CoV-2 spike protein. Calculated K on , K O ff, and KD values are shown in the boxes on the right side of each figure.
  • Figure 18 shows data from neutralization experiments using certain antibodies of the present disclosure and SARS-CoV-2 virus pseudoparticles.
  • Figures 19A-19F show kinetics of binding by certain antibodies of the present disclosure to SARS-CoV-2 Domain A, as measured by BLI.
  • Figure 20 shows the frequency of antibodies recognizing the SARS-CoV-2 N- terminal domain (NTD, also referred to herein as Domain A), RBD, or other S regions for monoclonal antibodies cloned from IgG+ memory B cells of three donors.
  • NTD SARS-CoV-2 N- terminal domain
  • RBD RBD
  • Figure 21 shows binding and neutralization data for certain NTD-specific antibodies.
  • the left panel shows binding of 41 anti -NTD antibodies to immobilized SARS-CoV-2 S protein, NTD, or RBD, as determined by ELISA.
  • the center panel shows neutralization of infection by MLV pseudotyped with SARS-CoV-2 S protein for each of 15 NTD-specific antibodies.
  • the right panel shows maximal neutralization plateau for the same 15 NTD-specific antibodies.
  • Figure 22 shows neutralization of authentic SARS-CoV-2 -Nluc infection for certain antibodies assessed after 6 hours, using an MOI of 0.1. Error bars indicate standard deviation of triplicates.
  • Figure 23 shows neutralization of authentic SARS-CoV-2 -Nluc infection for certain antibodies assessed after 24 hours, using an MOI of 0.01. Error bars indicate standard deviation of triplicates.
  • Figures 24A-24D show binding kinetic analysis of SARS-CoV-2 NTD to immobilized antibodies, as measured using BLI.
  • Figure 25 shows V gene usage for heavy chain (left panel) and light chain (right panel) of certain NTD-specific antibodies.
  • Figure 26 shows further characterization of certain NTD-specific antibodies.
  • the left panel shows nucleotide sequence identity of the antibodies relative to their respective V germline genes.
  • the right panel shows the HCDR3 amino acid length for the antibodies.
  • Figure 27 shows results from a cell-to-cell fusion inhibition assay using Vero E6 cells expressing SARS-CoV-2 S protein incubated with varying concentrations of each of four NTD-specific antibodies or RBD-specific antibody S2M11.
  • Figures 28A-28F show binding of each of 41 NTD-specific antibodies to immobilized SARS-CoV-2 S protein ("Spike”), NTD (“Dorn A”), or RBD as measured by ELISA.
  • Spike immobilized SARS-CoV-2 S protein
  • NTD NTD
  • RBD RBD
  • Figures 29A-29F show neutralization of infection by MLV pseudotyped with SARS-CoV-2 S protein for each of 41 NTD-specific antibodies.
  • Figure 30 shows six antigenic sites (i) - (vi) identified by epitope binning of 41 NTD-specific antibodies based on competition binding assays using biolayer interferometry (BLI).
  • Figures 31A-31I show the results of competition binding assays for 41 NTD- specific antibodies using BLI.
  • Results for antibodies identified as binding Site i are shown in Figures 31 A-31C.
  • Results for antibodies identified as binding Site ii are shown in Figure 3 ID.
  • Results for antibodies identified as binding Site iii are shown in Figures 3 IE-31H.
  • Results for antibodies identified as binding Site iv, Site v, and Site vi are shown in Figure 3 II.
  • Figure 32 shows competition by each of four NTD-specific antibodies and RBD-specific antibody S2E12 with ACE2 for binding to SARS-CoV-2 S protein as measured by BLI.
  • ACE2 was immobilized at the surface of the biosensors before incubation with S protein alone or in complex with antibody.
  • the vertical dashed line in each graph indicates the start of the association of S/antibody complex or free S with solid-phase ACE2.
  • Figure 33 shows neutralization of authentic SARS-CoV-2 -Nluc infection by IgG or Fab of each of four NTD-specific antibodies and of comparator antibodies S309 and S2M11. Symbols are means ⁇ SD of triplicates. Dotted lines in each graph indicate IC50 and IC90 values.
  • Figure 34 shows results of SPR analysis of antibodies binding to SARS-CoV-2 S protein ectodomain trimer.
  • the gray dashed line in each graph indicates a fit to a 1 : 1 binding model.
  • the equilibrium dissociation constant (KD) or apparent equilibrium dissociation constant (KD, app) are indicated on each graph.
  • White and gray stripes on each graph indicate association and dissociation phases, respectively.
  • Figure 35 shows activation of FcyRIIa H131 (left panel) and FcyRIIIa V158 (right panel) induced by the NTD-specific antibodies indicated and by RBD-specific antibody S309.
  • Figure 36 shows a matrix assessing synergistic activity of S2X333 and S309 antibody cocktails for in vitro neutralization of authentic SARS-CoV-2-Nluc infection. Data are from one representative example performed in triplicate.
  • Figures 37A-37D show data from Syrian hamsters injected with the indicated amount of S2X333 antibody 48 hours before intra-nasal challenge with SARS-CoV-2.
  • Figure 37A shows quantification of viral RNA in the lungs four days post-infection.
  • Figure 37B shows quantification of replicating virus in lung homogenates harvested four days post infection using a TCID50 assay.
  • Figures 37C and 37D show viral RNA load ( Figure 37C) and replicating virus titers ( Figure 37D) in the lung four days post infection plotted as a function of serum antibody concentration before infection (day 0).
  • Figure 38 shows infection of HEK293T cells transfected to over-express ACE2 or one of a panel of selected lectins and receptor candidates by VSV-SARS-CoV-2 pseudovirus.
  • Figure 39 shows micrographs of stable HEK293T cell lines overexpressing DC- SIGN, L-SIGN, SIGLEC1, or ACE2 infected with authentic SARS-CoV-2 (MOI of 0.1), then fixed and immunostained for 24 hours for SARS-CoV-2 nucleoprotein (red)
  • Figure 40 shows quantification of luciferase levels in stable HEK293T cell lines overexpressing DC-SIGN, L-SIGN, SIGLEC1, or ACE2, as measured 24 hours after infection with SARS-CoV-2 -Nluc.
  • Figure 41 shows quantification of luciferase levels in stable HEK293T cell lines overexpressing DC-SIGN, L-SIGN, SIGLEC1, or ACE2 after incubation with different concentrations of anti-SIGLECl monoclonal antibody (clone 7-239) and infection with SARS-CoV-2-Nluc.
  • Figure 42 shows infection of cells transiently transduced to overexpress DC- SIGN, L-SIGN, SIGLEC1, or ACE2 by VSV-SARS-CoV-2 pseudovirus. Results for HEK293T cells (left panel), HeLa cells (center panel), and MRC5 cells (right panel) are shown.
  • Figure 43 shows infection of stable HEK293T cell lines overexpressing DC- SIGN, L-SIGN, SIGLEC1, or ACE2 after treatment with ACE2 siRNA followed by infection with VSV-SARS-CoV-2 pseudovirus.
  • Figure 44 shows infection of stable HEK293T cell lines overexpressing DESIGN, L-SIGN, SIGLEC1, or ACE2 after treatment with different concentrations of anti-ACE2 antibody (polyclonal serum) followed by infection with VSV-SARS-CoV-2 pseudovirus.
  • Figure 45 shows the distribution and expression of ACE2, DC-SIGN (CD209), L-SIGN (CLEC4M), and SIGLEC1 in the human lung cell atlas.
  • Figure 46 shows analysis of major cell types with detectable SARS-CoV-2 genome in bronchoalveolar lavage fluid or sputum of severe COVID-19 patients.
  • the single cell gene expression profiles are shown as a t-SNE (t-distributed stochastic neighbor embedding) plot, sized by viral load.
  • Figure 47 shows analysis of major cell types with detectable SARS-CoV-2 genome in bronchoalveolar lavage fluid or sputum of severe COVID-19 patients.
  • the cumulative fraction of cells (y-axis) with detected viral RNA per cell up to the corresponding logCPM (log(counts per million); x-axis) is shown for each of the indicated cell types.
  • Figure 49 shows the correlation of receptor transcript counts (y-axis of each plot) with SARS-CoV-2 RNA counts (x-axis of each plot) in macrophages and in secretory cells. Correlation is based on counts before log transformation from Ren et al.
  • Figure 50 shows the results of trans-infection with VSV-SARS-CoV-2.
  • a schematic of the trans-infection process is shown in the left panel.
  • HeLa cells transduced with DC-SIGN, L-SIGN, or SIGLEC1 were incubated with VSV-SARS- CoV-2, extensively washed, and co-cultured with Vero-E6-TMPRSS2 susceptible target cells. Results in the presence or absence of target cells are shown in the right panel.
  • Figure 51 shows the results of trans-infection, where VSV-SARS-CoV-2 viral adsorption was performed in the presence or absence of an anti-SIGLECl blocking antibody.
  • Figure 52 shows neutralization of SARS-CoV-2 infection of Vero-E6 cells by antibodies S309, S2E12, and S2X33.
  • Figure 53 shows neutralization of SARS-CoV-2 infection of Vero-E6- TMPRSS2 cells by antibodies S309, S2E12, and S2X33.
  • Figure 54 shows quantification of binding of purified, fluorescently-labeled SARS-CoV-2 spike protein or RBD to the indicated cell lines, as measured by flow cytometry.
  • A indicates cell line overexpressing ACE2;
  • T indicates cell line overexpressing TMPRSS2.
  • Figure 55 shows quantification of cellular ACE2 and TMPRSS2 transcripts in the indicated cell lines, as measured by RT-qPCR.
  • A indicates cell line overexpressing ACE2;
  • T indicates cell line overexpressing TMPRSS2.
  • Figure 56 shows neutralization of SARS-CoV-2 -Nluc infection by antibodies S309, S2E12, or S2X333. Each of the seven cell lines indicated was tested. Luciferase signal was quantified 24 hours post infection.
  • Figure 57 shows neutralization of VSV-SARS-CoV-2 pseudovirus infection by antibodies S309, S2E12, or S2X333. Each of the seven cell lines indicated was tested. Luciferase signal was quantified 24 hours post infection.
  • Figure 58 shows S2E12-induced uni-directional fusion (also referred to as trans-fusion) of S-positive CHO-S cells with fluorescently labelled S-negative CHO cells in the absence of ACE2. Nuclei were stained with Hoechst dye; cytoplasm was stained with CellTracker Green.
  • Figure 59 shows neutralization of infection of a stable HEK293T cell line overexpressing ACE2 by authentic SARS-CoV-2 pre-incubated with the indicated monoclonal antibodies. Infection was measured by immunostaining at 24 hours for the SARS-CoV-2 nucleoprotein.
  • Figure 60 shows neutralization of infection of a stable HEK293T cell line overexpressing SIGLEC1 by authentic SARS-CoV-2 pre-incubated with the indicated monoclonal antibodies. Infection was measured by immunostaining at 24 hours for the SARS-CoV-2 nucleoprotein.
  • Figure 61 shows neutralization of infection of a stable HEK293T cell line overexpressing DC-SIGN by authentic SARS-CoV-2 pre-incubated with the indicated monoclonal antibodies. Infection was measured by immunostaining at 24 hours for the SARS-CoV-2 nucleoprotein.
  • Figure 62 shows neutralization of infection of a stable HEK293T cell line overexpressing L-SIGN by authentic SARS-CoV-2 pre-incubated with the indicated monoclonal antibodies. Infection was measured by immunostaining at 24 hours for the SARS-CoV-2 nucleoprotein.
  • Figure 63 shows analysis of binding of antibodies targeting DC/L-SIGN, DC- SIGN, SIGLEC1, or ACE2 on HEK293T cells stably over-expressing the respective attachment receptor, as measured by flow cytometry.
  • Figure 64 shows analysis of binding of antibodies targeting DC/L-SIGN, DC- SIGN, SIGLEC1, or ACE2 on HEK293T cells stably over-expressing the respective attachment receptor, as measured by immunofluorescence.
  • Figure 65 shows infection of HEK293T cells stably over-expressing the indicated attachment receptor by VSV-SARS-CoV-2 pseudotyped with wild type spike protein (grey bars), or VSV-SARS-CoV-2 pseudotyped with spike protein bearing the mutations of the B 1.1.7 lineage (red bars). Luminescence was analyzed one day post infection.
  • Figure 66 shows neutralization of SARS-CoV-2 infection of Vero-E6 or Vero- E6-TMPRSS2 cells by 10 pg/ml of S309, S2E12, and S2X333.
  • Cells were infected with SARS-CoV-2 (isolate USA-WA1/2020) at MOI 0.01 in the presence of the indicated antibodies. Cells were fixed 24h post infection and viral nucleocapsid protein was immunostained.
  • Figure 67 shows quantification of binding of purified, fluorescently labelled SARS-CoV-2 spike protein (left panels) or RBD (right panels) to the indicated cell lines, as measured by flow cytometry.
  • Figure 68 shows quantification of binding of punned, fluorescently labelled SARS-CoV-2 spike protein (left panels) or RBD (right panels) to the indicated cell lines, as measured by flow cytometry.
  • Figure 69 shows an analysis of the correlation between ACE2 transcript levels (x-axis) and maximum antibody-related neutralization of infection (y-axis) in SARS- CoV-2-susceptible cell lines for antibody S309 (left panel) and antibody S2X333 (right panel).
  • Figure 70 shows binding of immunocomplexes to hamster splenocytes.
  • Alexa- 488 fluorescent immunocomplexes IC
  • IC Alexa- 488 fluorescent immunocomplexes
  • Binding was revealed with a cytometer upon exclusion of dead/apoptotic cells and physical gating on bona fide monocyte population.
  • Left panel shows the fluorescent intensity associated to hamster cells of IC made with either hamster or human Fc antibodies. A single replicate of two is shown.
  • Right panel shows the relative Alexa-488 mean fluorescent intensity of the replicates measured on the entire monocyte population.
  • Figure 71 shows analysis of the role of host effector function in SARS-CoV-2 challenge.
  • Syrian hamsters were injected with the indicated amount (mg/kg) of hamster IgG2a S309, either wt or Fc silenced (S309-N297A).
  • Top panel shows quantification of viral RNA in the lung 4 days post infection.
  • Center panel shows quantification of replicating virus in the lung 4 days post infection.
  • Bottom panel shows histopathological score in the lung 4 days post infection.
  • Control animals (white symbols) were injected with 4 mg/kg unrelated control isotype antibody.
  • Figure 72 shows neutralization of SARS-CoV-2 infection of HEK293T cells stably expressing ACE2 (top panel) or DC-SIGN (bottom panel) in the presence of the indicated antibodies.
  • Cells were infected at MOI of 0.02. Cells were fixed 24h post infection, viral nucleocapsid protein was immunostained and positive cells were quantified.
  • Figure 73 shows neutralization of SARS-CoV-2 infection of HEK293T cells stably expressing SIGLEC1 (top panel) or L-SIGN (bottom panel) in the presence of the indicated antibodies.
  • Cells were infected at MOI of 0.02. Cells were fixed 24h post infection, viral nucleocapsid protein was immunostained and positive cells were quantified.
  • antibodies and antigen-binding fragments that bind to SARS-CoV-2 coronavirus (e.g., a SARS-CoV-2 Domain A, in a SARS-CoV-2 virion and/or expressed on the surface of a cell infected by the SARS-CoV-2 coronavirus).
  • SARS-CoV-2 coronavirus e.g., a SARS-CoV-2 Domain A, in a SARS-CoV-2 virion and/or expressed on the surface of a cell infected by the SARS-CoV-2 coronavirus.
  • presently disclosed antibodies and antigen-binding fragments can neutralize a SARS-CoV-2 infection in an in vitro model of infection and/or in a human subject.
  • polynucleotides that encode the antibodies and antigenbinding fragments, vectors, host cells, and related compositions, as well as methods of using the antibodies, nucleic acids, vectors, host cells, and related compositions to treat (e.g., reduce, delay, eliminate, or prevent) a SARS-CoV-2 infection in a subject and/or in the manufacture of a medicament for treating a SARS-CoV-2 infection in a subject.
  • SARS-CoV-2 also referred to herein as "Wuhan seafood market phenomia virus”, or “Wuhan coronavirus” or “Wuhan CoV”, or “novel CoV”, or “nCoV”, or “2019 nCoV”, or “Wuhan nCoV” is a betacoronavirus believed to be of lineage B (sarbecovirus).
  • SARS-CoV-2 was first identified in Wuhan, Hubei province, China, in late 2019 and spread within China and to other parts of the world by early 2020. Symptoms of SARS-CoV-2 infection include fever, dry cough, and dyspnea.
  • SARS-CoV-2 comprises a "spike” or surface (“S") type I transmembrane glycoprotein containing a receptor binding domain (RBD). RBD is believed to mediate entry of the lineage B SARS coronavirus to respiratory epithelial cells by binding to the cell surface receptor angiotensin-converting enzyme 2 (ACE2).
  • ACE2 cell surface receptor angiotensin-converting enzyme 2
  • SARS CoV-2 S protein also includes, N-terminal to the RBD and C-terminal to the S protein signal peptide, domain A (also referred-to as the N-terminal Domain or "NTD").
  • N-terminal Domain also referred-to as the N-terminal Domain or "NTD”
  • Antibodies of the present disclosure are specific for domain A.
  • the amino acid sequence of the Wuhan-Hu- 1 surface glycoprotein is provided in SEQ ID NO.:3.
  • the amino acid sequence of SARS-CoV-2 RBD is provided in SEQ ID NO.:4.
  • SARS-CoV-2 S protein has approximately 73% amino acid sequence identity with SARS-CoV-1.
  • the amino acid sequence of SARS-CoV-2 RBM is provided in SEQ ID NO.:5.
  • SARS-CoV-2 RBD has approximately 75% to 77% amino acid sequence similarity to SARS-CoV-1 RBD
  • SARS-CoV-2 RBM has approximately 50% amino acid sequence similarity to SARS-CoV-1 RBM.
  • SARS-CoV-2 Wuhan-Hu- 1 refers to a virus comprising the amino acid sequence set forth in any one or more of SEQ ID NOs.:2, or 3, optionally with the genomic sequence set forth in SEQ ID NO.: 1.
  • SARS-CoV-2 variants There have been a number of emerging SARS-CoV-2 variants. Some SARS- CoV-2 variants contain an N439K mutation, which has enhanced binding affinity to the human ACE2 receptor (Thomson, E.C., et al., The circulating SARS-CoV-2 spike variant N439K maintains fitness while evading antibody-mediated immunity. bioRxiv, 2020). Some SARS-CoV-2 variants contain an N501 Y mutation, which is associated with increased transmissibility, including the lineages B. l.1.7 (also known as 201/501 Y.
  • VI and VOC 202012/01) and B.1.351 also known as 20H/501Y.V2
  • SARS-CoV-2 severe acute respiratory syndrome -related coronavirus 2
  • medRxiv, 2020: p. 2020.12.21.20248640 Leung, K., et al., Early empirical assessment of the N501Y mutant strains of SARS-CoV-2 in the United Kingdom, October to November 2020.
  • B.1.351 also include two other mutations in the RBD domain of SARS-CoV2 spike protein, K417N and E484K (Tegally, H., et al., Emergence and rapid spread of a new severe acute respiratory syndrome-related coronavirus 2 (SARS-CoV-2) lineage with multiple spike mutations in South Africa. medRxiv, 2020: p. 2020.12.21.20248640).
  • SARS-CoV-2 variants include the Lineage B.1.1.28, which was first reported in Brazil; the Variant P.1, lineage B.1.1.28 (also known as 20J/501Y.V3), which was first reported in Japan; Variant L452R, which was first reported in California in the United States (Pan American Health Organization, Epidemiological update: Occurrence of variants of SARS-CoV-2 in the Americas, January 20, 2021, available at https://reliefweb.int/sites/reliefweb.int/files/resources/2021-jan-20-phe-epi-update- SARS-CoV-2.pdf).
  • SARS-CoV-2 variants include a SARS CoV-2 of clade 19A; SARS CoV-2 of clade 19B; a SARS CoV-2 of clade 20A; a SARS CoV-2 of clade 20B; a SARS CoV-2 of clade 20C; a SARS CoV-2 of clade 20D; a SARS CoV-2 of clade 20E (EU1); a SARS CoV-2 of clade 20F; a SARS CoV-2 of clade 20G; and SARS CoV-2 Bl.1.207; and other SARS CoV-2 lineages described in Rambaut, A., et al., A dynamic nomenclature proposal for SARS-CoV-2 lineages to assist genomic epidemiology.
  • Treating a SARS CoV-2 infection in accordance with the present disclosure includes treating infection by any one or more of the aforementioned SARS-CoV-2 viruses.
  • treating a SARS-CoV-2 infection comprises treating any one or more of: SARS CoV-2 Wuhan-Hu-1; a SARS-CoV-2 variant comprising a N439K mutation; a SARS-CoV-2 variant comprising a N501 Y mutation; a SARS-CoV-2 variant comprising a K417N mutation and/or a E484K mutation; a SARS-CoV-2 comprising a L452R mutation; B.1.1.28; B. l.1.7 (also referred-to as the "alpha” variant); B.1.351 (also referred-to as the "beta” variant); P. l (also referred-to as the "gamma” variant);
  • B.1.617.1 also referred-to as the "kappa” variant
  • B.1.429 also referred-to as the "epsilon” variant
  • B.1.525 also referred-to as the "eta” variant
  • B.1.526 also referred- to as the "iota” variant
  • B.1.258 a variant of Wuhan-Hu-1 comprising a N440K mutation; B.1.243.1; B.1.258 with a K417N mutation; A.27.1; R.l; P.2; R.2; B.1.1.519; A.23.1; B.1.318; B.1.619; A.V0I.V2; B.1.618; a variant of Wuhan-Hu-1 comprising N440K and E484K mutations; B.1.617.2 (also referred-to as the "delta" variant);
  • B.1.1.298; B.1.617.2-AY.1; B.1.617.2-AY.2; C.37 also referred-to as the "lambda” variant
  • Other coronaviruses are believed to enter cells by binding to other receptors (e.g., 9-O-Ac-Sia receptor analog; DPP4; APN).
  • any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated.
  • any number range recited herein relating to any physical feature, such as polymer subunits, size or thickness are to be understood to include any integer within the recited range, unless otherwise indicated.
  • the term “about” means ⁇ 20% of the indicated range, value, or structure, unless otherwise indicated. In particular embodiments, "about” comprises ⁇ 5%, ⁇ 10%, or ⁇ 15%.
  • a protein domain, region, or module e.g., a binding domain
  • a protein "consists essentially of a particular amino acid sequence when the amino acid sequence of a domain, region, module, or protein includes extensions, deletions, mutations, or a combination thereof (e.g., amino acids at the amino- or carboxy -terminus or between domains) that, in combination, contribute to at most 20% (e.g., at most 15%, 10%, 8%, 6%, 5%, 4%, 3%, 2% or 1%) of the length of a domain, region, module, or protein and do not substantially affect (i.e., do not reduce the activity by more than 50%, such as no more than 40%, 30%, 25%, 20%, 15%, 10%, 5%, or 1%) the activity of the domain(s), region(s), module(s), or protein (e.g., the target binding affinity of a binding protein).
  • extensions, deletions, mutations, or a combination thereof e.g., amino acids at the amino- or carboxy
  • amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.
  • Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, y-carboxyglutamate, and O-phosphoserine.
  • Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a-carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid.
  • Amino acid mimetics refer to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
  • mutation refers to a change in the sequence of a nucleic acid molecule or polypeptide molecule as compared to a reference or wild-type nucleic acid molecule or polypeptide molecule, respectively.
  • a mutation can result in several different types of change in sequence, including substitution, insertion or deletion of nucleotide(s) or amino acid(s).
  • a “conservative substitution” refers to amino acid substitutions that do not significantly affect or alter binding characteristics of a particular protein. Generally, conservative substitutions are ones in which a substituted amino acid residue is replaced with an amino acid residue having a similar side chain.
  • Conservative substitutions include a substitution found in one of the following groups: Group 1 : Alanine (Ala or A), Glycine (Gly or G), Serine (Ser or S), Threonine (Thr or T); Group 2: Aspartic acid (Asp or D), Glutamic acid (Glu or Z); Group 3 : Asparagine (Asn or N), Glutamine (Gin or Q); Group 4: Arginine (Arg or R), Lysine (Lys or K), Histidine (His or H); Group 5: Isoleucine (He or I), Leucine (Leu or L), Methionine (Met or M), Valine (Vai or V); and Group 6: Phenylalanine (Phe or F), Tyrosine (Tyr or Y), Tryptophan (Trp or W).
  • Group 1 Alanine (Ala or A), Glycine (Gly or G), Serine (Ser or S), Threonine (Thr or T);
  • Group 2 Aspartic
  • amino acids can be grouped into conservative substitution groups by similar function, chemical structure, or composition (e.g., acidic, basic, aliphatic, aromatic, or sulfur-containing).
  • an aliphatic grouping may include, for purposes of substitution, Gly, Ala, Vai, Leu, and He.
  • Other conservative substitutions groups include: sulfur-containing: Met and Cysteine (Cys or C); acidic: Asp, Glu, Asn, and Gin; small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro, and Gly; polar, negatively charged residues and their amides: Asp, Asn, Glu, and Gin; polar, positively charged residues: His, Arg, and Lys; large aliphatic, nonpolar residues: Met, Leu, He, Vai, and Cys; and large aromatic residues: Phe, Tyr, and Trp. Additional information can be found in Creighton (1984) Proteins, W.H. Freeman and Company.
  • protein or “polypeptide” refers to a polymer of amino acid residues. Proteins apply to naturally occurring amino acid polymers, as well as to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, and non-naturally occurring amino acid polymers. Variants of proteins, peptides, and polypeptides of this disclosure are also contemplated.
  • variant proteins, peptides, and polypeptides comprise or consist of an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% identical to an amino acid sequence of a defined or reference amino acid sequence as described herein.
  • Nucleic acid molecule or “polynucleotide” or “polynucleic acid” refers to a polymeric compound including covalently linked nucleotides, which can be made up of natural subunits (e.g., purine or pyrimidine bases) or non-natural subunits (e.g., morpholine ring).
  • Nucleic acid molecules include polyribonucleic acid (RNA), which includes mRNA, microRNA, siRNA, viral genomic RNA, and synthetic RNA, and polydeoxyribonucleic acid (DNA), which includes cDNA, genomic DNA, and synthetic DNA, either of which may be single or double stranded. If single-stranded, the nucleic acid molecule may be the coding strand or non-coding (anti-sense) strand.
  • RNA polyribonucleic acid
  • DNA polydeoxyribonucleic acid
  • a nucleic acid molecule encoding an amino acid sequence includes all nucleotide sequences that encode the same amino acid sequence.
  • nucleotide sequences may also include intron(s) to the extent that the intron(s) would be removed through co- or post-transcriptional mechanisms.
  • different nucleotide sequences may encode the same amino acid sequence as the result of the redundancy or degeneracy of the genetic code, or by splicing.
  • Variants of nucleic acid molecules of this disclosure are also contemplated. Variant nucleic acid molecules are at least 70%, 75%, 80%, 85%, 90%, and are preferably 95%, 96%, 97%, 98%, 99%, or 99.9% identical a nucleic acid molecule of a defined or reference polynucleotide as described herein, or that hybridize to a polynucleotide under stringent hybridization conditions of 0.015M sodium chloride, 0.0015M sodium citrate at about 65-68°C or 0.015M sodium chloride, 0.0015M sodium citrate, and 50% formamide at about 42°C. Nucleic acid molecule variants retain the capacity to encode a binding domain thereof having a functionality described herein, such as binding a target molecule.
  • Percent sequence identity refers to a relationship between two or more sequences, as determined by comparing the sequences. Preferred methods to determine sequence identity are designed to give the best match between the sequences being compared. For example, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment). Further, non-homologous sequences may be disregarded for comparison purposes. The percent sequence identity referenced herein is calculated over the length of the reference sequence, unless indicated otherwise. Methods to determine sequence identity and similarity can be found in publicly available computer programs.
  • Sequence alignments and percent identity calculations may be performed using a BLAST program (e.g., BLAST 2.0, BLASTP, BLASTN, or BLASTX).
  • BLAST program e.g., BLAST 2.0, BLASTP, BLASTN, or BLASTX.
  • the mathematical algorithm used in the BLAST programs can be found in Altschul et al., Nucleic Acids Res. 25:3389-3402, 1997.
  • sequence analysis software is used for analysis, the results of the analysis are based on the "default values" of the program referenced. "Default values" mean any set of values or parameters which originally load with the software when first initialized.
  • isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring).
  • a naturally occurring nucleic acid or polypeptide present in a living animal is not isolated, but the same nucleic acid or polypeptide, separated from some or all of the co-existing materials in the natural system, is isolated.
  • nucleic acid could be part of a vector and/or such nucleic acid or polypeptide could be part of a composition (e.g., a cell lysate), and still be isolated in that such vector or composition is not part of the natural environment for the nucleic acid or polypeptide.
  • isolated can, in some embodiments, also describe an antibody, antigen-binding fragment, polynucleotide, vector, host cell, or composition that is outside of a human body.
  • gene means the segment of DNA or RNA involved in producing a polypeptide chain; in certain contexts, it includes regions preceding and following the coding region (e.g., 5’ untranslated region (UTR) and 3’ UTR) as well as intervening sequences (introns) between individual coding segments (exons).
  • regions preceding and following the coding region e.g., 5’ untranslated region (UTR) and 3’ UTR
  • intervening sequences introns between individual coding segments (exons).
  • a “functional variant” refers to a polypeptide or polynucleotide that is structurally similar or substantially structurally similar to a parent or reference compound of this disclosure, but differs slightly in composition (e.g., one base, atom or functional group is different, added, or removed), such that the polypeptide or encoded polypeptide is capable of performing at least one function of the parent polypeptide with at least 50% efficiency, preferably at least 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% level of activity of the parent polypeptide.
  • a functional variant of a polypeptide or encoded polypeptide of this disclosure has "similar binding,” “similar affinity” or “similar activity” when the functional variant displays no more than a 50% reduction in performance in a selected assay as compared to the parent or reference polypeptide, such as an assay for measuring binding affinity (e.g., Biacore® or tetramer staining measuring an association (Ka) or a dissociation (KD) constant).
  • binding affinity e.g., Biacore® or tetramer staining measuring an association (Ka) or a dissociation (KD) constant.
  • a “functional portion” or “functional fragment” refers to a polypeptide or polynucleotide that comprises only a domain, portion or fragment of a parent or reference compound, and the polypeptide or encoded polypeptide retains at least 50% activity associated with the domain, portion or fragment of the parent or reference compound, preferably at least 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% level of activity of the parent polypeptide, or provides a biological benefit e.g., effector function).
  • a “functional portion” or “functional fragment” of a polypeptide or encoded polypeptide of this disclosure has “similar binding” or “similar activity” when the functional portion or fragment displays no more than a 50% reduction in performance in a selected assay as compared to the parent or reference polypeptide (preferably no more than 20% or 10%, or no more than a log difference as compared to the parent or reference with regard to affinity).
  • the term "engineered,” “recombinant,” or “non-natural” refers to an organism, microorganism, cell, nucleic acid molecule, or vector that includes at least one genetic alteration or has been modified by introduction of an exogenous or heterologous nucleic acid molecule, wherein such alterations or modifications are introduced by genetic engineering (i.e., human intervention).
  • Genetic alterations include, for example, modifications introducing expressible nucleic acid molecules encoding functional RNA, proteins, fusion proteins or enzymes, or other nucleic acid molecule additions, deletions, substitutions, or other functional disruption of a cell’s genetic material. Additional modifications include, for example, non-coding regulatory regions in which the modifications alter expression of a polynucleotide, gene, or operon.
  • heterologous or non-endogenous or exogenous refers to any gene, protein, compound, nucleic acid molecule, or activity that is not native to a host cell or a subject, or any gene, protein, compound, nucleic acid molecule, or activity native to a host cell or a subject that has been altered.
  • Heterologous, non-endogenous, or exogenous includes genes, proteins, compounds, or nucleic acid molecules that have been mutated or otherwise altered such that the structure, activity, or both is different as between the native and altered genes, proteins, compounds, or nucleic acid molecules.
  • heterologous, non-endogenous, or exogenous genes, proteins, or nucleic acid molecules may not be endogenous to a host cell or a subject, but instead nucleic acids encoding such genes, proteins, or nucleic acid molecules may have been added to a host cell by conjugation, transformation, transfection, electroporation, or the like, wherein the added nucleic acid molecule may integrate into a host cell genome or can exist as extra-chromosomal genetic material (e.g., as a plasmid or other self-replicating vector).
  • homologous or homolog refers to a gene, protein, compound, nucleic acid molecule, or activity found in or derived from a host cell, species, or strain.
  • a heterologous or exogenous polynucleotide or gene encoding a polypeptide may be homologous to a native polynucleotide or gene and encode a homologous polypeptide or activity, but the polynucleotide or polypeptide may have an altered structure, sequence, expression level, or any combination thereof.
  • a non-endogenous polynucleotide or gene, as well as the encoded polypeptide or activity may be from the same species, a different species, or a combination thereof.
  • a nucleic acid molecule or portion thereof native to a host cell will be considered heterologous to the host cell if it has been altered or mutated, or a nucleic acid molecule native to a host cell may be considered heterologous if it has been altered with a heterologous expression control sequence or has been altered with an endogenous expression control sequence not normally associated with the nucleic acid molecule native to a host cell.
  • heterologous can refer to a biological activity that is different, altered, or not endogenous to a host cell.
  • heterologous nucleic acid molecule can be introduced into a host cell as separate nucleic acid molecules, as a plurality of individually controlled genes, as a polycistronic nucleic acid molecule, as a single nucleic acid molecule encoding a fusion protein, or any combination thereof.
  • endogenous or “native” refers to a polynucleotide, gene, protein, compound, molecule, or activity that is normally present in a host cell or a subject.
  • expression refers to the process by which a polypeptide is produced based on the encoding sequence of a nucleic acid molecule, such as a gene.
  • the process may include transcription, post-transcriptional control, post-transcriptional modification, translation, post-translational control, post- translational modification, or any combination thereof.
  • An expressed nucleic acid molecule is typically operably linked to an expression control sequence (e.g., a promoter).
  • operably linked refers to the association of two or more nucleic acid molecules on a single nucleic acid fragment so that the function of one is affected by the other.
  • a promoter is operably linked with a coding sequence when it is capable of affecting the expression of that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter).
  • Unlinked means that the associated genetic elements are not closely associated with one another and the function of one does not affect the other.
  • more than one heterologous nucleic acid molecule can be introduced into a host cell as separate nucleic acid molecules, as a plurality of individually controlled genes, as a polycistronic nucleic acid molecule, as a single nucleic acid molecule encoding a protein (e.g., a heavy chain of an antibody), or any combination thereof.
  • a protein e.g., a heavy chain of an antibody
  • two or more heterologous nucleic acid molecules are introduced into a host cell, it is understood that the two or more heterologous nucleic acid molecules can be introduced as a single nucleic acid molecule (e.g., on a single vector), on separate vectors, integrated into the host chromosome at a single site or multiple sites, or any combination thereof.
  • the number of referenced heterologous nucleic acid molecules or protein activities refers to the number of encoding nucleic acid molecules or the number of protein activities, not the number of separate nucleic acid molecules introduced into a host cell.
  • the term "construct” refers to any polynucleotide that contains a recombinant nucleic acid molecule (or, when the context clearly indicates, a fusion protein of the present disclosure).
  • a (polynucleotide) construct may be present in a vector (e.g., a bacterial vector, a viral vector) or may be integrated into a genome.
  • a "vector” is a nucleic acid molecule that is capable of transporting another nucleic acid molecule.
  • Vectors may be, for example, plasmids, cosmids, viruses, a RNA vector or a linear or circular DNA or RNA molecule that may include chromosomal, non-chromosomal, semi -synthetic or synthetic nucleic acid molecules.
  • Vectors of the present disclosure also include transposon systems (e.g., Sleeping Beauty, see, e.g., Geurts et al., Mol. Ther. 5:108, 2003: Mates et al., Nat. Genet. 41'.753, 2009).
  • Exemplary vectors are those capable of autonomous replication (episomal vector), capable of delivering a polynucleotide to a cell genome (e.g., viral vector), or capable of expressing nucleic acid molecules to which they are linked (expression vectors).
  • expression vector refers to a DNA construct containing a nucleic acid molecule that is operably linked to a suitable control sequence capable of effecting the expression of the nucleic acid molecule in a suitable host.
  • control sequences include a promoter to effect transcription, an optional operator sequence to control such transcription, a sequence encoding suitable mRNA ribosome binding sites, and sequences which control termination of transcription and translation.
  • the vector may be a plasmid, a phage particle, a virus, or simply a potential genomic insert.
  • the vector may replicate and function independently of the host genome, or may, in some instances, integrate into the genome itself or deliver the polynucleotide contained in the vector into the genome without the vector sequence.
  • plasmid "expression plasmid,” “virus,” and “vector” are often used interchangeably.
  • nucleic acid molecule in the context of inserting a nucleic acid molecule into a cell, means “transfection", “transformation,” or “transduction” and includes reference to the incorporation of a nucleic acid molecule into a eukaryotic or prokaryotic cell wherein the nucleic acid molecule may be incorporated into the genome of a cell (e.g., chromosome, plasmid, plastid, or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).
  • polynucleotides of the present disclosure may be operatively linked to certain elements of a vector.
  • Expression control sequences may include appropriate transcription initiation, termination, promoter, and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (/. ⁇ ., Kozak consensus sequences); sequences that enhance protein stability; and possibly sequences that enhance protein secretion.
  • Expression control sequences may be operatively linked if they are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
  • the vector comprises a plasmid vector or a viral vector (e.g., a lentiviral vector or a y-retroviral vector).
  • Viral vectors include retrovirus, adenovirus, parvovirus (e.g., adeno-associated viruses), coronavirus, negative strand RNA viruses such as ortho-myxovirus (e.g., influenza virus), rhabdovirus (e.g., rabies and vesicular stomatitis virus), paramyxovirus (e.g., measles and Sendai), positive strand RNA viruses such as picornavirus and alphavirus, and double-stranded DNA viruses including adenovirus, herpesvirus (e.g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e.g., vaccinia, fowlpox, and canarypox).
  • herpesvirus e.
  • viruses include, for example, Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, and hepatitis virus.
  • retroviruses include avian leukosis-sarcoma, mammalian C-type, B-type viruses, D type viruses, HTLV-BLV group, lentivirus, spumavirus (Coffin, J. M., Retroviridae: The viruses and their replication, In Fundamental Virology, Third Edition, B. N. Fields et al., Eds., Lippincott-Raven Publishers, Philadelphia, 1996).
  • “Retroviruses” are viruses having an RNA genome, which is reverse-transcribed into DNA using a reverse transcriptase enzyme, the reverse-transcribed DNA is then incorporated into the host cell genome.
  • “Gammaretrovirus” refers to a genus of the retroviridae family. Examples of gammaretroviruses include mouse stem cell virus, murine leukemia virus, feline leukemia virus, feline sarcoma virus, and avian reticuloendotheliosis viruses.
  • Lentiviral vectors include HIV-based lentiviral vectors for gene delivery, which can be integrative or non-integrative, have relatively large packaging capacity, and can transduce a range of different cell types. Lentiviral vectors are usually generated following transient transfection of three (packaging, envelope, and transfer) or more plasmids into producer cells. Like HIV, lentiviral vectors enter the target cell through the interaction of viral surface glycoproteins with receptors on the cell surface. On entry, the viral RNA undergoes reverse transcription, which is mediated by the viral reverse transcriptase complex. The product of reverse transcription is a double-stranded linear viral DNA, which is the substrate for viral integration into the DNA of infected cells.
  • the viral vector can be a gammaretrovirus, e.g., Moloney murine leukemia virus (MLV)-derived vectors.
  • the viral vector can be a more complex retrovirus-derived vector, e.g., a lentivirus-derived vector. HIV-l-derived vectors belong to this category.
  • Other examples include lentivirus vectors derived from HIV-2, FIV, equine infectious anemia virus, SIV, and Maedi-Visna virus (ovine lentivirus).
  • Retroviral and lentiviral vector constructs and expression systems are also commercially available.
  • Other viral vectors also can be used for polynucleotide delivery including DNA viral vectors, including, for example adenovirus-based vectors and adeno-associated virus (AAV)-based vectors; vectors derived from herpes simplex viruses (HSVs), including amplicon vectors, replication-defective HSV and attenuated HSV (Krisky et al., Gene Ther. 5: 1517, 1998).
  • HSVs herpes simplex viruses
  • the viral vector may also comprise additional sequences between the two (or more) transcripts allowing for bicistronic or multi ci str onic expression.
  • additional sequences used in viral vectors include internal ribosome entry sites (IRES), furin cleavage sites, viral 2A peptide, or any combination thereof.
  • Plasmid vectors including DNA-based antibody or antigen-binding fragmentencoding plasmid vectors for direct administration to a subject, are described further herein.
  • the term "host” refers to a cell or microorganism targeted for genetic modification with a heterologous nucleic acid molecule to produce a polypeptide of interest (e.g., an antibody of the present disclosure).
  • a host cell may include any individual cell or cell culture which may receive a vector or the incorporation of nucleic acids or express proteins. The term also encompasses progeny of the host cell, whether genetically or phenotypically the same or different. Suitable host cells may depend on the vector and may include mammalian cells, animal cells, human cells, simian cells, insect cells, yeast cells, and bacterial cells. These cells may be induced to incorporate the vector or other material by use of a viral vector, transformation via calcium phosphate precipitation, DEAE-dextran, electroporation, microinjection, or other methods. See, for example, Sambrook et a!.. Molecular Cloning: A Laboratory Manual 2d ed. (Cold Spring Harbor Laboratory, 1989).
  • a "host” refers to a cell or a subject infected with the SARS-CoV-2 coronavirus.
  • Antigen refers to an immunogenic molecule that provokes an immune response. This immune response may involve antibody production, activation of specific immunologically-competent cells, activation of complement, antibody dependent cytotoxicicity, or any combination thereof.
  • An antigen immunogenic molecule
  • An antigen may be, for example, a peptide, glycopeptide, polypeptide, glycopolypeptide, polynucleotide, polysaccharide, lipid, or the like. It is readily apparent that an antigen can be synthesized, produced recombinantly, or derived from a biological sample. Exemplary biological samples that can contain one or more antigens include tissue samples, stool samples, cells, biological fluids, or combinations thereof.
  • Antigens can be produced by cells that have been modified or genetically engineered to express an antigen. Antigens can also be present in a SARS-CoV-2 coronavirus (e.g., a surface glycoprotein or portion thereof), such as present in a virion, or expressed or presented on the surface of a cell infected by SARS-CoV-2.
  • SARS-CoV-2 coronavirus e.g., a surface glycoprotein or portion thereof
  • epitope includes any molecule, structure, amino acid sequence, or protein determinant that is recognized and specifically bound by a cognate binding molecule, such as an immunoglobulin, or other binding molecule, domain, or protein.
  • Epitopic determinants generally contain chemically active surface groupings of molecules, such as amino acids or sugar side chains, and can have specific three-dimensional structural characteristics, as well as specific charge characteristics.
  • the epitope can be comprised of consecutive amino acids (e.g., a linear epitope), or can be comprised of amino acids from different parts or regions of the protein that are brought into proximity by protein folding (e.g., a discontinuous or conformational epitope), or non-contiguous amino acids that are in close proximity irrespective of protein folding.
  • the present disclosure provides an isolated antibody, or an antigen-binding fragment thereof, that comprises a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, and is capable of binding to a surface glycoprotein of SARS-CoV-2, in particular in an epitope that is at least partially comprised in or defined by Domain A.
  • the antibody or antigen-binding fragment is capable of binding to a surface glycoprotein of SARS- CoV-2 expressed on a cell surface of a host cell and/or on a SARS-CoV-2 virion.
  • an antibody or antigen-binding fragment of the present disclosure associates with or unites with a SARS-CoV-2 surface glycoprotein Domain A epitope or antigen comprising the epitope, while not significantly associating or uniting with any other molecules or components in a sample.
  • an antibody or antigen binding fragment of the present disclosure is cross-reactive for SARS-CoV-2 and one or more additional sarbecovirus of clade 2, but not of clade 1 or clade 3. In certain embodiments, an antibody or antigen binding fragment of the present disclosure is not cross-reactive against an embecovirus, a merbecovirus, or both.
  • an antibody or antigen-binding fragment of the present disclosure specifically binds to a SARS-CoV-2 surface glycoprotein.
  • “specifically binds” refers to an association or union of an antibody or antigen-binding fragment to an antigen with an affinity or K a (z.e., an equilibrium association constant of a particular binding interaction with units of 1/M) equal to or greater than 10 5 M' 1 (which equals the ratio of the on-rate [K on ] to the off rate [K O ff] for this association reaction), while not significantly associating or uniting with any other molecules or components in a sample.
  • affinity may be defined as an equilibrium dissociation constant (Kd) of a particular binding interaction with units of M (e.g., 10' 5 M to 10' 13 M).
  • Antibodies may be classified as “high-affinity” antibodies or as “low- affinity” antibodies.
  • “High-affinity” antibodies refer to those antibodies having a K a of at least 10 7 M -1 , at least 10 8 M' 1 , at least 10 9 M' 1 , at least IO 10 M' 1 , at least 10 11 M' 1 , at least 10 12 M -1 , or at least 10 13 M' 1 .
  • “Low-affinity” antibodies refer to those antibodies having a K a of up to 10 7 M -1 , up to 10 6 M' 1 , up to 10 5 M' 1 .
  • affinity may be defined as an equilibrium dissociation constant (Kd) of a particular binding interaction with units of M (e.g., 10' 5 M to 10' 13 M).
  • antibody and antigen-binding fragments may be described with reference to affinity and/or to avidity for antigen.
  • avidity refers to the total binding strength of an antibody or antigen-binding fragment thereof to antigen, and reflects binding affinity, valency of the antibody or antigenbinding fragment (e.g., whether the antibody or antigen-binding fragment comprises one, two, three, four, five, six, seven, eight, nine, ten, or more binding sites), and, for example, whether another agent is present that can affect the binding (e.g., a noncompetitive inhibitor of the antibody or antigen-binding fragment).
  • assays for identifying antibodies of the present disclosure that bind a particular target, as well as determining binding domain or binding protein affinities, such as Western blot, ELISA (e.g., direct, indirect, or sandwich), analytical ultracentrifugation, spectroscopy, and surface plasmon resonance (Biacore®) analysis (see, e.g., Scatchard et al., Ann. N.Y. Acad. Sci. 57:660, 1949; Wilson, Science 295:2103, 2002; Wolff et al., Cancer Res. 53:2560, 1993; and U.S. Patent Nos. 5,283,173, 5,468,614, or the equivalent). Assays for assessing affinity or apparent affinity or relative affinity are also known.
  • binding can be determined by recombinantly expressing a SARS-CoV-2 antigen in a host cell (e.g., by transfection) and immunostaining the (e.g., fixed, or fixed and permeabilized) host cell with antibody and analyzing binding by flow cytometry (e.g., using a ZE5 Cell Analyzer (BioRad®) and FlowJo software (TreeStar).
  • positive binding can be defined by differential staining by antibody of SARS-CoV-2 -expressing cells versus control (e.g., mock) cells.
  • an antibody or antigen-binding fragment of the present disclosure binds to SARS-CoV-2 S protein, as measured using biolayer interferometry. In certain embodiments, an antibody or antigen-binding fragment of the present disclosure binds to SARS-CoV-2 S protein with a KD of less than about 4.5xl0' 9 M, less than about 5xl0' 9 M, less than about IxlO' 10 M, less than about 5xl0' 10 M, less than about IxlO' 11 M, less than about 5xl0' n M, less than about IxlO' 12 M, or less than about 5x1 O' 12 M.
  • the IC50 is the concentration of a composition (e.g., antibody) that results in half-maximal inhibition of the indicated biological or biochemical function, activity, or response.
  • the EC50 is the concentration of a composition that provides the half-maximal response in the assay.
  • IC50 and EC50 are used interchangeably.
  • an antibody of the present disclosure is capable of neutralizing infection by SARS-CoV-2.
  • a "neutralizing antibody” is one that can neutralize, /. ⁇ ., prevent, inhibit, reduce, impede, or interfere with, the ability of a pathogen to initiate and/or perpetuate an infection in a host.
  • Neutralization may be quantified by, for example, assessing SARS-CoV-2 RNA levels in a(n e.g. lung) sample, assessing SARS-CoV-2 viral load in a(n e.g. lung) sample, assessing histopathology of a(n e.g. lung) sample, or the like.
  • the antibody or antigen-binding fragment is capable of preventing and/or neutralizing a SARS-CoV-2 infection in an in vitro model of infection and/or in an in vivo animal model of infection (e.g., using a Syrian hamster model with intranasal delivery of SARS-CoV-2) and/or in a human.
  • the antibody or antigen-binding fragment (i) recognizes an epitope in the Domain A of SARS-CoV-2; (ii) is capable of neutralizing a SARS CoV-2 infection; (iii) is capable of eliciting at least one immune effector function against SARS CoV-2; (iv) is capable of preventing shedding, from a cell infected with SARS CoV-2, of SI protein; or (v) any combination of (i)-(iv).
  • antibody refers to an intact antibody comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds, as well as any antigen-binding portion or fragment of an intact antibody that has or retains the ability to bind to the antigen target molecule recognized by the intact antibody, such as an scFv, Fab, or Fab'2 fragment.
  • antibody herein is used in the broadest sense and includes polyclonal and monoclonal antibodies, including intact antibodies and functional (antigen-binding) antibody fragments thereof, including fragment antigen binding (Fab) fragments, F(ab')2 fragments, Fab' fragments, Fv fragments, recombinant IgG (rlgG) fragments, single chain antibody fragments, including single chain variable fragments (scFv), and single domain antibodies (e.g., sdAb, sdFv, nanobody) fragments.
  • Fab fragment antigen binding
  • rlgG recombinant IgG
  • scFv single chain variable fragments
  • single domain antibodies e.g., sdAb, sdFv, nanobody
  • immunoglobulins such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, and heteroconjugate antibodies, multi specific, e.g., bi specific antibodies, diabodies, tnabodies, tetrabodies, tandem di-scFv, and tandem tri-scFv.
  • antibody should be understood to encompass functional antibody fragments thereof.
  • the term also encompasses intact or full-length antibodies, including antibodies of any class or sub-class, including IgG and sub-classes thereof (IgGl, IgG2, IgG3, IgG4), IgM, IgE, IgA, and IgD.
  • VL or “VL” and “ VH” or “VH” refer to the variable binding region from an antibody light chain and an antibody heavy chain, respectively.
  • a VL is a kappa (K) class (also “VK” herein).
  • a VL is a lambda (X) class.
  • the variable binding regions comprise discrete, well-defined sub-regions known as “complementarity determining regions” (CDRs) and “framework regions” (FRs).
  • CDR complementarity determining region
  • HVR hypervariable region
  • an antibody VH comprises four FRs and three CDRs as follows: FR1-HCDR1-FR2-HCDR2-FR3-HCDR3-FR4; and an antibody VL comprises four FRs and three CDRs as follows: FR1-LCDR1-FR2- LCDR2-FR3-LCDR3-FR4.
  • the VH and the VL together form the antigenbinding site through their respective CDRs.
  • a "variant" of a CDR refers to a functional variant of a CDR sequence having up to 1-3 amino acid substitutions (e.g., conservative or nonconservative substitutions), deletions, or combinations thereof.
  • Numbering of CDR and framework regions may be according to any known method or scheme, such as the Kabat, Chothia, EU, IMGT, and AHo numbering schemes (see, e.g., Kabat et al., "Sequences of Proteins of Immunological Interest, US Dept. Health and Human Services, Public Health Service National Institutes of Health, 1991, 5 th ed.; Chothia and Lesk, J. Mol. Biol. 796:901-917 (1987)); Lefranc et al., Dev. Comp. Immunol. 27:55, 2003; Honegger and Pluckthun, J. Mol. Bio. 309:657-670 (2001)).
  • Kabat et al. Kabat et al., "Sequences of Proteins of Immunological Interest, US Dept. Health and Human Services, Public Health Service National Institutes of Health, 1991, 5 th ed.; Chothia and Lesk, J. Mol. Biol. 796:901-917 (1987
  • an antibody or antigen-binding fragment comprises CDRs in a VH sequence according to any one of SEQ ID NOs.: 22, 32, 42, 52, 62, 72, 82, 92, 102, 112, 122, 132, 142,152, 162, 172, 182 192, 202, 212, 222, 232, 242, 252, 262, 272, 282, 292, 302, 312, 322, 332, 342, 352, 362, 372, 382, 392, 402, 412, 422, and 432, and in a VL sequence according to any one of SEQ ID NOs.: 26, 36, 46, 56, 66, 76, 86, 96, 106, 116, 126, 136, 146, 156, 166, 176, 186, 196, 206, 216, 226, 236, 246, 256, 266, 276, 286, 296, 306, 316, 326, 336, 346, 356, 366, 376, 386, 386, 386, 386
  • CDRs are according to the IMGT numbering method. In certain embodiments, CDRs are according to the antibody numbering method developed by the Chemical Computing Group (CCG); e.g., using Molecular Operating Environment (MOE) software (www.chemcomp.com).
  • CCG Chemical Computing Group
  • MOE Molecular Operating Environment
  • an antibody or an antigen-binding fragment comprises a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein: (i) the CDRH1 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs.: 23, 33, 43, 53, 63, 73, 83, 93, 103, 113, 123, 133, 143, 153, 163, 173, 183, 193, 203, 213, 223, 233, 243, 253, 263, 273, 283, 293, 303, 313, 323, 333, 343, 353, 363, 373, 383, 393, 403, 413, 423, or 433, or a sequence variant thereof comprising one, two, or three acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to
  • the antibody or antigen-binding fragment is capable of preventing and/or neutralizing a SARS-CoV-2 infection in an in vitro model of infection and/or in an in vivo animal model of infection and/or in a human.
  • the antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NOs.: (i) 23-25 and 27-29, respectively; (ii) 33-35 and 37-39, respectively; (iii) 43-45 and 47-49, respectively; (iv) 53-55 and 57-59, respectively; (v) 63-65 and 67-69, respectively; (vi) 73-75 and 77-79, respectively; (vii) 83-85 and 87-89, respectively; (viii) 93-95 and 97-99, respectively; (ix) 103-105 and 107-109, respectively; (x) 113-115 and 117-119, respectively; (xi) 123-125 and 127- 129, respectively; (xii) 133-135 and 137-139, respectively, (xiii) 143-145 and 147-149, respectively; (
  • an antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences as set forth in SEQ ID NOs.: 163-165 and 167-169, respectively.
  • the antibody or antigen-binding fragment comprises VH and VL amino acid sequences as set forth in SEQ ID NOs.: 162 and 166, respectively.
  • an antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences as set forth in SEQ ID NOs.: 103-105 and 107-109, respectively.
  • the antibody or antigen-binding fragment comprises VH and VL amino acid sequences as set forth in SEQ ID NOs.: 102 and 106, respectively.
  • an antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences as set forth in SEQ ID NOs.:73-75 and 77-79, respectively.
  • the antibody or antigen-binding fragment comprises VH and VL amino acid sequences as set forth in SEQ ID NOs.:72 and 76, respectively.
  • an antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences as set forth in SEQ ID NOs.:63-65 and 67-69, respectively.
  • the antibody or antigen-binding fragment comprises VH and VL amino acid sequences as set forth in SEQ ID NOs.:62 and 66, respectively.
  • an antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences as set forth in SEQ ID NOs.:23-25 and 27-29, respectively.
  • the antibody or antigen-binding fragment comprises VH and VL amino acid sequences as set forth in SEQ ID NOs.:22 and 26, respectively.
  • an antibody or antigen-binding fragment that comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences as set forth in SEQ ID NOs.:33-35 and 37-39, respectively.
  • the antibody or antigen-binding fragment comprises VH and VL amino acid sequences as set forth in SEQ ID NOs.:32 and 36, respectively.
  • an antibody or antigen-binding fragment is provided that comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences as set forth in SEQ ID NOs.:53-55 and 57-59, respectively.
  • the antibody or antigen-binding fragment comprises VH and VL amino acid sequences as set forth in SEQ ID NOs.:52 and 56, respectively.
  • an antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences as set forth in SEQ ID NOs.:363-365 and 367-369, respectively.
  • the antibody or antigen-binding fragment comprises VH and VL amino acid sequences as set forth in SEQ ID NOs.:362 and 366, respectively.
  • an antibody or an antigen-binding fragment of the present disclosure comprises a CDRH1, a CDRH2, a CDRH3, a CDRL1, a CDRL2, and a CDRL3, wherein each CDR is independently selected from a corresponding CDR of Antibody 418_1, Antibody 418_2, Antibody 418 3, Antibody 418_4, Antibody 418 5, Antibody 418_6, Antibody 418_7, Antibody 418 8, Antibody 418_9, Antibody 418 10, Antibody 418 11, Antibody 418 12, Antibody 418_13, Antibody 418_14, Antibody 418_15, Antibody 418 16, Antibody 418_17, Antibody 418 18, Antibody 418 19, Antibody 418_20, Antibody 418 21, Antibody 418_22, Antibody 418_23, Antibody 418_24, Antibody 418_25, Antibody 418_26, Antibody 418_27, Antibody 418_28, Antibody 418_29, Antibody 418_30
  • Antibody 418 1 is also referred to herein as S2X28.
  • Antibody 418_2 is also referred to herein as S2X303.
  • Antibody 418 3 is also referred to herein as S2X320.
  • Antibody 418_4 is also referred to herein as S2X333.
  • Antibody 418 5 is also referred to herein as S2M28.
  • Antibody 418_6 is also referred to herein as S2M24 or S2M24v2.
  • Antibody 418 7 is also referred to herein as S2L7.
  • Antibody 418 8 is also referred to herein as S2L24.
  • Antibody 418_9 is also referred to herein as S2L28.
  • Antibody 418 10 is also referred to herein as S2X310.
  • Antibody 418 11 is also referred to herein as S2X94.
  • Antibody 418 12 is also referred to herein as S2X169.
  • Antibody 418 13 is also referred to herein as S2L11.
  • Antibody 418 14 is also referred to herein as S2L12.
  • Antibody 418 15 is also referred to herein as S2X186.
  • Antibody 418 16 is also referred to herein as S2X175.
  • Antibody 418 17 is also referred to herein as S2X170.
  • Antibody 418 18 is also referred to herein as S2X125.
  • Antibody 418 19 is also referred to herein as S2X107.
  • Antibody 418_20 is also referred to herein as S2X105.
  • Antibody 418 21 is also referred to herein as S2X102.
  • Antibody 418_22 is also referred to herein as S2X15.
  • Antibody 418_23 is also referred to herein as S2X49.
  • Antibody 418_24 is also referred to herein as S2X51.
  • Antibody 418_25 is also referred to herein as S2X72.
  • Antibody 418_26 is also referred to herein as S2X91.
  • Antibody 418 27 is also referred to herein as S2X98.
  • Antibody 418 28 is also referred to herein as S2X124.
  • Antibody 418_29 is also referred to herein as S2X158.
  • Antibody 418_30 is also referred to herein as S2X161.
  • Antibody 418 31 is also referred to herein as S2X165.
  • Antibody 418 33 is also referred to herein as S2X173.
  • Antibody 418_34 is also referred to herein as S2X176.
  • Antibody 418 35 is also referred to herein as S2X316.
  • Antibody 418_37 is also referred to herein as S2X90.
  • Antibody 418 38 is also referred to herein as S2X93.
  • Antibody 418 39 is also referred to herein as S2L14.
  • Antibody 418_40 is also referred to herein as S2L20 or S2L20vl.
  • Antibody 418 41 is also referred to herein as S2L26.
  • Antibody 418 42 is also referred to herein as S2L35.
  • Antibody 418 43 is also referred to herein as S2L38.
  • Antibody 418 44 is also referred to herein as S2L50.
  • CL refers to an "immunoglobulin light chain constant region” or a "light chain constant region,” /. ⁇ ., a constant region from an antibody light chain.
  • CH refers to an "immunoglobulin heavy chain constant region” or a "heavy chain constant region,” which is further divisible, depending on the antibody isotype into CHI, CH2, and CH3 (IgA, IgD, IgG), or CHI, CH2, CH3, and CH4 domains (IgE, IgM).
  • CHI unimmunoglobulin heavy chain constant region
  • an antibody or antigen-binding fragment of the present disclosure comprises any one or more of CL, a CHI, a CH2, and a CH3.
  • a CL comprises an amino acid sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence of SEQ ID NO : 8 or SEQ ID NO.: 9.
  • a CH1-CH2-CH3 comprises an amino acid sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acid sequence of SEQ ID NO.:6 or SEQ ID NO.:7.
  • production in a mammalian cell line can remove one or more C-terminal lysine of an antibody heavy chain (see, e.g., Liu et al. mAbs 6 5 .1145-1154 (2014)).
  • an antibody or antigen-binding fragment of the present disclosure can comprise a heavy chain, a CH1-CH3, a CH3, or an Fc polypeptide wherein a C-terminal lysine residue is present or is absent; in other words, encompassed are embodiments where the C-terminal residue of a heavy chain, a CH1- CH3, or an Fc polypeptide is not a lysine (e.g., is a glycine), and embodiments where a lysine is the C-terminal residue.
  • a composition comprises a plurality of an antibody and/or an antigen-binding fragment of the present disclosure, wherein one or more antibody or antigen-binding fragment does not comprise a lysine residue at the C-terminal end of the heavy chain, CH1-CH3, or Fc polypeptide, and wherein one or more antibody or antigen-binding fragment comprises a lysine residue at the C-terminal end of the heavy chain, CH1-CH3, or Fc polypeptide.
  • a “Fab” fragment antigen binding is the part of an antibody that binds to antigens and includes the variable region and CHI of the heavy chain linked to the light chain via an inter-chain disulfide bond. Each Fab fragment is monovalent with respect to antigen binding, i.e., it has a single antigen-binding site. Pepsin treatment of an antibody yields a single large F(ab')2 fragment that roughly corresponds to two disulfide linked Fab fragments having divalent antigen-binding activity and is still capable of cross-linking antigen.
  • Both the Fab and F(ab’)2 are examples of "antigenbinding fragments.”
  • Fab' fragments differ from Fab fragments by having additional few residues at the carboxy terminus of the CHI domain including one or more cysteines from the antibody hinge region.
  • Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group.
  • F(ab')2 antibody fragments originally were produced as pairs of Fab' fragments that have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
  • Fab fragments may be joined, e.g., by a peptide linker, to form a single chain Fab, also referred to herein as "scFab.”
  • a single chain Fab also referred to herein as "scFab.”
  • an inter-chain disulfide bond that is present in a native Fab may not be present, and the linker serves in full or in part to link or connect the Fab fragments in a single polypeptide chain.
  • a heavy chain- derived Fab fragment e.g., comprising, consisting of, or consisting essentially of VH + CHI, or "Fd
  • a light chain-derived Fab fragment e.g., comprising, consisting of, or consisting essentially of VL + CL
  • a scFab may be arranged, in N-terminal to C-terminal direction, according to (heavy chain Fab fragment - linker - light chain Fab fragment) or (light chain Fab fragment - linker - heavy chain Fab fragment).
  • Peptide linkers and exemplary linker sequences for use in scFabs are discussed in further detail herein.
  • Fv is a small antibody fragment that contains a complete antigen-recognition and antigen-binding site. This fragment generally consists of a dimer of one heavy- and one light-chain variable region domain in tight, non-covalent association. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) can have the ability to recognize and bind antigen, although typically at a lower affinity than the entire binding site.
  • Single-chain Fv also abbreviated as “sFv” or “scFv”
  • sFv single-chain Fv
  • the scFv polypeptide comprises a polypeptide linker disposed between and linking the VH and VL domains that enables the scFv to retain or form the desired structure for antigen binding.
  • a peptide linker can be incorporated into a fusion polypeptide using standard techniques well known in the art.
  • the antibody or antigen-binding fragment comprises a scFv comprising a VH domain, a VL domain, and a peptide linker linking the VH domain to the VL domain.
  • a scFv comprises a VH domain linked to a VL domain by a peptide linker, which can be in a VH-linker- VL orientation or in a VL-linker-VH orientation.
  • Any scFv of the present disclosure may be engineered so that the C-terminal end of the VL domain is linked by a short peptide sequence to the N-terminal end of the VH domain, or vice versa (i.e., (N)VL(C)-linker-(N)VH(C) or (N)VH(C)-linker-(N)VL(C).
  • a linker may be linked to an N-terminal portion or end of the VH domain, the VL domain, or both.
  • Peptide linker sequences may be chosen, for example, based on: (1) their ability to adopt a flexible extended conformation; (2) their inability or lack of ability to adopt a secondary structure that could interact with functional epitopes on the first and second polypeptides and/or on a target molecule; and/or (3) the lack or relative lack of hydrophobic or charged residues that might react with the polypeptides and/or target molecule.
  • linker design e.g., length
  • linker design can include the conformation or range of conformations in which the VH and VL can form a functional antigen-binding site.
  • peptide linker sequences contain, for example, Gly, Asn and Ser residues.
  • linker sequence may also be included in a linker sequence.
  • Other amino acid sequences which may be usefully employed as linker include those disclosed in Maratea et al., Gene 40:39 46 (1985); Murphy et al., Proc. Natl. Acad. Sci. USA 83:8258 8262 (1986); U.S. Pat. No. 4,935,233, and U.S. Pat. No. 4,751,180.
  • linkers may include, for example, Glu-Gly-Lys-Ser-Ser-Gly-Ser-Gly-Ser-Glu-Ser-Lys- Val-Asp (SEQ ID NO: 19) (Chaudhary et al., Proc. Natl. Acad. Sci.
  • Any suitable linker may be used, and in general can be about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 15 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100 amino acids in length, or less than about 200 amino acids in length, and will preferably comprise a flexible structure (can provide flexibility and room for conformational movement between two regions, domains, motifs, fragments, or modules connected by the linker), and will preferably be biologically inert and/or have a low risk of immunogenicity in a human.
  • Exemplary linkers include those comprising or consisting of the amino acid sequence set forth in any one or more of SEQ ID NOs: 10-21.
  • the linker comprises or consists of an ammo acid sequence having at least 75% (i.e., at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) identity to the amino acid sequence set forth in any one of SEQ ID NOs: 10-21.
  • scFvs can be constructed using any combination of the VH and VL sequences or any combination of the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 sequences disclosed herein.
  • linker sequences are not required; for example, when the first and second polypeptides have non-essential N-terminal amino acid regions that can be used to separate the functional domains and prevent steric interference.
  • DNA in the germline variable (V), joining (J), and diversity (D) gene loci may be rearranged and insertions and/or deletions of nucleotides in the coding sequence may occur. Somatic mutations may be encoded by the resultant sequence, and can be identified by reference to a corresponding known germline sequence.
  • somatic mutations that are not critical to a desired property of the antibody e.g., binding to a SARS-CoV-2 antigen
  • that confer an undesirable property upon the antibody e.g., an increased risk of immunogenicity in a subject administered the antibody
  • the antibody or antigen-binding fragment of the present disclosure comprises at least one more germline-encoded amino acid in a variable region as compared to a parent antibody or antigen-binding fragment, provided that the parent antibody or antigen binding fragment comprises one or more somatic mutations.
  • Variable region and CDR amino acid sequences of exemplary anti-SARS-CoV-2 antibodies of the present disclosure are provided in Table 1 herein.
  • an antibody or antigen-binding fragment comprises an amino acid modification (e.g., a substitution mutation) to remove an undesired risk of oxidation, deamidation, and/or isomerization.
  • variant antibodies that comprise one or more ammo acid alterations in a variable region (e.g., VH, VL, framework or CDR) as compared to a presently disclosed ("parent") antibody, wherein the variant antibody is capable of binding to a SARS-CoV-2 antigen.
  • the VH comprises or consists of an amino acid sequence having at least 85% (i.e., 85%, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%) identity to the amino acid sequence according to any one of SEQ ID NOs.: 22, 32, 42, 52, 62, 72, 82, 92, 102, 112, 122, 132, 142, 152, 162, 172, 182 192, 202, 212, 222, 232, 242, 252, 262, 272, 282, 292, 302, 312, 322, 332, 342, 352, 362, 372, 382, 392, 402, 412, 422, or 432, wherein the variation is optionally limited to one or more framework regions and/or the variation comprises one or more substitution to a germline-encoded amino acid; and/or (ii) the VL comprises or consists of an amino acid sequence having at least 85% (i.e, 87,
  • the VH comprises or consists of any VH amino acid sequence set forth in Table 1
  • the VL comprises or consists of any VL amino acid sequence set forth in Table 1.
  • the VH and the VL comprise amino acid sequences having at least have at least 85% (i.e., 85%, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%) identity to, or comprise or consist of, the amino acid sequences according to SEQ ID NOs.: (i) 22 and 26, respectively; (ii) 32 and 36, respectively; (iii) 42 and 46, respectively; (iv) 52 and 56, respectively; (v) 62 and 66, respectively; (vi) 72 and 76, respectively; (vii) 82 and 86, respectively; (viii) 92 and 96, respectively; (ix) 102 and 106, respectively; (x) 112 and 116, respectively; (xi) 122 and
  • an antibody or antigen-binding fragment of the present disclosure is monospecific (e.g., binds to a single epitope) or is multispecific (e.g., binds to multiple epitopes and/or target molecules).
  • Antibodies and antigen binding fragments may be constructed in various formats. Exemplary antibody formats are disclosed in Spiess et al., Mol. Immunol.
  • FIT-Ig e.g., PCT Publication No.
  • WuxiBody formats e.g, PCT Publication No. WO 2019/057122, which formats are incorporated herein by reference in their entirety
  • In-Elbow-Insert Ig formats lELIg; e.g, PCT Publication Nos. WO 2019/024979 and WO 2019/025391, which formats are incorporated herein by reference in their entirety.
  • the antibody or antigen-binding fragment comprises two or more of VH domains, two or more VL domains, or both (/. ⁇ ., two or more VH domains and two or more VL domains).
  • an antigen-binding fragment comprises the format (N-terminal to C-terminal direction) VH-linker- VL- linker-VH-linker-VL, wherein the two VH sequences can be the same or different and the two VL sequences can be the same or different.
  • Such linked scFvs can include any combination of VH and VL domains arranged to bind to a given target, and in formats comprising two or more VH and/or two or more VL, one, two, or more different eptiopes or antigens may be bound. It will be appreciated that formats incorporating multiple antigen-binding domains may include VH and/or VL sequences in any combination or orientation.
  • the antigen-binding fragment can comprise the format VL-linker-VH-linker-VL-linker-VH, VH-linker-VL-linker-VL-linker-VH, or VL-linker- VH-linker- VH-linker- VL .
  • Monospecific or multispecific antibodies or antigen-binding fragments of the present disclosure constructed comprise any combination of the VH and VL sequences and/or any combination of the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 sequences disclosed herein.
  • a bispecific or multispecific antibody or antigenbinding fragment may, in some embodiments, comprise one, two, or more antigenbinding domains (e.g., a VH and a VL) of the instant disclosure.
  • Two or more binding domains may be present that bind to the same or a different SARS-CoV-2 epitope, and a bispecific or multispecific antibody or antigen-binding fragment as provided herein can, in some embodiments, comprise a further SARS-CoV-2 binding domain, and/or can comprise a binding domain that binds to a different antigen or pathogen altogether.
  • the antibody or antigen-binding fragment can be multispecific; e.g., bispecific, trispecific, or the like.
  • the antibody or antigen-binding fragment comprises: (i) a first VH and a first VL; and (ii) a second VH and a second VL, wherein the first VH and the second VH are different and each independently comprise an amino acid sequence having at least 85% (i.e., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the amino acid sequence set forth in any one of SEQ ID NOs.: 22, 32, 42, 52, 62, 72, 82, 92, 102, 112, 122, 132, 142, 152, 162, 172, 182 192, 202, 212, 222, 232, 242, 252, 262, 272, 282, 292, 302, 312, 322, 332, 342, 352, 362, 372, 382, 392, 402, 412, 422, or 432, and wherein the first VL and the first VH and
  • the antibody or antigen-binding fragment comprises: (i) a first VH and a first VL; and (ii) a second VH and a second VL, wherein the first VH comprises an amino acid sequence having at least 85% (z.e., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the amino acid sequence set forth in SEQ ID NO: 52 and the first VL comprises an amino acid sequence having at least 85% (z.e., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the amino acid sequence set forth in SEQ ID NO: 56; and a) the second VH comprises an amino acid sequence having at least 85% (z.e., 85%, 86%, 87%, 88%, 89%,
  • the antibody or antigen-binding fragment comprises a Fc polypeptide, or a fragment thereof.
  • the "Fc” fragment or Fc polypeptide comprises the carboxy -terminal portions (z.e., the CH2 and CH3 domains of IgG) of both antibody H chains held together by disulfides.
  • Antibody "effector functions" refer to those biological activities attributable to the Fc region (a native sequence Fc region or amino acid sequence variant Fc region) of an antibody, and vary with the antibody isotype.
  • antibody effector functions include: Clq binding and complement dependent cytotoxicity; Fc receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; down regulation of cell surface receptors (e.g., B cell receptor); and B cell activation.
  • modifications e.g., amino acid substitutions
  • Fc domain in order to modify (e.g., improve, reduce, or ablate) one or more functionality of an Fc-containing polypeptide (e.g., an antibody of the present disclosure).
  • Such functions include, for example, Fc receptor (FcR) binding, antibody half-life modulation (e.g., by binding to FcRn), ADCC function, protein A binding, protein G binding, and complement binding.
  • Amino acid modifications that modify (e.g., improve, reduce, or ablate) Fc functionalities include, for example, the T250Q/M428L, M252Y/S254T/T256E, H433K/N434F, M428L/N434S, E233P/L234V/L235A/G236 + A327G/A330S/P331S, E333A, S239D/A330L/I332E, P257EQ311, K326W/E333S, S239D/I332E/G236A, N297Q, K322A, S228P, L235E + E318A/K320A/K322A, L234A/L235A (also referred to herein as "LALA"), and L234A/L235 A/P329G mutations, which mutations are summarized and annotated in "Engineered Fc Regions", published by InvivoGen (2011) and available online at
  • the Clq protein complex can bind to at least two molecules of IgGl or one molecule of IgM when the immunoglobulin molecule(s) is attached to the antigenic target (Ward, E. S., and Ghetie, V., Ther. Immunol. 2 (1995) 77-94).
  • Burton, D. R. described (MoL Immunol. 22 (1985) 161-206) that the heavy chain region comprising amino acid residues 318 to 337 is involved in complement fixation.
  • Duncan, A. R., and Winter, G. (Nature 332 (1988) 738-740), using site directed mutagenesis, reported that Glu318, Lys320 and Lys322 form the binding site to Clq.
  • the role of Glu318, Lys320 and Lys 322 residues in the binding of Clq was confirmed by the ability of a short synthetic peptide containing these residues to inhibit complement mediated lysis.
  • FcR binding can be mediated by the interaction of the Fc moiety (of an antibody) with Fc receptors (FcRs), which are specialized cell surface receptors on cells including hematopoietic cells.
  • Fc receptors belong to the immunoglobulin superfamily, and shown to mediate both the removal of antibody-coated pathogens by phagocytosis of immune complexes, and the lysis of erythrocytes and various other cellular targets (e.g. tumor cells) coated with the corresponding antibody, via antibody dependent cell mediated cytotoxicity (ADCC; Van de Winkel, J. G., and Anderson, C. L., J. Leukoc. Biol. 49 (1991) 511-524).
  • ADCC antibody dependent cell mediated cytotoxicity
  • FcRs are defined by their specificity for immunoglobulin classes; Fc receptors for IgG antibodies are referred to as FcyR, for IgE as FcsR, for IgA as FcaR and so on and neonatal Fc receptors are referred to as FcRn.
  • Fc receptor binding is described for example in Ravetch, J. V., and Kinet, J. P., Annu. Rev. Immunol. 9 (1991) 457-492; Capel, P. J., et al., Immunomethods 4 (1994) 25-34; de Haas, M., et al., J Lab. Clin. Med. 126 (1995) 330-341; and Gessner, J. E., et al., Ann. Hematol. 76 (1998) 231-248.
  • FcyR Fc domain of native IgG antibodies
  • FcyR In humans, three classes of FcyR have been characterized to-date, which are: (i) FcyRI (CD64), which binds monomeric IgG with high affinity and is expressed on macrophages, monocytes, neutrophils and eosinophils; (ii) FcyRII (CD32), which binds complexed IgG with medium to low affinity, is widely expressed, in particular on leukocytes, is believed to be a central player in antibody-mediated immunity, and which can be divided into FcyRIIA, FcyRIIB and FcyRIIC, which perform different functions in the immune system, but bind with similar low affinity to the IgG-Fc, and the ectodomains of these receptors are highly homologuous; and (iii) FcyRIII (CD 16), which binds IgG with medium to low affinity and has been found in two forms: FcyRIIIA, which has been found on NK cells, macrophages,
  • FcyRIIA is found on many cells involved in killing (e.g. macrophages, monocytes, neutrophils) and seems able to activate the killing process.
  • FcyRIIB seems to play a role in inhibitory processes and is found on B-cells, macrophages and on mast cells and eosinophils. Importantly, it has been shown that 75% of all FcyRIIB is found in the liver (Ganesan, L. P. et al., 2012: “FcyRIIb on liver sinusoidal endothelium clears small immune complexes," Journal of Immunology 189: 4981-4988).
  • FcyRIIB is abundantly expressed on Liver Sinusoidal Endothelium, called LSEC, and in Kupffer cells in the liver and LSEC are the major site of small immune complexes clearance (Ganesan, L. P. et al., 2012: FcyRIIb on liver sinusoidal endothelium clears small immune complexes. Journal of Immunology 189: 4981-4988).
  • the antibodies disclosed herein and the antigen-binding fragments thereof comprise an Fc polypeptide or fragment thereof for binding to FcyRIIb, in particular an Fc region, such as, for example IgG-type antibodies.
  • FcyRIIb an Fc region
  • it is possible to engineer the Fc moiety to enhance FcyRIIB binding by introducing the mutations S267E and L328F as described by Chu, S. Y. et al., 2008: Inhibition of B cell receptor-mediated activation of primary human B cells by coengagement of CD19 and FcgammaRIIb with Fc-engineered antibodies.
  • Molecular Immunology 45, 3926-3933 are examples of the FcyRIIb.
  • the antibodies of the present disclosure comprise an engineered Fc moiety with the mutations S267E and L328F, in particular as described by Chu, S. Y. et al., 2008: Inhibition of B cell receptor-mediated activation of primary human B cells by coengagement of CD19 and FcgammaRIIb with Fc-engineered antibodies.
  • FcyRIIB may function to suppress further immunoglobulin production and isotype switching to, for example, the IgE class.
  • FcyRIIB On macrophages, FcyRIIB is thought to inhibit phagocytosis as mediated through FcyRIIA.
  • the B form On eosinophils and mast cells, the B form may help to suppress activation of these cells through IgE binding to its separate receptor.
  • modification in native IgG of at least one of E233- G236, P238, D265, N297, A327 and P329 reduces binding to FcyRI.
  • IgG2 residues at positions 233-236, substituted into corresponding positions IgGl and IgG4, reduces binding of IgGl and IgG4 to FcyRI by 10 3 -fold and eliminated the human monocyte response to antibody-sensitized red blood cells (Armour, K. L., et al. Eur. J. Immunol. 29 (1999) 2613-2624).
  • FcyRIIA reduced binding for FcyRIIA is found, e.g., for IgG mutation of at least one of E233-G236, P238, D265, N297, A327, P329, D270, Q295, A327, R292 and K414.
  • FcyRIII binding reduced binding to FcyRIIIA is found, e.g., for mutation of at least one of E233-G236, P238, D265, N297, A327, P329, D270, Q295, A327, S239, E269, E293, Y296, V303, A327, K338 and D376. Mapping of the binding sites on human IgGl for Fc receptors, the above-mentioned mutation sites, and methods for measuring binding to FcyRI and FcyRIIA, are described in Shields, R. L., et al., J. Biol. Chem. 276 (2001) 6591-6604.
  • FcyRIIIA Two allelic forms of human FcyRIIIA are the "Fl 58" variant, which binds to IgGl Fc with low affinity, and the "VI 58" variant, which binds to IgGl Fc with high affinity. See, e.g., Bruhns et al., Blood 773:3716-3725 (2009).
  • two regions of native IgG Fc appear to be involved in interactions between FcyRIIs and IgGs, namely (i) the lower hinge site of IgG Fc, in particular amino acid residues L, L, G, G (234 - 237, EU numbering), and (ii) the adjacent region of the CH2 domain of IgG Fc, in particular a loop and strands in the upper CH2 domain adjacent to the lower hinge region, e.g. in a region of P331 (Wines, B.D., et al., J. Immunol. 2000; 164: 5313 - 5318).
  • FcyRI appears to bind to the same site on IgG Fc
  • FcRn and Protein A bind to a different site on IgG Fc, which appears to be at the CH2-CH3 interface
  • mutations that increase binding affinity of an Fc polypeptide or fragment thereof of the present disclosure to a (i.e., one or more) Fey receptor (e.g., as compared to a reference Fc polypeptide or fragment thereof or containing the same that does not comprise the mutation(s)). See, e.g., Delillo and Ravetch, Cell 161(5): 1035-1045 (2015) and Ahmed et al., J. Struc. Biol. 194(1):78 (2016), the Fc mutations and techniques of which are incorporated herein by reference.
  • an antibody or antigen-binding fragment can comprise a Fc polypeptide or fragment thereof comprising a mutation selected from G236A; S239D; A330L; and I332E; or a combination comprising any two or more of the same; e.g., S239D/I332E; S239D/A330L/I332E; G236A/S239D/I332E; G236A/A330L/I332E (also referred to herein as "GAALIE"); or G236A/S239D/A330L/I332E.
  • the Fc polypeptide or fragment thereof does not comprise S239D.
  • the Fc polypeptide or fragment thereof comprises S at position 239 (EU numbering).
  • the Fc polypeptide or fragment thereof may comprise or consist of at least a portion of an Fc polypeptide or fragment thereof that is involved in binding to FcRn binding.
  • the Fc polypeptide or fragment thereof comprises one or more ammo acid modifications that improve binding affinity for (e.g., enhance binding to) FcRn (e.g., at a pH of about 6.0) and, in some embodiments, thereby extend in vivo half-life of a molecule comprising the Fc polypeptide or fragment thereof (e.g., as compared to a reference Fc polypeptide or fragment thereof or antibody that is otherwise the same but does not comprise the modification(s)).
  • the Fc polypeptide or fragment thereof comprises or is derived from a IgG Fc and a half-life-extending mutation comprises any one or more of: M428L; N434S; N434H; N434A; N434S; M252Y; S254T; T256E; T250Q; P257I Q31 II; D376V; T307A; E380A (EU numbering).
  • a half-life-extending mutation comprises M428L/N434S (also referred to herein as "MLNS").
  • a half-life-extending mutation comprises M252Y/S254T/T256E.
  • a half-life-extending mutation comprises T250Q/M428L. In certain embodiments, a half-life-extending mutation comprises P257EQ311I. In certain embodiments, a half-life-extending mutation comprises P257I/N434H. In certain embodiments, a half-life-extending mutation comprises D376V/N434H. In certain embodiments, a half-life-extending mutation comprises T307A/E380A/N434A.
  • an antibody or antigen-binding fragment includes a Fc moiety that comprises the substitution mtuations M428L/N434S. In some embodiments, an antibody or antigen-binding fragment includes a Fc polypeptide or fragment thereof that comprises the substitution mtuations G236A/A330L/I332E. In certain embodiments, an antibody or antigen-binding fragment includes a (e.g., IgG) Fc moiety that comprises a G236A mutation, an A330L mutation, and a I332E mutation (GAALIE), and does not comprise a S239D mutation (e.g., comprises a native S at position 239).
  • a S239D mutation e.g., comprises a native S at position 239
  • an antibody or antigen-binding fragment includes an Fc polypeptide or fragment thereof that comprises the substitution mutations: M428L/N434S and G236A/A330L/I332E, and optionally does not comprise S239D (e.g., comprises S at 239).
  • an antibody or antigenbinding fragment includes a Fc polypeptide or fragment thereof that comprises the substitution mutations: M428L/N434S and G236A/S239D/A330L/I332E.
  • the antibody or antigen-binding fragment comprises a mutation that alters glycosylation, wherein the mutation that alters glycosylation comprises N297A, N297Q, or N297G, and/or the antibody or antigen-binding fragment is partially or fully aglycosylated and/or is partially or fully afucosylated.
  • Host cell lines and methods of making partially or fully aglycosylated or partially or fully afucosylated antibodies and antigen-binding fragments are known (see, e.g., PCT Publication No. WO 2016/181357; Suzuki et al. Clin. Cancer Res. 73(6): 1875-82 (2007); Huang et al. MAbs 6 1-12 (2018)).
  • the antibody or antigen-binding fragment is capable of eliciting continued protection in vivo in a subject even once no detectable levels of the antibody or antigen-binding fragment can be found in the subject (i.e., when the antibody or antigen-binding fragment has been cleared from the subject following administration). Such protection is referred to herein as a vaccinal effect. Without wishing to be bound by theory, it is believed that dendritic cells can internalize complexes of antibody and antigen and thereafter induce or contribute to an endogenous immune response against antigen.
  • an antibody or antigenbinding fragment comprises one or more modifications, such as, for example, mutations in the Fc comprising G236A, A330L, and I332E, that are capable of activating dendritic cells that may induce, e.g., T cell immunity to the antigen.
  • the antibody or antigen-binding fragment comprises a Fc polypeptide or a fragment thereof, including a CH2 (or a fragment thereof, a CH3 (or a fragment thereof), or a CH2 and a CH3, wherein the CH2, the CH3, or both can be of any isotype and may contain amino acid substitutions or other modifications as compared to a corresponding wild-type CH2 or CH3, respectively.
  • a Fc polypeptide of the present disclosure comprises two CH2-CH3 polypeptides that associate to form a dimer.
  • the antibody or antigen-binding fragment can be monoclonal.
  • the term "monoclonal antibody” (mAb) as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present, in some cases in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to polyclonal antibody preparations that include different antibodies directed against different epitopes, each monoclonal antibody is directed against a single epitope of the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they may be synthesized uncontaminated by other antibodies.
  • monoclonal antibodies useful in the present invention may be prepared by the hybridoma methodology first described by Kohler et al., Nature 256 :495 (1975), or may be made using recombinant DNA methods in bacterial, eukaryotic animal, or plant cells (see, e.g., U.S. Pat. No. 4,816,567).
  • Monoclonal antibodies may also be isolated from phage antibody libraries using the techniques described in Clackson et al., Nature, 352:624-628 (1991) and Marks et al., J. Mol. Biol., 222:581-597 (1991), for example.
  • Monoclonal antibodies may also be obtained using methods disclosed in PCT Publication No. WO 2004/076677A2.
  • Antibodies and antigen-binding fragments of the present disclosure include "chimeric antibodies" in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (see, U.S. Pat. Nos. 4,816,567; 5,530,101 and 7,498,415; and Morrison et al., Proc. Natl. Acad. Sci. USA, 57:6851-6855 (1984)).
  • chimeric antibodies may comprise human and non-human residues.
  • chimeric antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. For further details, see Jones et al., Nature 321 :522-525 (1986); Riechmann et al., Nature 332:323- 329 (1988); and Presta, Curr. Op. Struct. Biol. 2:593-596 (1992).
  • Chimeric antibodies also include primatized and humanized antibodies.
  • a "humanized antibody” is generally considered to be a human antibody that has one or more amino acid residues introduced into it from a source that is non-human. These non-human amino acid residues are typically taken from a variable domain.
  • Humanization may be performed following the method of Winter and co-workers (Jones et al., Nature, 321 :522-525 (1986); Reichmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239: 1534-1536 (1988)), by substituting non-human variable sequences for the corresponding sequences of a human antibody.
  • such "humanized” antibodies are chimeric antibodies (U.S. Pat. Nos. 4,816,567; 5,530,101 and 7,498,415) wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
  • a “humanized” antibody is one which is produced by a non-human cell or animal and comprises human sequences, e.g., He domains.
  • human antibody is an antibody containing only sequences that are present in an antibody that is produced by a human (i.e., sequences that are encoded by human antibody-encoding genes).
  • human antibodies may comprise residues or modifications not found in a naturally occurring human antibody (e.g., an antibody that is isolated from a human), including those modifications and variant sequences described herein. These are typically made to further refine or enhance antibody performance.
  • human antibodies are produced by transgenic animals. For example, see U.S. Pat. Nos. 5,770,429; 6,596,541 and 7,049,426.
  • an antibody or antigen-binding fragment of the present disclosure is chimeric, humanized, or human.
  • the present disclosure provides isolated polynucleotides that encode any of the presently disclosed antibodies or an antigen-binding fragment thereof, or a portion thereof (e.g., a CDR, a VH, a VL, a heavy chain, or a light chain).
  • the polynucleotide is codon-optimized for expression in a host cell. Once a coding sequence is known or identified, codon optimization can be performed using known techniques and tools, e.g., using the GenScript® OptimiumGeneTM tool; see also Scholten et al., Clin. Immunol. 119 : 135, 2006). Codon-optimized sequences include sequences that are partially codon-optimized (/. ⁇ ., one or more codon is optimized for expression in the host cell) and those that are fully codon-optimized.
  • polynucleotides encoding antibodies and antigenbinding fragments of the present disclosure may possess different nucleotide sequences while still encoding a same antibody or antigen-binding fragment due to, for example, the degeneracy of the genetic code, splicing, and the like.
  • the polynucleotide comprises a polynucleotide having at least 50% (i.e., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the polynucleotide sequence according to any one or more of SEQ ID NOs.:30, 31, 40, 41, 50, 51, 60, 61, 70, 71, 80, 81, 90, 91, 100, 101, 110, 111, 120, 121, 130, 131, 140, 141, 150, 151, 160, 161, 170, 171, 180, 181, 190, 191, 200, 201, 210, 211, 220, 221, 230, 231, 240, 241, 250, 251,
  • 50% i.e., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%
  • a polynucleotide comprises a polynucleotide having at least 50% identity to to SEQ ID NO.:30 and a polynucleotide having at least 50% identity to SEQ ID NO. :31).
  • a polynucleotide encoding an antibody or antigen-binding fragment is comprised in a polynucleotide that includes other sequences and/or features for, e.g., expression of the antibody or antigen-binding fragment in a host cell.
  • exemplary features include a promoter sequence, a polyadenylation sequence, a sequence that encodes a signal peptide (e.g., located at the N-terminus of a expressed antibody heavy chain or light chain), or the like.
  • the polynucleotide can comprise deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).
  • the RNA comprises messenger RNA (mRNA).
  • Vectors are also provided, wherein the vectors comprise or contain a polynucleotide as disclosed herein (e.g, a polynucleotide that encodes an antibody or antigen-binding fragment that binds to SARS-CoV-2).
  • a vector can comprise any one or more of the vectors disclosed herein.
  • a vector is provided that comprises a DNA plasmid construct encoding the antibody or antigen-binding fragment, or a portion thereof (e.g., so-called "DMAb”; see, e.g., Muthumani et al., J Infect Dis.
  • a DNA plasmid construct comprises a single open reading frame encoding a heavy chain and a light chain (or a VH and a VL) of the antibody or antigenbinding fragment, wherein the sequence encoding the heavy chain and the sequence encoding the light chain are optionally separated by polynucleotide encoding a protease cleavage site and/or by a polynucleotide encoding a self-cleaving peptide.
  • the substituent components of the antibody or antigen-binding fragment are encoded by a polynucleotide comprised in a single plasmid.
  • the substituent components of the antibody or antigen-binding fragment are encoded by a polynucleotide comprised in two or more plasmids (e.g., a first plasmid comprises a polynucleotide encoding a heavy chain, VH, or VH+CH, and a second plasmid comprises a polynucleotide encoding the cognate light chain, VL, or VL+CL).
  • a single plasmid comprises a polynucleotide encoding a heavy chain and/or a light chain from two or more antibodies or antigen-binding fragments of the present disclosure.
  • An exemplary expression vector is pVaxl, available from Invitrogen®.
  • a DNA plasmid of the present disclosure can be delivered to a subject by, for example, electroporation (e.g., intramuscular electroporation), or with an appropriate formulation (e.g., hyaluronidase).
  • the present disclosure also provides a host cell expressing an antibody or antigen-binding fragment according to the present disclosure; or comprising or containing a vector or polynucleotide according the present disclosure.
  • the cells include but are not limited to, eukaryotic cells, e.g., yeast cells, animal cells, insect cells, plant cells; and prokaryotic cells, including E. coli.
  • the cells are mammalian cells.
  • the cells are a mammalian cell line such as CHO cells (e.g., DHFR- CHO cells (Urlaub et al., PNAS 77:4216 (1980)), human embryonic kidney cells (e.g., HEK293T cells), PER.C6 cells, YO cells, Sp2/0 cells.
  • CHO cells e.g., DHFR- CHO cells (Urlaub et al., PNAS 77:4216 (1980)
  • human embryonic kidney cells e.g., HEK293T cells
  • PER.C6 cells e.g., PER.C6 cells
  • YO cells YO cells
  • Sp2/0 cells e.g. Hepa RG cells
  • mammalian host cell lines include mouse sertoli cells (e.g., TM4 cells); monkey kidney CV1 line transformed by SV40 (COS-7); baby hamster kidney cells (BHK); African green monkey kidney cells (VERO-76); monkey kidney cells (CV1); human cervical carcinoma cells (HELA); human lung cells (W138); human liver cells (Hep G2); canine kidney cells (MDCK; buffalo rat liver cells (BRL 3 A); mouse mammary tumor (MMT 060562); TRI cells; MRC 5 cells; and FS4 cells.
  • Mammalian host cell lines suitable for antibody production also include those described in, for example, Yazaki and Wu, Methods in Molecular Biology, Vol. 248 (B. K. C. Lo, ed., Humana Press, Totowa, N.J.), pp. 255- 268 (2003).
  • a host cell is a prokaryotic cell, such as an E. coli.
  • a prokaryotic cell such as an E. coli.
  • the expression of peptides in prokaryotic cells such as E. coli is well established (see, e.g., Pluckthun, A. Bio/Technology 9:545-551 (1991).
  • antibodies may be produced in bacteria, in particular when glycosylation and Fc effector function are not needed.
  • For expression of antibody fragments and polypeptides in bacteria see, e.g., U.S. Pat. Nos. 5,648,237; 5,789,199; and 5,840,523.
  • the cell may be transfected with a vector according to the present description with an expression vector.
  • transfection refers to the introduction of nucleic acid molecules, such as DNA or RNA (e.g. mRNA) molecules, into cells, such as into eukaryotic cells.
  • RNA e.g. mRNA
  • transfection encompasses any method known to the skilled person for introducing nucleic acid molecules into cells, such as into eukaryotic cells, including into mammalian cells.
  • Such methods encompass, for example, electroporation, lipofection, e.g., based on cationic lipids and/or liposomes, calcium phosphate precipitation, nanoparticle based transfection, virus based transfection, or transfection based on cationic polymers, such as DEAE-dextran or polyethylenimine, etc.
  • the introduction is non-viral.
  • host cells of the present disclosure may be transfected stably or transiently with a vector according to the present disclosure, e.g. for expressing an antibody, or an antigen-binding fragment thereof, according to the present disclosure.
  • the cells may be stably transfected with the vector as described herein.
  • cells may be transiently transfected with a vector according to the present disclosure encoding an antibody or antigen-binding fragment as disclosed herein.
  • a polynucleotide may be heterologous to the host cell.
  • the present disclosure also provides recombinant host cells that heterologously express an antibody or antigen-binding fragment of the present disclosure.
  • the cell may be of a species that is different to the species from which the antibody was fully or partially obtained (e.g., CHO cells expressing a human antibody or an engineered human antibody).
  • the cell type of the host cell does not express the antibody or antigen-binding fragment in nature.
  • the host cell may impart a post-translational modification (PTM; e.g., glysocylation or fucosylation) on the antibody or antigen-binding fragment that is not present in a native state of the antibody or antigen-binding fragment (or in a native state of a parent antibody from which the antibody or antigen binding fragment was engineered or derived).
  • PTM post-translational modification
  • Such a PTM may result in a functional difference (e.g., reduced immunogenicity).
  • an antibody or antigen-binding fragment of the present disclosure that is produced by a host cell as disclosed herein may include one or more post-translational modification that is distinct from the antibody (or parent antibody) in its native state (e.g., a human antibody produced by a CHO cell can comprise a more post-translational modification that is distinct from the antibody when isolated from the human and/or produced by the native human B cell or plasma cell).
  • Insect cells useful expressing a binding protein of the present disclosure include, for example, Spodoptera frugipera Sf9 cells, Trichoplusia ni BTI-TN5B1-4 cells, and Spodoptera frugipera SfSWTOl “MimicTM” cells. See, e.g., Palmberger et al., J. Biotechnol. 753(3-4): 160-166 (2011). Numerous baculoviral strains have been identified which may be used in conjunction with insect cells, particularly for transfection of Spodoptera frugiperda cells.
  • Eukaryotic microbes such as filamentous fungi or yeast are also suitable hosts for cloning or expressing protein-encoding vectors, and include fungi and yeast strains with "humanized” glycosylation pathways, resulting in the production of an antibody with a partially or fully human glycosylation pattern. See Gerngross, Nat. Biotech. 22: 1409-1414 (2004); Li etal., Nat. Biotech. 24:210-215 (2006).
  • Plant cells can also be utilized as hosts for expressing a binding protein of the present disclosure.
  • PLANTIBODIESTM technology (described in, for example, U.S. Pat. Nos. 5,959,177; 6,040,498; 6,420,548; 7,125,978; and 6,417,429) employs transgenic plants to produce antibodies.
  • the host cell comprises a mammalian cell.
  • the host cell is a CHO cell, a HEK293 cell, a PER.C6 cell, a Y0 cell, a Sp2/0 cell, a NS0 cell, a human liver cell, a myeloma cell, or a hybridoma cell.
  • the present disclosure provides methods for producing an antibody, or antigen-binding fragment, wherein the methods comprise culturing a host cell of the present disclosure under conditions and for a time sufficient to produce the antibody, or the antigen-binding fragment.
  • Methods useful for isolating and purifying recombinantly produced antibodies may include obtaining supernatants from suitable host cell/vector systems that secrete the recombinant antibody into culture media and then concentrating the media using a commercially available filter. Following concentration, the concentrate may be applied to a single suitable purification matrix or to a series of suitable matrices, such as an affinity matrix or an ion exchange resin.
  • One or more reverse phase HPLC steps may be employed to further purify a recombinant polypeptide. These purification methods may also be employed when isolating an immunogen from its natural environment. Methods for large scale production of one or more of the isolated/recombinant antibody described herein include batch cell culture, which is monitored and controlled to maintain appropriate culture conditions. Purification of soluble antibodies may be performed according to methods described herein and known in the art and that comport with laws and guidelines of domestic and foreign regulatory agencies.
  • compositions that comprise any one or more of the presently disclosed antibodies, antigen-binding fragments, polynucleotides, vectors, or host cells, singly or in any combination, and can further comprise a pharmaceutically acceptable earner, excipient, or diluent. Carriers, excipients, and diluents are discussed in further detail herein.
  • a composition comprises a plurality of an antibody and/or an antigen-binding fragment of the present disclosure, wherein one or more antibody or antigen-binding fragment does not comprise a lysine residue at the C- terminal end of the heavy chain, CH1-CH3, or Fc polypeptide, and wherein one or more antibody or antigen-binding fragment comprises a lysine residue at the C-terminal end of the heavy chain, CH1-CH3, or Fc polypeptide.
  • a composition comprises two or more different antibodies or antigen-binding fragments according to the present disclosure.
  • antibodies or antigen-binding fragments to be used in a combination each independently have one or more of the following characteristics: neutralize naturally occurring SARS-CoV-2 variants; do not compete with one another for Spike protein binding; bind distinct Spike protein epitopes; have a reduced formation of resistance to SARS-CoV-2; when in a combination, have a reduced formation of resistance to SARS-CoV-2; potently neutralize live SARS-CoV-2 virus; exhibit additive or synergistic effects on neutralization of live SARS-CoV-2 virus when used in combination; exhibit effector functions; are protective in relevant animal model(s) of infection; are capable of being produced in sufficient quantities for large-scale production.
  • a composition comprises (a) antibody S2X333 (or an antigen-binding fragment thereof) or an antibody or antigen-binding fragment that competes with antibody S2X333 for SARS-CoV-2 S protein binding and (b) antibody S309 (or an antigen-binding fragment thereof) or an antibody or antigen-binding fragment that competes with antibody S309 for SARS-CoV-2 S protein binding.
  • a composition comprises (a) antibody S2X333 (or an antigen-binding fragment thereof) or an antibody or antiben-binding fragment that competes with antibody S2X333 for SARS-CoV-2 S protein binding and (b) antibody S2E12 (or an antigen-binding fragment thereof) or an antibody or antigen-binding fragment that competes with antibody S2E12 for SARS-CoV-2 S protein binding.
  • a composition comprises (a) antibody S2X333 (or an antigen-binding fragment thereof) or an antibody or antigen-binding fragment that competes with antibody S2X333 for SARS-CoV-2 S protein binding and (b) antibody S2M11 (or an antigen-binding fragment thereof) or an antibody or antigen-binding fragment that competes with antibody S2M11 for SARS-CoV-2 S protein binding.
  • Antibody S2X333 comprises the VH amino acid sequence of SEQ ID NO.:52 and the VL amino acid sequence of SEQ ID NO.:56.
  • Antibody S2E12 comprises the VH amino acid sequence of SEQ ID NO.:450 and the VL amino acid sequence of SEQ ID NO.:454.
  • Antibody S309 comprises the VH amino acid sequence of SEQ ID NO.:442 and the VL amino acid sequence of SEQ ID NO.:446.
  • a variant VH of antibody S309 comprises the amino acid sequence of SEQ ID NO.:466.
  • Antibody S2M11 comprises the VH amino acid sequence of SEQ ID NO.:458 and the VL amino acid sequence of SEQ ID NO.:462.
  • composition comprises two or more different antibodies or antigen-binding fragments according to the present disclosure.
  • a composition comprises a first vector comprising a first plasmid, and a second vector comprising a second plasmid, wherein the first plasmid comprises a polynucleotide encoding a heavy chain, VH, or VH+CH, and a second plasmid comprises a polynucleotide encoding the cognate light chain, VL, or VL+CL of the antibody or antigen-binding fragment thereof.
  • a composition comprises a polynucleotide (e.g., mRNA) coupled to a suitable delivery vehicle or carrier.
  • Exemplary vehicles or carriers for administration to a human subject include a lipid or lipid-derived delivery vehicle, such as a liposome, solid lipid nanoparticle, oily suspension, submicron lipid emulsion, lipid microbubble, inverse lipid micelle, cochlear liposome, lipid microtubule, lipid microcylinder, or lipid nanoparticle (LNP) or a nanoscale platform (see, e.g., Li et al. Wilery Interdiscip Rev. Nanomed Nanobiotechnol. 77(2):el530 (2019)).
  • LNP lipid nanoparticle
  • Principles, reagents, and techniques for designing appropriate mRNA and and formulating mRNA-LNP and delivering the same are described in, for example, Pardi et al.
  • lipid nanoparticles e.g., ionizable cationic lipid/phosphatidylcholine/cholesterol/PEG-lipid; ionizable lipid:distearoyl PC:cholesterol:polyethylene glycol lipid
  • subcutaneous, intramuscular, intradermal, intravenous, intraperitoneal, and intratracheal administration of the same, are incorporated herein by reference.
  • Methods of diagnosis may include contacting an antibody or antibody fragment e.g., antigen binding fragment) with a sample.
  • a sample may be isolated from a subject, for example an isolated e.g., fluid, tissue, or secretion) sample from a nasal passage, a sinus cavity, a salivary gland, a lung, a liver, a trachea, a bronchiole, a pancreas, a kidney, an ear, an eye, a placenta, an alimentary tract, a heart, an ovary, a pituitary gland, an adrenal, a thyroid gland, a brain, sera, plasma, skin, or blood.
  • an isolated e.g., fluid, tissue, or secretion from a nasal passage, a sinus cavity, a salivary gland, a lung, a liver, a trachea, a bronchiole, a pancreas, a kidney, an ear, an eye, a placenta, an
  • the sample may comprise a nasal secretion, sputum, bronchial lavage, urine, stool, saliva, sweat, or any combination thereof.
  • Methods of diagnosis may also include the detection of an antigen/antibody complex, in particular following the contacting of an antibody or antibody fragment with a sample. Such a detection step can be performed at the bench, i.e. without any contact to the human or animal body. Examples of detection methods are well-known to the person skilled in the art and include, e.g., ELISA (enzyme-linked immunosorbent assay), including direct, indirect, and sandwich ELISA.
  • Treatment refers to medical management of a disease, disorder, or condition of a subject (e.g., a human or non-human mammal, such as a primate, horse, cat, dog, goat, mouse, or rat).
  • an appropriate dose or treatment regimen comprising an antibody or composition of the present disclosure is administered in an amount sufficient to elicit a therapeutic or prophylactic benefit.
  • Therapeutic or prophylactic/preventive benefit includes improved clinical outcome; lessening or alleviation of symptoms associated with a disease; decreased occurrence of symptoms; improved quality of life; longer disease-free status; diminishment of extent of disease, stabilization of disease state; delay or prevention of disease progression; remission; survival; prolonged survival; or any combination thereof.
  • therapeutic or prophylactic/preventive benefit includes reduction or prevention of hospitalization for treatment of a SARS-CoV-2 infection (z.e., in a statistically significant manner).
  • therapeutic or prophylactic/preventive benefit includes a reduced duration of hospitalization for treatment of a SARS-CoV-2 infection (z.e., in a statistically significant manner).
  • therapeutic or prophylactic/preventive benefit includes a reduced or abrogated need for respiratory intervention, such as intubation and/or the use of a respirator device.
  • therapeutic or prophylactic/preventive benefit includes reversing a late-stage disease pathology and/or reducing mortality.
  • a “therapeutically effective amount” or “effective amount” of an antibody, antigen-binding fragment, polynucleotide, vector, host cell, or composition of this disclosure refers to an amount of the composition or molecule sufficient to result in a therapeutic effect, including improved clinical outcome; lessening or alleviation of symptoms associated with a disease; decreased occurrence of symptoms; improved quality of life; longer disease-free status; diminishment of extent of disease, stabilization of disease state; delay of disease progression; remission; survival; or prolonged survival in a statistically significant manner.
  • a therapeutically effective amount refers to the effects of that ingredient or cell expressing that ingredient alone.
  • a therapeutically effective amount refers to the combined amounts of active ingredients or combined adjunctive active ingredient with a cell expressing an active ingredient that results in a therapeutic effect, whether administered serially, sequentially, or simultaneously.
  • a combination may comprise, for example, two different antibodies that specifically bind a SARS-CoV-2 antigen, which in certain embodiments, may be the same or different SARS-CoV-2 antigen, and/or can comprise the same or different epitopes.
  • methods for treating a SARS-CoV-2 infection in a subject, wherein the methods comprise administering to the subject an effective amount of an antibody, antigen-binding fragment, polynucleotide, vector, host cell, or composition as disclosed herein.
  • Subjects that can be treated by the present disclosure are, in general, human and other primate subjects, such as monkeys and apes for veterinary medicine purposes. Other model organisms, such as mice and rats, may also be treated according to the present disclosure.
  • the subject may be a human subject.
  • the subjects can be male or female and can be any suitable age, including infantjuvenile, adolescent, adult, and geriatric subjects.
  • a subject treated according to the present disclosure comprises one or more risk factors.
  • a human subject treated according to the present disclosure is an infant, a child, a young adult, an adult of middle age, or an elderly person. In certain embodiments, a human subject treated according to the present disclosure is less than 1 year old, or is 1 to 5 years old, or is between 5 and 125 years old (e.g., 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, or 125 years old, including any and all ages therein or therebetween).
  • a human subject treated according to the present disclosure is 0- 19 years old, 20-44 years old, 45-54 years old, 55-64 years old, 65-74 years old, 75-84 years old, or 85 years old, or older. Persons of middle, and especially of elderly age are believed to be at particular risk.
  • the human subject is 45-54 years old, 55-64 years old, 65-74 years old, 75-84 years old, or 85 years old, or older.
  • the human subject is biologically male. In some embodiments, the human subject is biologically female.
  • a human subject treated according to the present disclosure is a resident of a nursing home or a long-term care facility, is a hospice care worker, is a healthcare provider or healthcare worker, is a first responder, is a family member or other close contact of a subject diagnosed with or suspected of having a SARS-CoV-2 infection, is overweight or clinically obese, is or has been a smoker, has or had chronic obstructive pulmonary disease (COPD), is asthmatic (e.g., having moderate to severe asthma), has an autoimmune disease or condition (e.g., diabetes), and/or has a compromised or depleted immune system (e.g., due to AIDS/HIV infection, a cancer such as a blood cancer, a lymphodepleting therapy such as a chemotherapy, a bone marrow or organ transplantation, or a genetic immune condition), has chronic liver disease, has cardiovascular disease, has a pulmonary or heart defect, works or otherwise spends time in close proximity with others, such as in a factory, shipping center
  • COPD
  • a subject treated according to the present disclosure has received a vaccine for SARS-CoV-2 and the vaccine is determined to be ineffective, e.g., by post-vaccine infection or symptoms in the subject, by clinical diagnosis or scientific or regulatory consensus.
  • treatment is administered as peri-exposure prophylaxis.
  • treatment is administered to a subject with mild-to-moderate disease, which may be in an outpatient setting.
  • treatment is administered to a subject with moderate-to-severe disease, such as requiring hospitalization.
  • Typical routes of administering the presently disclosed compositions thus include, without limitation, oral, topical, transdermal, inhalation, parenteral, sublingual, buccal, rectal, vaginal, and intranasal.
  • parenteral includes subcutaneous injections, intravenous, intramuscular, intrastemal injection or infusion techniques.
  • administering comprises administering by a route that is selected from oral, intravenous, parenteral, intragastric, intrapleural, intrapulmonary, intrarectal, intradermal, intraperitoneal, intratumoral, subcutaneous, topical, transdermal, intracisternal, intrathecal, intranasal, and intramuscular.
  • a method comprises orally administering the antibody, antigenbinding fragment, polynucleotide, vector, host cell, or composition to the subject.
  • compositions according to certain embodiments of the present invention are formulated so as to allow the active ingredients contained therein to be bioavailable upon administration of the composition to a patient.
  • Compositions that will be administered to a subject or patient may take the form of one or more dosage units, where for example, a tablet may be a single dosage unit, and a container of a herein described an antibody or antigen-binding in aerosol form may hold a plurality of dosage units.
  • Actual methods of preparing such dosage forms are known, or will be apparent, to those skilled in this art; for example, see Remington: The Science and Practice of Pharmacy, 20th Edition (Philadelphia College of Pharmacy and Science, 2000).
  • composition to be administered will, in any event, contain an effective amount of an antibody or antigen-binding fragment, polynucleotide, vector, host cell, , or composition of the present disclosure, for treatment of a disease or condition of interest in accordance with teachings herein.
  • a composition may be in the form of a solid or liquid.
  • the carrier(s) are particulate, so that the compositions are, for example, in tablet or powder form.
  • the carrier(s) may be liquid, with the compositions being, for example, an oral oil, injectable liquid or an aerosol, which is useful in, for example, inhalatory administration.
  • the pharmaceutical composition is preferably in either solid or liquid form, where semi solid, semi liquid, suspension and gel forms are included within the forms considered herein as either solid or liquid.
  • the pharmaceutical composition may be formulated into a powder, granule, compressed tablet, pill, capsule, chewing gum, wafer or the like.
  • a solid composition will typically contain one or more inert diluents or edible carriers.
  • binders such as carboxymethylcellulose, ethyl cellulose, microcrystalline cellulose, gum tragacanth or gelatin; excipients such as starch, lactose or dextrins, disintegrating agents such as alginic acid, sodium alginate, Primogel, corn starch and the like; lubricants such as magnesium stearate or Sterotex; glidants such as colloidal silicon dioxide; sweetening agents such as sucrose or saccharin; a flavoring agent such as peppermint, methyl salicylate or orange flavoring; and a coloring agent.
  • a liquid carrier such as polyethylene glycol or oil.
  • the composition may be in the form of a liquid, for example, an elixir, syrup, solution, emulsion or suspension.
  • the liquid may be for oral administration or for delivery by injection, as two examples.
  • preferred compositions contain, in addition to the present compounds, one or more of a sweetening agent, preservatives, dye/colorant and flavor enhancer.
  • a surfactant, preservative, wetting agent, dispersing agent, suspending agent, buffer, stabilizer and isotonic agent may be included.
  • Liquid pharmaceutical compositions may include one or more of the following adjuvants: sterile diluents such as water for injection, saline solution, preferably physiological saline, Ringer’s solution, isotonic sodium chloride, fixed oils such as synthetic mono or diglycerides which may serve as the solvent or suspending medium, polyethylene glycols, glycerin, propylene glycol or other solvents; antibacterial agents such as benzyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose.
  • the parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
  • Physiological saline is a preferred adjuvant.
  • a liquid composition intended for either parenteral or oral administration should contain an amount of an antibody or antigen-binding fragment as herein disclosed such that a suitable dosage will be obtained. Typically, this amount is at least 0.01% of the antibody or antigen-binding fragment in the composition. When intended for oral administration, this amount may be varied to be between 0.1 and about 70% of the weight of the composition. Certain oral pharmaceutical compositions contain between about 4% and about 75% of the antibody or antigen-binding fragment. In certain embodiments, pharmaceutical compositions and preparations according to the present invention are prepared so that a parenteral dosage unit contains between 0.01 to 10% by weight of antibody or antigen-binding fragment prior to dilution.
  • the composition may be intended for topical administration, in which case the carrier may suitably comprise a solution, emulsion, ointment or gel base.
  • the base may comprise one or more of the following: petrolatum, lanolin, polyethylene glycols, bee wax, mineral oil, diluents such as water and alcohol, and emulsifiers and stabilizers. Thickening agents may be present in a composition for topical administration. If intended for transdermal administration, the composition may include a transdermal patch or iontophoresis device.
  • the pharmaceutical composition may be intended for rectal administration, in the form, for example, of a suppository, which will melt in the rectum and release the drug.
  • the composition for rectal administration may contain an oleaginous base as a suitable nonirritating excipient.
  • bases include, without limitation, lanolin, cocoa butter and polyethylene glycol.
  • a composition may include various materials which modify the physical form of a solid or liquid dosage unit.
  • the composition may include materials that form a coating shell around the active ingredients.
  • the materials that form the coating shell are typically inert, and may be selected from, for example, sugar, shellac, and other enteric coating agents.
  • the active ingredients may be encased in a gelatin capsule.
  • the composition in solid or liquid form may include an agent that binds to the antibody or antigen-binding fragment of the disclosure and thereby assists in the delivery of the compound. Suitable agents that may act in this capacity include monoclonal or polyclonal antibodies, one or more proteins or a liposome.
  • the composition may consist essentially of dosage units that can be administered as an aerosol.
  • aerosol is used to denote a variety of systems ranging from those of colloidal nature to systems consisting of pressurized packages. Delivery may be by a liquefied or compressed gas or by a suitable pump system that dispenses the active ingredients. Aerosols may be delivered in single phase, bi phasic, or tri phasic systems in order to deliver the active ingredient(s). Delivery of the aerosol includes the necessary container, activators, valves, subcontainers, and the like, which together may form a kit. One of ordinary skill in the art, without undue experimentation, may determine preferred aerosols.
  • compositions of the present disclosure also encompass carrier molecules for polynucleotides, as described herein (e.g., lipid nanoparticles, nanoscale delivery platforms, and the like).
  • compositions may be prepared by methodology well known in the pharmaceutical art.
  • a composition intended to be administered by injection can be prepared by combining a composition that comprises an antibody, antigen-binding fragment thereof, or antibody conjugate as described herein and optionally, one or more of salts, buffers and/or stabilizers, with sterile, distilled water so as to form a solution.
  • a surfactant may be added to facilitate the formation of a homogeneous solution or suspension.
  • Surfactants are compounds that non-covalently interact with the peptide composition so as to facilitate dissolution or homogeneous suspension of the antibody or antigen-binding fragment thereof in the aqueous delivery system.
  • an appropriate dose and treatment regimen provide the composition(s) in an amount sufficient to provide therapeutic and/or prophylactic benefit (such as described herein, including an improved clinical outcome (e.g., a decrease in frequency, duration, or severity of diarrhea or associated dehydration, or inflammation, or longer disease-free and/or overall survival, or a lessening of symptom severity).
  • a dose should be sufficient to prevent, delay the onset of, or diminish the severity of a disease associated with disease or disorder.
  • Prophylactic benefit of the compositions administered according to the methods described herein can be determined by performing pre-clinical (including in vitro and in vivo animal studies) and clinical studies and analyzing data obtained therefrom by appropriate statistical, biological, and clinical methods and techniques, all of which can readily be practiced by a person skilled in the art.
  • Compositions are administered in an effective amount (e.g., to treat a Wuhan coronavirus infection), which will vary depending upon a variety of factors including the activity of the specific compound employed; the metabolic stability and length of action of the compound; the age, body weight, general health, sex, and diet of the subject; the mode and time of administration; the rate of excretion; the drug combination; the severity of the particular disorder or condition; and the subject undergoing therapy.
  • an effective amount e.g., to treat a Wuhan coronavirus infection
  • test subjects will exhibit about a 10% up to about a 99% reduction in one or more symptoms associated with the disease or disorder being treated as compared to placebo-treated or other suitable control subjects.
  • a therapeutically effective daily dose of an antibody or antigen binding fragment is (for a 70 kg mammal) from about 0.001 mg/kg (z.e., 0.07 mg) to about 100 mg/kg (/. ⁇ ., 7.0 g); preferably a therapeutically effective dose is (for a 70 kg mammal) from about 0.01 mg/kg (i.e., 0.7 mg) to about 50 mg/kg (i.e., 3.5 g); more preferably a therapeutically effective dose is (for a 70 kg mammal) from about 1 mg/kg (i.e., 70 mg) to about 25 mg/kg (i.e., 1.75 g).
  • a therapeutically effective dose may be different than for an antibody or antigen-binding fragment.
  • a method comprises administering the antibody, antigen-binding fragment, polynucleotide, vector, host cell, or composition to the subject at 2, 3, 4, 5, 6, 7, 8, 9, 10 times, or more.
  • a method comprises administering the antibody, antigen-binding fragment, or composition to the subject a plurality of times, wherein a second or successive administration is performed at about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 24, about 48, about 74, about 96 hours, or more, following a first or prior administration, respectively.
  • a method comprises administering the antibody, antigen-binding fragment, polynucleotide, vector, host cell, or composition at least one time prior to the subject being infected by SARS-CoV-2.
  • compositions comprising an antibody, antigen-binding fragment, polynucleotide, vector, host cell, or composition of the present disclosure may also be administered simultaneously with, prior to, or after administration of one or more other therapeutic agents.
  • combination therapy may include administration of a single pharmaceutical dosage formulation which contains a compound of the invention and one or more additional active agents, as well as administration of compositions comprising an antibody or antigen-binding fragment of the disclosure and each active agent in its own separate dosage formulation.
  • an antibody or antigenbinding fragment thereof as described herein and the other active agent can be administered to the patient together in a single oral dosage composition such as a tablet or capsule, or each agent administered in separate oral dosage formulations.
  • an antibody or antigen-binding fragment as described herein and the other active agent can be administered to the subject together in a single parenteral dosage composition such as in a saline solution or other physiologically acceptable solution, or each agent administered in separate parenteral dosage formulations.
  • the compositions comprising an antibody or antigen-binding fragment and one or more additional active agents can be administered at essentially the same time, /. ⁇ ., concurrently, or at separately staggered times, /. ⁇ ., sequentially and in any order; combination therapy is understood to include all these regimens.
  • a combination therapy comprises one or more anti-SARS-CoV-2 antibody (or one or more nucleic acid, host cell, vector, or composition) of the present disclosure and one or more anti-inflammatory agent and/or one or more anti-viral agent.
  • the one or more antiinflammatory agent comprises a corticosteroid such as, for example, dexamethasone, prednisone, or the like.
  • the one or more anti-inflammatory agents comprise a cytokine antagonist such as, for example, an antibody that binds to IL6 (such as siltuximab), or to IL-6R (such as tocilizumab), or to IL-ip, IL-7, IL-8, IL- 9, IL-10, FGF, G-CSF, GM-CSF, IFN-y, IP-10, MCP-1, MIP-1A, MIP1-B, PDGR, TNF-a, or VEGF.
  • a cytokine antagonist such as, for example, an antibody that binds to IL6 (such as siltuximab), or to IL-6R (such as tocilizumab), or to IL-ip, IL-7, IL-8, IL- 9, IL-10, FGF, G-CSF, GM-CSF, IFN-y, IP-10, MCP-1, MIP-1A, MIP1-B, PDGR, TNF-a,
  • the one or more anti-viral agents comprise nucleotide analogs or nucelotide analog prodrugs such as, for example, remdesivir, sofosbuvir, acyclovir, and zidovudine.
  • an antiviral agent comprises lopinavir, ritonavir, favipiravir, or any combination thereof.
  • Other anti-inflammatory agents for use in a combination therapy of the present disclosure include non-steroidal anti-inflammatory drugs (NSAIDS).
  • the one or more antibody or one or more nucleic acid, host cell, vector, or composition
  • the one or more antiinflammatory agent and/or one or the more antiviral agent can be administered in any order and any sequence, or together.
  • an antibody (or one or more nucleic acid, host cell, vector, or composition) is administered to a subject who has previously received one or more anti-inflammatory agent and/or one or more antiviral agent.
  • one or more anti-inflammatory agent and/or one or more antiviral agent is administered to a subject who has previously received an antibody (or one or more nucleic acid, host cell, vector, or composition).
  • a combination therapy comprises two or more anti-SARS-CoV-2 antibodies of the present disclosure.
  • a method can comprise administering a first antibody to a subject who has received a second antibody, or can comprise administering two or more antibodies together.
  • a method is provided that comprises administering to the subject (a) a first antibody or antigen-binding fragment, when the subject has received a second antibody or antigen-binding fragment; (b) the second antibody or antigenbinding fragment, when the subject has received the first antibody or antigen-binding fragment; or (c) the first antibody or antigen-binding fragment, and the second antibody or antigen-binding fragment.
  • an antibody, antigen-binding fragment, polynucleotide, vector, host cell, or composition is provided for use in a method of treating a SARS- CoV-2 infection in a subject.
  • an antibody, antigen-binding fragment, or composition is provided for use in a method of manufacturing or preparing a medicament for treating a SARS-CoV-2 infection in a subject.
  • an antibody or antigen-binding fragment is provided for use in a method of detecting SARS-CoV-2 in a sample.
  • the method comprises contacting the sample with the antibody or antigen-binding fragment and detecting binding of the antibody or antigen-binding fragment to a SARS-CoV-2 protein or polypeptide in the sample.
  • binding to SARS-CoV-2 protein or polypeptide is detected by immunohistochemistry, ELISA, agglutination, immuno-dot, immuno-chromatography, and/or immuno-filtration.
  • an antibody or antigen-binding fragment is provided for use in a method of diagnosing a SARS-CoV-2 infection in a subject.
  • the method comprises testing a biological sample from the subject for the presence of a SARS-CoV-2 protein or polypeptide.
  • the testing comprises contacting the sample with the antibody or antigen-binding fragment and detecting binding of the antibody or antigen-binding fragment to the SARS-CoV-2 protein or polypeptide.
  • binding to SARS-CoV-2 protein or polypeptide is detected by immunohistochemistry, ELISA, agglutination, immuno-dot, immuno-chromatography, and/or immuno-filtration.
  • a detection and/or diagnostic method as provided herein can provide a result within 1, 5, 10, 20, 30, 45, 60, 75, 90, or 120 minutes, or within one day, of beginning the method.
  • kits comprising materials useful for carrying out detection or diagnostic methods.
  • a kit comprising an antibody or antigen-binding fragment as described herein is provided.
  • the kit is used for detecting the presence of SARS-CoV-2 in a biological sample.
  • the kit is used for detecting the presence of a SARS-CoV-2 protein or polypeptide, for example, SARS-CoV-2 spike protein, in a biological sample.
  • the presence of a SARS-CoV-2 protein is detected by immunohistochemistry, immunoblot, ELISA, agglutination, immuno-dot, immuno-chromatography, and/or immuno-filtration.
  • the kit includes a secondary antibody detectably labeled with, for example, horseradish peroxidase (HRP), and/or instructions and/or other reagents for performing a detection method as provided herein.
  • HRP horseradish peroxidase
  • kits comprising a composition
  • the composition comprises an antibody or antigen-binding fragment as described herein and a carrier or excipient.
  • the kit is used for detecting the presence of SARS-CoV-2 in a biological sample.
  • the kit is used for detecting the presence of a SARS-CoV-2 protein or polypeptide, for example, SARS- CoV-2 spike protein, in a biological sample.
  • the presence of a SARS-CoV-2 protein is detected by immunohistochemistry, immunoblot, ELISA, agglutination, immuno-dot, immuno-chromatography, and/or immuno-filtration.
  • the kit includes a secondary antibody detectably labeled with, for example, horseradish peroxidase (HRP) and/or instructions and/or other reagents for performing a detection method as provided herein.
  • HRP horseradish peroxidase
  • kits that can be used in one or more of these settings. Materials and reagents for characterizing biological samples and diagnosis a SARS-CoV-2 infection in a subject according to the methods herein by be assembled together as a kit.
  • a kit comprises an antibody or antigen-binding fragment according to the present disclosure and instructions for using the kit.
  • Kits comprising an antibody or antigen-binding fragment as described herein may futher comprise one or more substrates to anchor the antigen binding molecules, including membranes, beads, plastic tubes, or other surfaces, secondary antibodies, sample buffer, labeling buffer or reagents, wash buffers or reagents, immunodetection buffer or reagents, and detection means.
  • the kit comprises a substrate to which antibodies or antigen-binding fragments are anchored. Protocols for using these buffers and reagents for performing different steps of the procedure may be included in the kit.
  • the reagents may be supplied in a solid e.g., lyophilized) or liquid form.
  • Kits of the present disclosure may optionally comprise different containers (e.g., vial, ampoule, test tube, flask or bottle) for each individual buffer or reagent. Each component will generally be suitable as aliquoted in its respective container or provided in a concentrated form. Other containers suitable for conducting certain steps of the disclosed methods may also be provided.
  • the individual containers of the kit a preferably maintained in close confinement for commercial sale.
  • kits of the present disclosure further include control samples, reference samples, or any combination thereof. Instructions for using the kit, according to one or more methods of this disclosure, may comprise instructions for processing the biological sample obtained from a subject, performing the test, interpreting the results, or any combination thereof. Kits of the present disclosure may further include a notice in the form prescribed by a governmental agency (e.g., FDA) regulating the manufacture, use, or sale of pharmaceuticals or biological products.
  • a governmental agency e.g., FDA
  • an antibody or antigen-binding fragment for use in a detection and/or diagnostic method can comprise a detectable agent.
  • detectable agents include enzymes (e.g., a chromogenic reporter enzyme, such as horseradish peroxidase (HRP) or an alkaline phosphatase (AP)), dyes, (e.g.
  • cyanin dye coumarin, rhodamine, xanthene, fluorescein or a sulfonated derivative thereof, and fluorescent proteins, including those described by Shaner et al., Nature Methods (2005)), fluorescent labels or moieties (e.g., PE, Pacific blue, Alexa fluor, APC, and FITC) DNA barcodes (e.g., ranging from five up to 75 nucleotides long), and peptide tags (e.g., Strep tag, Myc tag, His tag, Flag tag, Xpress tag, Avi tag, Calmodulin tag, Polyglutamate tag, HA tag, Nus tag, S tag, X tag, SBP tag, Softag, V5 tag, CBP, GST, MBP, GFP, Thioredoxin tag).
  • fluorescent labels or moieties e.g., PE, Pacific blue, Alexa fluor, APC, and FITC
  • DNA barcodes e.g., ranging from five up to 75 nu
  • the present disclosure also provides the following non-limiting Embodiments.
  • Embodiment 1 An antibody, or antigen-binding fragment thereof, comprising a heavy chain variable domain (VH) comprising a CDRH1, a CDRH2, and a CDRH3, and a light chain variable domain (VL) comprising a CDRL1, a CDRL2, and a CDRL3, wherein:
  • the CDRH1 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs.: 53, 23, 33, 43, 63, 73, 83, 93, 103, 113, 123, 133, 143, 153, 163, 173, 183, 193, 203, 213, 223, 233, 243, 253, 263, 273, 283, 293, 303, 313, 323, 333, 343, 353, 363, 373, 383, 393, 403, 413, 423, or 433, or a sequence variant thereof comprising one, two, or three acid substitutions, one or more of which substitutions is optionally a conservative substitution and/or is a substitution to a germline-encoded amino acid;
  • the CDRH2 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs.: 54, 24, 34, 44, 64, 74, 84, 94, 104, 114, 124, 134, 144, 154,
  • the CDRH3 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs.: 55, 25, 35, 45, 65, 75, 85, 95, 105, 115, 125, 135, 145, 155,
  • the CDRL1 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs.: 57, 27, 37, 47, 67, 77, 87, 97, 107, 117, 127, 137, 147, 157,
  • the CDRL2 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs.: 58, 28, 38, 48, 68, 78, 88, 98, 108, 118, 128, 138, 148, 158,
  • the CDRL3 comprises or consists of the amino acid sequence according to any one of SEQ ID NOs.: 59, 29, 39, 49, 69, 79, 89, 99, 109, 119, 129, 139, 149, 159, 169, 179, 189, 199, 209, 219, 229, 239, 249, 259, 269, 279, 289, 299, 309, 319, 329, 339, 349, 359, 369, 379, 389, 399, 409, 419, 429, or 439, or a sequence variant thereof comprising having one, two, or three amino acid
  • Embodiment 2 The antibody or antigen-binding fragment of Embodiment 1, which is capable of neutralizing a SARS-CoV-2 infection in an in vitro model of infection and/or in an in vivo animal model of infection and/or in a human.
  • Embodiment 3 The antibody or antigen-binding fragment of any one of Embodiments 1-2, comprising CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NOs. :
  • Embodiment 4 The antibody or antigen-binding fragment of any one of Embodiments 1-3, wherein:
  • the VH comprises or consists of an amino acid sequence having at least 85% identity to the amino acid sequence according to any one of SEQ ID NOs.: 52, 22, 32, 42, 62, 72, 82, 92, 102, 112, 122, 132, 142, 152, 162, 172, 182 192, 202, 212, 222, 232, 242, 252, 262, 272, 282, 292, 302, 312, 322, 332, 342, 352, 362, 372, 382, 392, 402, 412, 422, and 432, wherein the variation is optionally limited to one or more framework regions and/or the variation comprises one or more substitution to a germline-encoded amino acid; and/or
  • the VL comprises or consists of an amino acid sequence having at least 85% identity to the amino acid sequence according to any one of SEQ ID NOs.: 56, 26, 36, 46, 66, 76, 86, 96, 106, 116, 126, 136, 146, 156, 166, 176, 186, 196, 206, 216, 226, 236, 246, 256, 266, 276, 286, 296, 306, 316, 326, 336, 346, 356, 366, 376, 386, 396, 406, 416, 426, and 436, wherein the variation is optionally limited to one or more framework regions and/or the variation comprises one or more substitution to a germline-encoded amino acid.
  • Embodiment 5 The antibody or antigen-binding fragment of any one of Embodiments 1-4, wherein the VH and the VL comprise or consist of the amino acid sequences according to SEQ ID NOs. :
  • Embodiment 6 The antibody or antigen-binding fragment of any one of Embodiments 1-5, which: (i) recognizes an epitope in a Domain A of SARS-CoV-2; (ii) is capable of neutralizing a SARS CoV-2 infection; (iii) is capable of eliciting at least one immune effector function against SARS CoV-2; (iv) is capable of preventing shedding, from a cell infected with SARS CoV-2, of SI protein; or (v) any combination of (i)-(iv).
  • Embodiment 7 The antibody or antigen-binding fragment of any one of Embodiments 1-6, which is a IgG, IgA, IgM, IgE, or IgD isotype.
  • Embodiment 8 The antibody or antigen-binding fragment of any one of Embodiments 1-7, which is an IgG isotype selected from IgGl, IgG2, IgG3, and IgG4.
  • Embodiment 9 The antibody or antigen-binding fragment of any one of Embodiments 1-8, which is human, humanized, or chimeric.
  • Embodiment 10 The antibody or antigen-binding fragment of any one of Embodiments 1-9, wherein the antibody, or the antigen-binding fragment, comprises a human antibody, a monoclonal antibody, a purified antibody, a single chain antibody, a Fab, a Fab’, a F(ab’)2, a Fv, a scFv, or a scFab.
  • Embodiment 11 The antibody or antigen-binding fragment of Embodiment
  • the scFv comprises more than one VH domain and more than one VL domain.
  • Embodiment 12 The antibody or antigen-binding fragment of any one of Embodiments 1-11, wherein the antibody or antigen-binding fragment is a multi-specific antibody or antigen binding fragment.
  • Embodiment 13 The antibody or antigen-binding fragment of Embodiment 12, wherein the antibody or antigen binding fragment is a bispecific antibody or antigen-binding fragment.
  • Embodiment 14 The antibody or antigen-binding fragment of Embodiment 12 or 13, comprising:
  • a second VH and a second VL wherein the first VH and the second VH are different and each independently comprise an amino acid sequence having at least 85% identity to the amino acid sequence set forth in any one of SEQ ID NOs.: 52, 22, 32, 42, 62, 72, 82, 92, 102, 112, 122, 132, 142, 152, 162, 172, 182 192, 202, 212, 222, 232, 242, 252, 262, 272, 282, 292, 302, 312, 322, 332, 342, 352, 362, 372, 382, 392, 402, 412, 422, and 432, wherein the first VL and the second VL are different and each independently comprise an amino acid sequence having at least 85% identity to the amino acid sequence set forth in any one of SEQ ID NOs.: 56, 26, 36, 46, 66, 76, 86, 96, 106, 116, 126, 136, 146, 156, 166, 176, 186, 196,
  • Embodiment 15 The antibody or antigen-binding fragment of any one of Embodiments 1-14, wherein the antibody or antigen-binding fragment further comprises a Fc polypeptide or a fragment thereof.
  • Embodiment 16 The antibody or antigen-binding fragment of Embodiment
  • Fc polypeptide or fragment thereof comprises:
  • Embodiment 17 The antibody or antigen-binding fragment of Embodiment
  • the mutation that enhances binding to a FcRn comprises: M428L; N434S; N434H; N434A; N434S; M252Y; S254T; T256E; T250Q; P257I; Q311I; D376V; T307A; or E380A; or any combination thereof.
  • Embodiment 18 The antibody or antigen-binding fragment of Embodiment 16 or 17, wherein the mutation that enhances binding to FcRn comprises:
  • Embodiment 19 The antibody or antigen-binding fragment of any one of Embodiments 16-18, wherein the mutation that enhances binding to FcRn comprises M428L/N434S.
  • Embodiment 20 The antibody or antigen-binding fragment of any one of Embodiments 16-19, wherein the mutation that enhances binding to a FcyR comprises S239D; I332E; A330L; G236A; or any combination thereof.
  • Embodiment 21 The antibody or antigen-binding fragment of any one of
  • Embodiments 16-20 wherein the mutation that enhances binding to a FcyR comprises:
  • Embodiment 22 The antibody or antigen-binding fragment of any one of Embodiments 16-21, wherein the Fc polypeptide comprises a L234A mutation and a L235A mutation.
  • Embodiment 23 The antibody or antigen-binding fragment of any one of Embodiments 1-22, which comprises a mutation that alters glycosylation, wherein the mutation that alters glycosylation comprises N297A, N297Q, or N297G, and/or which is aglycosylated and/or afucosylated.
  • Embodiment 24 An isolated polynucleotide encoding the antibody or antigen-binding fragment of any one of Embodiments 1-23, or encoding a VH, a heavy chain, a VL, and/or a light chain of the antibody or the antigen-binding fragment.
  • Embodiment 25 The polynucleotide of Embodiment 24, wherein the polynucleotide comprises deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), wherein the RNA optionally comprises messenger RNA (mRNA).
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • mRNA messenger RNA
  • Embodiment 26 The polynucleotide of Embodiment 24 or 25, which is codon-optimized for expression in a host cell.
  • Embodiment 27 The polynucleotide of any one of Embodiments 24-26, comprising a polynucleotide having at least 50% identity to the polynucleotide sequence according to any one or more of SEQ ID NOs.: 60, 61, 30, 31, 40, 41, 50, 51, 70, 71, 80, 81, 90, 91, 100, 101, 110, 111, 120, 121, 130, 131, 140, 141, 150, 151, 160, 161, 170, 171, 180, 181, 190, 191, 200, 201, 210, 211, 220, 221, 230, 231, 240, 241,
  • Embodiment 28 A recombinant vector comprising the polynucleotide of any one of Embodiments 24-27.
  • Embodiment 29 A host cell comprising the polynucleotide of any one of Embodiments 24-27 and/or the vector of Embodiment 28, wherein the polynucleotide is heterologous to the host cell.
  • Embodiment 30 A human B cell comprising the polynucleotide of any one of Embodiments 24-28, wherein polynucleotide is heterologous to the human B cell and/or wherein the human B cell is immortalized.
  • Embodiment 31 A composition or combination comprising:
  • Embodiment 32 The composition or combination of Embodiment 31, comprising two or more antibodies or antigen-binding fragments of any one of Embodiments 1-23, and/or comprising one or more antibody according to any one of Embodiments 1-23 and an antibody or antigen-binding fragment that binds to a SARS CoV-2 surface glycoprotein RBD.
  • Embodiment 33 A composition comprising the polynucleotide of any one of Embodiments 24-27 encapsulated in a carrier molecule, wherein the carrier molecule optionally comprises a lipid, a lipid-derived delivery vehicle, such as a liposome, a solid lipid nanoparticle, an oily suspension, a submicron lipid emulsion, a lipid microbubble, an inverse lipid micelle, a cochlear liposome, a lipid microtubule, a lipid microcylinder, lipid nanoparticle (LNP), or a nanoscale platform.
  • Embodiment 34 A method of treating a SARS-CoV-2 infection in a subject, the method comprising administering to the subject an effective amount of
  • Embodiment 35 The antibody or antigen-binding fragment of any one of Embodiments 1-23, the polynucleotide of any one of Embodiments 24-27, the recombinant vector of Embodiment 28, the host cell of Embodiment 29, the human B cell of Embodiment 30, and/or the composition or combination of any one of Embodiments 31-33 for use in a method of treating a SARS-CoV-2 infection in a subject.
  • Embodiment 36 The antibody or antigen-binding fragment of any one of Embodiments 1-23, the polynucleotide of any one of Embodiments 24-27, the recombinant vector of Embodiment 28, the host cell of Embodiment 29, the human B cell of Embodiment 30, and/or the composition or combination of any one of Embodiments 31-33 for use in the preparation of a medicament for the treatment of a SARS-CoV-2 infection in a subject.
  • Embodiment 37 A method for in vitro or ex vivo diagnosis of a SARS- CoV-2 infection, the method comprising:
  • Embodiment 38 The method of Embodiment 37, wherein the sample comprises blood isolated from the subject.
  • Embodiment 39 An antibody, or an antigen-binding fragment thereof, that competes for binding to a SARS-CoV-2 surface glycoprotein with the antibody or antigen-binding fragment of any one of Embodiments 1-23.
  • Embodiment 40 A method of preventing or treating or neutralizing a coronavirus infection in a subject, the method comprising administering to a subject an effective amount of (i) an antibody or antigen-binding fragment of any one of Embodiments 1-23 or 39 and (ii) an antibody or antigen-binding fragment that is capable of specifically binding to a SARS CoV-2 S protein RBD.
  • Embodiment 41 A method of detecting a SARS-CoV-2 protein or polypeptide in a sample, comprising contacting the sample with the antibody or antigen-binding fragment of any one of Embodiments 1-23 or 39 and detecting binding of the antibody or antigen-binding fragment to the SARS-CoV-2 protein or polypeptide.
  • Embodiment 42 The method of Embodiment 41, wherein detecting binding of the antibody or antigen-binding fragment to the SARS-CoV-2 protein or polypeptide comprises immunohistochemistry, ELISA, agglutination, immuno-dot, immuno-chromatography, and/or immuno-filtration.
  • Embodiment 43 The antibody or antigen-binding fragment thereof of any one of Embodiments 1-23 for use in a method of detecting a SARS-CoV-2 protein or polypeptide in a sample, the method comprising contacting the sample with the antibody or antigen-binding fragment and detecting binding of the antibody or antigenbinding fragment to the SARS-CoV-2 protein or polypeptide, wherein, optionally, detecting binding of the antibody or antigen-binding fragment to the SARS-CoV-2 protein or polypeptide comprises immunohistochemistry, ELISA, agglutination, immuno-dot, immuno-chromatography, and/or immuno-filtration.
  • Embodiment 44 A method of diagnosing a SARS-CoV-2 infection in a subject, comprising testing a biological sample from the subject for the presence of a SARS-CoV-2 protein or polypeptide, wherein the testing comprises contacting the sample with the antibody or antigen-binding fragment of any one of Embodiments 1-23 and detecting binding of the antibody or antigen-binding fragment to the SARS-CoV-2 protein or polypeptide, wherein, optionally, detecting binding of the antibody or antigen-binding fragment to the SARS-CoV-2 protein or polypeptide comprises immunohistochemistry, ELISA, agglutination, immuno-dot, immuno-chromatography, and/or immuno-filtration.
  • Embodiment 45 The method of Embodiment 44, wherein the SARS-CoV- 2 protein or polypeptide is detected by immunohistochemistry.
  • Embodiment 46 The method of any one of Embodiments 41-45, wherein the sample comprises a nasal secretion, sputum, a bronchial lavage, urine, stool, saliva, sweat, or any combination thereof.
  • Embodiment 47 An antibody or antigen-binding fragment thereof for use in a method of diagnosing a SARS-CoV-2 infection in a subject, the method comprising testing a biological sample from the subject for the presence of a SARS-CoV-2 protein or polypeptide, wherein the testing comprises contacting the sample with the antibody or antigen-binding fragment and detecting binding of the antibody or antigen-binding fragment to the SARS-CoV-2 protein or polypeptide, wherein, optionally, detecting binding of the antibody or antigen-binding fragment to the SARS-CoV-2 protein or polypeptide comprises immunohistochemistry, ELISA, agglutination, immuno-dot, immuno-chromatography, and/or immuno-filtration, wherein, optionally, the antibody or antigen-binding fragment is the antibody or antigen-binding fragment thereof of any one of Embodiments 1-23.
  • Embodiment 48 The antibody or antigen-binding fragment of any one of Embodiments 1-23 or the antibody or antigen-binding fragment for use of Embodiment 43 or 47, or the method of any one of Embodiments 41, 42, or 44-46, wherein the antibody or antigen-binding fragment comprises a detectable agent.
  • Embodiment 49 A kit comprising the antibody or antigen-binding fragment thereof of any one of Embodiments 1-23, and optional instructions for using the antibody or antigen-binding fragment to detect the presence of a SARS-CoV-2 protein or polypeptide in a biological sample.
  • Embodiment 50 The kit according to Embodiment 49 for use in a method of detecting the presence of a SARS-CoV-2 protein or polypeptide in a biological sample.
  • Embodiment 51 The kit of for use of Embodiment 50, wherein the method comprises detecting the presence of a SARS-CoV-2 protein or polypeptide by immunohistochemistry, ELISA, agglutination, immuno-dot, immuno-chromatography, and/or immuno-filtration.
  • Embodiment 52 The kit of Embodiment 49 or the kit for use of any one of Embodiments 50 or 51, further comprising a detectably labeled secondary antibody.
  • Embodiment 53 The kit of Embodiment 49 or the kit for use of any one of Embodiments 50-52, further comprising one or more of a sample buffer, a wash buffer, an immunodetection buffer, a substrate, detection means, a control sample, a reference sample, and instructions for use.
  • Embodiment 54 The kit of Embodiment 49 or the kit for use of any one of Embodiments 50-53, wherein the sample comprises a nasal secretion, sputum, bronchial lavage, urine, stool, saliva, and/or sweat.
  • Embodiment 55 The composition or combination of Embodiment 32, comprising (a) antibody S2X333 (or an antigen-binding fragment thereof) or an antibody or antigen-binding fragment thereof that competes with antibody S2X333 for SARS-CoV-2 S protein binding and (b) antibody S309 (or an antigen-binding fragment thereof) or an antibody or antigen-binding fragment thereof that competes with antibody S309 for SARS-CoV-2 S protein binding.
  • Embodiment 56 The composition of Embodiment 32, comprising a) antibody S2X333 (or an antigen-binding fragment thereof) or an antibody or an antigenbinding fragment thereof that competes with antibody S2X333 for SARS-CoV-2 S protein binding and b) antibody S2E12 (or an antigen-binding fragment thereof) or an antibody or an antigen-binding fragment thereof that competes with antibody S2E12 for SARS-CoV-2 S protein binding.
  • Embodiment 57 The composition of Embodiment 32, comprising (a) antibody S2X333 (or an antigen-binding fragment thereof) or an antibody or an antigenbinding fragment thereof that competes with antibody S2X333 for SARS-CoV-2 S protein binding and (b) antibody S2M11 (or an antigen-binding fragment thereof) or an antibody or an antigen-binding fragment thereof that competes with antibody S2M11 for SARS-CoV-2 S protein binding.
  • Embodiment 58 The antibody or antigen-binding fragment of Embodiment 12 or 13, comprising (i) a first VH and a first VL; and (ii) a second VH and a second VL, wherein the first VH comprises an amino acid sequence having at least 85% (z.e., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the amino acid sequence set forth in SEQ ID NO: 52 and the first VL comprises an amino acid sequence having at least 85% (z.e., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to the amino acid sequence set forth in SEQ ID NO: 56; and a) the second VH comprises an amino acid sequence having at least 85% (z.e., 85%, 86%
  • Embodiment 59 A method of treating or preventing SARS-CoV-2 infection comprising administering a composition or combination of any one of Embodiments 55-57 or the antibody or antigen-binding fragment of Embodiment 58.
  • Embodiment 60 The composition or combination of any one of
  • Embodiments 55-57 wherein, optionally the antibody or antigen-binding fragment of a) and/or b) comprises (i) a Fc polypeptide comprising a mutation that enhances binding to a FcRn as compared to a reference Fc polypeptide that does not comprise the mutation; and/or (ii) a Fc polypeptide comprising a mutation that enhances binding to a FcyR as compared to a reference Fc polypeptide that does not comprise the mutation.
  • Embodiment 61 The antibody or antigen-binding fragment of Embodiment 58, or the method of Embodiment 59, wherein, optionally, the antibody or antigenbinding fragment comprises (i) a Fc polypeptide comprising a mutation that enhances binding to a FcRn as compared to a reference Fc polypeptide that does not comprise the mutation; and/or (ii) a Fc polypeptide comprising a mutation that enhances binding to a FcyR as compared to a reference Fc polypeptide that does not comprise the mutation.
  • Antibodies were recombinantly expressed in ExpiCHO cells transiently co- transfected with plasmids expressing the heavy and light chains as previously described (Stettler et al. (2016)). Specificity, cross-reactivity, and function of antibodies elicited by Zika virus infection. Science, 353(6301), 823-826). The concentration of antibody in cell culture supernatant was measured for antibodies as shown in Table 2.
  • Certain antibodies of the present disclosure were characterized by identification of the germline VH and VL genes, their EC50 and KD for binding to SARS-CoV-2 Domain A, and whether they exhibit neutralizing activity against SARS-CoV-2. The results are shown in Table 3. The notation "nn" indicates that the antibody was not neutralizing by this assay. Blank cells in the table indicate that no measurement was made.
  • EC50 values were measured by ELISA for binding to SARS-CoV-2 Spike protein Domain A.
  • KD, kon, and kdis values were measured by BLI for binding to SARS-CoV-2 Spike protein Domain A. Table 5.
  • SARS-CoV-2 coronavirus The emergence of SARS-CoV-2 coronavirus at the end of 2019 resulted in the ongoing COVID-19 pandemic.
  • Prophylactic and/or therapeutic anti-viral drugs may be helpful for unvaccinated individuals or those who respond poorly to vaccination as well as upon waning of immunity or emergence of antigenically distinct strains.
  • SARS-CoV-2 infects host cells through attachment of the viral transmembrane spike (S) glycoprotein to angiotensin-converting enzyme 2 (ACE2) followed by fusion of the viral and host membranes (Letko et al., 2020; Walls et al., 2020c; Wrapp et al., 2020; Zhou et al., 2020).
  • S viral transmembrane spike
  • ACE2 angiotensin-converting enzyme 2
  • SARS-CoV-2 S also engages cell-surface heparan-sulfates (Clausen et al., 2020), neuropilin-1 (Cantuti-Castelvetri et al., 2020; Daly et al., 2020) and L-SIGN/DC-SIGN (Chiodo et al., 2020; Gao et al., 2020; Soh et al., 2020; Thepaut et al., 2020) which were proposed to serve as co-receptors, auxiliary receptors, or adsorption factors.
  • SARS-CoV-2 S is the main target of neutralizing Abs in infected individuals and the focus of the many nucleic acid, vectored, and protein subunit vaccines currently deployed or in development (Corbett et al., 2020a; Corbett et al., 2020b; Erasmus et al., 2020; Hassan et al., 2020; Keech et al., 2020; Mercado et al., 2020; Walls et al., 2020b).
  • some neutralizing Abs may interfere with heparan-sulfate, neuropilin-1 or L-SIGN/DC-SIGN interactions.
  • the SARS-CoV-2 S protein comprises an N-terminal Si subunit responsible for virus-receptor binding, and a C-terminal S2 subunit that promotes virus-cell membrane fusion (Walls et al., 2020c; Wrapp et al., 2020).
  • the Si subunit comprises an N- terminal domain (NTD) and a receptor-binding domain (RBD), also known as domain A and B, respectively (Tortorici and Veesler, 2019).
  • Antibodies targeting the RBD account for 90% of the neutralizing activity in CO VID-19 convalescent sera (Piccoli et al., 2020) and numerous monoclonal antibodies (mAbs) recognizing this domain have been isolated and characterized (Barnes et al., 2020a; Barnes et al., 2020b; Baum et al., 2020b; Brouwer et al., 2020; Hansen et al., 2020; Ju et al., 2020; Piccoli et al., 2020; Pinto et al., 2020; Tortorici et al., 2020; Wang et al., 2020; Wu et al., 2020).
  • RBD-specific mAbs capable of protecting small animals and non-human primates from SARS-CoV-2 challenge are able to neutralize viral infection by targeting multiple distinct antigenic sites (Baum et al., 2020a; Hansen et al., 2020; Jones et al., 2020; Pinto et al., 2020; Rogers et al., 2020; Tortorici et al., 2020; Zost et al., 2020).
  • a subset of these mAbs is currently being evaluated in clinical trials or have recently received emergency use authorization from the FDA.
  • NTD neurodegenerative disease 2019
  • auxiliary receptors in cell types that do not express ACE2
  • its role and the mechanism of action of NTD targeted neutralizing mAbs remain unknown (Son et al., 2020). Understanding the immunogenicity of different S domains and the function of mAbs targeting them, including the NTD, is important to understanding immunity during the pandemic.
  • IgG + memory B cells from peripheral blood mononuclear cells (PBMCs) of three CO VID-19 convalescent individuals (L, M, X) were sorted using biotinylated prefusion SARS- CoV-2 S as a bait.
  • the percentage of SARS-CoV-2 S-reactive IgG + B cells ranged between 1.1 - 1.3 % of IgG + memory B cells.
  • a total of 278 mAbs were isolated and recombinantly produced as human IgGl ( Figure 20). Characterization by ELISA showed that most mAbs isolated from the three donors recognize the RBD (65-77%), with a smaller fraction targeting the NTD (6-20%).
  • the remaining mAbs (4-20%) are expected to bind to either the S2 subunit or the C-D domains within the Si subunit ( Figure 20).
  • the low proportion of NTD-specific mAbs isolated from these donors is in line with the previously observed limited NTD immunogenicity in SARS-CoV-2 exposed individuals (Piccoli et al., 2020; Rogers et al., 2020).
  • 41 mAbs recognizing the SARS-CoV2 NTD were identified, with EC50s ranging between 7.6 - 698 ng/ml and nanomolar binding affinities, as evaluated using ELISA and biolayer interferometry, respectively ( Figures 21, 24A-24D, and 28A-28F, and Tables 6 and 7).
  • NTD-specific mAbs use a large repertoire of V genes, with an overrepresentation of IGHV3-21 and IGK3-15 genes ( Figure 25 and Tables 6 and 7). These mAbs harbor few somatic hypermutations (VH and VL are 97.57% and 97.54% identical to V germline genes, respectively; ( Figure 26, Tables 6 and 7), as previously described for most SARS-CoV-2 neutralizing mAbs binding to the RBD (Piccoli et al., 2020; Seydoux et al., 2020).
  • Antibody 418 1 is also referred to herein as S2X28.
  • Antibody 418_2 is also referred to herein as S2X303.
  • Antibody 418 3 is also referred to herein as S2X320.
  • Antibody 418_4 is also referred to herein as S2X333.
  • Antibody 418 5 is also referred to herein as S2M28.
  • Antibody 418 6 is also referred to herein as S2M24 or S2M24v2.
  • Antibody 418_7 is also referred to herein as S2L7.
  • Antibody 418 8 is also referred to herein as S2L24.
  • Antibody 418 9 is also referred to herein as S2L28.
  • Antibody 418 10 is also referred to herein as S2X310.
  • Antibody 418 11 is also referred to herein as S2X94.
  • Antibody 418 12 is also referred to herein as S2X169.
  • Antibody 418 13 is also referred to herein as S2L11.
  • Antibody 418 14 is also referred to herein as S2L12.
  • Antibody 418 15 is also referred to herein as S2X186.
  • Antibody 418 16 is also referred to herein as S2X175.
  • Antibody 418 17 is also referred to herein as S2X170.
  • Antibody 418 18 is also referred to herein as S2X125.
  • Antibody 418 19 is also referred to herein as S2X107.
  • Antibody 418_20 is also referred to herein as S2X105.
  • Antibody 418 21 is also referred to herein as S2X102.
  • Antibody 418_22 is also referred to herein as S2X15.
  • Antibody 418_23 is also referred to herein as S2X49.
  • Antibody 418_24 is also referred to herein as S2X51.
  • Antibody 418_25 is also referred to herein as S2X72.
  • Antibody 418_26 is also referred to herein as S2X91.
  • Antibody 418_27 is also referred to herein as S2X98.
  • Antibody 418_28 is also referred to herein as S2X124.
  • Antibody 418_29 is also referred to herein as S2X158.
  • Antibody 418_30 is also referred to herein as S2X161.
  • Antibody 418 31 is also referred to herein as S2X165.
  • Antibody 418 33 is also referred to herein as S2X173.
  • Antibody 418_34 is also referred to herein as S2X176.
  • Antibody 418 35 is also referred to herein as S2X316.
  • Antibody 418 37 is also referred to herein as S2X90.
  • Antibody 418 38 is also referred to herein as S2X93.
  • Antibody 418_39 is also referred to herein as S2L14.
  • Antibody 418 40 is also referred to herein as S2L20 or S2L20vl.
  • Antibody 418 41 is also referred to herein as S2L26.
  • Antibody 418_42 is also referred to herein as S2L35.
  • Antibody 418 43 is also referred to herein as S2L38.
  • Antibody 418_44 is also referred to herein as S2L50.
  • CDRH3 lengths of these mAbs range between 10 and 24 amino acid residues ( Figure 26). Collectively, these data indicate that the Ab response to the SARS-CoV-2
  • S2X333 neutralized SARS-CoV-2 with an IC50 of 2 ng/ml and an IC90 of 12 ng/ml, on par with the potent RBD-targeting mAbs S2E12 and S2M11 ( Figure 23).
  • NTD-specific mAb-mediated neutralization further relies on steric hindrance provided by Fc positioning, similar to what was observed for antihemagglutinin influenza A virus neutralizing mAbs (Xiong et al., 2015).
  • Fc-mediated effector functions can contribute to protection by promoting viral clearance and anti-viral immune responses in vivo (Bournazos et al., 2020; Bournazos et al., 2016; Schafer et al., 2021; Winkler et al., 2020), the ability of site i- targeting mAbs to trigger activation of FcyRIIa and FcyRIIIa was evaluated as a proxy for Ab-dependent cellular phagocytosis (ADCP) and Ab-dependent cellular cytotoxicity (ADCC), respectively.
  • ADCP Ab-dependent cellular phagocytosis
  • ADCC Ab-dependent cellular cytotoxicity
  • NTD neutralizing mAbs protect against SARS-CoV-2 challenge in hamsters
  • the S2X333 mAb was selected for a prophylactic study in a Syrian hamster model (Boudewijns et al., 2020).
  • the mAb was administered at 4 and 1 mg/kg via intraperitoneal injection 48 hours before intranasal SARS-CoV-2 challenge.
  • lungs were collected for the quantification of viral RNA and infectious virus titers.
  • Prophylactic administration of S2X333 decreased the amount of viral RNA detected in the lungs by ⁇ 3 orders of magnitude, compared to hamsters receiving a control mAb (Figure 37A) and completely abrogated viral replication in the lungs of most animals at both doses tested (Figure 37B).
  • neutralizing NTD-targeting mAbs represent one aspect of immunity to SARS-CoV-2 and account for 5-20% of SARS-CoV-2 S-specific mAbs cloned from memory B cells isolated from the PBMCs of three COVID-19 individuals.
  • Analysis of a large panel of neutralizing and non-neutralizing mAbs defined an antigenic map of the heavily glycosylated SARS-CoV-2 NTD, in which 6 antigenic sites (i-vi) were identified. All the neutralizing mAbs from the three donors investigated targeted the same antigenic supersite (site i).
  • a highly potent NTD mAb provides prophylactic protection against SARS-CoV-2 challenge of Syrian hamsters demonstrating that this class of mAbs can be a critical barrier to infection.
  • Fc-mediated effector functions can be affected by the epitope specificity of the mAbs (Piccoli et al., 2020), highlighting the importance of the orientation of the S-bound Fc fragments for efficient FcyR cross-linking and engagement.
  • the site vi -targeting NTD mAb S2M24 did not activate either FcyRIIa or FcyRIIIa.
  • the contribution of Fc-mediated effector functions could further enhance the prophylactic activity of potent NTD-specific mAbs against SARS-CoV-2 in humans.
  • REGN-COV2 antibodies prevent and treat SARS-CoV-2 infection in rhesus macaques and hamsters. Science.
  • Neuropilin-1 facilitates SARS-CoV-2 cell entry and infectivity. Science 370, 856-860.
  • a neutralizing human antibody binds to the N- terminal domain of the Spike protein of SARS-CoV-2. Science 369, 650-655.
  • SARS-CoV-2 mRNA vaccine design enabled by prototype pathogen preparedness. Nature 586, 567-571.
  • Neuropilin-1 is a host factor for SARS-CoV-2 infection. Science 370, 861-865.
  • Chloroquine does not inhibit infection of human lung cells with SARS-CoV-2. Nature 585, 588-590.
  • SARS-CoV-2 D614G variant exhibits efficient replication ex vivo and transmission in vivo. Science 370, 1464-1468.
  • LY-CoV555 a rapidly isolated potent neutralizing antibody, provides protection in a non-human primate model of SARS-CoV-2 infection.
  • Tortorici M.A., Beltramello, M., Lempp, F.A., Pinto, D., Dang, H.V., Rosen, L.E., McCallum, M., Bowen, J., Minola, A., Jaconi, S., et al. (2020).
  • Ultrapotent human antibodies protect against SARS-CoV-2 challenge via multiple mechanisms. Science 370, 950-957.
  • SARS-CoV-2 and bat RaTG13 spike glycoprotein structures inform on virus evolution and furin-cleavage effects. Nat Struct Mol Biol 27, 763-767.
  • protein A biosensors (Pall ForteBio) were used to immobilize recombinant antibodies at 2.7 pg/ml for 1 minute, after a hydration step for 10 minutes with Kinetics Buffer (KB). Association curves were recorded for 5min by incubating the antibody-coated sensors with SARS-CoV-1 Domain A analyte at 10 pg/ml (66.6 nM) in KB for 5 minutes (association phase), followed by dissociation with KB for 9 minutes. Signals were recorded and analysed with Octet Systems Software.
  • SARS-CoV Spike SI Subunit Protein strain WH20 protein
  • ELISA enzyme-linked immunosorbent assays
  • Bound mAbs were detected by incubating alkaline phosphatase- conjugated goat anti-human IgG (Southern Biotechnology: 2040-04) for 1 h at room temperature and were developed by 1 mg/ml p-nitrophenylphosphate substrate in 0.1 M glycine buffer (pH 10.4) for 30 min at room temperature.
  • the optical density (OD) values were measured at a wavelength of 405 nm in an ELISA reader (Powerwave 340/96 spectrophotometer, BioTek).
  • Murine leukemia virus (MLV) pseudotyped with SARS-CoV-2 Spike protein (SARS-CoV-2pp) was used.
  • DBT cells stably transfected with ACE2 (DBT-ACE2) were used as target cells.
  • SARS-CoV-2pp was activated with trypsin TPCK at lOug/ml.
  • Activated SARS-CoV-2pp was added to a dilution series of antibodies (starting 50ug/ml final concentration per antibody, 3-fold dilution).
  • DBT- ACE2 cells were added to the antibody-virus mixtures and incubated for 48h. Luminescence was measured after aspirating cell culture supernatant and adding steady - GLO substrate (Promega).
  • pseudoparticle neutralization assays use a VSV-based luciferase reporter pseudotyping system (Kerafast). VSV pseudoparticles and antibody are mixed in DMEM and allowed to incubate for 30 minutes at 37C. The infection mixture is then allowed to incubate with Vero E6 cells for Ih at 37C, followed by the addition of DMEM with Pen-Strep and 10% FBS (infection mixture is not removed). The cells are incubated at 37C for 18-24 hours. Luciferase is measured using an Ensight Plate Reader (Perkin Elmer) after the addition of Bio-Gio reagent (Promega).
  • Cell lines were obtained from ATCC (HEK293T and Vero-E6)or ThermoFisher Scientific (Expi CHO cells, FreeStyleTM 293-F cells and Expi293FTM cells).
  • Samples were obtained from three SARS-CoV-2 recovered individuals (L, M and X) under study protocols approved by the local Institutional Review Boards (Canton Ticino Ethics Committee, Switzerland, the Ethical committee of Luigi Sacco Hospital, Milan, Italy). All donors provided written informed consent for the use of blood and blood components (such as PBMCs, sera or plasma).
  • Samples were collected 14 and 52 days after symptoms onset for donor L and M, respectively. Blood drawn from donor X was obtained at day 36, 48, 75 and 125 after symptoms onset.
  • SARS-CoV-2 NTD was sub-cloned with E. coli DH10B Competent Cells into pCMV using primers NTD_fwd and NTD_rev.
  • the resulting construct was mutated by PCR mutagenesis to generate N149Q, D253G/Y, T19A, R246A, L18F, H146Y, A222V, Y144del, S254F, K147T, C136Y, and the NTD construct with native signal peptide with and without S12P, using the eponymously named primers (Key Resources Table).
  • the genes encoding for the Sarbecovirus S proteins tested were cloned in the phCMVl or pcDNA.3 vectors, and the gene for the C-terminally his-tagged ectodomain of P-GD S was cloned into pCMV (Key Resources Table). Plasmid sequences were verified by Genewiz sequencing facilities (Brooks Life Sciences).
  • All SARS-CoV-2 S spike ectodomains were produced in 500 mL cultures of FreeStyleTM 293-F cells (ThermoFisher Scientific) grown in suspension using FreeStyle 293 expression medium (ThermoFisher Scientific) at 37°C in a humidified 8% CO2 incubator rotating at 130 r.p.m.
  • S ectodomains were purified from clarified supernatants using a Cobalt affinity column (Cytiva, HiTrap TALON crude), washing with 20 column volumes of 20 mM Tris-HCl pH 8.0 and 150 mM NaCl and eluted with a gradient of 600 mM imidazole.
  • the same protocol was followed for P-GD spike ectodomain purification, except that 25 mM sodium phosphate pH 7 and 300 mM sodium chloride were used instead of 20 mM Tris-HCl pH 8.0 and 150 mM NaCl.
  • SARS- CoV-2 S with the avi tag was biotinylated (BirA biotin-protein ligase standard reaction kit, Avidity) and further purified by size exclusion chromatography (Superose6, GE Healthcare). All purified proteins were then concentrated using a 100 kDa centrifugal filter (Amicon Ultra 0.5 mL centrifugal filters, MilliporeSigma), residual imidazole was washed away by consecutive dilutions in the centrifugal filter unit with 20 mM Tris-HCl pH 8.0 and 150 mM NaCl, and finally concentrated to 5 mg/ml and flash frozen.
  • All SARS-CoV-2 S NTD domain constructs (residues 14-307) with a C-terminal 8XHis-tag were produced in 100 mL culture of Expi293FTM Cells (ThermoFisher Scientific) grown in suspension using Expi293TM Expression Medium (ThermoFisher Scientific) at 37°C in a humidified 8% CO2 incubator rotating at 130 r.p.m.) (Walls et al., 2020) (Walls et al., 2020) (Walls et al., 2020) (Walls et al., 2020) (Walls et al., 2020) (Walls et al., 2020) (Walls et al., 2020) (Walls et al., 2020) (Walls et al., 2020) (Walls et al., 2020) (Walls et al., 2020) (Walls et al., 2020
  • Purified protein was concentrated using a 30 kDa centrifugal filter (Amicon Ultra 0.5 mL centrifugal filters, MilliporeSigma), the imidazole was washed away by consecutive dilutions in the centrifugal filter unit with 20 mM HEPES-HC1 pH 8.0 and 150 mM NaCl, and finally concentrated to 20 mg/ml and flash frozen.
  • the purified NTD was not frozen but was further purified by size exclusion chromatography (Superdex Increase 75 10/300 G, GE Healthcare), concentrated using a new 30 kDa centrifugal filter, and used immediately.
  • the purpose of intact MS was to verify the n-terminal sequence on four constructs. N-linked glycans were removed by PNGase F after overnight nondenaturing reaction at room temperature. 4pg of deglycosylated protein was used for each injection on the LC-MS system to acquire intact MS signal after separation of protease and protein by LC (Agilent PLRP-S reversed phase column). Thermo MS (Q Exactive Plus Orbitrap) was used to acquire intact protein mass under denaturing condition. BioPharma Finder 3.2 software was used to deconvolute the raw m/z data to protein average mass.
  • PBMCs peripheral blood mononuclear cells
  • plasma and sera PBMCs were isolated from blood draw performed using tubes pre-filled with heparin, followed by Ficoll density gradient centrifugation.
  • PBMCs were either used freshly along SARS-CoV2 Spike protein specific memory B cells sorting or stored in liquid nitrogen for later use.
  • Sera were obtained from blood collected using tubes containing clot activator, followed by centrifugation and stored at -80 °C.
  • B cells were enriched by staining with CD 19 PE-Cy7 (BD Bioscience 341113) and incubation with anti -PE bead (Miltenyi Biotec, cat. 130- 048-801), followed by positive selection using LS columns. Enriched B cells were stained with anti-IgM, anti-IgD, anti-CD14 and anti-IgA, all PE labelled, and prefusion SARS-CoV-2 S with a biotinylated avi tag conjugated to Streptavidin Alexa-Fluor 647 (Life Technologies).
  • SARSCoV-2 S-specific IgG+ memory B cells were sorted by flow cytometry via gating for PE negative and Alexa-Fluor 647 positive cells. Cells were cultured for the screening of positive supernatants. Antibody VH and VL sequences were obtained by RT-PCR and mAbs were expressed as recombinant human Fab fragment or as IgGl (Glm3 allotype) carrying the half-life extending M428L/N434S (LS) mutation in the Fc region. ExpiCHO cells were transiently transfected with heavy and light chain expression vectors as previously described (Pinto et al., 2020).
  • Affinity purification was performed on AKTA Xpress FPLC (Cytiva) operated by UNICORN software version 5.11 (Build 407) using HiTrap Protein A columns (Cytiva) for full length human and hamster mAbs and CaptureSelect CHI -XL MiniChrom columns (ThermoFisher Scientific) for Fab fragments, using PBS as mobile phase. Buffer exchange to the appropriate formulation buffer was performed with a HiTrap Fast desalting column (Cytiva). The final products were sterilized by filtration through 0.22 pm filters and stored at 4 °C.
  • 96 half area wellplates (Corning) were coated over-night at 4°C with of SARS-CoV-2 S, NTD or RBD proteins prepared 1 pg/ml, 2 pg/ml and 5 pg/ml in PBS pH 7.2, respectively. Plates were then blocked with PBS 1% BSA (Sigma) and subsequently incubated with mAbs serial dilutions for 1 h at room temperature. After 2 washing steps with PBS 0.05% Tween 20 (PBS-T) (Sigma-Aldrich) goat anti-huma IgG secondary antibody (Southern Biotech) was added in incubated for 1 h at room temperature.
  • PBS-T PBS 0.05% Tween 20
  • goat anti-huma IgG secondary antibody Southern Biotech
  • SARS-CoV-2 S murine leukemia virus pseudotyped virus S murine leukemia virus pseudotyped virus
  • HEK293T cells were seeded in 10-cm dishes in DMEM supplemented with 10% FBS. The next day cells were transfected with a SARS-CoV-2 S glycoprotein-encoding plasmid harboring the D 19 C-terminal truncation (Ou et al., 2020) using the X- tremeGENE HP DNA transfection reagent (Roche) according to the manufacturer’s instructions. Cells were then incubated at 37°C with 5% CO2 for 72 h. Supernatant was harvested and cleared from cellular debris by centrifugation at 400 X g, and stored at - 80 °C.
  • Vero E6 cells were seeded into white 96-well plates (PerkinElmer) at 20,000 cells/well and cultured overnight at 37 °C with 5 % CO2 in 100 pl DMEM supplemented with 10% FBS and 1% penicillin/streptomycin. The next day, MLV-SARS-CoV-2 pseudovirus was activated with 10 Dg/ml TPCK treated- Trypsin (Worthington Biochem) for 1 h at 37 °C. Then recombinant antibodies at various concentrations were incubated with activated pseudovirus for 1 h at 37 °C.
  • Vero E6 cells were then washed with DMEM, and the 50 Dl of pseudovirus/mAbs mixes were added and incubated for 2 h at 37 °C with 5 % CO2. After incubation, 50 pl of DMEM containing 20% FBS and 2 % penicillin/ streptomycin was added and the cells were incubated 48 h at 37 °C with 5 % CO2.
  • Neutralization of authentic SARS-CoV-2 by entry-inhibition assay Neutralization was determined using SARS-CoV-2-Nluc, an infectious clone of SARSCoV-2 (based on strain 2019-nCoV/USA_WAl/2020) which encodes nanoluciferase in place of the viral ORF7 and demonstrated comparable growth kinetics to wildtype virus (Xie et al., 2020). Vero E6 cells were seeded into black-walled, clearbottom 96-well plates at 2 x 104 cells/well and cultured overnight at 37 °C. The next day, 9-point 4-fold serial dilutions of mAbs were prepared in infection media (DMEM + 10% FBS).
  • SARS-CoV-2-Nluc was diluted in infection media at a final MOI of 0.1 or 0.01 PFU/cell, added to the mAb dilutions and incubated for 30 minutes at 37 °C. Media was removed from the Vero E6 cells, mAb-virus complexes were added and incubated at 37 °C for 6 or 24 hours. Media was removed from the cells, Nano-Gio luciferase substrate (Promega) was added according to the manufacturer’s recommendations, incubated for 10 minutes at room temperature and the luciferase signal was quantified on a VICTOR Nivo plate reader (Perkin Elmer).
  • BLI was used to assess antibody binding affinity to SARS-CoV-2 NTD.
  • IgG antibodies were prepared at 2.7 pg/ml and captured on pre-hydrated Protein A biosensors (Sartorius) for 1 min.
  • the biosensors with immobilized antibodies were moved into kinetics buffer with SARS-CoV-2 NTD (concentrations tested: 333.3, 166.6, 83.3, 41.7, 20.8, 10.4, 5.2 nM) for 5 min (i.e. association).
  • the dissociation of the SARS-CoV-2 NTD was then recorded for 9 min in wells containing kinetics buffer. Affinity constants were calculated using a global fit model and results were plotted using GraphPad Prism.
  • Biotinylated SARS-CoV-2 S protein was prepared at 10 pg/ml in kinetics buffer and loaded on pre-hydrated High Precision Streptavidin SAX Biosensors (Sartorius) for 3 min. NTD mAbs at 20 pg/ml in kinetics buffer were then sequentially added to observe binding competition and signal recorded for 5 min (or 7 min)
  • SARS-CoV2 S ectodomain trimer 5 pg/ml was incubated with tested mAbs (30 pg/ml) or no mAb for 30 minutes at 37°C.
  • Biotinylated recombinant human ACE2 protein (2 pg/ml) was immobilized on High Precision Streptavidin SAX Biosensors (Sartorius). Next, an association step with S/mAb complexes was performed for 10 minutes. Results were plotted using GraphPad Prism.
  • ExpiCHO-S cells were seeded at 6 x 106 cells cells/mL in a volume of 5 mL in a 50 mL bioreactor. Spike coding plasmids were diluted in cold OptiPRO SFM, mixed with ExpiFectamine CHO Reagent (Life Technologies) and added to the cells. Transfected cells were then incubated at 37°C with 8% CO2 with an orbital shaking speed of 120 RPM (orbital diameter of 25 mm) for 42 hours
  • Vero E6 cells were seeded in 96 well plates at 15,000 cells per well in 70 pl DMEM with high glucose and 2.4% FBS (Hyclone). After 16 h at 37 °C with 8 % CO2, the cells were transfected with SARS-CoV-2-S-D19j>cDNA3.1 as follows: for 10 wells, 0.57 pg plasmid SARS-CoV-2- S-D19_pcDNA3.1 were mixed with 1.68 pl X- tremeGENE HP in 30 pl OPTIMEM. After 15 minutes incubation, the mixture was diluted 1 : 10 in DMEM medium and 30pl was added per well.
  • a 4-fold serial dilution mAbs was prepared and added to the cells, with a starting concentration of 20 pg/ml. The following day, 30 pl 5X concentrated DRAQ5 in DMEM was added per well and incubated for 2 hours at 37°C. Nine images of each well were acquired with a Cytation 5 equipment for analysis.
  • Fc-effector functions Ab-dependent activation of human FcyRIIIa was performed with a bioluminescent reporter assay. ExpiCHO cells stably expressing full-length wild-type SARS-CoV-2 S (target cells) were incubated with different amounts of mAbs. After a 15-minute incubation, Jurkat cells stably expressing FcyRIIIa receptor (V158 variant) or FcyRIIa receptor (H131 variant) and NFAT-driven luciferase gene (effector cells) were added at an effector to target ratio of 6: 1 for FcyRIIIa and 5: 1 for FcyRIIa.
  • luciferase signal produced as a result of NF AT pathway activation. Luminescence was measured after 20 hours of incubation at 37 C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega, Cat. Nr.: G9798, G7018 and G9995).
  • CHO cells stably expressing wild-type SARS-CoV-2 S were resuspended in wash buffer (PBS 1 % BSA, 2 mM EDTA) and treated with 10 pg/mL TPCK-trypsin (Worthington Biochem) for 30 min at 37°C. Cells were then washed and distributed into round bottom 96-well plates (90,000 cells/well). MAbs were added to cells at 15 pg/mL final concentration for 180 min at 37 °C.
  • Cells were collected at different time points (5, 30, 60, 120 and 180), washed with wash buffer at 4 °C, and incubated with 1.5 mg/mL secondary goat anti -human IgG, Fc fragment specific (Jackson ImmunoResearch) on ice for 20 min. Cells were washed and resuspended in wash buffer and analyzed with ZE5 FACS (Bio-rad).
  • Lentiviruses were generated by co-transfection of Lenti-X 293T cells (Takara) with lentiviral expression plasmids encoding DC-SIGN (CD209), L-SIGN (CLEC4M), SIGLEC1, TMPRSS2 or ACE2 (all obtained from Genecopoeia) and the respective lentiviral helper plasmids. Forty-eight hours post transfection, lentivirus in the supernatant was harvested and concentrated by ultracentrifugation for 2 h at 20,000 rpm.
  • Lenti-X 293T (Takara), Vero E6 (ATCC), MRC5 (Sigma-Aldrich), A549 (ATCC) were transduced in the presence of 6 ug/mL polybrene (Millipore) for 24 h. Cell lines overexpressing two transgenes were transduced subsequently. Selection with puromycin and/or blasticidin (Gibco) was started two days after transduction and selection reagent was kept in the growth medium for all subsequent culturing. Single cell clones were derived from the A549-ACE2-TMPRSS2 cell line, all other cell lines represent cell pools.
  • SARS-CoV-2 isolated USA- WA1/2020, passage 3, passaged in Vero E6 cells
  • Neutralization was determined using SARS-CoV-2-Nluc, an infectious clone of SARS-CoV-2 (based on strain 2019-nCoV/USA_WAl/2020) encoding nanoluciferase in place of the viral ORF7, which demonstrates comparable growth kinetics to wild type virus (Xie et al., Nat Comm, 2020, https://doi.org/10.1038/s41467-020-19055-7).
  • Cells were seeded into black-walled, clear-bottom 96-well plates at 20,000 cells/well (293T cells were seeded into poly-L-lysine-coated wells at 35,000 cells/well) and cultured overnight at 37°C.
  • Lenti-X 293T cells (Takara) were seeded in 10-cm dishes for 80% next day confluency. The next day, cells were transfected with a plasmid encoding for SARS-CoV-2 S-glycoprotein (YP 009724390.1) harboring a C-terminal 19 aa truncation using TransIT-Lenti (Minis Bio) according to the manufacturer’s instructions. One day post-transfection, cells were infected with VSV(G*AG-luciferase) (Kerafast) at an MOI of 3 infectious umts/cell.
  • Viral inoculum was washed off after one hour and cells were incubated for another day at 37°C.
  • the cell supernatant containing SARS-CoV-2 pseudotyped VSV was collected at day 2 post-transfection, centrifuged at 1000 x g for 5 minutes to remove cellular debris, aliquoted, and frozen at -80°C.
  • Lenti-X 293T cells were transfected with plasmids encoding the following receptor candidates (all purchased from Genecopoeia): ACE2 (NM 021804), DC-SIGN (NM_021155), L-SIGN (BC110614), LGALS3 (NM_002306), SIGLEC1 (NM_023068), SIGLEC3 (XM_057602), SIGLEC9 (BC035365), SIGLEC10 (NM_033130), MGL (NMJ82906), MINCLE (NM_014358), CD147 (NMJ98589), ASGR1 (NM-001671.4), ASGR2 (NM_080913), NRP1 (NM_003873).
  • CHO cells stably expressing SARS-CoV-2 S-glycoprotein were seeded in 96 well plates for microscopy (Thermo Fisher Scientific) at 12’500 cells/well and the following day, different concentrations of mAbs and nuclei marker Hoechst (final dilution 1 : 1000) were added to the cells and incubated for additional 24h hours. Fusion degree was established using the Cytation 5 Imager (BioTek) and an object detection protocol was used to detect nuclei as objects and measure their size.
  • the nuclei of fused cells i.e., syncytia
  • the area of the objects in fused cells divided by the total area of all the object multiplied by 100 provides the percentage of fused cells
  • HEK 293T cells were seeded onto poly-D-Lysine-coated 96-well plates (Sigma- Aldrich) and fixed 24 h after seeding with 4% paraformaldehyde for 30 min, followed by two PBS (pH 7.4) washes and permeabilization with 0.25% Triton X-100 in PBS for 30 min.
  • Cells were incubated with primary antibodies anti-DC-SIGN/L-SIGN (Biolegend, cat. 845002, 1 :500 dilution), anti-DC-SIGN (Cell Signaling, cat. 13193 S, 1 :500 dilution), anti-SIGLECl (Biolegend, cat.
  • Intracellular levels of ACE2 (Forward Primer: CAAGAGCAAACGGTTGAACAC, Reverse Primer: CCAGAGCCTCTCATTGTAGTCT), HPRT (Forward Primer: CCTGGCGTCGTGATTAGTG, Reverse Primer: ACACCCTTTCCAAATCCTCAG), and TMPRSS2 (Forward Primer: CAAGTGCTCCRACTCTGGGAT, Reverse Primer: AACACACCGRTTCTCGTCCTC) were quantified using the Luna Universal qPCR Master Mix (New England Biolabs) according to the manufacturer’s protocol. Levels of ACE2 and TMPRSS2 were normalized to HPRT. Hela cells were used as the reference sample. All qPCRs were run on a QuantStudio 3 Real-Time PCR System (Applied Biosystems).
  • Prefusion-stabilized SARS2 D614G spike (comprising amino acid sequence Q14 to K1211) with a C-terminal TEV cleavage site, T4 bacteriophage fibritin foldon, 8x His-, Avi- and EPEA-tag was transfected into HEK293 Freestyle cells, using 293fectin as a transfection reagent. Cells were left to produce protein for three days at 37°C. Afterwards, supernatant was harvested by centrifuging cells for 30 minutes at 500 xg, followed by another spin for 30 minutes at 4000 xg.
  • SARS2 D614G spike was eluted, using 10 column volumes of 100 mM Tris, 200 mM NaCl and 3.8 mM SEPEA peptide. Elution peak was concentrated and injected on a Superose 6 increase 10/300 GL gel filtration column, using 50 mM Tris pH 8 and 200 mM NaCl as a running buffer. SEC fractions corresponding to monodisperse SARS2 D614G spike were collected and flash frozen in liquid nitrogen for storage at -80°C.
  • Purified SARS2 D614G spike protein was biotinylated using BirA500 biotinylation kit from Avidity. To 50 ug of spike protein, 5 ug of BirA, and 11 uL of BiomixA and BiomixB was added. Final spike protein concentration during the biotinylation reaction was ⁇ 1 uM. The reaction was left to proceed for 16 hours at 4°C. Then, protein was desalted using two Zeba spin columns pre-equilibrated with lx PBS pH 7.4.
  • HEK 293T cells expressing DC-SIGN, L-SIGN, SIGLEC1 or ACE2 were resuspended at 4xl0 6 cells/mL and 100 pL per well were seeded onto V-bottom 96-well plates (Corning, 3894). The plate was centrifuged at 2,000 rpm for 5 minutes and washed with PBS (pH 7.4). The cells were resuspended in 200 pL of PBS containing ghost violet 510 viability dye (Cell Signaling, cat. 13-0870-T100, 1 : 1,000 dilution), incubated for 15 minutes on ice and then washed.
  • PBS PBS containing ghost violet 510 viability dye
  • the cells were resuspended in 100 pL of FACS buffer prepared with 0.5% BSA (Sigma-Aldrich) in PBS containing the primary antibodies at a 1 : 100 dilution: mouse anti-DC/L-SIGN (Biolegend, cat. 845002), rabbit anti-DC-SIGN (Cell Signaling, cat. 13193), mouse anti-SIGLECl (Biologend, cat. 346002) or goat anti-ACE2 (R&D Systems, cat. AF933).
  • mouse anti-DC/L-SIGN Biolegend, cat. 845002
  • rabbit anti-DC-SIGN Cell Signaling, cat. 13193
  • mouse anti-SIGLECl Biologend, cat. 346002
  • goat anti-ACE2 R&D Systems, cat. AF933
  • the cells were washed two times and resuspended in FACS buffer containing the Alexa Fluor-488-labeled secondary antibodies at a 1 :200 dilution: goat anti-mouse (Invitrogen cat. Al 1001), goat anti-rabbit (Invitrogen cat. Al 1008) or donkey anti-goat (Invitrogen cat. Al 1055).
  • FACS buffer containing the Alexa Fluor-488-labeled secondary antibodies at a 1 :200 dilution: goat anti-mouse (Invitrogen cat. Al 1001), goat anti-rabbit (Invitrogen cat. Al 1008) or donkey anti-goat (Invitrogen cat. Al 1055).
  • the cells were washed three times with 200pL of FACS buffer and fixed with 200pL of 4% PF A (Alfa Aesar) for 15 mins at room temperature. Cells were washed three times, resuspended in 200pL of FACS buffer and analyzed by flow
  • Biotinylated SARS-CoV-2 Spike D614G protein (Spikebiotin, in-house generated) or the biotinylated SARS-CoV-2 Spike receptor-binding domain (RBDbiotin, Sino Biological, 40592-V08B) were incubated with Alexa Fluor® 647 streptavidin (AF647-strep, Invitrogen, S21374) at a 1 :20 ratio by volume for 20 min at room temperature. The labeled proteins were then stored at 4°C until further use. Cells were dissociated with TrpLE Express (Gibco, 12605-010) and 10 5 cells were transferred to each well of a 96-well V bottom plate (Coming, 3894).
  • Human mAbs were isolated from plasma cells or memory B cells of SARS- CoV-2 immune donors, as previously described. Recombinant antibodies were expressed in ExpiCHO cells at 37°C and 8% CO2. Cells were transfected using ExpiFectamine. Transfected cells were supplemented 1 day after transfection with ExpiCHO Feed and ExpiFectamine CHO Enhancer. Cell culture supernatant was collected eight days after transfection and filtered through a 0.2 pm filter.
  • Recombinant antibodies were affinity purified on an AKTA xpress FPLC device using 5 mL HiTrapTM MabSelectTM PrismA columns followed by buffer exchange to Histidine buffer (20 mM Histidine, 8% sucrose, pH 6) using HiPrep 26/10 desalting columns
  • the SARS-CoV-2 strain used in this study BetaCov/Belgium/GHB-03021/2020 (EPI ISL 109 407976
  • a close relation with the prototypic Wuhan-Hu-1 2019-nCoV (GenBank accession 112 number MN908947.3) strain was confirmed by phylogenetic analysis. Infectious virus was isolated by serial passaging on HuH7 and Vero E6 cells; passage 6 virus was used for the study described here. The titer of the virus stock was determined by end-point dilution on Vero E6 cells by the Reed and Muench method.
  • Vero E6 cells African green monkey kidney, ATCC CRL-1586 were cultured in minimal essential medium (Gibco) supplemented with 10% fetal bovine serum (Integro), 1% L- glutamine (Gibco) and 1% bicarbonate (Gibco). End-point titrations were performed with medium containing 2% fetal bovine serum instead of 10%.
  • Animals were prophylactically treated 48h before infection by intraperitoneal administration (i.p.) and monitored for appearance, behavior, and weight.
  • hamsters were euthanized by i.p. injection of 500 pL Dolethal (200 mg/mL sodium pentobarbital, Vetoquinol SA).
  • Lungs were collected and viral RNA and infectious virus were quantified by RT-qPCR and end-point virus titration, respectively. Blood samples were collected before infection for PK analysis.
  • RT-qPCR was performed on a LightCycler96 platform (Roche) using the iTaq Universal Probes One- Step RT-qPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid.
  • Standards of SARS-CoV-2 cDNA (IDT) were used to express viral genome copies per mg tissue or per mL serum.
  • End-point virus titrations Lung tissues were homogenized using bead disruption (Precellys) in 350 pL minimal essential medium and centrifuged (10,000 rpm, 5min, 4°C) to pellet the cell debris. To quantify infectious SARS-CoV-2 particles, endpoint titrations were performed on confluent Vero E6 cells in 96- well plates. Viral titers were calculated by the Reed and Muench method using the Lindenbach calculator and were expressed as 50% tissue culture infectious dose (TCID50) per mg tissue.
  • TCID50 tissue culture infectious dose
  • the scored parameters were the following: congestion, intra-alveolar hemorrhagic, apoptotic bodies in bronchus wall, necrotizing bronchiolitis, perivascular edema, bronchopneumonia, perivascular inflammation, peribronchial inflammation and vasculitis.
  • Immunocomplexes were generated by complexing S309 mAb (hamster IgG, either wt or N297A) with a biotinylated anti-idiotype fab fragment and Alexa-488- streptavidin, using a precise molar ratio (4:8:1, respectively). Pre-generated fluorescent IC were serially diluted incubated at 4°C for 3 hrs with freshly revitalized hamster splenocytes, obtained from a naive animal. Cellular binding was then evaluated by cytometry upon exclusion of dead cells and physical gating on monocyte population. Results are expressed as Alexa-488 mean florescent intensity of the entire monocyte population.
  • HLCA Human Lung Cell Atlas
  • Github github.com/krasnowlab/HLCA
  • Processed single-cell transcriptome data and annotation of lung epithelial and immune cells from SARS- CoV-2 infected individuals were downloaded from NCBI GEO database (ID: GSE158055) and Github (github.com/zhangzlab/covid_balf).
  • Available sequence data from the second single-cell transcriptomics study by Liao et al. were downloaded from NCBI SRA (ID: PRJNA608742) for inspection of reads corresponding to viral RNA.
  • the proportion of sgRNA relative to genomic RNA was estimated by counting TRS- containing reads supporting a leader-TRS junction.
  • leader- TRS junction reads were adapted from Alexandersen et al. The viral genome reference and TRS annotation was based on Wuhan-Hu-1 NC_045512.2/MN908947. Only 2 samples from individuals with severe COVID-19 had detectable leader-TRS junction reads (SRR11181958, SRR11181959).
  • S309 antibody VH of SEQ ID NO.:442, VL of SEQ ID NO.:446 was expressed as recombinant IgGl with M428L and N434S Fc mutations.
  • antibody S2X333 VH of SEQ ID NO.:52, VL of SEQ ID NO.:56
  • S2E12 VH of SEQ ID NO.:450, VL of SEQ ID NO.:454 (also expressed as rlgGl) were tested.
  • S2M11 VH of SEQ ID NO.:458, VL of SEQ ID NO.:462
  • S2D106 S2X58
  • S2X58 Starr et al., Nature 597:97-102 (2021), which antibodies are incorporated herein by reference).
  • Vero E6 or Vero E6-TMPRSS2 cells were infected with SARS-CoV- 2 (isolate USA-WA1/2020) at MOI 0.01 in the presence of S309 (10 pg/ml). Cells were fixed 24h post infection, viral nucleocapsid protein was immunostained and quantified. Nucleocapsid staining was effectively absent in antibody-treated cells. S309 had an IC50 (ng/mL) in Vero E6 cells of 65 and in Vero E6-TMPRSS2 of 91 (data not shown).
  • a panel of 7 cell lines (HeLa, 293T (wt), Vero E6, Huh7, 293T ACE2, MRC 5- ACE2-TMPRSS2, A549-ACE2-TMPRSS2 clone 5, A549-ACE2-TMPRSS2 clone 10) were infected with SARS-CoV-2-Nluc or VSV pseudotyped with the SARS-CoV-2 spike protein in the presence of S309. Luciferase signal was quantified 24h post infection. S309 maximum neutralization values were as shown in Table 8. Table 8. Maximum Neutralization Values of S309
  • the seven cell lines described above were incubated with purified, fluorescently-labeled SARS-CoV-2 spike protein or RBD protein and protein binding was quantified by flow cytometry.
  • the cell lines were: A549-ACE2-TMPRSS2 clone 10; 293T ACE2; MRC 5-ACE2-TMPRSS2; A549-ACE2-TMPRSS2 clone 5; Vero E6; Huh7;
  • ACE2 Selected lectins and published receptor candidates were screened using HEK293T cells infected with SARS-CoV-2 VSV pseudoviruses.
  • ACE2 DC-SIGN, L- SIGN, and SIGLEC-1 gave the highest signals.
  • ACE2 provided a signal of approximately 10 5 relative luminescence units (RLUs), and DC-SIGN, SIGLEC-1, and L-SIGN had signals of approximately 10 4 RLUs. All other lectins/candidates tested gave signals of approximately 10 2 - 10 3 RLUs.
  • HEK 293T, HeLa and MRC5 cells were transiently transduced to overexpress DC-SIGN, L-SIGN, SIGLEC1 or ACE2 and infected with SARS-CoV-2 VSV pseudoviruses. Uninfected cells and untransduced cells were included as controls.
  • ACE2 In HEK293T cells, ACE2, DC-SIGN, SIGLEC-1, and L-SIGN all provided substantial increases in infection.
  • ACE2 In HeLa and MRC5 cells, only ACE2 increased infection.
  • Stable HEK293T cell lines overexpressing DC-SIGN, L-SIGN, SIGLEC-1 or ACE2 were infected with authentic SARS-CoV-2 (MOI 0.1), fixed and immunostained at 24 hours for the SARS-CoV-2 nucleoprotein. Wild-type cells (infected and uninfected) were used as controls. Increased staining was observed in cells overexpressing DC-SIGN, L-SIGN, or SIGLEC-1, and staining was significantly increased in cells overexpressing ACE2.
  • Stable cell lines were infected with SARS-CoV-2-Nluc and luciferase levels were quantified at 24 hours.
  • RLUs uninfected (approx. 10 2 - 10 3 RLUs); parental 293T (approx. 10 4 RLUs); DC-SIGN (approx. 10 5 RLUs); L-SIGN (approx. 10 5 RLUS); SIGLEC-1 (approx. 10 5 -10 6 RLUs); ACE2 (>10 7 RLUs).
  • Stable cell lines were incubated with different concentration of anti-SIGLECl mAb (clone 7-239) and infected with SARS-CoV-2-Nluc. Infection as a percentage of untreated cells remained near to exceeded 100% in 293T cells expressing DC-SIGN, L- SIGN, or ACE2, but dropped to below 50% (0.2 pg/mL anti-SIGLEC) to close to 0 (1 pg/mL or 5 pg/mL anti-SIGLEC) in 293T cells expressing SIGLEC-1.
  • Single cell expression levels of selected potential SARS-CoV-2 (co)receptor candidates were determined in different lung cell types derived from the Human Lung Cell Atlas (nature.com/articles/s41586-020-2922-4).
  • DC-SIGN, L-SIGN and SIGLEC- 1 are expressed in a variety of cell types in the lung at levels similar to or even higher than ACE2.
  • Binding of antibodies targeting DC-/L-SIGN, DC-SIGN, SIGLEC1 or ACE2 on HEK293T cells stably over-expressing the respective attachment receptor was analyzed by flow cytometry and immunofluorescence analysis.
  • HEK 293T cells over-expressing the respective attachment receptors were infected with VSV pseudotyped with SARS- COV-2 wildtype spike or spike bearing mutations of the B 1.1.7 lineage. Luminescence was analyzed one day post infection. Infection was increased in cells expressing the attachment receptors. Infection by VSV pseudotyped with either spike was similar for each test group. Cells expressing ACE2 gave the highest luminescence signal.
  • Vero E6 cells in vitro differentiated moDCs or PBMCs were infected with SARS-CoV-2 at MOI 0.01. At 24h post infection, cells were fixed, immunostained for viral nucleocapsid protein and infected cells were quantified. Only VeroE6 cells showed infection (approximately 7% of cells). Supernatant of the infected cells was taken at 24, 48 and 72h and infectious viral titer was quantified by FFU assay on Vero E6 cells.
  • ACE2 DC-SIGN (CD209), L-SIGN (CLEC4M), SIGLEC1 transcript counts were correlated with SARS-CoV-2 RNA counts in macrophages and in secretory cells. Correlation was based on counts (before log transformation), from Ren et al. Cell 2021.
  • FIG. 40 Representative data showing expression of receptors in stable HEK293T cell lines are shown in Figure 40.
  • Cell lines were generated to overexpress DC-SIGN, L- SIGN or ACE2 by transducing HEK293T cells with lenti virus encoding the transgene, and immunofluorescence assays were performed to assess transgene expression.
  • FIG. 41 Representative data showing the ability of VSV pseudovirus expressing SARS- CoV-2 S protein with luciferase reporter to infect the HEK293T cells (using a luminescence assay) are shown in Figure 41; expression of DC-SIGN or L-SIGN increased pseudovirus infection levels by over 10-fold compared to infection of WT HEK293T cells, and expression of ACE2 increased pseudovirus infection levels by over 100-fold compared to infection of WT HEK293T cells.
  • Neutralizing activity of mAb S309 against the VSV pseudovirus was assessed in the engineered HEK293T cells. S309 fully neutralized infection via DC-SIGN and L- SIGN, and to a lesser extent, ACE2.
  • Neutralizing activity of mAb S309 against the VSV pseudovirus was assessed in the engineered HEK293T cells. S309 fully neutralized infection via DC-SIGN and L- SIGN, and neutralized infection via ACE2 to a lesser extent.
  • 293T cells, HeLa cells, and MRC5 cells were transiently transduced with lentivirus encoding DC-SIGN, L-SIGN, SIGLEC-1 or ACE2 and infected with VSV pseudovirus three days after transduction. While the 293T cells showed a low level of susceptibility (compare uninfected with untransduced), HeLa and MRC5 cells were completely refractory to the virus. The low level of infection in 293T cells can be increased by expression of L-SIGN, DC-SIGN, or SIGLEC-1, consistent with a role for these proteins as as attachment factors.
  • the HeLa and MRC5 cells remained refractory to infection even after expression of L- SIGN, DC-SIGN, or SIGLEC-1, and only become susceptible after expression of ACE2. These data indicate that L-SIGN, DC-SIGN, and SIGLEC-1 are not primary receptors for SARS-CoV-2.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pulmonology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Communicable Diseases (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne des anticorps et des fragments de liaison à l'antigène de ceux-ci qui peuvent se lier à un antigène du SARS-CoV-2 et, dans certains modes de réalisation, peuvent neutraliser une infection par le SARS-CoV-2. Dans certains modes de réalisation, un anticorps ou un fragment de liaison à l'antigène est capable de se lier à une protéine de spicule du SARS-CoV-2 dans le domaine N-terminal (NTD). L'invention concerne également des polynucléotides qui codent pour un anticorps ou un fragment de liaison à l'antigène, des vecteurs qui comprennent un polynucléotide, des cellules hôtes qui expriment un anticorps ou un fragment de liaison à l'antigène, des compositions pharmaceutiques et des méthodes de traitement ou de diagnostic d'une infection par le SARS-CoV-2.
PCT/US2021/052481 2020-09-28 2021-09-28 Anticorps contre le sars-cov-2 WO2022067269A2 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP21806447.5A EP4217385A2 (fr) 2020-09-28 2021-09-28 Anticorps contre le sars-cov-2
BR112023005684A BR112023005684A2 (pt) 2020-09-28 2021-09-28 Anticorpos contra sars-cov-2
CA3194162A CA3194162A1 (fr) 2020-09-28 2021-09-28 Anticorps contre le sars-cov-2
JP2023544186A JP2023545322A (ja) 2020-09-28 2021-09-28 Ｓａｒｓ－ｃｏｖ－２に対する抗体

Applications Claiming Priority (12)

Application Number Priority Date Filing Date Title
US202063084501P 2020-09-28 2020-09-28
US63/084,501 2020-09-28
US202063111435P 2020-11-09 2020-11-09
US63/111,435 2020-11-09
US202063112505P 2020-11-11 2020-11-11
US63/112,505 2020-11-11
US202063119545P 2020-11-30 2020-11-30
US63/119,545 2020-11-30
US202163137112P 2021-01-13 2021-01-13
US63/137,112 2021-01-13
US202163170356P 2021-04-02 2021-04-02
US63/170,356 2021-04-02

Publications (2)

Publication Number Publication Date
WO2022067269A2 true WO2022067269A2 (fr) 2022-03-31
WO2022067269A3 WO2022067269A3 (fr) 2022-06-23

Family

ID=78599130

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2021/052481 WO2022067269A2 (fr) 2020-09-28 2021-09-28 Anticorps contre le sars-cov-2

Country Status (5)

Country Link
EP (1) EP4217385A2 (fr)
JP (1) JP2023545322A (fr)
BR (1) BR112023005684A2 (fr)
CA (1) CA3194162A1 (fr)
WO (1) WO2022067269A2 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114805564A (zh) * 2022-06-10 2022-07-29 郑州大学 特异性识别SARS-CoV-2 S蛋白NTD区域的单克隆抗体及应用
WO2023201256A1 (fr) * 2022-04-12 2023-10-19 Vir Biotechnology, Inc. Thérapies par anticorps à haute dose contre une infection par le sars-cov-2
WO2024036313A3 (fr) * 2022-08-12 2024-04-18 The Rockefeller University Anticorps anti-sars-cov-2 et procédés d'utilisation associés

Citations (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4751180A (en) 1985-03-28 1988-06-14 Chiron Corporation Expression using fused genes providing for protein product
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4935233A (en) 1985-12-02 1990-06-19 G. D. Searle And Company Covalently linked polypeptide cell modulators
US5283173A (en) 1990-01-24 1994-02-01 The Research Foundation Of State University Of New York System to detect protein-protein interactions
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5648237A (en) 1991-09-19 1997-07-15 Genentech, Inc. Expression of functional antibody fragments
US5770429A (en) 1990-08-29 1998-06-23 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5789199A (en) 1994-11-03 1998-08-04 Genentech, Inc. Process for bacterial production of polypeptides
US5840523A (en) 1995-03-01 1998-11-24 Genetech, Inc. Methods and compositions for secretion of heterologous polypeptides
US5959177A (en) 1989-10-27 1999-09-28 The Scripps Research Institute Transgenic plants expressing assembled secretory antibodies
US6040498A (en) 1998-08-11 2000-03-21 North Caroline State University Genetically engineered duckweed
US6420548B1 (en) 1999-10-04 2002-07-16 Medicago Inc. Method for regulating transcription of foreign genes
US6596541B2 (en) 2000-10-31 2003-07-22 Regeneron Pharmaceuticals, Inc. Methods of modifying eukaryotic cells
WO2004076677A2 (fr) 2003-02-26 2004-09-10 Institute For Research In Biomedicine Production d'anticorps monoclonaux par transformation de lymphocytes b par le virus d'epstein barr
US7049426B2 (en) 1999-06-10 2006-05-23 Abgenix, Inc. Transgenic animals for producing specific isotypes of human antibodies via non-cognate switch regions
US7125978B1 (en) 1999-10-04 2006-10-24 Medicago Inc. Promoter for regulating expression of foreign genes
US7498415B2 (en) 2003-09-24 2009-03-03 Kyowa Hakko Kogyo Co., Ltd. Recombinant antibody against human insulin-like growth factor
US8119772B2 (en) 2006-09-29 2012-02-21 California Institute Of Technology MART-1 T cell receptors
US8258268B2 (en) 2005-08-19 2012-09-04 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
WO2015103072A1 (fr) 2013-12-30 2015-07-09 Epimab Biotherapeutics Fabs d'immunoglobuline en tandem et leurs utilisations
WO2016181357A1 (fr) 2015-05-13 2016-11-17 Zumutor Biologics, Inc. Protéine afucosylée, cellule exprimant ladite protéine et procédés associés
WO2019025391A1 (fr) 2017-07-31 2019-02-07 Institute For Research In Biomedicine Anticorps ayant des domaines fonctionnels dans la région de coude entre un domaine variable et un domaine constant
WO2019057122A1 (fr) 2017-09-22 2019-03-28 Wuxi Biologics (Shanghai) Co., Ltd. Nouveaux complexes polypeptidiques bispécifiques

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111303280B (zh) * 2020-03-22 2022-01-07 中国人民解放军军事科学院军事医学研究院 高中和活性抗SARS-CoV-2全人源单克隆抗体及应用

Patent Citations (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4816567A (en) 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4751180A (en) 1985-03-28 1988-06-14 Chiron Corporation Expression using fused genes providing for protein product
US4935233A (en) 1985-12-02 1990-06-19 G. D. Searle And Company Covalently linked polypeptide cell modulators
US5530101A (en) 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5959177A (en) 1989-10-27 1999-09-28 The Scripps Research Institute Transgenic plants expressing assembled secretory antibodies
US6417429B1 (en) 1989-10-27 2002-07-09 The Scripps Research Institute Transgenic plants expressing assembled secretory antibodies
US5283173A (en) 1990-01-24 1994-02-01 The Research Foundation Of State University Of New York System to detect protein-protein interactions
US5468614A (en) 1990-01-24 1995-11-21 The Research Foundation Of State University Of New York System to detect protein-protein interactions
US5770429A (en) 1990-08-29 1998-06-23 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5648237A (en) 1991-09-19 1997-07-15 Genentech, Inc. Expression of functional antibody fragments
US5789199A (en) 1994-11-03 1998-08-04 Genentech, Inc. Process for bacterial production of polypeptides
US5840523A (en) 1995-03-01 1998-11-24 Genetech, Inc. Methods and compositions for secretion of heterologous polypeptides
US6040498A (en) 1998-08-11 2000-03-21 North Caroline State University Genetically engineered duckweed
US7049426B2 (en) 1999-06-10 2006-05-23 Abgenix, Inc. Transgenic animals for producing specific isotypes of human antibodies via non-cognate switch regions
US6420548B1 (en) 1999-10-04 2002-07-16 Medicago Inc. Method for regulating transcription of foreign genes
US7125978B1 (en) 1999-10-04 2006-10-24 Medicago Inc. Promoter for regulating expression of foreign genes
US6596541B2 (en) 2000-10-31 2003-07-22 Regeneron Pharmaceuticals, Inc. Methods of modifying eukaryotic cells
WO2004076677A2 (fr) 2003-02-26 2004-09-10 Institute For Research In Biomedicine Production d'anticorps monoclonaux par transformation de lymphocytes b par le virus d'epstein barr
US7498415B2 (en) 2003-09-24 2009-03-03 Kyowa Hakko Kogyo Co., Ltd. Recombinant antibody against human insulin-like growth factor
US8258268B2 (en) 2005-08-19 2012-09-04 Abbott Laboratories Dual variable domain immunoglobulin and uses thereof
US8119772B2 (en) 2006-09-29 2012-02-21 California Institute Of Technology MART-1 T cell receptors
WO2015103072A1 (fr) 2013-12-30 2015-07-09 Epimab Biotherapeutics Fabs d'immunoglobuline en tandem et leurs utilisations
WO2016181357A1 (fr) 2015-05-13 2016-11-17 Zumutor Biologics, Inc. Protéine afucosylée, cellule exprimant ladite protéine et procédés associés
WO2019025391A1 (fr) 2017-07-31 2019-02-07 Institute For Research In Biomedicine Anticorps ayant des domaines fonctionnels dans la région de coude entre un domaine variable et un domaine constant
WO2019024979A1 (fr) 2017-07-31 2019-02-07 Institute For Research In Biomedicine Anticorps à domaines fonctionnels dans la région de coude
WO2019057122A1 (fr) 2017-09-22 2019-03-28 Wuxi Biologics (Shanghai) Co., Ltd. Nouveaux complexes polypeptidiques bispécifiques

Non-Patent Citations (164)

* Cited by examiner, † Cited by third party
Title
"GenBank", Database accession no. QHD43416.1
"NCBI", Database accession no. PRJNA608742
"Remington: The Science and Practice of Pharmacy", 2000, PHILADELPHIA COLLEGE OF PHARMACY AND SCIENCE
"The Development of Human Gene Therapy", COLD SPRING HARBOR LAB, article "Emerging Viral Vectors", pages: 209 - 40
AHMED ET AL., J. STRUC. BIOL., vol. 194, no. 1, 2016, pages 78
ALMAGRO ARMENTEROS, J.J.TSIRIGOS, K.D.SONDERBY, C.K.PETERSEN, T.N.WINTHER, O.BRUNAK, S.VON HEIJNE, G.NIELSEN, H.: "SignalP 5.0 improves signal peptide predictions using deep neural networks", NAT BIOTECHNOL, vol. 37, 2019, pages 420 - 423, XP036900634, DOI: 10.1038/s41587-019-0036-z
ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402
ANDREANO, E., PICCINI, G., LICASTRO, D., CASALINO, L., JOHNSON, N.V., PACIELLO, I.,MONEGO, S.D., PANTANO, E., MANGANARO, N., MANEN: "SARS-CoV-2 escape in vitro from a highly neutralizing COVID-19 convalescent plasma", BIORXIV
ARMOUR, K. L. ET AL., EUR. J. IMMUNOL., vol. 29, 1999, pages 2613 - 2624
AVANZATO, V.A.MATSON, M.J.SEIFERT, S.N.PRYCE, R.WILLIAMSON, B.N.ANZICK, S.L.BARBIAN, K.JUDSON, S.D.FISCHER, E.R.MARTENS, C. ET AL.: "Case Study: Prolonged infectious SARS-CoV-2 shedding from an asymptomatic immunocompromised cancer patient", CELL, 2020
BARNES, C.O., JETTE, C.A., ABERNATHY, M.E., DAM, K.-M.A., ESSWEIN, S.R.,GRISTICK, H.B., MALYUTIN, A.G., SHARAF, N.G., HUEY-TUBMAN,: "Structural classification of neutralizing antibodies against the SARS-CoV-2 spike receptor-binding domain suggests vaccine and therapeutic strategies", BIORXIV, 2020
BARNES, C.O., WEST, A.P., HUEY-TUBMAN, K.E., HOFFMANN, M.A.G., SHARAF N.G., HOFFMAN, P.R., KORANDA, N., GRISTICK, H.B., GAEBLER, C: "Structures of Human Antibodies Bound to SARS-CoV-2 Spike Reveal Common Epitopes and Recurrent Features of Antibodies", CELL, 2020
BAUM, A.AJITHDOSS, D.COPIN, RZHOU, A.LANZA, K.NEGRON, N.NI, M.WEI, Y.MOHAMMADI, K.MUSSER, B. ET AL.: "REGN-COV2 antibodies prevent and treat SARS-CoV-2 infection in rhesus macaques and hamsters", SCIENCE, 2020
BAUM, A.FULTON, B.O.WLOGA, E.COPIN, R.PASCAL, K.E.RUSSO, V.GIORDANO, S.LANZA, K.NEGRON, N.NI, M. ET AL.: "Antibody cocktail to SARS-CoV-2 spike protein prevents rapid mutational escape seen with individual antibodies", SCIENCE, 2020
BIOINFORMATICS, vol. 15, 2016, pages 298 - 300
BOUDEWIJNS, R.THIBAUT, H.J.KAPTEIN, S.J.F.LI, R.VERGOTE, V.SELDESLACHTS, L.VAN WEYENBERGH, J.DE KEYZER, C.BERVOETS, L.SHARMA, S. E: "STAT2 signaling restricts viral dissemination but drives severe pneumonia in SARS-CoV-2 infected hamsters", NAT COMMUN, vol. 11, 2020, pages 5838
BOURNAZOS, S.CORTI, D.VIRGIN, H.W.RAVETCH, J.V.: "Fc-optimized antibodies elicit CD8 immunity to viral respiratory infection", NATURE, vol. 588, 2020, pages 485 - 490, XP037317195, DOI: 10.1038/s41586-020-2838-z
BOURNAZOS, S.WANG, T.T.RAVETCH, J.V.: "The Role and Function of Fey Receptors on Myeloid Cells", MICROBIOL SPECTR, vol. 4, 2016
BRINKMANNKONTERMANN, MABS, vol. 9, no. 2, 2017, pages 182 - 212
BROUWER, P.J.M.CANIELS, T.G.VAN DER STRATEN, K.SNITSELAAR, J.L.ALDON, Y.BANGARU, S.TORRES, J.L.OKBA, N.M.A.CLAIREAUX, M.KERSTER, G: "Potent neutralizing antibodies from COVID-19 patients define multiple targets of vulnerability", SCIENCE, 2020
BRUHNS ET AL., BLOOD, vol. 113, 2009, pages 3716 - 3725
BURTON, D. R., MOL. IMMUNOL., vol. 22, 1985, pages 161 - 206
CANTUTI-CASTELVETRI, L.OJHA, R.PEDRO, L.D.DJANNATIAN, M.FRANZ, J.KUIVANEN, S.VAN DER MEER, F.KALLIO, K.KAYA, T.ANASTASINA, M. ET A: "Neuropilin-1 facilitates SARS-CoV-2 cell entry and infectivity", SCIENCE, vol. 370, 2020, pages 856 - 860
CAPEL, P. ET AL., IMMUNOMETHODS, vol. 113, 1994, pages 269 - 315
CASE, J.B.ROTHLAUF, P.W.CHEN, R.E.LIU, Z.ZHAO, H.KIM, A.S.BLOYET, L.M.ZENG, Q.TAHAN, S.DROIT, L. ET AL.: "Neutralizing Antibody and Soluble ACE2 Inhibition of a Replication-Competent VSV-SARS-CoV-2 and a Clinical Isolate of SARS-CoV-2", CELL HOST MICROBE, vol. 28, 2020, pages 475 - 485
CHAUDHARY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 1066 - 1070
CHEN, Y.LU, S.JIA, H.DENG, Y.ZHOU, J.HUANG, B.YU, Y.LAN, J.WANG, W.LOU, Y. ET AL.: "A novel neutralizing monoclonal antibody targeting the N-terminal domain of the MERS-CoV spike protein", EMERG MICROBES INFECT, vol. 6, 2017, pages e37
CHI, X.YAN, R.ZHANG, J.ZHANG, G.ZHANG, Y.HAO, M.ZHANG, Z.FAN, P.DONG, Y.YANG, Y. ET AL.: "A neutralizing human antibody binds to the N-terminal domain of the Spike protein of SARS-CoV-2", SCIENCE, vol. 369, 2020, pages 650 - 655, XP055850542, DOI: 10.1126/science.abc6952
CHIODO, F., BRUIJNS, S.C.M., RODRIGUEZ, E., LI, R.J.E., MOLINARO, A., SILIPO, A DI LORENZO, F., GARCIA-RIVERA, D., VALDES-BALBIN, : "Novel ACE2-Independent Carbohydrate-Binding of SARS-CoV-2 Spike Protein to Host Lectins and Lung Microbiota", BIORXIV, 2020
CHOI, B.CHOUDHARY, M.C.REGAN, J.SPARKS, J.A.PADERA, R.F.QIU, X.SOLOMON, I.H.KUO, H.H.BOUCAU, J.BOWMAN, K ET AL.: "Persistence and Evolution of SARS-CoV-2 in an Immunocompromised Host", N ENGL J MED, 2020
CHOTHIALESK, J. MOL. BIOL., vol. 196, 1987, pages 901 - 917
CHU, S. ET AL.: "Am J Respir Crit", 2014, AMERICAN THORACIC SOCIETY INTERNATIONAL CONFERENCE ABSTRACTS, article "Accelerated Clearance of IgE In Chimpanzees Is Mediated By Xmab7195, An Fc-Engineered Antibody With Enhanced Affinity For Inhibitory Receptor FcyRIIb"
CHU, S. Y. ET AL.: "Inhibition of B cell receptor-mediated activation of primary human B cells by coengagement of CD19 and FcgammaRIIb with Fc-engineered antibodies", MOLECULAR IMMUNOLOGY, vol. 45, 2008, pages 3926 - 3933, XP002498116, DOI: 10.1016/j.molimm.2008.06.027
CHU, S. Y.: "Inhibition of B cell receptor-mediated activation of primary human B cells by coengagement of CD19 and FcgammaRIIb with Fc-engineered antibodies ", IMMUNOLOGY, vol. 45, pages 3926 - 3933, XP002498116, DOI: 10.1016/j.molimm.2008.06.027
CLACKSON ET AL., NATURE, vol. 352, 1991, pages 624 - 628
CLAUSEN, T.M.SANDOVAL, D.R.SPLIID, C.B.PIHL, J.PERRETT, H.R.PAINTER, C.D.NARAYANAN, A.MAJOWICZ, S.A.KWONG, E.M.MCVICAR, R.N. ET AL: "SARS-CoV-2 Infection Depends on Cellular Heparan Sulfate and ACE2", CELL, vol. 183, 2020, pages 1043 - 1057
COFFIN, J. M. ET AL.: "Fundamental Virology", 1996, LIPPINCOTT-RAVEN PUBLISHERS, article "Retroviridae: The viruses and their replication"
CORBETT, K.S., EDWARDS, D.K., LEIST, S.R., ABIONA, O.M., BOYOGLU-BARNUM, S GILLESPIE, R.A., HIMANSU, S., SCHAFER, A., ZIWAWO, C.T.: "SARS-CoV-2 mRNA vaccine design enabled by prototype pathogen preparedness", NATURE, vol. 586, 2020, pages 567 - 571, XP037277114, DOI: 10.1038/s41586-020-2622-0
CORBETT, K.S.FLYNN, B.FOULDS, K.E.FRANCICA, J.R.BOYOGLU-BARNUM, S.WERNER, A.P.FLACH, B.O'CONNELL, S.BOCK, K.W.MINAI, M. ET AL.: "Evaluation of the mRNA-1273 Vaccine against SARS-CoV-2 in Nonhuman Primates", N ENGL J MED, vol. 383, 2020, pages 1544 - 1555
DALY, J.L.SIMONETTI, B.KLEIN, K.CHEN, K.E.WILLIAMSON, M.K.ANTON-PLAGARO, C.SHOEMARK, D.K.SIMON-GRACIA, L.BAUER, M.HOLLANDI, R. ET : "Neuropilin-1 is a host factor for SARS-CoV-2 infection", SCIENCE, vol. 370, 2020, pages 861 - 865
DAVIES, N.G.BARNARD, R.C.JARVIS, C.I.KUCHARSKI, A.J.MUNDAY, J.PEARSON, C.A.B.RUSSELL, T.W.TULLY, D.C.ABBOTT, S.GIMMA, A. ET AL.: "Estimated transmissibility and severity of novel SARS-CoV-2 Variant of Concern 202012/01 in England", MEDRXIV, 2020
DE HAAS, M. ET AL., J LAB. CLIN. MED., vol. 126, 1995, pages 330 - 341
DELILLORAVETCH, CELL, vol. 161, no. 5, 2015, pages 1035 - 1045
DUNCAN, A. R.WINTER, G., NATURE, vol. 332, 1988, pages 323 - 327
ELLIOTT ET AL., NPJ VACCINES, vol. 18, 2017
ENGELS ET AL., HUM. GENE THER., vol. 14, 2003, pages 1155
ERASMUS, J.H.KHANDHAR, A.P.O'CONNOR, M.A.WALLS, A.C.HEMANN, E.A.MURAPA, P.ARCHER, J.LEVENTHAL, S.FULLER, J.T.LEWIS, T.B. ET AL.: "An Alphavirus-derived replicon RNA vaccine induces SARS-CoV-2 neutralizing antibody and T cell responses in mice and nonhuman primate", SCI TRANSL MED, vol. 12, 2020, XP055743966, DOI: 10.1126/scitranslmed.abc9396
FLINGAI ET AL., SCI REP., vol. 5, 2015, pages 12616
FRECHA ET AL., MOL. THER., vol. 18, 2010, pages 1748
GANESAN, L. P. ET AL.: "FcyRIIb on liver sinusoidal endothelium clears small immune complexes", JOURNAL OF IMMUNOLOGY, vol. 189, 2012, pages 4981 - 4988, XP002724347, DOI: 10.4049/jimmunol.1202017
GAO, C.ZENG, J.JIA, N.STAVENHAGEN, K.MATSUMOTO, Y.ZHANG, H.LI, J.HUME, A.J.MUHLBERGER, E.VAN DIE, I. ET AL.: "SARS-CoV-2 Spike Protein Interacts with Multiple Innate Immune Receptors", BIORXIV, 2020
GERNGROSS, NAT. BIOTECH., vol. 22, 2004, pages 1409 - 1414
GESSNER, J. E. ET AL., ANN. HEMATOL., vol. 76, 1998, pages 231 - 248
GEURTS ET AL., MOL. THER., vol. 8, 2003, pages 108
GREANEY, A.J.STARR, T.N.GILCHUK, P.ZOST, S.J.BINSHTEIN, E.LOES, A.N.HILTON, S.K.HUDDLESTON, J.EGUIA, R.CRAWFORD, K.H.D. ET AL.: "Complete Mapping of Mutations to the SARS-CoV-2 Spike Receptor-Binding Domain that Escape Antibody Recognition", CELL HOST MICROBE, 2020
HANSEN, J.BAUM, A.PASCAL, K.E.RUSSO, V.GIORDANO, S.WLOGA, E.FULTON, B.O.YAN, Y.KOON, K.PATEL, K ET AL.: "Studies in humanized mice and convalescent humans yield a SARS-CoV-2 antibody cocktail", SCIENCE, 2020
HASSAN, A.O.KAFAI, N.M.DMITRIEV, I.P.FOX, J.M.SMITH, B.K.HARVEY, I.B.CHEN, R.E.WINKLER, E.S.WESSEL, A.W.CASE, J.B. ET AL.: "A Single-Dose Intranasal ChAd Vaccine Protects Upper and Lower Respiratory Tracts against SARS-CoV-2", CELL, vol. 183, 2020, pages 169 - 184
HODCROFT, E.B.ZUBER, M.NADEAU, S.CRAWFORD, K.H.D.BLOOM, J.D.VEESLER, D.VAUGHAN, T.G.COMAS, I.CANDELAS, F.G.STADLER, T. ET AL.: "Emergence and spread of a SARS-CoV-2 variant through Europe in the summer of 2020", MEDRXIV, 2020
HOFFMANN, M.KLEINE-WEBER, H.POHLMANN, S: "A Multibasic Cleavage Site in the Spike Protein of SARS-CoV-2 Is Essential for Infection of Human Lung Cells", MOL CELL, vol. 78, 2020, pages 779 - 784
HOFFMANN, M.KLEINE-WEBER, H.SCHROEDER, S.KRUGER, N.HERRLER, T.ERICHSEN, S.SCHIERGENS, T.S.HERRLER, G.WU, N.H.NITSCHE, A. ET AL.: "SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor", CELL, vol. 181, 2020, pages 271 - 280
HOFFMANN, M.MOSBAUER, K.HOFMANN-WINKLER, H.KAUL, A.KLEINE-WEBER, H.KRIIGER, N.GASSEN, N.C.MULLER, M.ADROSTEN, C.POHLMANN, S.: "Chloroquine does not inhibit infection of human lung cells with SARS-CoV-2", NATURE, vol. 585, 2020, pages 588 - 590, XP037253990, DOI: 10.1038/s41586-020-2575-3
HONEGGERPLUCKTHUN, J. MOL. BIO., vol. 309, 2001, pages 657 - 670
HOU, Y.J.CHIBA, S.HALFMANN, P.EHRE, C.KURODA, M.DINNON, K.H.LEIST, S.R.SCHAFER, A.NAKAJIMA, N.TAKAHASHI, K. ET AL.: "SARS-CoV-2 D614G variant exhibits efficient replication ex vivo and transmission in vivo", SCIENCE, vol. 370, 2020, pages 1464 - 1468
HUANG ET AL., MABS, vol. 6, 2018, pages 1 - 12
HUO, J.ZHAO, Y.REN, J.ZHOU, D.DUYVESTEYN, H.M.E.GINN, H.M.CARRIQUE, L.MALINAUSKAS, T.RUZA, R.R.SHAH, P.N.M. ET AL.: "Neutralisation of SARS-CoV-2 by destruction of the prefusion Spike", CELL HOST & MICROBE, 2020
J. LEUKOC. BIOL., vol. 49, 1991, pages 511 - 524
JIAMING, L.YANFENG, Y.YAO, D.YAWEI, H.LINLIN, B.BAOYING, H.JINGHUA, Y.GAO, G.F.CHUAN, Q.WENJIE, T.: "The recombinant N-terminal domain of spike proteins is a potential vaccine against Middle East respiratory syndrome coronavirus (MERS-CoV) infection", VACCINE, vol. 35, 2017, pages 10 - 18, XP029841627, DOI: 10.1016/j.vaccine.2016.11.064
JONES ET AL., NATURE, vol. 321, 1986, pages 522 - 525
JONES, B.E.BROWN-AUGSBURGER, P.L.CORBETT, K.S.WESTENDORF, K.DAVIES, J.CUJEC, T.P.WIETHOFF, C.M.BLACKBOURNE, J.L.HEINZ, B.A.FOSTER,: "LY-CoV555, a rapidly isolated potent neutralizing antibody, provides protection in a non-human primate model of SARS-CoV-2 infection", BIORXIV, 2020
JU, B.ZHANG, Q.GE, X.WANG, R.YU, J.SHAN, S.ZHOU, B.SONG, S.TANG, X.YU, J. ET AL.: "Potent human neutralizing antibodies elicited by SARS-CoV-2 infection", BIORXIV, 2020
KEECH, C.ALBERT, G.CHO, I.ROBERTSON, A.REED, P.NEAL, S.PLESTED, J.S.ZHU, M.CLONEY-CLARK, S.ZHOU, H. ET AL.: "Phase 1-2 Trial of a SARS-CoV-2 Recombinant Spike Protein Nanoparticle Vaccine", N ENGL J MED, 2020
KOHLER ET AL., NATURE, vol. 256, 1975, pages 495
KORBER, B.FISCHER, W.M.GNANAKARAN, S.YOON, H.THEILER, J.ABFALTERER, W.HENGARTNER, NGIORGI, E.E.BHATTACHARYA, T.FOLEY, B. ET AL.: "Tracking Changes in SARS-CoV-2 Spike: Evidence that D614G Increases Infectivity of the COVID-19 Virus", CELL, vol. 182, 2020, pages 812 - 827
KOSE ET AL., SCI. IMMUNOL., vol. 4, 2019
KRISKY ET AL., GENE THER., vol. 5, 1998, pages 1517
LEFRANC: "Dev.Comp. Immunol", COMP. IMMUNOL., vol. 27, 2003, pages 55
LETKO, M.MARZI, A.MUNSTER, V.: "Functional assessment of cell entry and receptor usage for SARS-CoV-2 and other lineage B betacoronaviruses", NATURE MICROBIOLOGY, 2020
LEUNG, K. ET AL.: "Early empirical assessment of the N501Y mutant strains of SARS-CoV-2 in the United Kingdom, October to November 2020", MEDRXIV, 2020
LI ET AL., NAT. BIOTECH., vol. 24, 2006, pages 210 - 215
LI ET AL., WILERY INTERDISCIP REV. NANOMEDNANOBIOTECHNOL., vol. 1l, no. 2, 2019, pages e1530
LI, Q.WU, J.NIE, J.ZHANG, L.HAO, H.LIU, S.ZHAO, CZHANG, Q.LIU, H.NIE, L. ET AL.: "The Impact of Mutations in SARS-CoV-2 Spike on Viral Infectivity and Antigenicity", CELL, vol. 182, 2020, pages 1284 - 1294
LIU ET AL., MABS, vol. 6, no. 5, 2014, pages 1145 - 1154
LIU, L.WANG, P.NAIR, M.S.YU, J.RAPP, M.WANG, Q.LUO, Y.CHAN, J.F.SAHI, V.FIGUEROA, A. ET AL.: "Potent neutralizing antibodies against multiple epitopes on SARS-CoV-2 spike", NATURE, vol. 584, 2020, pages 450 - 456, XP037223585, DOI: 10.1038/s41586-020-2571-7
LIU, Z.VANBLARGAN, L.A.ROTHLAUF, P.W.BLOYET, L.-M.CHEN, R.E.STUMPF, S.ZHAO, H.ERRICO, J.M.THEEL, E.S.ELLEBEDY, A.H. ET AL.: "Landscape analysis of escape variants identifies SARS-CoV-2 spike mutations that attenuate monoclonal and serum antibody neutralization", BIORXIV, 2020
MARATEA ET AL., GENE, vol. 40, 1985, pages 39 46
MARKS ET AL., J. MOL. BIOL., vol. 222, 1991, pages 581 - 597
MATES ET AL., NAT. GENET., vol. 41, 2009, pages 753
MCCALLUM, M.WALLS, A.C.BOWEN, J.E.CORTI, D.VEESLER, D.: "Structure-guided covalent stabilization of coronavirus spike glycoprotein trimers in the closed conformation", NAT STRUCT MOL BIOL, 2020
MCCARTHY, K.R.RENNICK, L.J.NAMBULLI, S.ROBINSON-MCCARTHY, L.R.BAIN, W.G.HAIDAR, G.DUPREX, W.P.: "Natural deletions in the SARS-CoV-2 spike glycoprotein drive antibody escape", BIORXIV, 2020
MERCADO, N.B.ZAHN, R.WEGMANN, F.LOOS, C.CHANDRASHEKAR, A.YU, J.LIU, J.PETER, L.MCMAHAN, K.TOSTANOSKI, L.H. ET AL.: "Single-shot Ad26 vaccine protects against SARS-CoV-2 in rhesus macaques", NATURE, vol. 586, 2020, pages 583 - 588, XP037277110, DOI: 10.1038/s41586-020-2607-z
MILLET, J.K.WHITTAKER, G.R.: "Murine Leukemia Virus (MLV)-based Coronavirus Spike-pseudotyped Particle Production and Infection", BIO PROTOC, vol. 6, 2016
MORRISON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 6851 - 6855
MURPHY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 83, 1986, pages 8258 8262
MUTHUMANI ET AL., HUM VACCIN IMMUNOTHER, vol. 9, 2013, pages 2253 - 2262
MUTHUMANI ET AL., J INFECT DIS., vol. 214, no. 3, 2016, pages 369 - 378
PALMBERGER ET AL., J. BIOTECHNOL., vol. 753, no. 3-4, 2011, pages 160 - 166
PAN AMERICAN HEALTH ORGANIZATION, EPIDEMIOLOGICAL UPDATE: OCCURRENCE OF VARIANTS OF SARS-COV-2 IN THE AMERICAS, 20 January 2021 (2021-01-20)
PARDI ET AL., J CONTROL RELEASE, 2015
PICCOLI, L.PARK, Y.J.TORTORICI, M.A.CZUDNOCHOWSKI, N.WALLS, A.CBELTRAMELLO, M.SILACCI-FREGNI, C.PINTO, D.ROSEN, L.E.BOWEN, J.E. ET: "Mapping Neutralizing and Immunodominant Sites on the SARS-CoV-2 Spike Receptor-Binding Domain by Structure-Guided High-Resolution Serology", CELL, vol. 183, 2020, pages 1024 - 1042
PINTO, D.PARK, Y.J.BELTRAMELLO, M.WALLS, A.C.TORTORICI, M.A.BIANCHI, S.JACONI, S.CULAP, K.ZATTA, F.DE MARCO, A. ET AL.: "Cross-neutralization of SARS-CoV-2 by a human monoclonal SARS-CoV antibody", NATURE, vol. 583, 2020, pages 290 - 295, XP037289888, DOI: 10.1038/s41586-020-2349-y
PLANTE, J.A.LIU, Y.LIU, J.XIA, H.JOHNSON, B.A.LOKUGAMAGE, K.G.ZHANG, X.MURUATO, A.E.ZOU, J.FONTES-GARFIAS, C.R. ET AL.: "Spike mutation D614G alters SARS-CoV-2 fitness", NATURE, 2020
PLUCKTHUN, A, BIO/TECHNOLOGY, vol. 9, 1991, pages 545 - 551
PRESTA, CURR. OP. STRUCT. BIOL., vol. 2, 1992, pages 593 - 596
RAMBAUT, A. ET AL.: "A dynamic nomenclature proposal for SARS-CO V÷2 lineages to assist genomic epidemiology", NAT MICROBIOL, vol. 5, 2020, pages 1403 - 1407, XP037277086, DOI: 10.1038/s41564-020-0770-5
RAVETCH, J. V.KINET, J. P., ANNU. REV. IMMUNOL., vol. 9, 1991, pages 457 - 492
REN ET AL., CELL, 2021
REN, X. ET AL.: "COVID-19 immune features revealed by a large-scale single cell transcriptome atlas", CELL, 2021
ROGERS, T.F.ZHAO, F.HUANG, D.BEUTLER, N.BURNS, A.HE, W.T.LIMBO, O.SMITH, C.SONG, G.WOEHL, J. ET AL.: "Isolation of potent SARS-CoV-2 neutralizing antibodies and protection from disease in a small animal model", SCIENCE, 2020
SABNIS ET AL., MOL. THER., vol. 26, 2018, pages 1509 - 1519
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY
SCATCHARD ET AL., ANN. N.Y. ACAD. SCI., vol. 51, 1949, pages 660
SCHAFER, A.MUECKSCH, F.LORENZI, J.C.C.LEIST, S.R.CIPOLLA, M.BOURNAZOS, S.SCHMIDT, F.MAISON, R.M.GAZUMYAN, A.MARTINEZ, D.R. ET AL.: "Antibody potency, effector function, and combinations in protection and therapy for SARS-CoV-2 infection in vivo", J EXP MED, vol. 218, 2021
SCHOLTEN ET AL., CLIN. IMMUNOL., vol. 119, 2006, pages 135
SEYDOUX, E.HOMAD, L.J.MACCAMY, A.J.PARKS, K.R.HURLBURT, N.K.JENNEWEIN, M.F.AKINS, N.R.STUART, A.B.WAN, Y.-H.FENG, J. ET AL.: "Characterization of neutralizing antibodies from a SARS-CoV-2 infected individual", BIORXIV, 2020
SHANER ET AL., NATURE METHODS, 2005
SHIELDS, R. L. ET AL., J. BIOL. CHEM., vol. 276, 2001, pages 6591 - 6604
SOH, W.T.LIU, Y.NAKAYAMA, E.E.ONO, C.TORII, S.NAKAGAMI, H.MATSUURA, Y.SHIODA, T.ARASE, H.: "The N-terminal domain of spike glycoprotein mediates SARS-CoV-2 infection by associating with L-SIGN and DC-SIGN", BIORXIV, 2020
SPIESS ET AL., MOL. IMMUNOL., vol. 67, no. 2, 2015, pages 95
STARR ET AL., NATURE, vol. 597, 2021, pages 97 - 102
STARR, T.N.GREANEY, A.J.ADDETIA, A.HANNON, W.W.CHOUDHARY, M.C.DINGENS, A.S.LI, J.Z.BLOOM, J.D.: "Prospective mapping of viral mutations that escape antibodies used to treat COVID-19", BIORXIV, 2020
STARR, T.N.GREANEY, A.J.HILTON, S.K.ELLIS, D.CRAWFORD, K.H.D.DINGENS, A.S.NAVARRO, M.J.BOWEN, J.E.TORTORICI, M.A.WALLS, A.C. ET AL: "Deep Mutational Scanning of SARS-CoV-2 Receptor Binding Domain Reveals Constraints on Folding and ACE2 Binding", CELL, vol. 182, 2020, pages 1295 - 1310
STETTLER ET AL.: "Specificity, cross-reactivity, and function of antibodies elicited by Zika virus infection", SCIENCE, vol. 353, no. 6301, 2016, pages 823 - 826, XP055352097, DOI: 10.1126/science.aaf8505
SUZUKI ET AL., CLIN. CANCER RES., vol. 13, no. 6, 2007, pages 1875 - 82
TEGALLY, H.WILKINSON, E.GIOVANETTI, M.IRANZADEH, A.FONSECA, V.GIANDHARI, J.DOOLABH, D.PILLAY, S.SAN, E.J.MSOMI, N. ET AL.: "Emergence and rapid spread of a new severe acute respiratory syndrome-related coronavirus 2 (SARS-CoV-2) lineage with multiple spike mutations in South Africa", MEDRXIV, 2020
TER MEULEN, J.VAN DEN BRINK, E.N.POON, L.L.MARISSEN, W.E.LEUNG, C.S.COX, F.CHEUNG, C.Y.BAKKER, A.Q.BOGAARDS, J.A.VAN DEVENTER, E. : "Human monoclonal antibody combination against SARS coronavirus: synergy and coverage of escape mutants", PLOS MED, vol. 3, 2006, pages e237
THEPAUT, M.LUCZKOWIAK, J.VIVES, C.LABIOD, N.BALLY, I.LASALA, F.GRIMOIRE, Y.FENEL, D.SATTIN, S.THIELENS, N. ET AL.: "DC/L-SIGN recognition of spike glycoprotein promotes SARS-CoV-2 trans-infection and can be inhibited by a glycomimetic antagonist", BIORXIV, 2020
THESS ET AL., MOL THER, vol. 23, 2015, pages 1456 - 1464
THOMSON, E.C. ET AL.: "The circulating SARS-CoV-2 spike variant N439K maintains fitness while evading antibody-mediated immunity", BIORXIV, 2020
THRAN ET AL., EMBO MOLMED, vol. 9, no. 10, 2017, pages 1434 - 1448
TORTORICI, M.A.BELTRAMELLO, M.LEMPP, F.A.PINTO, D.DANG, H.V.ROSEN, L.E.MCCALLUM, M.BOWEN, J.MINOLA, A.JACONI, S. ET AL.: "Ultrapotent human antibodies protect against SARS-CoV-2 challenge via multiple mechanisms", SCIENCE, vol. 370, 2020, pages 950 - 957, XP055794998, DOI: 10.1126/science.abe3354
TORTORICI, M.A.VEESLER, D.: "Structural insights into coronavirus entry", ADV VIRUS RES, vol. 105, 2019, pages 93 - 116
URLAUB ET AL., PNAS, vol. 77, 1980, pages 4216
VERHOEYEN ET AL., METHODS MOL. BIOL., vol. 506, 2009, pages 97
VERHOEYEN ET AL., SCIENCE, vol. 239, 1988, pages 1534 - 1536
VOSS, W.N.HOU, Y.J.JOHNSON, N.V.KIM, J.E.DELIDAKIS, G.HORTON, A.P.BARTZOKA, F.PARESI, C.J.TANNO, Y.ABBASI, S.A. ET AL.: "Prevalent, protective, and convergent IgG recognition of SARS-CoV-2 non-RBD spike epitopes in COVID-19 convalescent plasma", BIORXIV, 2020
WALCHLI ET AL., PLOS ONE, vol. 6, 2011, pages 327930
WALLS, A.C.FIALA, B.SCHAFER, A.WRENN, S.PHAM, M.N.MURPHY, M.TSE, L.V.SHEHATA, L.O'CONNOR, M.A.CHEN, C. ET AL.: "Elicitation of Potent Neutralizing Antibody Responses by Designed Protein Nanoparticle Vaccines for SARS-CoV-2", CELL, vol. 183, 2020, pages 1367 - 1382
WALLS, A.C.PARK, Y.J.TORTORICI, M.A.WALL, A.MCGUIRE, A.T.VEESLER, D.: "Structure, Function, and Antigenicity of the SARS-CoV-2 Spike Glycoprotein", CELL, vol. 181, 2020, pages 281 - 292
WALLS, A.C.XIONG, X.PARK, Y.J.TORTORICI, M.A.SNIJDER, J.QUISPE, J.CAMERONI, E.GOPAL, R.DAI, M.LANZAVECCHIA, A. ET AL.: "Unexpected Receptor Functional Mimicry Elucidates Activation of Coronavirus Fusion", CELL, vol. 176, 2019, pages 1026 - 1039
WANG, C., LI, W., DRABEK, D., OKBA, N.M.A., VAN HAPEREN, R., OSTERHAUS,A.D.M.E., VAN KUPPEVELD, F.J.M., HAAGMANS, B.L., GROSVELD, : "A human monoclonal antibody blocking SARS-CoV-2 infection", NAT COMMUN, vol. 11, 2020, pages 2251
WANG, L.SHI, W.CHAPPELL, J.D.JOYCE, M.G.ZHANG, Y.KANEKIYO, M.BECKER, M.M.VAN DOREMALEN, N.FISCHER, R.WANG, N. ET AL.: "Importance of Neutralizing Monoclonal Antibodies Targeting Multiple Antigenic Sites on the Middle East Respiratory Syndrome Coronavirus Spike Glycoprotein To Avoid Neutralization Escape", J VIROL, vol. 92, 2018, XP055691699, DOI: 10.1128/JVI.02002-17
WANG, N.ROSEN, O.WANG, L.TURNER, H.L.STEVENS, L.J.CORBETT, K.S.BOWMAN, C.A.PALLESEN, J.SHI, W.ZHANG, Y. ET AL.: "Structural Definition of a Neutralization-Sensitive Epitope on the MERS-CoV Sl-NTD", CELL REP, vol. 28, 2019, pages 3395 - 3405
WARD, E. S.GHETIE, V., THER. IMMUNOL., vol. 2, 1995, pages 77 - 94
WATANABE, Y.ALLEN, J.D.WRAPP, D.MCLELLAN, J.S.CRISPIN, M.: "Site-specific glycan analysis of the SARS-CoV-2 spike", SCIENCE, 2020
WEC, A.Z.WRAPP, D.HERBERT, A.S.MAURER, D.P.HASLWANTER, D.SAKHARKAR, M.JANGRA, R.K.DIETERLE, M.E.LILOV, A.HUANG, D. ET AL.: "Broad neutralization of SARS-related viruses by human monoclonal antibodies", SCIENCE, 2020
WEISBLUM, Y.SCHMIDT, F.ZHANG, F.DASILVA, J.POSTON, D.LORENZI, J.C.C.MUECKSCH, F.RUTKOWSKA, M.HOFFMANN, H.-H.MICHAILIDIS, E. ET AL.: "Escape from neutralizing antibodies by SARS-CoV-2 spike protein variants", ELIFE, vol. 9, 2020, pages e61312, XP055850201, DOI: 10.7554/eLife.61312
WILSON, SCIENCE, vol. 295, 2002, pages 2103
WINES, B.D. ET AL., J. IMMUNOL., vol. 164, 2000, pages 5313 - 5318
WINKLER, E.S.GILCHUK, P.YU, J.BAILEY, A.L.CHEN, R.E.ZOST, S.J.JANG, H.HUANG, YALLEN, J.D.CASE, J.B. ET AL.: "Human neutralizing antibodies against SARS-CoV-2 require intact Fc effector functions and monocytes for optimal therapeutic protection", BIORXIV, 2020
WOLFF ET AL., CANCER RES., vol. 53, 1993, pages 2560
WRAPP, D.WANG, N.CORBETT, K.S.GOLDSMITH, J.A.HSIEH, C.L.ABIONA, O.GRAHAM, B.S.MCLELLAN, J.S.: "Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation", SCIENCE, vol. 367, 2020, pages 1260 - 1263, XP055829062, DOI: 10.1126/science.abb2507
WROBEL, A.G.BENTON, D.J.HUSSAIN, S.HARVEY, R.MARTIN, S.R.ROUSTAN, C.ROSENTHAL, P.B.SKEHEL, J.J.GAMBLIN, S.J.: "Antibody-mediated disruption of the SARS-CoV-2 spike glycoprotein", NAT COMMUN, vol. 11, 2020, pages 5337
WROBEL, A.G.BENTON, D.J.XU, P.ROUSTAN, C.MARTIN, S.R.ROSENTHAL, P.B.SKEHEL, J.J.GAMBLIN, S.J.: "SARS-CoV-2 and bat RaTG13 spike glycoprotein structures inform on virus evolution and furin-cleavage effects", NAT STRUCT MOL BIOL, vol. 27, 2020, pages 763 - 767, XP037523235, DOI: 10.1038/s41594-020-0468-7
WU, Y.WANG, F.SHEN, C.PENG, W.LI, D.ZHAO, C.LI, Z.LI, S.BI, Y.YANG, Y. ET AL.: "A noncompeting pair of human neutralizing antibodies block COVID-19 virus binding to its receptor ACE2", SCIENCE, vol. 368, 2020, pages 1274 - 1278, XP055799109, DOI: 10.1126/science.abc2241
XIE ET AL., NAT COMM, 2020, Retrieved from the Internet <URL:https://doi.org/10.1038/s41467-020-19055-7).Cells>
XIONG, X.CORTI, D.LIU, J.PINNA, D.FOGLIERINI, M.CALDER, L.J.MARTIN, S.R.LIN, Y.P.WALKER, P.A.COLLINS, P.J. ET AL.: "Structures of complexes formed by H5 influenza hemagglutinin with a potent broadly neutralizing human monoclonal antibody", PROC NATL ACAD SCI U S A, vol. 112, 2015, pages 9430 - 9435
YAZAKIWU: "Methods in Molecular Biology", vol. 248, 2003, HUMANA PRESS, pages: 255 - 268
YURKOVETSKIY, L.WANG, X.PASCAL, K.E.TOMKINS-TINCH, C.NYALILE, T.P.WANG, Y.BAUM, A.DIEHL, W.E.DAUPHIN, A.CARBONE, C. ET AL.: "Structural and Functional Analysis of the D614G SARS-CoV-2 Spike Protein Variant", CELL, vol. 183, 2020, pages 739 - 751
ZHANG, L.CAO, L.GAO, X.-S.ZHENG, B.-Y.DENG, Y.-Q.LI, J.-X.FENG, R.BIAN, Q.GUO, X.-L.WANG, N. ET AL.: "A proof of concept for neutralizing antibody-guided vaccine design against SARS-CoV-2", BIORXIV, 2020
ZHAO ET AL., J. IMMUNOL., vol. 174, 2005, pages 4415
ZHOU, H.CHEN, Y.ZHANG, S.NIU, P.QIN, KJIA, W.HUANG, B.LAN, J.ZHANG, L.TAN, W. ET AL.: "Structural definition of a neutralization epitope on the N-terminal domain of MERS-CoV spike glycoprotein", NAT COMMUN, vol. 10, 2019, pages 3068, XP055844048, DOI: 10.1038/s41467-019-10897-4
ZHOU, P.YANG, X.L.WANG, X.G.HU, B.ZHANG, L.ZHANG, W.SI, H.R.ZHU, Y.LI, B.HUANG, C.L. ET AL.: "A pneumonia outbreak associated with a new coronavirus of probable bat origin", NATURE, 2020
ZHU, N.ZHANG, D.WANG, W.LI, X.YANG, B.SONG, J.ZHAO, X.HUANG, B.SHI, W.LU, R. ET AL.: "A Novel Coronavirus from Patients with Pneumonia in China", N ENGL J MED, 2020
ZOST, S.J.GILCHUK, P.CASE, J.B.BINSHTEIN, E.CHEN, R.E.NKOLOLA, J.P.SCHAFER, A.REIDY, J.X.TRIVETTE, A.NARGI, R.S. ET AL.: "Potently neutralizing and protective human antibodies against SARS-CoV-2", NATURE, vol. 584, 2020, pages 443 - 449, XP037223576, DOI: 10.1038/s41586-020-2548-6

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023201256A1 (fr) * 2022-04-12 2023-10-19 Vir Biotechnology, Inc. Thérapies par anticorps à haute dose contre une infection par le sars-cov-2
CN114805564A (zh) * 2022-06-10 2022-07-29 郑州大学 特异性识别SARS-CoV-2 S蛋白NTD区域的单克隆抗体及应用
CN114805564B (zh) * 2022-06-10 2023-06-06 郑州大学 特异性识别SARS-CoV-2 S蛋白NTD区域的单克隆抗体及应用
WO2024036313A3 (fr) * 2022-08-12 2024-04-18 The Rockefeller University Anticorps anti-sars-cov-2 et procédés d'utilisation associés

Also Published As

Publication number Publication date
BR112023005684A2 (pt) 2023-11-07
WO2022067269A3 (fr) 2022-06-23
EP4217385A2 (fr) 2023-08-02
CA3194162A1 (fr) 2022-03-31
JP2023545322A (ja) 2023-10-27

Similar Documents

Publication Publication Date Title
EP3872091B1 (fr) Anticorps contre le sars-cov-2
AU2021268361A1 (en) Antibodies against SARS-CoV-2
US20240059757A1 (en) Antibodies against sars-cov-2 and methods of using the same
WO2022067269A2 (fr) Anticorps contre le sars-cov-2
WO2022115486A1 (fr) Anticorps se liant à plusieurs bétacoronavirus
WO2021247925A1 (fr) Immunothérapie guidée par une structure dirigée contre le sars-cov-2
WO2022204202A1 (fr) Anticorps qui se lient à de multiples sarbecovirus
AU2021382620A1 (en) Antibodies against influenza a viruses
US20240092876A1 (en) Broadly neutralizing antibodies against influenza neuraminidase
TW202204395A (zh) 抗sars-cov-2之抗體及使用其之方法
WO2024006472A1 (fr) Anticorps qui se lient à de multiples sarbecovirus
WO2023230448A1 (fr) Immunothérapie combinée contre la grippe
WO2023230445A2 (fr) Anticorps largement neutralisants dirigés contre la neuraminidase de la grippe
WO2024112818A1 (fr) Anticorps anti-sars-cov-2 modifiés et leurs utilisations
TW202210505A (zh) 抗sars-cov-2之抗體
TW202411247A (zh) 針對流感神經胺酸酶的廣泛中和抗體

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 2023544186

Country of ref document: JP

Kind code of ref document: A

Ref document number: 3194162

Country of ref document: CA

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112023005684

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 2021806447

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2021806447

Country of ref document: EP

Effective date: 20230428

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 21806447

Country of ref document: EP

Kind code of ref document: A2

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112023005684

Country of ref document: BR

Free format text: APRESENTAR NOVO CONTEUDO ELETRONICO DE LISTAGEM DE SEQUENCIAS BIOLOGICAS, UMA VEZ QUE FOI VERIFICADA DIVERGENCIA EM CAMPO 110 E NAO SE ENCONTRA NO FORMATO OMPI ST.25, PADRONIZADO PELA PORTARIA INPI 56/2022.

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112023005684

Country of ref document: BR

Free format text: COM BASE NA PORTARIA INPI 56, DE 27/12/2021, APRESENTAR, EM ATE 60 (SESSENTA) DIAS, NOVO CONTEUDO DE LISTAGEM DE SEQUENCIAS, POIS OS CONTEUDOS APRESENTADOS ENCONTRAM-SE FORA DO PADRAO OMPI ST.25.

ENP Entry into the national phase

Ref document number: 112023005684

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20230328