WO2022055320A1

WO2022055320A1 - Adeno-associated virus vector for targeted gene delivery

Info

Publication number: WO2022055320A1
Application number: PCT/KR2021/012420
Authority: WO
Inventors: 백경화; 변미란
Original assignee: 주식회사 제너로스
Priority date: 2020-09-14
Filing date: 2021-09-13
Publication date: 2022-03-17
Also published as: KR20220035693A

Abstract

The present invention relates to an adeno-associated virus vector capable of delivering genes by targeting the central nervous system, and to various uses of same. The vector of the present invention comprises: a sequence encoding a first inverted terminal repeat (ITR); a promoter sequence; a sequence encoding AIMP2-DX2 operably linked to the promoter sequence; a sequence targeting mir142-3p linked to the sequence encoding the AIMP2-DX2; and a sequence encoding a second ITR, wherein the adeno-associated virus vector can be selectively expressed only in the central nervous system among various tissues, and thus can be useful in related industries.

Description

Adeno-associated viral vectors for targeted gene delivery

The present invention relates to an adeno-associated virus vector capable of delivering a gene by targeting the central nervous system and various uses thereof.

The mammalian brain can perform complex functions by generating a systematic neural network through a series of processes such as division and differentiation of neural stem cells, survival and death, and synapse formation. Even in the adult period, animal nerve cells produce many substances necessary for nerve growth, and axons and dendrites grow. remodeling), so it can be said that differentiation continues. In the process of cell differentiation and synapse formation, nerve cells die if they do not receive target-derived survival factors such as nerve growth factors. become a major cause of disease. Unlike the central nervous system, when the peripheral nervous system of animals is damaged, the axon regenerates over a long period of time. The posterior axon at the site of nerve injury is degenerated by a process known as Wallerian degeneration, the nerve cell body resumes axonal regrowth, and Schwann cells divide and determine the target nerve by survival and death. It regenerates through the process of development, such as re-differentiation.

As the aging population is rapidly increasing worldwide, the incidence of degenerative brain disease is also increasing every year. am. In addition, the therapeutic agents and treatments used for these diseases often exhibit side effects and toxicity due to long-term use, and they only have the effect of delaying the course of symptoms or temporarily alleviating the severity of symptoms rather than a complete disease treatment, so side effects and toxicity are reduced. There is an urgent need to discover and develop materials with decisive therapeutic effects.

Since the first clinical trial in humans for gene therapy started in 1990, about 600 clinical trials have been conducted on 3,500 patients until 2002. With the completion of human genome sequencing in 2003, the development of new gene therapy according to the discovery of various genes will be accelerated. However, 75% of the gene therapies approved so far target the treatment of monogenetic diseases such as cancer or cystic fibrosis, and the development of gene therapies for neurological diseases or nerve regeneration is not active (NIH Recombinant DNA Advisory Report, USA). (2002); Gene therapy clinical trials (2002) J Gene Med. www.wiley.co.uk/genmed). However, the development of gene therapy using nerve growth factors such as NT-3 and GDNF (glial derived neuronal factor) for the treatment of Parkinson's disease and regeneration of sensory nerves has already been attempted (GDNF family ligands activate multiple events during axonal growth in mature). sensory neurons (2004) Mol. cell. Neurosci. 25, 4453-4459). As for neurological diseases, overall neuroscience research on brain function research is still in a sluggish state, so the development of therapeutic agents for various chronic nervous system diseases is also difficult.

Meanwhile, AIMP2-DX2 is known to inhibit apoptosis by inhibiting the function of AIMP2 as an alternative splicing variant of AIMP2, a tumor suppressor factor involved in apoptosis in many ways. AIMP2-DX2 inhibits the pro-apoptotic interaction of AIMP2 by competing with AIMP2 in the presence of TGF-β, TNF-α and DNA damage signals. AIMP2 released from MSC (Multi-Synthetase Complex) by TGF-β and TNF-α stimulation binds to FBP and TRAF2, respectively, and is known to induce cell death by inducing ubiquitin-mediated degradation of FBP and TRAF2, The presence of AIMP2-DX2 induces cell survival by competitively inhibiting the binding of AIMP2 to FBP and TRAF2. In addition, when a DNA damage signal such as UV irradiation is given, AIMP2 interacts with p53 to protect p53 from MDM2-mediated degradation to induce apoptosis, but AIMP2-DX2 inhibits the binding of p53 to AIMP2, leading to cell survival. do.

The present inventors have developed an adeno-associated viral vector comprising an ITR from which the TRS (terminal resolution site) region has been removed, a sequence targeting miR-142-3p, and a sequence encoding an AIMP2 mutant (AIMP2-DX2) gene with a deletion of exon 2 was constructed, and the present invention was completed by confirming that the vector can be selectively expressed only in the central nervous system, such as the brain or spinal cord.

Therefore, an object of the present invention is an adeno-containing sequence encoding the ITR, miR-142-3p targeting sequence and exon 2 deleted AIMP2 variant (AIMP2-DX2) gene from which the TRS (terminal resolution site) region has been removed. - To provide an accessory viral vector and its use for preventing and treating neurodegenerative diseases.

In order to achieve the above object, the present invention provides a sequence encoding a first inverted terminal repeat (ITR); promoter sequence; a sequence encoding AIMP2-DX2 operably linked to the promoter sequence; a sequence targeting mir142-3p linked to the sequence encoding AIMP2-DX2; And it provides an adeno-associated viral vector comprising a sequence encoding a second ITR, comprising the sequence sequentially in a 5' to 3' direction.

In addition, the present invention provides a composition for preventing or treating neurodegenerative diseases comprising the vector of the present invention.

In addition, the present invention provides a method for preventing or treating a neurodegenerative disease comprising administering the recombinant vector of the present invention to an individual in need of treatment.

In addition, the present invention provides a method for treating a neurodegenerative disease comprising administering the vector of the present invention to a subject suffering from a neurodegenerative disease in a pharmaceutically effective amount.

In addition, the present invention provides a use of the vector of the present invention for use in the manufacture of a pharmaceutical composition for the prevention or treatment of neurodegenerative diseases.

The adeno-associated virus vector of the present invention can be selectively expressed only in the central nervous system among various tissues, and thus can be usefully used in related industries.

1 is a diagram showing a vector map of the adeno-associated viral vector of the present invention.

2 is a diagram showing a vector map of the adeno-associated viral vector of the present invention.

Figure 3 is a schematic diagram showing the production process of the adeno-associated viral vector of the present invention.

4 is a diagram showing that DX2 competitively inhibits the binding of TRAF2 and AIMP2, thereby reducing the pro-apoptotic activity of AIMP2. The upper panel shows that DX2 inhibits AIMP2 binding to TRAF2 in a dose-dependent manner. Lower panel shows NF-κB activation and cell viability.

5 is a diagram showing that DX2 reduces TNFα-induced neuronal death. (A) SH-SY5Y cells were transfected with EV (empty vector), DX2, and SOD1 G93A, and the level of ubiquitinated TRAF2 was confirmed by immunoblotting. (B) SH-SY5Y cells were transfected with EV, DX2, SOD1 WT, G93A, and G85R and treated with TNF-α and CHX for 6 h. Cell viability was confirmed by MTT assay. (C) Primary neuronal cells of WT and mutant SOD1 mice were transfected with ith EV and DX2, and viability was confirmed by performing MTT analysis.

6 is a diagram showing the TRAF2 expression level in the ALS mouse model. (A) Immunohistochemical staining results showing the expression of SOD1 (upper panel) and TRAF2 (lower panel) in each mouse. (B) Immunoblot analysis results showing the expression of TRAF2, EPRS, KARS1, and SOD1 in each mouse. (CD) Expression of GFP and DX2 in the spinal cord of mice: (C) Expression of GFP after injection of AAV-GFP and (D) Quantification of DX2 mRNA expression in the spinal cord (n = 2 per group). Br; brain cortex, SC; spinal cord, scAAV-GFP; 2.4 x 10 ¹⁰ vg, scAAV-DX2; 2.4x10 ¹⁰ vg.

7 is a view confirming the behavior, disease onset time and lifespan of ALS model mice by administration of DX2. (A) Behavior was improved in the group administered with AAV-DX2. (B) The onset of disease was delayed in the AAV-DX2 group. (C) Lifespan of mice was prolonged in the AAV-DX2 group compared to the AAV-GFP group. Animals; WT n=5, SOD1 ^G93A n=6, SOD1 ^G93A AAV2-Con n=9 and SOD1 ^G93A AAV2-DX2 n=9.

8 is a diagram confirming at the protein level whether DX2 inhibits neuronal inflammation and apoptosis in ALS model mice. While it was confirmed that TRAF2, which is known to inhibit apoptosis among inflammatory signaling factors caused by TNF-α, significantly decreased in mice injected with AAV-GFP (Con) into AAV-GFP (Con) mice injected with AAV-GFP (Con), whereas in mice injected with AAV-DX2 It was confirmed that the expression of TRAF2 was restored to a level similar to that of WT.

9 is a schematic diagram showing the mechanism by which DX2 inhibits cell death by blocking ubiquitination of TRAF2.

10 is a diagram showing that 67 laminin receptor stability is reduced in ALS. (A) SK-N-SH cells were transfected with SOD1 WT and G93A. Cells were harvested and then immunoblotted for 67 laminin receptor (LR). (B) Neuronal cells were transfected with SOD1 WT and G93A and then cultured on 22x22 coverslips. After fixing the cells, they were treated with KARS1 or 67LR antibody, and images were obtained by confocal microscopy. (C) To confirm the effect of SOD1 WT and G93A on cell migration, neurons were loaded into the upper chamber of a transwell plate separated by a membrane with an 8.0 μm pore size, and WT and G93A were loaded into the lower chamber. The membrane was then cut and stained. (D) Neuronal cells were transfected with each plasmid and treated with laminin-1 (LN1) for 0, 15, 30 and 60 min. pERK and ERK levels were determined by Western blot. (E) SH-SY5Y cells were transfected with each plasmid and siRNA KARS1, and the transfected cells were inoculated on poly HEMA-coated plates and then treated with TNF-α, CHX and laminin 1 (LN1) for 6 hours. . Then, the cells were analyzed by MTT to determine the cell viability. (F) SH-SY5Y cells were transfected with each plasmid for 24 h. Thereafter, the cells were inoculated on poly HEMA-coated plates and treated with TNF-α and cycloheximide (CHX) for 6 hours. Cell viability was confirmed by performing an MTT assay.

11 is a diagram showing the effect of DX2 on 67LR expression and Anoikis. (A) Neuroblastoma cells were transfected with strep-DX2, SOD1 WT, G93A and G85R for 24 h. After harvesting the cells and performing ultracentrifugation, the samples were subjected to immunoblotting. (B) SK-N-SH cells were transfected with SOD1 WT, G93A, KARS1, AIMP2 and DX2. After harvesting the cells, Western blot analysis was performed on the 67LR. (C) Neuronal cells were transfected with SOD1 G93A and then either EV or DX2. Cells were treated with laminin 1 (LN1) for 0, 15, 30 and 60 min before lysis and immunoblotting for p-ERK and ERK levels. (D) SH-SY5Y cells were transfected with SOD1 G93A and then treated with TNF-α (30 ng/mL) for 24 hours. Cell adhesion was measured by iCelligence.

12 is a diagram comparing scAAV and ssAAV. (A) AAV-GFP transformation efficiency test result. SK-SY5Y (neuroblastoma) cells were infected with scAAV-GFP or ssAAV-GFP (single-stranded AAV-GFP) and 48 hours later, GFP expression of (B) ssAAV-GFP and (C) scAAV-GFP was examined by fluorescence microscopy. observed.

AIMP2-DX2 is an alternative splicing variant of AIMP2, an apoptosis factor involved in apoptosis in many ways, and is known to inhibit apoptosis of tumors by inhibiting the function of AIMP2.

As used herein, the term "AIMP2 splicing variant" refers to a variant resulting from partial or total loss of the region of exon 2 among exons 1 to 4, wherein the variant forms a heterodimer with the AIMP2 protein to interfere with the normal function of AIMP2. means that In addition, when the AIMP2 mutant is overexpressed in cells or tissues, cancer may be induced. Therefore, it is necessary to induce tissue-specific expression in order to suppress the induction of cancer.

In KR 10-1067816 (2011), it is described that an inhibitor of AIMP2-DX2 can treat inflammatory diseases. Also, AIMP2/p38 promotes ubiquitination of TRAF2 to regulate TNF-alpha-induced apoptosis and AIMP2/p38 AIMP2-DX2, a splice variant of p38, acts as a competitive inhibitor of AIMP2 and inhibits ubiquitin of TRAF2, thereby inhibiting TNF-alpha-induced apoptosis, thereby promoting tumor progression and inflammatory marker Cox-2 It has been shown to inhibit the expression of

In addition, although AIMP2-DX2 has been previously reported to have increased expression in lung cancer, AIMP2-DX2 itself does not have the ability to form tumors to transform normal cells.

There was also a report that AIMP2-DX2 can treat neurological diseases (US2019/0298858 A1).

As used herein, the term "recombinant vector" refers to a vector capable of expressing a target protein or target RNA in an appropriate host cell, and refers to a genetic construct comprising essential regulatory elements operably linked to express a gene insert.

As used herein, the term “operably linked” refers to a functional linkage between a nucleic acid expression control sequence and a nucleic acid sequence encoding a desired protein or RNA to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect expression of the encoding nucleic acid sequence. The operative linkage with the recombinant vector can be prepared using a genetic recombination technique well known in the art, and site-specific DNA cleavage and ligation are performed using enzymes generally known in the art.

The present invention provides a sequence encoding a first inverted terminal repeat (ITR); promoter sequence; a sequence encoding AIMP2-DX2 operably linked to the promoter sequence; a sequence targeting mir142-3p linked to the sequence encoding AIMP2-DX2; And it provides an adeno-associated viral vector comprising a sequence encoding a second ITR, wherein the sequence is sequentially included in a 5' to 3' direction.

The adeno-associated viral vector of the present invention may have a vector structure as shown in FIGS. 1 and 2, but is not limited thereto. The adeno-associated viral vector may include the sequence represented by SEQ ID NO: 7, but is not limited thereto.

The vector of the present invention can express DX2 specifically in the central nervous system, but is not expressed in hematopoietic cells such as leukocytes and lymphoid cells. Accordingly, the vectors of the present invention may be useful for specifically targeting neurons to treat neurological diseases.

AIMP2-DX2 polypeptide is a splicing variant of AIMP2, in which the second exon of AIMP2 is deleted. Specifically, the AIMP2-DX2 gene includes the nucleotide sequence shown in SEQ ID NO: 3, and the AIMP2-DX2 polypeptide includes the amino acid sequence shown in SEQ ID NO: 4.

In one embodiment of the present invention, the AIMP2-DX2 gene is at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% homologous to the sequence represented by SEQ ID NO: 4 It may comprise a nucleotide sequence encoding an amino acid. The AIMP2-DX2 gene may include a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 4.

The AIMP2-DX2 gene may comprise a nucleotide sequence that is at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to the nucleotide sequence of SEQ ID NO:3. The AIMP2-DX2 gene may include a nucleotide sequence represented by SEQ ID NO: 3.

As used herein, the term "micro RNA (miRNA)" refers to a noncoding RNA consisting of about 20, 21, 22, 23 or 24 nucleotides MicroRNA (abbreviated miRNA) serves to regulate gene expression. The microRNA acts in the post-transcription stage after gene transcription, and in mammals, it is known that about 60% of the gene expression is regulated by microRNA. MicroRNAs play an important role in a variety of in vivo processes and have been implicated in cancer, heart disease, and neurological diseases. Although miRNA is single-stranded RNA, a target sequence of either side of single-stranded RNA can be used as long as expression of the target gene among premature two-stranded RNAs can be suppressed. For example, miR-142 includes miR-142-3p and miR-142-5p. In the present invention, any target sequence may be used, and miR-142 includes both miR-142-3p and miR-142-5p. is included, and may preferably be miR-142-3p.

As used herein, the term "miR-142-3p" refers to its gene being present at the site of translocation in B-cell leukemia, and is expressed in hematopoietic tissues (bone marrow, spleen, thymus, etc.). is known In addition, expression of miR-142-3p has been confirmed in mouse fetal liver (fetal hematopoietic tissue), and is known to be involved in the differentiation of the hematopoietic system.

The nucleic acid targeting miR-142-3p may include a nucleotide sequence comprising ACACTA. The miR-142 target nucleic acid may comprise a nucleotide sequence comprising ACACTA and 1-17 additional contiguous nucleotides of SEQ ID NO: 5. For example, the miR-142 target nucleic acid may include a nucleotide sequence comprising ACACTA and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 additional nucleotides.

The nucleic acid targeting miR-142-3p has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the nucleotide sequence of SEQ ID NO: 5 (TCCATAAAGTAGGAAACACTACA; miR-142-3p). % homologous nucleotide sequences. The miR-142 target nucleic acid may comprise the nucleotide sequence of SEQ ID NO:5.

The sequence targeting miR-142-3p may be repeated 2-10 times, for example, it may be repeated at least 2-8 times, at least 2-6 times, at least 4 times. The sequence targeting the miR-142-3p may include the nucleotide sequence of SEQ ID NO: 5.

The sequence encoding the first ITR or the sequence encoding the second ITR may be a sequence in which a terminal resolution site (TRS) site has been removed, for example, the sequence encoding the first ITR or the second ITR. Either or both of the sequences may have the TRS region removed, but is not limited thereto. The sequence encoding the first ITR (left ITR) is the sequence shown in SEQ ID NO: 1, and the sequence coding the second ITR (right ITR) is the sequence shown in SEQ ID NO: 2.

The adeno-associated virus (AAV) is a single-stranded provirus, and requires an auxiliary virus to replicate, and the AAV genome is 4,680 bp, which can be inserted into a specific site on chromosome 19 of an infected cell. Do. The trans-gene is inserted into plasmid DNA linked by two inverted terminal repeat (ITR) sequence portions of 145 bp each and a signal sequence portion. Transgene-expressing DNA, AAV rep part, plasmid DNA expressing cap part, and helper DNA are transfected into 293 cells to generate an adeno-associated virus. AAV has the advantages of a wide range of host cells to deliver genes, fewer immune side effects during repeated administration, and a long gene expression period. Moreover, the AAV genome is safe to integrate into the host cell's chromosomes and does not alter or rearrange the host's gene expression.

It is known that the adeno-associated virus has various serotypes. Among the many adeno-associated virus serotypes that can be used for target gene delivery, the most widely studied vector is Adeno-associated virus serotype 2, cystic fibrosis, hemophilia, and Canavan It is currently used for clinical gene transfer of disease. In addition, recently, the potential of rAAV (recombinant adeno-associated virus) in cancer gene therapy is increasing.

The adeno-associated virus may be a self complementary adeno-associated virus (scAAV), but is not limited thereto.

EagI-NotI, Eco53KI, SacI, EcoRI, acc65I, KpnI and SexAI between the promoter and the sequence encoding AIMP2-DX2 may include any one or more restriction enzyme sites from the group consisting of, but is not limited thereto.

The first stop codon, the poly A coding sequence, and the second stop codon may be sequentially positioned toward the 3' end of the mir142-3P-targeting sequence, but the present invention is not limited thereto. In the first stop codon or the second stop codon, the stop codon may be repeated three or more times, but is not limited thereto. One or more restriction enzyme sites from the group consisting of BspDI-ClaI, BamHI, and StuI may be included between the first stop codon and the second stop codon.

The adeno-associated viral recombinant vector of the present invention consists of a composition comprising ITR, miR-142-3p, and AIMP2-DX2, and regulates the inhibition of AIMP2-DX2 expression in cd45-derived cells, particularly lymphocytes and leukocytes, thereby reducing lymph nodes (lymph nodes). node) can control the side effect of overexpression of AIMP2-DX2 mutant. Thus, the AIMP2-DX2 variant can be expressed only in the central nervous system or can be selectively expressed only in brain or spinal cord tissues and not other types of cells or tissues. That is, in cells expressing miR-142-3p, the expression or activity of AIMP2-DX2 can be inhibited, and in cells in which miR-142-3p is not expressed, the expression or activity of AIMP2-DX2 can be maintained or increased. . In addition, when the recombinant vector is injected in vivo, AIMP2-DX2 can be specifically expressed only in the central nervous system.

The promoter is a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, an MMT promoter, an EF-1 alpha promoter, a UB6 promoter, a chicken beta-actin promoter, a CAG promoter, a RPE65 promoter, It may be a promoter selected from the group consisting of an opsin promoter and combinations thereof, for example, a cytomegalovirus (CMV) promoter.

The term “% sequence homology”, “% homology” or “% homology” to a nucleotide or amino acid sequence is identified by comparing two optimally aligned sequences with a comparison region, wherein the nucleotide sequence in the comparison region is A portion of may contain additions or deletions (ie, gaps) compared to a reference sequence (not including additions or deletions) for the optimal alignment of the two sequences.

The protein of the present invention includes not only a protein having its native amino acid sequence but also an amino acid sequence variant thereof within the scope of the present invention.

A variant of the protein of the present invention refers to a protein having a sequence different from the native amino acid sequence by deletion, insertion, non-conservative or conservative substitution of one or more amino acid residues, or a combination thereof. Amino acid exchanges in proteins and peptides that do not entirely alter the activity of the molecule are known in the art (H.Neurath, R.L.Hill, The Proteins, Academic Press, New York, 1979).

The protein or variant thereof can be extracted from nature, synthesized (Merrifleld, J. Amer. chem. Soc. 85:2149-2156, 1963), or prepared by a genetic recombination method based on a DNA sequence (Sambrook et al. , Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, 2nd ed., 1989).

The amino acid mutation is made based on the relative similarity of the amino acid side chain substituents, such as hydrophobicity, hydrophilicity, charge, size, and the like. According to the analysis of the size, shape and type of amino acid side chain substituents, arginine, lysine and histidine are all positively charged residues; alanine, glycine and serine have similar sizes; It can be seen that phenylalanine, tryptophan and tyrosine have similar shapes. Therefore, based on these considerations, arginine, lysine and histidine; alanine, glycine and serine; And phenylalanine, tryptophan and tyrosine can be said to be biologically functional equivalents.

In introducing the mutation, the hydropathic index of the amino acid may be considered. Each amino acid is assigned a hydrophobicity index according to its hydrophobicity and charge: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cysteine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).

The hydrophobic amino acid index is very important in conferring an interactive biological function of a protein. It is a known fact that amino acids having a similar hydrophobicity index must be substituted to retain similar biological activity. When introducing a mutation with reference to the hydrophobicity index, the substitution is made between amino acids showing a difference in the hydrophobicity index, preferably within ±2, more preferably within ±1, and even more preferably within ±0.5.

On the other hand, it is also well known that substitution between amino acids having similar hydrophilicity values results in proteins having equivalent biological activity. As disclosed in US Pat. No. 4,554,101, the following hydrophilicity values are assigned to each amino acid residue: arginine (+3.0); lysine (+3.0); Aspartate (+3.0± 1); glutamate (+3.0± 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5 ± 1); alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); Tryptophan (-3.4).

When the mutation is introduced with reference to the hydrophilicity value, the substitution is made between amino acids exhibiting a difference in the hydrophilicity value within preferably ±2, more preferably within ±1, and even more preferably within ±0.5.

Amino acid exchanges in proteins that do not entirely alter the activity of the molecule are known in the art (H. Neurath, R.L. Hill, The Proteins, Academic Press, New York, 1979). The most common exchanges are amino acid residues Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Thy/Phe, Ala/ It is an exchange between Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, Asp/Gly.

The vector of the present invention may be fused with other sequences as necessary to facilitate protein purification, and the fused sequences include, for example, glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA). ), FLAG (IBI, USA) and 6x His (hexahistidine; Quiagen, USA) may be used, but is not limited thereto. In addition, the expression vector of the present invention may contain an antibiotic resistance gene commonly used in the art as a selection marker, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin , resistance genes to neomycin and tetracycline.

The present invention also provides a method for delivering and expressing a heterologous gene such as AIMP2-DX2 to neurons, comprising administering the adeno-associated viral vector to an individual in need of treatment.

In this method, the expression of the heterologous gene is increased in the central nervous system (the spinal canal and brain tissue), and the expression of the heterologous gene can be controlled in other tissues.

The present invention also provides a composition for preventing or treating neurodegenerative diseases comprising the adeno-associated viral vector as an active ingredient.

Accordingly, the present invention provides a method for preventing or treating a neurodegenerative disease comprising administering the recombinant vector of the present invention to an individual in need of treatment. The neurological disease is Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, retinal degeneration, mild cognitive impairment, multiple-infarct dementia (Multi -infarct dementia, frontotemporal dementia, dementia with Lewy bodies, Huntington's disease, neurodegenerative disease, metabolic brain disease, depression, epilepsy, multiple sclerosis, cortex Corticobasal degeneration, multiple system atrophy, progressive supranuclear palsy, dentatorubropallidoluysian atrophy, spinocerebella ataxia It may be one or more selected from the group consisting of lateral sclerosis (primary lateral sclerosis), spinal muscular atrophy and stroke (stroke), but is not limited thereto. In one embodiment, the neurological disease is amyotrophic lateral sclerosis; ALS).The treatment may be to improve memory, motor impairment, motor ability or prolong the lifespan of an individual suffering from neurological disease such as ALS, Alzheimer's disease or Parkinson's disease. The treatment may be to improve motor performance or prolong the lifespan of an individual suffering from a neurological disease such as ALS.

As used herein, the term "treatment" includes partial cure, improvement and alleviation of symptoms according to the neurodegenerative disease as well as the complete cure of the neurodegenerative disease as a result of applying the pharmaceutical composition of the present invention to an individual having a neurodegenerative disease.

In the present invention, the term "prevention" refers to suppressing or blocking symptoms or phenomena such as cognitive impairment, behavioral disorder, and nerve destruction by applying the pharmaceutical composition of the present invention to an individual having a neurodegenerative disease, thereby causing various symptoms according to the neurodegenerative disease. This means that it does not happen in advance.

The pharmaceutical composition of the present invention may further include an adjuvant in addition to the active ingredient. The adjuvant may be used without limitation as long as it is known in the art, for example, Freund's complete adjuvant or incomplete adjuvant may be further included to increase the immunity thereof.

The pharmaceutical composition according to the present invention may be prepared in a form in which the active ingredient is incorporated into a pharmaceutically acceptable carrier. Here, the pharmaceutically acceptable carrier includes carriers, excipients and diluents commonly used in the pharmaceutical field. Pharmaceutically acceptable carriers that can be used in the pharmaceutical composition of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

The pharmaceutical composition of the present invention may be formulated in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, or sterile injection solutions according to conventional methods, respectively. .

In the case of formulation, it can be prepared using a diluent or excipient such as a filler, extender, binder, wetting agent, disintegrant, surfactant, etc. commonly used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations include at least one excipient in the active ingredient, for example, starch, calcium carbonate, sucrose, lactose, gelatin. It can be prepared by mixing and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid formulations for oral administration include suspensions, solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used diluents, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. can Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations and suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used. As the base of the suppository, witepsol, tween 61, cacao butter, laurin, glycerogelatin, and the like can be used.

The pharmaceutical composition according to the present invention may be administered to an individual by various routes. Any mode of administration can be envisaged, for example, it can be administered by oral, intravenous, intramuscular, subcutaneous, intraperitoneal injection, brain striatal injection, intrathecal injection, and the like.

Preferred dosage of the therapeutic composition according to the present invention depends on factors such as formulation method, administration method, age, weight, sex, degree of disease symptoms, food, administration time, administration route, excretion rate, and response sensitivity of the patient. Although different, it may be appropriately selected by those skilled in the art.

However, for therapeutic effect, an ordinary skilled physician can easily determine and prescribe an effective dosage for the desired treatment. For example, the therapeutic agent includes intravenous injection, subcutaneous fat injection, intramuscular injection, and direct injection into the ventricle or spinal cord using a micro-injector. In this case, single administration, multiple injection and repeated administration are possible. For example, the effective dose is 0.05 to 15 mg/kg of vector per 1 kg of body weight, and 5 Х 10 ¹¹ to 3.3 in the case of recombinant virus. Х 10 ¹⁴ virus particles (2.5 Х 10 ¹² to 1.5 Х 10 ¹⁶ IU)/kg for cells 5 Х 10 ² to 5 Х 10 ⁷ cells/kg, preferably 0.1 to 10 mg/kg for vectors kg, 5 Х 10 ¹² to 3.3 Х 10 ¹³ particles (2.5 Х 10 ¹³ to 1.5 Х10 ¹⁵ IU)/kg for recombinant virus, 5 Х10 ³ to 5 Х 10 ⁶ cells/kg for cells, per week It may be administered 2-3 times. The composition as described above is not necessarily limited thereto, and may vary depending on the patient's condition and the degree of onset of a neurological disease. Other effective doses for subcutaneous fat, intramuscular injection, and direct administration to the affected area are 9 Х 10 ¹⁰ to 3.3 Х 10 ¹⁴ recombinant virus particles at an interval of 10 cm, and can be administered 2-3 times a week. The composition as described above is not necessarily limited thereto, and may vary depending on the patient's condition and the degree of onset of a neurological disease. More specifically, the pharmaceutical composition of the present invention contains 1 Х 10 ¹⁰ to 1 Х 10 ¹² vg (virus genome)/mL of recombinant adeno-associated virus, and typically 1 Х 10 ¹² vg is injected every other day for 2 weeks. good to do Administration may be administered once a day, or may be administered in several divided doses.

The pharmaceutical composition may be formulated in various oral or parenteral dosage forms.

Formulations for oral administration include, for example, tablets, pills, hard, soft capsules, solutions, suspensions, emulsifiers, syrups, granules, and the like. crose, mannitol, sorbitol, cellulose and/or glycine), lubricants (eg silica, talc, stearic acid and its magnesium or calcium salts and/or polyethylene glycol). In addition, the tablet may contain a binder such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidine, and optionally starch, agar, alginic acid. or a disintegrant such as its sodium salt or a boiling mixture and/or absorbent, coloring, flavoring and sweetening agent. The formulation may be prepared by conventional mixing, granulating or coating methods.

In addition, a representative formulation for parenteral administration is an injection formulation, and examples of the solvent for the injection formulation include water, Ringer's solution, isotonic saline, or suspension. The sterile, fixed oil of the injectable preparation may be used as a solvent or suspending medium, and any non-irritating fixed oil including mono- and di-glycerides may be used for this purpose. In addition, the injection preparation may use a fatty acid such as oleic acid.

The present invention will be described in more detail through the following examples. However, the following examples are only intended to embody the contents of the present invention, and the present invention is not limited thereto.

<실시예 1> 본 발명의 재조합 벡터 제작<Example 1> Construction of the recombinant vector of the present invention

1-1. Creation of AIMP2 variants

AIMP2 is one of the proteins involved in the formation of aminoacyl-tRNA synthetase (ARSs), and acts as an apoptosis inhibitor. To construct a plasmid expressing a mutant in which exon 2 of AIMP2 is deleted, cDNA of the AIMP2 mutant was cloned into pcDNA3.1-myc. This AIMP2 mutant was amplified from H322 cDNA using EcoR1 and Xho I linker primers, and then cloned into pcDNA3.1-myc using EcoR1 and Xho1.

AIMP2 mutant of the present invention is represented by the nucleotide sequence of SEQ ID NO: 3, and is represented by the amino acid of SEQ ID NO: 4.

1-2. miRNA selection and its target sequence selection

It was confirmed that the AIMP2 variant of the present invention is overexpressed in tumors, and while it is safely expressed in nerve cells, which are target cells, to suppress the expression of the AIMP2 variant in leukocyte-related cells and lymphocyte-related cells, the expression of the AIMP2 variant can be controlled. miRNAs and their targets were selected.

To this end, miR-142-3p, which is specifically expressed only in hematopoietic cells that produce leukocyte-related cells and lymphocyte-related cells, was selected as a target. In order to prepare the sequence targeting the miR-142-3p, microarray data of mouse B cells and computer programming (mirSVR score) of the gene targeted by miR-142-3p were used. The sequence targeting miR-142-3p of the present invention is represented by the nucleotide sequence shown in SEQ ID NO: 5.

The sequence targeting miR-142-3p of the present invention includes a restriction enzyme (NheI, Hind III, BmtI) site sequence (ccagaagcttgctagc) and a restriction enzyme (Hind III) site sequence (aagcttgtag) for cloning. It includes a nucleotide sequence represented by SEQ ID NO: 5 that is repeated 4 times together with linkers (tcac and gatatc) connecting them.

1-3. Construction of the recombinant vector of the present invention

In order to construct the recombinant vector of the present invention, the sequence encoding the first ITR (SEQ ID NO: 1), the CMV promoter, the AIMP2 mutant of the present invention (SEQ ID NO: 3), miR-142-3p targeting sequence (SEQ ID NO: 5) and the second ITR (SEQ ID NO: 2) were inserted sequentially in the 5' to 3' direction. The binding of the AIMP-2 mutant and the miR-142-3p target sequence was shown as the nucleotide sequence of SEQ ID NO: 6, and specifically, it was cut using NheI and Hind Ⅲ sites. The adeno-associated viral vector of the present invention is shown in Figures 1 and 2.

The vector prepared as described above was produced through the process shown in FIG. 3 .

<실시예 2> AIMP2-DX2(이하 DX2라고 함)의 TNF-α-유도 신경염증 억제효과 확인<Example 2> Confirmation of TNF-α-induced neuroinflammation inhibitory effect of AIMP2-DX2 (hereinafter referred to as DX2)

2-1. Confirmation of inhibitory effect on pro-apoptotic activity of DX2

Neuroinflammation is a feature commonly observed in the nervous system of ALS patients, and TNF-α is known as an important cytokine inducing inflammation. In TNF-α signaling, tumor necrosis factor receptor-associated factor (TRAF)2 plays an important role in cell death. When TNF-α signaling is activated, TRADD (TNF receptor-associated death domain) and TRAF2 bind to TNFR1, a TNF-α receptor, and the activated complex mediates IKK activity. As caspase-8 is inactivated, TRAF2 is released from the TRADD complex, and the released TRAF2 is ubiquitinated by cIAP, an E3 ubiquitin ligase, to promote cell death. AIMP2, a pro-apoptotic protein, promotes ubiquitination of TRAF2 by cIAP and induces cell death. Therefore, it was confirmed whether DX2, a competitor of AIMP2, affects the binding of TRAF2. Neuroblastoma cells were transfected with mock, DX2 (AIMP2-DX2; AIMP2 from which exo 2 was removed) or AIMP2 expression plasmid and subjected to immunoprecipitation, and the results are shown in FIG. 4 . The upper panel of FIG. 4 shows that DX2 inhibits AIMP2 binding to TRAF2 in a dose-dependent manner. Lower panel shows NF-κB activation and cell viability. There was no difference in cell viability in control, AIMP2 and DX2 transfected cells under normal conditions, but after TNF-α treatment, increased cell viability and NF-κB activation were observed in DX2 overexpressing cells compared to AIMP2-transfected cells. became

2-2. Confirmation of inhibition of TNF-α-induced neuronal death by DX2

Then, it was confirmed whether DX2 inhibits ubiquitination of TRAF2. Mutant SOD1 was used as a model for in vitro ALS-like conditions. Neuroblastoma cells were transfected with SOD1 G93A and DX2 expression plasmids and subjected to in vitro ubiquitination assay. 5A , it was observed that DX2 effectively inhibited mutant SOD1-induced TRAF2 ubiquitination in a dose-dependent manner.

Then, the inhibitory effect of DX2 on neuronal cell death was confirmed. CHX/TNF-α induced apoptosis in both WT SOD1 or mutant SOD1 (G85R and G93A) overexpressing cells, but showed an approximately 20% higher cell death rate in mutant SOD1 overexpressing cells. DX2 significantly reduced the level of apoptosis in both CHX/TNF-α-treated WT or mutant SOD1 (G85R and G93A) cells ( FIG. 5B ).

In addition, the cell death inhibitory effect of DX2 was also observed in primary neurons. DX2 overexpression plasmids were transfected into primary neurons extracted from WT or SOD1 transgenic mice. The transfected cells were treated with CHX/TNF-α and the cell death rate was analyzed.

As a result, CHX/TNF-α induced apoptosis in both WT or G93A primary neurons, but showed an approximately 13% higher rate of cell death in G93A primary neurons. DX2 significantly reduced apoptosis in both CHX/TNF-α-treated WT or G93A primary neurons ( FIG. 5C ).

The above results demonstrate that DX2 inhibits neuronal cell death in a normal neuroinflammatory situation unrelated to genetic mutation or in a neuroinflammatory situation related to SOD1 mutation.

2-3. Confirmation of TRAF2 expression inhibitory effect

TRAF2 is an important protein mediating cell death by the TNF-α signaling pathway. Therefore, to confirm the importance of TRAF2 expression in ALS disease, TRAF2 levels were measured in an ALS mouse model (SOD1 G93A transgenic mice). Interestingly, the amount of KARS1 binding to AIMP2, which regulates TNF-α-induced ubiquitination of TRAF2, did not change; However, TRAF2 expression was significantly inhibited in ALS mice ( FIGS. 6A and 6B ). Accordingly, an AAV vector was designed (Example 1) to confirm the potential efficacy of DX2 as a therapeutic agent showing efficient expression of DX2 or GFP in ALS-induced mice. For in vivo evaluation of AAV-DX2 expression, AAV-GFP or AAV-DX2 was injected into the spinal cord of mice, and after 3 weeks, GFP and DX2 expression was analyzed by immunofluorescence and mRNA expression. GFP and DX2 expression was observed at the injection site of the spinal cord, indicating that either AAV-GFP or DX2 could be expressed only at the specific injection site ( FIGS. 6C and 6D ).

2-4. Confirmation of Lifespan Extension of Mice in DX2 Gene-Injected ALS Mouse Model

In order to study the effect of DX2 in vivo , the spinal canal of ALS mice (SOD1 transgenic mice) was treated with AAV-GFP (GFP) or AAV-DX2 (prepared in Example 1). As can be seen in FIG. 7A , it was confirmed that the behavior of the mouse model was improved ( FIG. 7A ) and the onset of the disease was delayed ( FIG. 7B ) due to the intrathecal injection of AAV-DX2. In addition, it was confirmed that the lifespan of the AAV-DX2 injected mouse group was extended compared to the AAV-GFP mouse group ( FIG. 7C ).

2-5. Confirmation of decrease in TRAF2 expression and increase in TRAF2 expression by DX2 in ALS mouse model

TNF-α signal is one of the inflammatory signal transduction systems, and has an important effect on the progression of neuroinflammation and ALS. . In fact, it was confirmed in FIG. 6 that the expression level of TRAF2 significantly decreased in the ALS model mouse. In addition, it was confirmed that DX2 regulates the expression level of TRAF2 in vitro in FIGS. 4 and 5, thereby suppressing cell death. Based on this, it was confirmed that the expression of DX2 in the actual mouse model regulates the expression of TRAF2. As a result, the significantly reduced expression of TRAF2 in the mouse model of ALS is restored to the normal mouse (WT) level by injection of DX2 (AAV-DX2). was confirmed (FIG. 8C). In addition, it was confirmed that the neuroinflammatory marker factors (FIGS. 8A, 8B) and apoptosis factors (FIGS. 8D, 8E) confirmed in the ALS mouse model were also reduced by DX2.

2-6. mechanism of action

Freeform AIMP2 binds to TRAF2 and promotes ubiquitination of TRAF2 protein, and ultimately TRAF2-binding AIMP2 induces cell death. However, ubiquitination of TRAF2 by AIMP2 was significantly reduced in the presence of DX2, and by this decrease, DX2 inhibits AIMP2-stimulated apoptosis in the TNF-α-active condition ( FIG. 9 ).

<실시예 3> ALS 질환에서 본 발명의 AAV 벡터의 아노이키스-유도 신경 세포사 감소 확인<Example 3> Confirmation of reduction in anoikis-induced neuronal cell death of the AAV vector of the present invention in ALS disease

3-1. Induction of anoikis in ALS disease, confirmation of membrane 67 laminin receptor reduction

The 67kDa laminin receptor (67LR), a dimer form of p40/37LRP, plays a role in increasing cell migration by binding to KARS1 in the cell membrane. 67LR has been reported as an important factor in cell migration and cell death, and KARS1 enables cell migration through stabilization of 67LR. According to the laminin signal, KARS1 phosphorylated at threonine 52 by p38MAPK is separated from the multi-tRNA synthetase complex (MSC) and migrated to the plasma membrane. In the membrane, KARS1 binds to 67LR and inhibits the interaction of 67LR with Nedd4, an E3 ubiquitin ligase, thereby inhibiting ubiquitination-mediated degradation of 67LR. Accordingly, it was confirmed whether 67LR protein stability was related to neuronal cell death in ALS conditions.

To study the effect of 67 LR protein stability, SK-N-SH cells, a human neuroblastoma cell, were transfected with SOD1-G93A, an ALS-like condition, and 67 LR levels were analyzed. As a result, it was confirmed that the expression of 67LR protein in the plasma membrane was significantly reduced under ALS-like conditions ( FIGS. 10A and 10B ). In addition, it is well known that 67LR activates MAPK/ERK (Extracellular Signal-regulated Kinase) signaling and increases cell migration. Accordingly, it was confirmed whether the 67LR protein level affects cell migration and downstream signaling pathways under ALS-like conditions. As can be seen in FIGS. 10C and 10D , cell migration and reduction of downstream signaling pathways by laminin-1 as a substrate for laminin receptor were observed in ALS conditions.

Anoikis is a type of apoptosis induced by reduced contact between the extracellular matrix (ECM) and cell membrane proteins, and the resistance of anoikis plays an important role in cell survival. Cells were inoculated on poly HEMA-coated plates to observe whether KARS1 and laminin treatment affect cell viability induced by anoikis. As a result, it was confirmed that the cell death of 93A-transfected cells was significantly lower than that of WT cells (FIG. 10E). And, KARS1 expression level did not affect the anoikis-induced cell death (FIG. 10F). These results suggest that the inhibition of anoikis-induced apoptosis by the laminin receptor is due to an increase in downstream signaling through the interaction of the laminin receptor with the ECM.

3-2. Confirmation of Restoration of 67 LR Expression in ALS-Like Cell Conditions of DX2

It was confirmed whether the expression of 67LR was decreased in the plasma membrane and restored by DX2. As a result, overexpression of DX2 in cells expressing ALS-induced genes increased 67LR protein in plasma membrane (FIG. 11A) and whole cells (FIG. 11B), and the downstream signal of 67LR was also recovered by DX2 gene introduction. was observed (FIG. 11C). The adhesion of cells transfected with each plasmid was then tested. As can be seen in FIG. 11D , DX2 expressing cells had increased cell adhesion, suggesting that DX2 prevents cell separation and anoikis.

<실시예 4> scAAV와 ssAAV의 비교<Example 4> Comparison of scAAV and ssAAV

In order to compare the scAAV containing the TRS-removed ITR of the present invention and the conventional ssAAV, the AAV-GFP transformation efficiency test was performed. SK-SY5Y (neuroblastoma) cells were infected with scAAV-GFP or ssAAV-GFP (single-stranded AAV-GFP), and 48 hours later, GFP expression of ssAAV-GFP and scAAV-GFP was observed under a fluorescence microscope. As a result, as can be seen in FIG. 12 , it was confirmed that the scAAV of the present invention and the conventional ssAAV showed a better GFP expression level. That is, it was indirectly confirmed that the AAV vector of the present invention was an optimized vector in order to increase the expression of AIMP2-DX2 in the central nervous system, restrict expression in blood or other organs, and express it specifically only in the central nervous system.

Claims

a sequence encoding a first inverted terminal repeat (ITR);

promoter sequence;

a sequence encoding AIMP2-DX2 operably linked to the promoter sequence;

a sequence targeting mir142-3p linked to the sequence encoding AIMP2-DX2; and

sequence encoding the second ITR

including,

An adeno-associated viral vector comprising the sequence sequentially in the 5' to 3' direction.
The vector according to claim 1, wherein the sequence encoding the first ITR or the sequence encoding the second ITR is a sequence in which a terminal resolution site (TRS) region has been removed.
The method according to claim 2, wherein the first ITR-coding sequence (left ITR) is a sequence represented by SEQ ID NO: 1, and the second ITR-coding sequence (right ITR) is a sequence represented by SEQ ID NO: 2 , vector.
The vector of claim 1, wherein the adeno-associated virus is a self complementary adeno-associated virus (scAAV).
According to claim 1, EagI-NotI, Eco53KI, SacI, EcoRI, acc65I, KpnI and SexAI between the promoter sequence and the sequence encoding AIMP2-DX2 to include any one or more restriction enzyme sites from the group consisting of, vector.
The vector according to claim 1, wherein the first stop codon, the poly A-encoding sequence and the second stop codon are sequentially positioned toward the 3' end of the mir142-3P-targeting sequence.
The vector according to claim 6, wherein the first stop codon or the second stop codon has a stop codon repeated three or more times.
The vector according to claim 6, wherein one or more restriction enzyme sites from the group consisting of BspDI-ClaI, BamHI, and StuI are included between the first stop codon and the second stop codon.
The vector according to claim 1, wherein the sequence targeting miR142-3p includes the sequence represented by SEQ ID NO: 5 or 6.
The vector according to claim 1, wherein the adeno-associated virus vector comprises the sequence represented by SEQ ID NO: 7.
The method of claim 1, wherein the promoter is a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, an MMT promoter, an EF-1 alpha promoter, a UB6 promoter, a chicken beta-actin promoter, The vector is a promoter selected from the group consisting of CAG promoter, RPE65 promoter, opsin promoter, and combinations thereof.
The vector according to claim 1, wherein the nucleic acid targeting miR-142-3p is repeated 2 to 10 times.
A pharmaceutical composition for preventing or treating neurodegenerative diseases comprising the vector of any one of claims 1 to 12 as an active ingredient.
According to claim 13, wherein the neurodegenerative disease is Lou Gehrig's disease (amyotrophic lateral sclerosis; ALS), Alzheimer's disease (alzheimer's disease), Parkinson's disease (Parkinson's disease), retinal degeneration (retinal degeneration), mild cognitive impairment (mild cognitive impairment) , Multi-infarct dementia, fronto-temporal dementia, dementia with Lewy bodies, Huntington's disease, neurodegenerative disease, metabolic brain disease, depression , epilepsy, multiple sclerosis, corticobasal degeneration, multiple system atrophy, progressive supranuclear palsy, dentatorubropallidoluysian atrophy , Spinocerebella ataxia, primary lateral sclerosis, spinal muscular atrophy, myasthenia gravis and at least one selected from the group consisting of stroke, composition .
15. The method of claim 14, wherein the neurodegenerative disease is Lou Gehrig's disease (amyotrophic lateral sclerosis; ALS), the composition.
16. The composition of claim 15, wherein the treatment improves athletic performance or prolongs the lifespan of the subject.
The composition of claim 13, wherein the composition is administered to the central nervous system selected from the brain or spinal cord.
The composition of claim 17, wherein when the composition is administered to the central nervous system, the vector is specifically expressed only in cells of the central nervous system.
13. A method of treating a neurodegenerative disease comprising administering the vector of any one of claims 1 to 12 to a subject suffering from a neurodegenerative disease in a pharmaceutically effective amount.
Use of the vector of any one of claims 1 to 12 for use in the preparation of a pharmaceutical composition for the prevention or treatment of neurodegenerative diseases.