KR102626543B1 - Recombinant vector containing AIMP2-DX2 and target sequence for miR-142-3p - Google Patents

Abstract

The present invention relates to a recombinant vector containing the target sequence of miR-142-3p and various uses thereof. The recombinant vector of the present invention inserts a sequence targeting miR-142-3p at the end of the AIMP2 variant to control the side effects of overexpression of the AIMP2 variant in tumors, and is expressed in CD45-derived cells, especially lymphocyte and leukocyte lineage cells. This has the effect of controlling this. Therefore, the AIMP2 variant can be specifically expressed only in nerve cells and can be selectively expressed only in brain tissue among various tissues, so it can be usefully used in related industries.

Description

Recombinant vector containing AIMP2-DX2 and target sequence for miR-142-3p}

The present invention relates to a recombinant vector containing target sequences of AIMP2-DX2 and miR-142 and its use in preventing and treating neurological diseases.

The mammalian brain is able to perform complex functions by generating a systematic neural network through a series of processes such as division and differentiation of neural stem cells, survival and death, and synapse formation. Even during the adult period, animal nerve cells produce many substances necessary for nerve growth, causing axons and dendrites to grow, and synaptic connections and neural networks are constantly reorganized (synaptic) whenever new learning and memory occurs. It can be said that differentiation continues because of remodeling. Nerve cells die if they do not receive target-derived survival factors such as nerve growth factor during the process of cell differentiation and synapse formation, and cell death caused by stress and cytotoxic agents leads to brain degeneration. It is the main cause of disease. Unlike the central nervous system, when an animal's peripheral nervous system is damaged, its axons regenerate over a long period of time. The axon posterior to the site of nerve injury degenerates in a process known as Wallerian degeneration, the cell body of the nerve begins axonal regrowth again, and Schwann cells divide and determine the target nerve by survival or death. Then, it differentiates again and goes through the developmental process again to regenerate.

As the aging population rapidly increases around the world, the incidence of degenerative brain diseases is increasing every year, and prevention and treatment methods are not yet clear, so effective drugs to treat these diseases have not been discovered. am. In addition, the treatments and treatments used for these diseases often show side effects and toxicity due to long-term use, and have the effect of only slowing down the progression of symptoms or temporarily alleviating the severity of symptoms rather than completely treating the disease, thus reducing side effects and toxicity. There is an urgent need to discover and develop materials that can cure the disease and have decisive therapeutic effects.

Since the first clinical trials of gene therapy on humans began in 1990, approximately 600 clinical trials are in progress on 3,500 patients as of 2002. With the completion of human genome sequencing in 2003, the development of new gene therapies based on the discovery of various genes will accelerate. However, 75% of gene therapy methods approved so far are aimed at treating monogenic diseases such as cancer or cystic fibrosis, and the development of gene therapy for neurological diseases or nerve regeneration is not active (US NIH Recombinant DNA Advisory Report) (2002); Gene therapy clinical trials (2002) J Gene Med. www.wiley.co.uk/genmed). However, attempts are already being made to develop gene therapy using nerve growth factors such as NT-3 and GDNF (glial derived neuronal factor) for the treatment of Parkinson's disease and regeneration of sensory nerves (GDNF family ligands activate multiple events during axonal growth in mature). sensory neurons (2004) Mol. cell. Neurosci. 25, 4453-4459). As for diseases of the nervous system, overall neuroscience research on brain function is still sluggish, so the development of drugs to treat various chronic nervous system diseases is also facing difficulties.

Meanwhile, AIMP2-DX2 is an alternative splicing variant of AIMP2, a tumor suppressor involved in various ways in cell death, and is known to inhibit apoptosis by inhibiting the function of AIMP2. This promotes the ubiquitination of TRAF2 by AIMP2/p38 to regulate cell death induced by TNF-α, and AIMP2-DX2, a splicing variant of AIMP2/p38, acts as a competitive inhibitor of AIMP2 and reduces ubiquitin of TRAF2. By suppressing cell death caused by TNF-α, it promotes tumorigenesis and inhibits the expression of Cox-2, an inflammatory marker. In addition, AIMP2-DX2 has previously been identified and reported as a lung cancer-causing factor, and the above-described previous studies have shown that AIMP2-DX2, a variant of AIMP2, occurs frequently in cancer cells and causes cancer by interfering with the cancer-suppressing function of AIMP2. It was confirmed that when AIMP2-DX2 is expressed in normal cells, the cancerization of the cells progresses, and conversely, when the generation of AIMP2-DX2 is suppressed, cancer growth is suppressed and a therapeutic effect appears. Additionally, it has been reported that AIMP2-DX2 is effective in treating neurological diseases (Korean Publication Patent No. 10-2015-0140723)

The present inventors constructed a recombinant vector containing a sequence targeting miR-142, such as miR-142-3p and/or miR-142-5p target nucleic acid, and the sequence targeting miR-142 is an AIMP2 splicing variant. The present invention was completed by confirming that the expression of was regulated so that it could be selectively expressed only in nerve cells and brain tissues.

Therefore, the purpose of the present invention is to provide a recombinant vector containing an AIMP2 variant (AIMP2-DX2) gene with deletion of exon 2 and a miR-142 target nucleic acid, and its use for preventing and treating neurological diseases.

To achieve the above object, the present invention provides a recombinant vector containing an AIMP2 variant (AIMP2-DX2) gene with deletion of exon 2 and a miR-142 target nucleic acid.

The vector may further include a promoter operably linked to AIMP2-DX2, the promoter being a retrovirus (LTR) promoter, cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, MMT promoter, EF It may be a promoter selected from the group consisting of -1 alpha promoter, UB6 promoter, chicken beta-actin promoter, CAG promoter, RPE65 promoter, opsin promoter, and combinations thereof.

The 3' side of the miR-142 target nucleic acid may be linked to the AIMP2-DX2 gene. Alternatively, the 5' side of the miR-142 target nucleic acid may be linked to the AIMP2-DX2 gene.

The AIMP2-DX2 gene may include a nucleotide sequence encoding an amino acid sequence having more than 90% homology to the amino acid sequence represented by SEQ ID NO: 2. The AIMP2-DX2 gene may include a nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 2.

The AIMP2-DX2 gene may include a nucleotide sequence having more than 90% homology to the nucleotide sequence represented by SEQ ID NO: 1. The AIMP2-DX2 gene may include the nucleotide sequence represented by SEQ ID NO: 1.

The miR-142 target nucleic acid may include a nucleotide sequence including ACACTA. The miR-142 target nucleic acid may include a nucleotide sequence comprising ACACTA and 1-17 additional contiguous nucleotides of SEQ ID NO:5.

The miR-142 target nucleic acid may include a nucleotide sequence having more than 50% homology to the nucleotide sequence represented by SEQ ID NO: 5 (TCCATAAAGTAGGAAACACTACA; miR-142-3p). The miR-142 target nucleic acid may include the nucleotide sequence represented by SEQ ID NO: 5.

The miR-142 target nucleic acid may include a nucleotide sequence including ACTTTA. The miR-142 target nucleic acid may include a nucleotide sequence comprising ACTTTA and 1-15 additional contiguous nucleotides of SEQ ID NO:7.

The miR-142 target nucleic acid may include a nucleotide sequence having more than 50% homology to the nucleotide sequence represented by SEQ ID NO: 7 (AGTAGTGCTTTTCTACTTTATG; miR-142-5p). The miR-142 target nucleic acid may include the nucleotide sequence represented by SEQ ID NO: 7.

The miR-142 target nucleic acid may be repeated 2-10 times.

The recombinant vector may be a viral vector, and the viral vector may include adenovirus, adeno-associated virus, lentivirus, retrovirus, human immunodeficiency virus (HIV), murine leukemia virus (MLV), It may be one or more types selected from the group consisting of ASLV (Avian sarcoma/leukosis), SNV (Spleen necrosis virus), RSV (Rous sarcoma virus), MMTV (Mouse mammary tumor virus), and Herpes simplex virus. The viral vector may be one or more types selected from the group consisting of adeno-assisted virus (AAV), adenovirus, lentivirus, retrovirus, vaccinia virus, and herpes simplex virus.

Additionally, the present invention provides a method for preventing or treating neurological diseases comprising administering the recombinant vector of the present invention to an entity other than a human.

The neurological diseases include amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, retinal degeneration, mild cognitive impairment, and multiple-infarct dementia ( (Multi-infarct dementia), fronto-temporal dementia, dementia with Lewy bodies, Huntington's disease, neurodegenerative disease, metabolic brain disease, depression, epilepsy, multiple sclerosis sclerosis, corticobasal degeneration, multiple system atrophy, progressive supranuclear palsy, dentatorubropallidoluysian atrophy, spinocerebella ataxia), primary lateral sclerosis, spinal muscular atrophy, and stroke. The neurological disease may be amyotrophic lateral sclerosis (ALS). It can be.

The treatment may improve the individual's motor skills or extend lifespan.

The vector can be administered to the brain or spinal cord. The vector can be administered to the brain by stereotaxic injection.

Additionally, the present invention provides a composition for preventing or treating neurological diseases comprising the recombinant vector of the present invention.

The degenerative brain diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, retinal degeneration, mild cognitive impairment, and multiple-infarct dementia (( Multi-infarct dementia, frontotemporal dementia, dementia with Lewy bodies, Huntington's disease, neurodegenerative disease, metabolic brain disease, depression, epilepsy, multiple sclerosis, Corticobasal degeneration, multiple system atrophy, progressive supranuclear palsy, dentatorubropallidoluysian atrophy, spinocerebella ataxia, It may be one or more types selected from the group consisting of primary lateral sclerosis, spinal muscular atrophy, and stroke.

Additionally, the present invention provides a recombinant vector containing a sequence targeting miR-142-3p.

Additionally, the present invention provides a gene delivery vehicle containing a recombinant vector containing a sequence targeting miR-142-3p.

Additionally, the present invention provides a method for delivering and expressing a heterologous gene in nerve cells, comprising administering the recombinant vector to a subject.

Additionally, the present invention provides 1) a promoter; 2) a base sequence encoding the target protein operably linked to the promoter; and 3) providing an expression cassette containing a base sequence targeting miR-142-3p inserted into the 3`UTR of the above base sequence.

In addition, the present invention provides a method for preventing or treating degenerative brain diseases comprising a base sequence encoding an AIMP-2 splicing variant with deletion of exon 2 and a base sequence targeting miR-142-3p linked to the 3`UTR of the base sequence. Provides a composition for

The recombinant vector of the present invention inserts a sequence targeting miR-142-3p at the end of the AIMP2 splicing variant, thereby controlling the side effects of AIMP2 splicing variant being overexpressed in tumors and CD45-derived cells, especially lymphocyte lineage. and has the effect of controlling expression in leukocyte-type cells to suppress expression. Therefore, the AIMP2 variant can be specifically expressed only in nerve cells and can be selectively expressed only in brain tissue among various tissues, so it can be usefully used in related industries.

Figure 1 is a diagram showing a vector map of the recombinant vector of the present invention.
Figure 2 is a diagram confirming in vitro the neuron-specific expression effect of the recombinant vector of the present invention.
Figure 3 is a diagram confirming the neuron-specific expression effect of the recombinant vector of the present invention in vivo.
Figure 4 is a diagram showing the miR142-3pT (target) sequence in which miR142-3pT (underlined) is repeated four times.
Figure 5A is a diagram showing miR142-3p with 1x, 2x, and 3x repeats and mutations.
Figure 5b is a diagram showing inhibition of miR142-3p in DX2 expression with 1x, 2x, and 3x repeats of miR-142-3pT.
Figure 6 is a diagram showing that the core binding sequence is important for inhibition of DX2. A vector carrying the 3 repeat sequence of miR-142-3pT showed significant DX2 inhibition (Figure 5B), and the DX2 construct was used as a control. Treatment with 100 pmol of miR-142-3p significantly inhibited the tTseq x3 vector but not DX2 and mutant sequences.
Figure 7 is a diagram showing total RNA extracted from the spinal cord after intrathecal injection of scAAV2-DX2-miR142-3p. qRT-PCR was performed.
Figure 8 is a diagram confirming the neuron-specific expression effect of the expression vector of the present invention in vitro.

AIMP2-DX2 is an alternative splicing variant of AIMP2, a tumor suppressor involved in various aspects of cell death, and is known to inhibit tumor apoptosis by inhibiting the function of AIMP2.

KR 10-1067816 (2011) describes that inhibitors of AIMP2-DX2 can treat inflammatory diseases. In addition, AIMP2/p38 promotes ubiquitination of TRAF2 to regulate TNF-alpha-induced apoptosis and AIMP2/p38 regulates TNF-alpha-induced apoptosis. AIMP2-DX2, a splice variant of p38, acts as a competitive inhibitor of AIMP2 and can inhibit TNF-alpha-induced apoptosis by inhibiting ubiquitin of TRAF2, thereby promoting tumor progression and reducing the inflammation marker Cox-2. It is stated that it inhibits the expression of .

In addition, AIMP2-DX2 has previously been identified and reported as a lung cancer-causing factor, and the previous study showed that AIMP2-DX2, a mutant of AIMP2, occurs frequently in cancer cells and causes cancer by interfering with the cancer-suppressing function of AIMP2. was confirmed, and it was discovered that when AIMP2-DX2 is expressed in normal cells, the cancerization of the cells progresses, and conversely, when the generation of AIMP2-DX2 is suppressed, cancer growth is suppressed and a therapeutic effect appears. Additionally, studies using animal models have reported that inhibition of the AIMP2-DX2 target leads to the treatment of ovarian cancer that does not respond to common anticancer drugs such as Taxol and cisplatin. However, AIMP2-DX2 itself does not have the oncogenic ability to transform normal cells.

Additionally, there was a report that AIMP2-DX2 can treat neurological diseases (US2019/0298858 A1).

The present invention provides a recombinant vector containing an AIMP2 variant (AIMP2-DX2) gene with deleted exon 2 and a target nucleic acid of miR-142. The vector of the present invention can specifically express DX2 in nerve cells, but is not expressed in hematopoietic cells such as leukocytes and lymphoid cells. Accordingly, the vectors of the present invention may be useful for specifically targeting nerve cells to treat neurological diseases.

AIMP2-DX2 polypeptide (SEQ ID NO: 2) is a splicing variant of AIMP2 (SEQ ID NO: 3), in which the second exon (SEQ ID NO: 4) of AIMP2 is deleted. Specifically, the AIMP2-DX2 gene includes the base sequence represented by SEQ ID NO: 1, and the AIMP2-DX2 polypeptide includes the amino acid sequence represented by SEQ ID NO: 2.

In one embodiment of the present invention, the AIMP2-DX2 gene is at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% homologous to the sequence represented by SEQ ID NO: 2. It may contain a nucleotide sequence encoding an amino acid. The AIMP2-DX2 gene may include a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2.

The AIMP2-DX2 gene may include a nucleotide sequence that is at least 90%, at least 93%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to the nucleotide sequence of SEQ ID NO: 1. It may include the nucleotide sequence represented by AIMP2-DX2 gene sequence number 1.

The miR-142 target nucleic acid may include a nucleotide sequence including ACACTA. The miR-142 target nucleic acid may include a nucleotide sequence comprising ACACTA and 1-17 additional contiguous nucleotides of SEQ ID NO:5. For example, the miR-142 target nucleic acid may include a nucleotide sequence comprising ACACTA and the adjacent 5' or 3' sequence of ACACTA as shown in SEQ ID NO: 5: 1, 2, 3, 4, 5, 6, 7, 8, 9, It may contain 10, 11, 12, 13, 14, 15, 16, or 17 additional nucleotides.

The miR-142 target nucleic acid is a nucleotide that is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% homologous to the nucleotide sequence of SEQ ID NO: 5 (TCCATAAAGTAGGAAACACTACA; miR-142-3p) May contain sequences. The miR-142 target nucleic acid may include the nucleotide sequence of SEQ ID NO:5.

The miR-142 target nucleic acid may include a nucleotide sequence including ACTTTA. The miR-142 target nucleic acid may comprise a nucleotide sequence comprising ACTTTA and 1-15 additional contiguous nucleotides of SEQ ID NO:7. For example, the miR-142 target nucleic acid may include a nucleotide sequence comprising ACTTTA and the adjacent 5' or 3' nucleotides 1, 2, 3, 4, 5, 6, 7, 8, 9 of ACTTTA, represented by SEQ ID NO: 7. It may contain 10, 11, 12, 13, 14, or 15 additional nucleotides.

The miR-142 target nucleic acid will comprise a nucleotide sequence that is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% homologous to SEQ ID NO: 7 (AGTAGTGCTTCTACTTTATG;miR-142-5p). You can. The miR-142 target nucleic acid may include the nucleotide sequence represented by SEQ ID NO:7.

microRNA (miRNA) is a non-coding RNA molecule that functions to regulate gene expression. MiRNAs function by forming base pairs with complementary sequences inside mRNA molecules. MiRNAs target and bind to messenger RNA (mRNA) transcripts of protein-coding genes, negatively regulating translation or causing mRNA degradation. Currently, more than 2000 human miRNAs have been identified and the miRbase database is publicly available. Many miRNAs are expressed in a tissue-specific manner and play important roles in maintaining tissue-specific function and differentiation.

The recombinant vector of the present invention inserts miR-142-3p and/or miR-142-5p into the target sequence at the end of AIMP2-DX2 and regulates the inhibition of AIMP2-DX2 expression in cd45-derived cells, especially lymphoid and leukocytes, thereby causing tumor growth. The side effects of AIMP2-DX2 mutant overexpression can be controlled. Therefore, AIMP2-DX2 variants may be expressed only in neurons or may be selectively expressed only in brain tissue and not other types of cells or tissues. That is, the expression or activity of AIMP2-DX2 can be inhibited in cells that express miR-142, and the expression or activity of AIMP2-DX2 can be maintained or increased in cells that do not express miR-142. Additionally, when injecting a recombinant vector in vivo, AIMP2-DX2 may be expressed specifically in the central nervous system.

The present invention provides a recombinant vector containing a sequence targeting miR-142-3p and/or miR-142-5p. The present invention provides a recombinant vector containing an AIMP2 variant (AIMP2-DX2) gene with deletion of exon 2 and a target nucleic acid of miR-142-3p and/or miR-142-5p.

In the present invention, the term "recombinant vector" refers to a vector capable of expressing a target protein or target RNA in a suitable host cell, and refers to a genetic construct containing essential regulatory elements operably linked to express the gene insert.

In the present invention, the term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence and a nucleic acid sequence encoding a desired protein or RNA to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA can be operably linked to affect the expression of the encoding nucleic acid sequence. Operational linkage with a recombinant vector can be made using genetic recombination techniques well known in the art, and site-specific DNA cutting and ligation can be done using enzymes generally known in the art.

The recombinant vector may further include a promoter operably linked to AIMP2-DX2. In one embodiment, the promoter is a retrovirus (LTR) promoter, cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, MMT promoter, EF-1 alpha promoter, UB6 promoter, chicken beta-actin promoter, CAG It may be a promoter selected from the group consisting of a promoter, RPE65 promoter, opsin promoter, and combinations thereof.

In the present invention, the term "micro RNA (miRNA)" means MicroRNA (abbreviated as miRNA) is a noncoding RNA consisting of about 20, 21, 22, 23 or 24 nucleotides and plays a role in regulating gene expression. The microRNA acts in the post-transcription stage after gene transcription, and in mammals, it is known that the expression of about 60% of genes is regulated by microRNA. MicroRNAs play an important role in various in vivo processes and have been found to be involved in cancer, heart disease, and neurological diseases. Although miRNA is a single-stranded RNA, a targeting sequence of either single-stranded RNA can be used as long as it can suppress the expression of the target gene among premature two-stranded RNAs. For example, there are miR-142-3p and miR-142-5p in miR-142, and in the present invention, either target array can be used, and both miR-142-3p and miR-142-5p exist in miR-142. is included, and may preferably be miR-142-3p.

The 5' or 3' side of the miR-142 target nucleic acid may be linked to the AIMP2-DX2 gene.

In the present invention, the term "miR-142-3p" means that this gene is present at the site where translocation occurs in aggressive B cell leukemia and is expressed in hematopoietic tissues (bone marrow, spleen, thymus, etc.) It is known. Additionally, the expression of miR-142-3p was confirmed in mouse fetal liver (fetal hematopoietic tissue), and it is known to be involved in the differentiation of the hematopoietic system.

The miR-142-3p and/or miR-142-5p target nucleic acid may be repeated 2-10 times, for example, at least 2-8 times, at least 2-6 times, or at least 4 times.

In one embodiment of the present invention, the miR-142-3p may include the base sequence represented by SEQ ID NO: 3. Additionally, the sequence targeting miR-142-3p may include the base sequence of SEQ ID NO: 4, which binds complementary to the miR-142-3p sequence. The miR-142-3p target sequence of the present invention including the complementary sequence is the base sequence represented by SEQ ID NO: 5, but is not limited thereto.

The recombinant vector may further include a heterologous promoter and a heterologous gene operably linked to the promoter.

As used herein, the term “heterologous gene” may include the coding sequence of a desired product, such as a biologically active protein or polypeptide, an immunogenic or antigenic protein or polypeptide, or a therapeutically active protein or polypeptide.

Polypeptides can complement deficient or absent expression of an endogenous protein in a host cell. The genetic sequence may be derived from a variety of sources, including DNA, cDNA, synthetic DNA, RNA, or combinations thereof. The genetic sequence may include genomic DNA, which may or may not include natural introns. Additionally, the genomic DNA can be obtained with a promoter sequence or polyadenylation sequence. Genomic DNA or cDNA can be obtained in many ways. Genomic DNA can be extracted and purified from appropriate cells by methods known in the art. Alternatively, mRNA can be isolated from cells and used to prepare cDNA by reverse transcription or other methods. Alternatively, the polynucleotide sequence may include a sequence complementary to an RNA sequence, such as an antisense RNA sequence, which may be administered to an individual to inhibit expression of the complementary polynucleotide in the individual's cells.

For the purpose of the present invention, the heterologous gene is an AIMP-2 splicing variant with exon 2 deleted, and the miR-142-3p target sequence of the present invention can be bound to the 3′ UTR of the heterologous gene. The sequence of the AIMP2 protein (312aa version: AAC50391.1 or GI: 1215669; 320aa version: AAH13630.1, GI: 15489023, BC013630.1) is described in the literature (312aa version: Nicolaides, N.C., Kinzler, K.W. and Vogelstein, B. Analysis of the 5' region of PMS2 reveals heterogeneous transcripts and a novel overlapping gene, Genomics 29 (2), 329-334 (1995)/ 320 aa version: Generation and initial analysis of more than 15,000 full-length human and mouse Cdna sequences , Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16899-16903 (2002).

In the present invention, the term "AIMP2 splicing variant" refers to a variant resulting from partial or total loss of the region of exon 2 of exons 1 to 4, and the variant forms a heterodimer with the AIMP2 protein and interferes with the normal function of AIMP2. means that Additionally, when the AIMP2 variant is overexpressed in cells or tissues, cancer may be induced. Therefore, it is necessary to induce tissue-specific expression in order to suppress the occurrence of cancer.

The recombinant vector of the present invention may include sequences represented by SEQ ID NOs: 1 and 5.

The terms “% sequence homology,” “% homology,” or “% homology” for a nucleotide or amino acid sequence are identified by comparing two optimally aligned sequences with a comparison region, and the base sequences in the comparison region are A portion of may contain additions or deletions (i.e., gaps) compared to a reference sequence (which does not contain additions or deletions) for the optimal alignment of the two sequences.

The protein of the present invention includes not only the protein having its native amino acid sequence, but also its amino acid sequence variants are also included within the scope of the present invention.

A protein variant of the present invention refers to a protein having a sequence that differs from the natural amino acid sequence by deletion, insertion, non-conservative or conservative substitution of one or more amino acid residues, or a combination thereof. Amino acid exchanges in proteins and peptides that do not overall alter the activity of the molecule are known in the art (H.Neurath, R.L.Hill, The Proteins, Academic Press, New York, 1979).

The protein or its variant can be extracted from nature, synthesized (Merrifleld, J. Amer. chem. Soc. 85:2149-2156, 1963), or produced by genetic recombination methods based on DNA sequence (Sambrook et al. , Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, 2nd edition, 1989).

The amino acid mutation is made based on the relative similarity of amino acid side chain substitutions, such as hydrophobicity, hydrophilicity, charge, size, etc. Analysis of the size, shape and type of amino acid side chain substitutions shows that arginine, lysine and histidine are all positively charged residues; Alanine, glycine and serine have similar sizes; It can be seen that phenylalanine, tryptophan and tyrosine have similar shapes. Therefore, based on these considerations, arginine, lysine and histidine; Alanine, glycine and serine; And phenylalanine, tryptophan, and tyrosine can be said to be biologically equivalent in function.

In introducing mutations, the hydrophobic index of the amino acid may be considered. Each amino acid is assigned a hydrophobicity index based on its hydrophobicity and charge: isoleucine (+4.5); Valine (+4.2); leucine (+3.8); phenylalanine (+2.8); Cysteine/Cysteine (+2.5); Methionine (+1.9); Alanine (+1.8); Glycine (-0.4); threonine (-0.7); Serine (-0.8); tryptophan (-0.9); Tyrosine (-1.3); Proline (-1.6); histidine (-3.2); glutamate (-3.5); Glutamine (-3.5); Aspartate (-3.5); Asparagine (-3.5); Lysine (-3.9); and arginine (-4.5).

The hydrophobic amino acid index is very important in imparting interactive biological functions to proteins. It is a known fact that similar biological activity can be maintained only when substituted with an amino acid having a similar hydrophobic index. When introducing a mutation with reference to the hydrophobicity index, substitution is made between amino acids showing a difference in the hydrophobicity index, preferably within ±2, more preferably within ±1, and even more preferably within ±0.5.

Meanwhile, it is also well known that substitution between amino acids with similar hydrophilicity values results in proteins with equal biological activity. As disclosed in U.S. Pat. No. 4,554,101, the following hydrophilicity values are assigned to each amino acid residue: arginine (+3.0); Lysine (+3.0); Asphaltate (+3.0± 1); glutamate (+3.0± 1); Serine (+0.3); Asparagine (+0.2); Glutamine (+0.2); Glycine (0); threonine (-0.4); Proline (-0.5 ± 1); Alanine (-0.5); histidine (-0.5); Cysteine (-1.0); Methionine (-1.3); Valine (-1.5); leucine (-1.8); isoleucine (-1.8); Tyrosine (-2.3); Phenylalanine (-2.5); Tryptophan (-3.4).

When introducing a mutation with reference to the hydrophilicity value, substitution is made between amino acids that show a difference in hydrophilicity value, preferably within ±2, more preferably within ±1, and even more preferably within ±0.5.

Amino acid exchanges in proteins that do not overall alter the activity of the molecule are known in the art (H. Neurath, R.L. Hill, The Proteins, Academic Press, New York, 1979). The most common exchanges are amino acid residues Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Thy/Phe, Ala/ It is an exchange between Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, and Asp/Gly.

The vector of the present invention can typically be constructed as a vector for cloning or as a vector for expression. Additionally, the vector of the present invention can be constructed using prokaryotic cells or eukaryotic cells as hosts. When the vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of advancing transcription (e.g., tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pLλ promoter, pRλ promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter, and T7 promoter, etc.), a ribosome binding site for initiation of translation, and a transcription/translation termination sequence. When E. coli (e.g., HB101, BL21, DH5α, etc.) is used as the host cell, the promoter and operator regions of the E. coli tryptophan biosynthesis pathway (Yanofsky, C. (1984), J. Bacteriol., 158:1018- 1024) and the left-handed promoter of phage λ (pLλ promoter, Herskowitz, I. and Hagen, D. (1980), Ann. Rev. Genet., 14:399-445) can be used as a control region.

Meanwhile, the vector that can be used in the present invention may be one or more types selected from the group consisting of viral vectors, linear DNA, and plasmid DNA.

In the present invention, the term “viral vector” refers to a viral vector that can deliver a therapeutic gene or genetic material to a desired cell, tissue, and/or organ.

The viral vectors include Adenovirus, Adeno-associated virus, Lentivirus, Retrovirus, Human immunodeficiency virus (HIV), Murine leukemia virus (MLV), Avian sarcoma/leukosis (ASLV), and Spleen necrosis (SNV). virus), RSV (Rous sarcoma virus), MMTV (Mouse mammary tumor virus), and Herpes simplex virus, but is not limited thereto. The viral vector may be one or more selected from the group consisting of adeno-assisted virus (AAV), adenovirus, lentivirus, retrovirus, vaccinia virus, and herpes simplex virus, but is not limited thereto.

Retrovirus has the function of integrating into the genome of the host cell. Although it is harmless to the human body, it can inhibit the function of normal cells when integrated, infects various cells, proliferates easily, and has a length of about 1 to 7 kb. It has the characteristic of being able to accept foreign genes and have the ability to create replication-deficient viruses. However, retroviruses have disadvantages in that they are difficult to infect post-mitotic cells, gene transfer is difficult in vivo, and somatic tissue must always be propagated in vitro. Additionally, retroviruses can be integrated into proto-oncogenes, leading to a risk of mutation and cell necrosis.

Meanwhile, adenovirus has several advantages as a cloning vector. It is medium-sized and can replicate in the cell nucleus, is clinically non-toxic, and is stable even when foreign genes are inserted. , it does not cause rearrangement or loss of genes, can transform eukaryotes, and is expressed stably and at a high level even when integrated into the host cell chromosome. Good host cells for adenovirus are the cells that cause hematopoietic, lymphoid, and myeloma in humans. However, because it is linear DNA, it is difficult to multiply, it is not easy to recover an infected virus, and the virus infection rate is low. In addition, expression of the transferred gene peaks after 1 to 2 weeks, and in some cells, expression is maintained for only 3 to 4 weeks. Also, what is problematic is that it has high immunogenicity.

Adeno-associated virus (AAV) has recently been preferred as it can overcome the above problems and has many advantages as a gene therapy agent. It is also called adeno-satellite virus. The diameter of adeno-assisted virus particles is 20 nm, and it is known to have little harm to the human body and has been approved for sale as a gene therapy agent in Europe.

The AAV is a single-stranded provirus and requires a helper virus to replicate. The AAV genome is 4,680 bp and can be inserted into a specific region of chromosome 19 of infected cells. The trans-gene is inserted into plasmid DNA connected by two inverted terminal repeat (ITR) sequence segments of 145 bp each and a signal sequence segment. It is transfected with other plasmid DNA expressing the AAV rep and cap parts, and adenovirus is added as a helper virus. AAV has the advantages of a wide range of host cells to which genes can be delivered, fewer immune side effects upon repeated administration, and a long gene expression period. Moreover, even if the AAV genome is integrated into the chromosome of the host cell, it is safe and does not modify or rearrange the host's gene expression.

The adeno-assisted virus is known to have four serotypes. Among the many adeno-assisted virus serotypes that can be used for the delivery of genes of interest, the most widely studied vector is Adeno-associated virus serotype 2, which is used to treat cystic fibrosis, hemophilia, and Canavan disease. It is currently being used for clinical gene transfer. Additionally, the potential of rAAV (recombinant adeno-associated virus) has recently been increasing in the field of cancer gene therapy. Adeno-assisted virus serotype 2 is also used in the present invention, and an appropriate viral vector can be selected and applied, but is not limited thereto.

In addition, when the vector of the present invention is an expression vector and uses a eukaryotic cell as a host, a promoter derived from the genome of a mammalian cell (e.g., metallothionein promoter) or a promoter derived from a mammalian virus (e.g., adenovirus) Viral late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and HSV four promoter) can be used, specifically, retrovirus LTR, cytomegalovirus (CMV) promoter, Rous sarcoma virus ( RSV) promoter, MMT promoter, EF-1 alpha promoter, UB6 promoter, chicken beta-actin promoter, CAG promoter, RPE65 promoter and opsin promoter, but may include one or more selected from the group consisting of promoters, It is not limited thereto, and generally has a polyadenylation sequence as a transcription termination sequence.

In order to facilitate protein purification, the vector of the present invention may be fused with other sequences as needed, and the fused sequences include, for example, glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA) ), FLAG (IBI, USA), and 6x His (hexahistidine; Quiagen, USA) may be used, but are not limited thereto. In addition, the expression vector of the present invention may include an antibiotic resistance gene commonly used in the art as a selection marker, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, and geneticin. , there are resistance genes for neomycin and tetracycline.

Additionally, the present invention provides a gene delivery vehicle containing a recombinant vector containing a sequence targeting miR-142, such as miR-142-3p and/or miR-142-5p.

As used herein, the term “gene transfer” typically includes the transfer of genetic material to a cell for transcription and expression. The method is ideal for protein expression and therapeutic purposes. Various delivery methods are known, such as DNA transfection and viral transduction. It refers to virus-mediated gene transfer due to the efficiency of delivery and high levels of expression of the transferred gene and, if necessary, the possibility to target specific receptors and/or cell types through native affinity or pseudotyping.

The gene carrier may be a transformant transformed with the recombinant vector of the present invention, and transformation includes any method of introducing a nucleic acid into an organism, cell, tissue or organ, and as known in the art, into a host cell. It can be performed by selecting an appropriate standard technique. These methods include electroporation, protoplast fusion, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, agitation using silicon carbide fibers, agrobacteria-mediated transformation, PEG, dextran sulfate, Includes, but is not limited to, lipofectamine.

The gene carrier is intended to express a heterologous gene in nerve cells, suppresses the expression of the heterologous gene in CD45-derived cells, and can increase the expression of the heterologous gene in brain tissue. The CD45 is a transmembrane protein tyrosine phosphatase located in most hematopoietic cells, which can define cells according to the molecules on the surface of the cell. It is a cellular marker of white blood cell clusters and B lymphocytes. The gene delivery vehicle of the present invention may not be expressed in CD45-derived cells, especially lymphoid and leukocyte lineage cells.

The gene delivery vehicle may further include a pharmaceutically acceptable carrier, excipient, or diluent.

Additionally, the present invention provides a method for delivering and expressing a heterologous gene in nerve cells, comprising administering the recombinant vector to a subject.

This method can increase the expression of heterologous genes in the central nervous system (spinal space and brain tissue) and control the expression of heterologous genes in other tissues.

Additionally, the present invention provides 1) a promoter; 2) a base sequence encoding a target protein operably linked to the promoter; and 3) providing an expression cassette containing a base sequence targeting miR-142-3p linked to the 3`UTR of the above base sequence. The present invention relates to 1) a promoter; 2) a base sequence encoding a target protein operably linked to the promoter; and 3) providing an expression cassette containing a base sequence targeting miR-142-5p inserted into the 3`UTR of the above base sequence.

In the present invention, the term "expression cassette" includes a promoter, a nucleotide sequence encoding a signal peptide, and a gene encoding a target protein, and is operably linked downstream of the signal peptide to express the target protein for secretion production. It means a unit cassette that can be ordered. In the present invention, the expression cassette for secretion can be used interchangeably with the secretion system. Various factors that can assist in efficient production of the target protein may be included inside or outside of such an expression cassette.

In addition, the present invention provides a method for preventing or treating neurodegenerative diseases, including a base sequence encoding an AIMP-2 splicing variant with deletion of exon 2 and a base sequence targeting miR-142-3p linked to the 3`UTR of the base sequence. Provides a composition for

Accordingly, the present invention provides a method for preventing or treating neurological diseases comprising the step of administering the recombinant vector of the present invention to an individual in need of treatment. The neurological diseases include Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, retinal degeneration, mild cognitive impairment, and multiple-infarct dementia. -infarct dementia, frontotemporal dementia, dementia with Lewy bodies, Huntington's disease, neurodegenerative disease, metabolic brain disease, depression, epilepsy, multiple sclerosis, cortex Corticobasal degeneration, multiple system atrophy, progressive supranuclear palsy, dentatorubropallidoluysian atrophy, spinocerebella ataxia, primary It may be, but is not limited to, one or more types selected from the group consisting of primary lateral sclerosis, spinal muscular atrophy, and stroke. In one embodiment, the neurological disease is amyotrophic disease. lateral sclerosis (ALS). The treatment may be to improve memory, dyskinesia, motor skills, or extend the lifespan of an individual suffering from a neurological disease such as ALS, Alzheimer's disease, or Parkinson's disease. In one embodiment, The treatment may improve the motor skills or extend the lifespan of an individual suffering from a neurological disease such as ALS.

The vector of the present invention can prevent or treat neurological diseases by inhibiting apoptosis, improving movement disorders, and/or inhibiting antioxidant stress, but is not limited thereto.

In the present invention, the term “treatment” includes complete cure of the neurodegenerative disease as well as partial cure, improvement, and relief of symptoms due to the neurodegenerative disease as a result of applying the pharmaceutical composition of the present invention to an individual with a neurodegenerative disease.

In the present invention, the term "prevention" refers to the prevention of symptoms caused by a neurodegenerative disease by suppressing or blocking symptoms or phenomena such as cognitive impairment, behavioral disorders, and nerve destruction by applying the pharmaceutical composition of the present invention to an individual with a neurodegenerative disease. This dictionary means to prevent something from happening.

The pharmaceutical composition of the present invention may further include adjuvants in addition to the active ingredients. Any adjuvant known in the art may be used without limitation, but, for example, Freund's complete adjuvant or incomplete adjuvant may be further included to increase immunity.

The pharmaceutical composition according to the present invention can be prepared by incorporating the active ingredient into a pharmaceutically acceptable carrier. Here, pharmaceutically acceptable carriers include carriers, excipients, and diluents commonly used in the pharmaceutical field. Pharmaceutically acceptable carriers that can be used in the pharmaceutical composition of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, Examples include calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

The pharmaceutical composition of the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, or sterile injection solutions according to conventional methods. .

When formulated, it can be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and such solid preparations contain the active ingredient plus at least one excipient, such as starch, calcium carbonate, sucrose, lactose, and gelatin. It can be prepared by mixing etc. Additionally, in addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, and syrups. In addition to the commonly used diluents such as water and liquid paraffin, they contain various excipients such as wetting agents, sweeteners, fragrances, and preservatives. You can. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. As a base for suppositories, witepsol, tween 61, cacao, laurel, glycerogelatin, etc. can be used.

The pharmaceutical composition according to the present invention can be administered to an individual through various routes. All modes of administration are contemplated, for example, by oral, intravenous, intramuscular, subcutaneous, or intraperitoneal injection.

The preferred dosage of the therapeutic composition according to the present invention depends on factors such as formulation method, administration method, patient's age, weight, sex, severity of disease symptoms, food, administration time, administration route, excretion rate, and reaction sensitivity. Although different, they can be appropriately selected by those skilled in the art.

However, for therapeutic effect, a normally skilled physician can easily determine and prescribe an effective dosage for the desired treatment. For example, the therapeutic agent includes intravascular injection, subcutaneous injection, intramuscular injection, and direct injection into the ventricle or spinal cord using a microsyringe. At this time, multiple injection and repeated administration are possible. For example, the effective dose is 0.05 to 15 mg/kg for vectors per kg of body weight, and 5 Х 10 ¹¹ to 3.3 Х 10 ¹⁴ virus particles (2.5 Х) for recombinant viruses. 10 ¹² to 1.5 Х 10 ¹⁶ IU)/kg, for cells, 5 Х 10 ² to 5 Х 10 ⁷ cells/kg, preferably 0.1 to 10 mg/kg for vectors, and 5 for recombinant viruses. Х 10 ¹² to 3.3 Х 10 ¹³ particles (2.5 Х 10 ¹³ to 1.5 Х10 ¹⁵ IU)/kg, for cells, 5 Х10 ³ to 5 Х 10 ⁶ cells/kg, and can be administered 2 to 3 times a week. . The composition as described above is not necessarily limited to this, and may vary depending on the patient's condition and the degree of onset of the neurological disease. The effective dose for other subcutaneous, intramuscular injections, and direct administration to the affected area is 9 Х 10 ¹⁰ to 3.3 Х 10 ¹⁴ recombinant virus particles administered at intervals of 10 cm, and can be administered 2 to 3 times a week. The composition as described above is not necessarily limited to this, and may vary depending on the patient's condition and the degree of onset of the neurological disease. More specifically, the pharmaceutical composition of the present invention contains 1 Х 10 ¹⁰ to 1 Х 10 ¹² vg (virus genome)/mL of recombinant adeno-assisting virus, and typically 1 Х 10 ¹² vg is injected every other day for 2 weeks. It's good to do it. Administration may be administered once a day, or may be administered several times.

The pharmaceutical composition may be formulated into various oral or parenteral dosage forms.

Dosage forms for oral administration include, for example, tablets, pills, hard and soft capsules, solutions, suspensions, emulsifiers, syrups, granules, etc. These dosage forms contain diluents (e.g. lactose, dextrose, water, etc.) in addition to the active ingredient. crose, mannitol, sorbitol, cellulose and/or glycine), lubricants (e.g. silica, talc, stearic acid and its magnesium or calcium salts and/or polyethylene glycol). Additionally, the tablets may contain binders such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidine, and in some cases starch, agar, alginic acid. or disintegrants such as sodium salts thereof or effervescent mixtures and/or absorbents, colorants, flavoring and sweetening agents. The formulation can be prepared by conventional mixing, granulating or coating methods.

In addition, representative formulations for parenteral administration are injectable formulations, and solvents for injectable formulations include water, Ringer's solution, isotonic saline solution, or suspension. The sterile fixed oil of the injectable preparation can be used as a solvent or suspending medium, and any non-irritating fixed oil, including mono- and di-glycerides, can be used for this purpose. Additionally, the injectable preparation may use fatty acids such as oleic acid.

Additional embodiments A to X are as follows.

A. Recombinant vector containing the miR-142-3p target sequence.

B. The recombinant vector according to Embodiment A, wherein miR-142-3p contains the base sequence represented by SEQ ID NO: 3.

C. The recombinant vector of Embodiment A, wherein the miR-142-3p target sequence is a sequence that binds complementary to the miR-142-3p sequence.

D. The recombinant vector according to Embodiment A, wherein the miR-142-3p target sequence includes the base sequence represented by SEQ ID NO: 4.

E. The recombinant vector according to Embodiment A, wherein the miR-142-3p target sequence includes the base sequence represented by SEQ ID NO: 5.

F. The recombinant vector according to Embodiment A, wherein the miR-142-3p target sequence includes the base sequence shown in SEQ ID NO: 4 and a base sequence having more than 90% homology.

G. The recombinant vector according to Embodiment A, wherein the miR-142-3p target sequence includes the base sequence shown in SEQ ID NO: 5 and a base sequence having more than 90% homology.

H. The recombinant vector of Embodiment A, further comprising a heterologous promoter and a heterologous gene operably linked to the promoter.

I. The recombinant vector of embodiment H, wherein the miR-142-3p target sequence is inserted into the 3' UTR of the heterologous gene.

J. The recombinant vector of embodiment H, wherein the heterologous gene is an AIMP2 variant with deletion of exon 2.

K. The method of embodiment H, wherein the heterologous promoter is a retrovirus (LTR) promoter, cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, MMT promoter, EF-1 alpha promoter, UB6 promoter, chicken beta- A recombinant vector selected from the group consisting of actin promoter, CAG promoter, RPE65 promoter, opsin promoter, and combinations thereof.

L. The recombinant vector according to Embodiment A, wherein the recombinant vector is one type selected from the group consisting of viral vectors, linear vectors, and plasmid vectors.

M. In embodiment L, the viral vector is Adenovirus, Adeno-associated virus, Lentivirus, Retrovirus, Human immunodeficiency virus (HIV), Murine (MLV) leukemia virus), ASLV (Avian sarcoma/leukosis), SNV (Spleen necrosis virus), RSV (Rous sarcoma virus), MMTV (Mouse mammary tumor virus), and Herpes simplex virus. A recombinant vector that is the above.

N. In embodiment A, the recombinant vector includes the nucleotide sequence represented by SEQ ID NO: 7.

O. Gene delivery vehicle containing a recombinant vector containing a sequence targeting miR-142-3p.

P. The method of embodiment O, wherein the gene carrier expresses a heterologous gene in a nerve.

Q. The gene delivery vehicle of embodiment O, wherein the gene delivery vehicle inhibits heterologous gene expression in CD45-derived cells.

R. The gene carrier of embodiment O, wherein the gene carrier increases heterologous gene expression in brain tissue.

S. A method for delivering and expressing a heterologous gene in nerve cells comprising administering the recombinant vector of Embodiment A to a subject.

T. The method of embodiment S, wherein the method increases the expression of the heterologous gene in neural tissue and controls the expression of the heterologous gene in other tissues.

U. Expression cassette comprising:

1) Promoter;

2) a base sequence encoding a target protein operably linked to the promoter; and

3) A base sequence targeting miR-142-3p inserted into the 3`UTR of the above base sequence.

V. The expression cassette of embodiment U, wherein the target protein is an AIMP-2 variant with exon 2 deleted.

W. A composition for preventing or treating degenerative brain diseases comprising a base sequence encoding an AIMP-2 splicing variant with deletion of exon 2 and a base sequence targeting miR-142-3p linked to the 3`UTR of the base sequence .

X. The method of embodiment W, wherein the degenerative brain disease is Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, retinal degeneration, mild cognitive impairment, Multi-infarct dementia, frontotemporal dementia, dementia with Lewy bodies, Huntington's disease, neurodegenerative disease, metabolic brain disease, depression, epilepsy, Multiple sclerosis, corticobasal degeneration, multiple system atrophy, progressive supranuclear palsy, dentatorubropallidoluysian atrophy, spinocerebellar One or more types selected from the group consisting of spinocerebella ataxia, primary lateral sclerosis, spinal muscular atrophy, and stroke.

The present invention will be described in more detail through the following examples. However, the following examples are only for illustrating the content of the present invention and are not intended to limit the present invention.

<Example 1> Production of recombinant vector of the present invention

CD45 is a transmembrane protein tyrosine phosphatase located mostly in hematopoietic cells. It can define cells according to the molecules on their surface. CD45 is found in all leukocytes. It is a cellular marker of clusters and B lymphocytes. The present inventors created a recombinant vector that specifically expresses only neural cells, but does not express CD45-derived cells, especially lymphoid and leukocyte cells. The recombinant vector contains a splicing variant in which exon 2 of AIMP2 (Aminoacyl TRNA Synthetase Complex Interacting Multifunctional Protein 2) is deleted, and is produced by inserting a miRNA that can regulate the expression of the AIMP2 variant. did.

The AIMP2 variant is a splicing mutation in AIMP2, which results in loss of the ability to degrade TRAF2 (TNF receptor-associated factor 2), which is related to tumor signaling, and inhibits the function of AIMP2 by competing with AIMP2 for binding to TRAF2. As a result, it was confirmed that AIMP2 was overexpressed in tumors by interfering with its tumor suppressing action.

Therefore, the recombinant vector of the present invention was constructed as described above to suppress tumor overexpression of the AIMP2 variant and induce expression specifically only in nerve cells.

1-1. AIMP2 mutant production

AIMP2 is one of the proteins involved in the formation of aminoacyl-tRNA synthetase (ARSs) complexes and acts as a tumor suppressor. In order to construct a plasmid expressing a mutant in which exon 2 of AIMP2 was deleted, the cDNA of the AIMP2 mutant was cloned into pcDNA3.1-myc. The AIMP2 variant was amplified from H322 cDNA using primers with EcoR1 and Xho I linkers and then cloned into pcDNA3.1-myc using EcoR1 and Xho1.

The AIMP2 variant of the present invention is represented by the base sequence of SEQ ID NO: 1 and the amino acid of SEQ ID NO: 2.

1-2. Selection of miRNA and its target sequence

As described above, it was confirmed that the AIMP2 variant of the present invention is overexpressed in tumors. In order to safely express it in nerve cells, which are target cells, while suppressing the expression of the AIMP2 variant in leukocyte-related cells and lymphocyte-related cells, the AIMP2 MiRNAs and their targets that can regulate variant expression were selected.

For this purpose, miR-142-3p, which is specifically expressed only in hematopoietic cells that produce leukocyte-related cells and lymphocyte-related cells, was selected as a target. To create a sequence targeting the miR-142-3p, microarray data of mouse B cells and computer programming (mirSVR score) of the gene targeted by miR-142-3p were used. The miR-142-3p has a nucleotide sequence represented by SEQ ID NO: 3, and the sequence targeting miR-142-3p is represented by a nucleotide sequence represented by SEQ ID NO: 4, which binds complementary to the miR-142-3p sequence. The target sequence of miR-142-3p of the present invention is represented by the base sequence represented by SEQ ID NO: 5.

The miR-142-3p target sequence of the present invention includes a restriction enzyme (NheⅠ, HindⅢ, BmtⅠ) site sequence (ccagaagcttgctagc) and a restriction enzyme (HindⅢ) site sequence (aagcttgtag) for cloning. It contains a nucleotide sequence represented by SEQ ID NO: 5 repeated four times along with a linker (tcac and gatatc) connecting it.

1-3. Construction of recombinant vector of the present invention

To construct the recombinant vector of the present invention, the miR-142-3p target sequence (SEQ ID NO: 5) was inserted into the 3'UTR of the AIMP2 variant (SEQ ID NO: 1) of the present invention. The combination of the AIMP-2 variant and the miR-142-3p target sequence is shown in the base sequence of SEQ ID NO: 6, and was specifically cut using NheI and Hind III sites. The recombinant vector of the present invention is shown in Figure 1.

<Example 2> Confirmation of neuron-specific expression of the recombinant vector of the present invention

2-1. Confirmation of neuron-specific expression effect in vitro

Since miR142-3p is specifically expressed only in hematopoietic stem cells, the level of AIMP2 variant expression in specific cells according to the knockdown of the AIMP2 variant of the present invention depends on the expression of the target sequence of miR142-3p of the recombinant vector of the present invention. was confirmed.

Specifically, a group not treated with the recombinant vector of the present invention (SHAM), an empty vector treated group (NC vector), an AIMP2 variant only vector treated group (pscAAV-DX2), and a group treated with the recombinant vector of the present invention (pscAAV-DX2- (miR142-3pT) was placed . The concentration of all vectors was ug/ul, and 2.5 ul (2.5 ug) of each was treated. Each treatment group was treated with THP-1 cell line (human leukemic monocyte cells) and SH-SY5Y cell line (neuroblastoma), and knockdown of AIMP2 mutant was confirmed. This qPCR was performed using the primers shown in Table 1 below (denaturation for 15 seconds, annealing and extension for 30 seconds at a temperature of 60 degrees, 40 cycles).

As a result, it was confirmed that the AIMP2 variant was not expressed in the group not treated with the recombinant vector of the present invention (SHAM) or the group treated with the empty vector (NC vector). In addition, in the AIMP2 mutant vector treatment group (pscAAV-DX2), it was confirmed that it was expressed in both the THP-1 cell line and the SH-SY5Y cell line, confirming that expression was not specifically induced in nerve cells. On the other hand, in the recombinant vector treatment group of the present invention, it was confirmed that the AIMP2 variant was specifically expressed only in the SH-SY5Y cell line (Figure 2).

Example 3. Materials and Methods

3-1. qRT-PCR

Total RNA was isolated from spinal cord using TRIzol (Invitrogen, Waltham, MA, USA). The extracted RNA was quantified using a spectrophotometer (ASP-2680, ACTgene, USA). To create cDNA, reverse transcription was performed using SuperScript Ⅲ First-Strand (Invitrogen). The resulting cDNA was used in real-time PCR using SYBR green PCR master mix (ThermoFisher Scientific, USA). Expression data from the results of two experiments was used for 2-ΔΔCt statistical analysis, and GAPDH expression was used for standardization.

3-2. animal testing

hSOD1 G93A transgenic mice (B6.Cg-Tg(SOD1*G93A)1Gur/J) were purchased from J ackson Laboratories (Bar Harbor, ME, USA) and used. Age-matched WT control mice were also used. Animals were housed in individual cages at the Seoul National University Animal Laboratory under pathogen-free conditions and constant environmental conditions (temperature 21-23°C, 50-60% humidity, and 12-h day/dark cycle). All experiments were conducted in accordance with the guidelines of SNUIACUC (Seoul National University Institutional Animal Care and Use Committee, Aug. 7, 2017), and the experiments were approved by the Animal Experiment Ethics Committee “SNUIACUC” (Approval No. SNU-170807-1) . At the pre-symptomatic stage, AAV-GFP and DX2 vectors were administered to female mice of the same age, and AAV-GFP or AAV-DX2 was directly injected intrathecally into the lumbar spine (the third lumbar spine vertebra, L3). A total of 8 μl (4 μl/point) of AAV-GFP or AAV-DX2 vector was slowly injected into two points using a Hamilton syringe (Hamilton, Switzerland) (1 μl/min), and the injection needle was slowly withdrawn to prevent loss of the injected vector.

3-3. DX2 expression inhibition experiment of miR142-3p target sequence

Inhibition of DX2 expression was observed when the miR142-3p binding core sequence was included once.

HEK293 cells were transfected with x1, x2, and x3 repeat miR-142-3p target sequence vector and 100 pmol miR-142-3p using lipofectamine 2000 (Invitrogen, US), and then incubated for 48 hours. Then, the amount of DX2 mRNA was analyzed by PCR. Inhibition of DX2 expression was observed when the miR142-3p binding core sequence was included once. (Figure 5b).

Example 4.

4-1. Enhanced inhibition of DX2 expression through miR142-3p binding core sequence repeats

Tseq x1 contains the core binding sequence once, Tseq x2 contains the core binding sequence repeated twice, and Tseq x3 contains the binding core sequence repeated three times (Figure 5a).

DX2 expression was observed to be suppressed starting from the case where the miR142-3p binding core sequence was included once. HEK293 cells were transiently transfected with x1, x2, and x3 repeats miR-142-3p T seq vector and 100 pmol miR-142-3p using lipofectamine 2000 (Invitrogen, US) and incubated for 48 hours. . Then, the amount of DX2 mRNA was analyzed by PCR. The effect of suppressing DX2 expression increased in proportion to the number of repetitions of the core binding sequence. DX2 expression was suppressed to the greatest extent when using a vector in which the miR142-3p target core sequence was repeated three times. (Figure 5B).

4-2. Combined core sequence modifications

Using mouse B cell microarray data and the mirSVR score of the miR-142-3p gene, a core sequence that can bind to the miR-142-3p sequence was predicted. In order to confirm that the core sequence plays a key role in suppressing DX2 expression, four bases of the binding core sequence were substituted as follows: (5'-AACACTAC-3' → 5'-CCACTGCA-3') (Figure See original sequence in 4 and schematic in Figure 5a).

4-3. Confirmation of importance of core sequence in suppressing DX2 expression of miR142-3p target sequence

Four binding core sequences were replaced (Figure 5A). HEK293 cells were transfected with DX2-miR-142-3p T seq x3 repeat vector (Tseq3x) or core sequence mutation vector (mut) together with 100 pmol miR-142-3p using lipofectamin 2000 (Invitrogen, US). Incubation was performed for 48 hours. Expression of DX2 mRNA was analyzed by PCR. The Tseq x3 repeat vector, which significantly suppressed DX2 expression, and a vector containing no binding core sequence (DX2) were used as controls (FIG. 5b).

DX2 expression was significantly suppressed in the group using the Tseq x3 repeat vector, but this suppression phenomenon was not observed in the group using the mutant vector (mut) (Figure 6).

4-4. Tissue distribution data in intraparenchymal injection mouse model

Specifically, there were an empty vector treatment group (NC vector), an AIMP2 mutant single vector treatment group (pscAAV-DX2), and a recombinant vector treatment group of the present invention (pscAAV-DX2-miR142-3pT). Intraparenchymal was treated with 10 ul (10 ⁹ vg) of each virus at a concentration of 10 ⁸ vg/ul. After intracranial injection of each treatment group into mice, one week later colon tissue, lung tissue, brain tissue, liver tissue, kidney tissue, thymus tissue, spleen tissue and peripheral blood mononuclear tissue. Expression of AIMP2 variants was confirmed in cells (peripheral blood mononuclear cells, PBMC). This qPCR was performed using the primers shown in Table 1 below (denaturation for 15 seconds, annealing and extension for 30 seconds at a temperature of 60 degrees, 40 cycles).

As a result, it was confirmed that in the group treated with the recombinant vector of the present invention, the expression of the AIMP2 variant was specifically increased only in brain tissue. On the other hand, it was confirmed that AIMP2 variants were hardly expressed in tissues other than brain tissue (Figure 3).

4-5. Tissue distribution data from intrathecal injection model

After intrathecal injection of scAAV2-DX2-miR142-3p, total RNA was extracted from the spinal cord, and then qRT-PCR was performed. DX2 expression was restricted to the spinal cord, the site of local injection. In hSOD1 G93A transgenic mice, scAAV-DX2miR142-3p was expressed by intrathecal injection. By injection of control excipient, it was observed that the recombinant vector of the present invention was expressed only in the spinal cord, but not in the brain and sciatic nerve (FIG. 7).

Example 5.

The experiment was performed identically to Example 2, except that HEK293 cells were co-transfected with three plasmids (Oxgene, UK) encoding all components essential for producing recombinant AAV2 particles.

Additionally, HEK293 cells were transfected with pSF-AAV-ITR-CMV-EGFP-ITR-KanR (Oxgene, UK) alone, which inserted AIMP2-DX2 or DX2-miR142 targeting nucleotides, as an expression vector rather than for AAV particle production. .

DX2 coding vector (2ug) and DX2-miR142 target sequence coding vector (2ug) were transfected into THP-1 cells (human monocytes, CD45+ cells) and SH-SY5Y (neuroblastoma). After 48 hours, cells were harvested and mRNA was isolated. Using the synthesized cDNA, the expression of DX2 was analyzed by PCR.

The level of DX2 expression was similar in SH-SY5Y transfected with the DX2 coding vector and the DX2-miR142-3p target sequence coding vector, but DX2 expression was low in THP-1 transfected with the DX2-miR142-3p target sequence coding vector. decreased significantly. Therefore, it can be seen that miR142-3p acts only in THP-1 cells (Figure 8).

<110> GENEROATH CO., LTD <120> Recombinant vector containing AIMP2-DX2 and target sequence for miR-142-3p <130> PN2009-405 <160> 9 <170> KoPatentIn 3.0 <210> 1 <211> 756 <212> DNA <213> Homo sapiens <400> 1 atgccgatgt accaggtaaa gccctatcac gggggcggcg cgcctctccg tgtggagctt 60 cccacctgca tgtaccggct ccccaacgtg cacggcagga gctacggccc agcgccgggc 120 gctggccacg tgcaggatta cggggcgctg aaagacatcg tgatcaacgc aaacccggcc 180 tcccctcccc tctccctgct tgtgctgcac aggctgctct gtgagcactt cagggtcctg 240 tccacggtgc acacgcactc ctcggtcaag agcgtgcctg aaaaccttct caagtgcttt 300 ggagaacaga ataaaaaaca gccccgccaa gactatcagc tgggattcac tttaatttgg 360 aagaatgtgc cgaagacgca gatgaaattc agcatccaga cgatgtgccc catcgaaggc 420 gaagggaaca ttgcacgttt cttgttctct ctgtttggcc agaagcataa tgctgtcaac 480 gcaaccctta tagatagctg ggtagatatt gcgatttttc agttaaaaga gggaagcagt 540 aaagaaaaag ccgctgtttt ccgctccatg aactctgctc ttgggaagag cccttggctc 600 gctgggaatg aactcaccgt agcagacgtg gtgctgtggt ctgtactcca gcagatcgga 660 ggctgcagtg tgacagtgcc agccaatgtg cagaggtgga tgaggtcttg tgaaaacctg 720 gctcctttta acacggccct caagctcctt aagtga 756 <210> 2 <211> 251 <212> PRT <213> Homo sapiens <400> 2 Met Pro Met Tyr Gln Val Lys Pro Tyr His Gly Gly Gly Ala Pro Leu 1 5 10 15 Arg Val Glu Leu Pro Thr Cys Met Tyr Arg Leu Pro Asn Val His Gly 20 25 30 Arg Ser Tyr Gly Pro Ala Pro Gly Ala Gly His Val Gln Asp Tyr Gly 35 40 45 Ala Leu Lys Asp Ile Val Ile Asn Ala Asn Pro Ala Ser Pro Pro Leu 50 55 60 Ser Leu Leu Val Leu His Arg Leu Leu Cys Glu His Phe Arg Val Leu 65 70 75 80 Ser Thr Val His Thr His Ser Ser Val Lys Ser Val Pro Glu Asn Leu 85 90 95 Leu Lys Cys Phe Gly Glu Gln Asn Lys Lys Gln Pro Arg Gln Asp Tyr 100 105 110 Gln Leu Gly Phe Thr Leu Ile Trp Lys Asn Val Pro Lys Thr Gln Met 115 120 125 Lys Phe Ser Ile Gln Thr Met Cys Pro Ile Glu Gly Glu Gly Asn Ile 130 135 140 Ala Arg Phe Leu Phe Ser Leu Phe Gly Gln Lys His Asn Ala Val Asn 145 150 155 160 Ala Thr Leu Ile Asp Ser Trp Val Asp Ile Ala Ile Phe Gln Leu Lys 165 170 175 Glu Gly Ser Ser Lys Glu Lys Ala Ala Val Phe Arg Ser Met Asn Ser 180 185 190 Ala Leu Gly Lys Ser Pro Trp Leu Ala Gly Asn Glu Leu Thr Val Ala 195 200 205 Asp Val Val Leu Trp Ser Val Leu Gln Gln Ile Gly Gly Cys Ser Val 210 215 220 Thr Val Pro Ala Asn Val Gln Arg Trp Met Arg Ser Cys Glu Asn Leu 225 230 235 240 Ala Pro Phe Asn Thr Ala Leu Lys Leu Leu Lys 245 250 <210> 3 <211> 936 <212> DNA <213> Homo sapiens <400> 3 atgccgatgt accaggtaaa gccctatcac gggggcggcg cgcctctccg tgtggagctt 60 cccacctgca tgtaccggct ccccaacgtg cacggcagga gctacggccc agcgccgggc 120 gctggccacg tgcaggaaga gtctaacctg tctctgcaag ctcttgagtc ccgccaagat 180 gatattttaa aacgtctgta tgagttgaaa gctgcagttg atggcctctc caagatgatt 240 caaacaccag atgcagactt ggatgtaacc aacataatcc aagcggatga gcccacgact 300 ttaaccacca atgcgctgga cttgaattca gtgcttggga aggattacgg ggcgctgaaa 360 gacatcgtga tcaacgcaaa cccggcctcc cctcccctct ccctgcttgt gctgcacagg 420 ctgctctgtg agcacttcag ggtcctgtcc acggtgcaca cgcactcctc ggtcaagagc 480 gtgcctgaaa accttctcaa gtgctttgga gaacagaata aaaaacagcc ccgccaagac 540 tatcagctgg gattcacttt aatttggaag aatgtgccga agacgcagat gaaattcagc 600 atccagacga tgtgccccat cgaaggcgaa gggaacattg cacgtttctt gttctctctg 660 tttggccaga agcataatgc tgtcaacgca acccttatag atagctgggt agatattgcg 720 atttttcagt taaaagaggg aagcagtaaa gaaaaaagccg ctgttttccg ctccatgaac 780 tctgctcttg ggaagagccc ttggctcgct gggaatgaac tcaccgtagc agacgtggtg 840 ctgtggtctg tactccagca gatcggaggc tgcagtgtga cagtgccagc caatgtgcag 900 aggtggatga ggtcttgtga aaacctggct cctttt 936 <210> 4 <211> 207 <212> DNA <213> Homo sapiens <400> 4 gaagagtcta acctgtctct gcaagctctt gagtcccgcc aagatgatat tttaaaacgt 60 ctgtatgagt tgaaagctgc agttgatggc ctctccaaga tgattcaaac accagatgca 120 gacttggatg taaccaacat aatccaagcg gatgagccca cgactttaac caccaatgcg 180 ctggacttga attcagtgct tgggaag 207 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of miR-142-3p Target <400> 5 tccataaagt aggaaacact aca 23 <210> 6 <211> 132 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of 4 repeats of miR-142-3p Target <400> 6 ccagaagctt gctagctcca taaagtagga aacactacat cactccataa agtaggaaac 60 actacagata tctccataaa gtaggaaaca ctacatcact ccataaagta ggaaacacta 120 caaagcttgt ag 132 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of miR-142-5p Target <400> 7 agtagtgctt tctactttat g 21 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AIMP2 variant Forward primer <400> 8 ctggccacgt gcaggattac gggg 24 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AIMP2 variant reverse primer <400> 9 aagtgaatcc cagctgatag 20

Claims (26)

Prevention or treatment of neurological diseases, comprising as active ingredients a recombinant vector containing an AIMP2 variant (AIMP2-DX2) gene with exon 2 deleted, a target nucleic acid of miR-142-3p, and a promoter operably linked to AIMP2-DX2. A pharmaceutical composition for use, wherein the AIMP2-DX2 gene is located in the 3' direction of the miR-142-3p target nucleic acid. delete The method of claim 1, wherein the promoter is a retrovirus (LTR) promoter, cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, MMT promoter, EF-1 alpha promoter, UB6 promoter, chicken beta-actin promoter, A pharmaceutical composition, which is a promoter selected from the group consisting of CAG promoter, RPE65 promoter, opsin promoter, and combinations thereof. The pharmaceutical composition according to claim 1, wherein the 3' side of the target nucleic acid of miR-142-3p is linked to the AIMP2-DX2 gene. delete The pharmaceutical composition according to claim 1, wherein the AIMP2-DX2 gene includes a nucleotide sequence encoding the amino acid sequence represented by SEQ ID NO: 2. delete The pharmaceutical composition according to claim 1, wherein the AIMP2-DX2 gene comprises a nucleotide sequence represented by SEQ ID NO: 1. The pharmaceutical composition according to claim 1, wherein the miR-142-3p target nucleic acid comprises a nucleotide sequence including ACACTA. The pharmaceutical composition of claim 9, wherein the miR-142-3p target nucleic acid comprises a nucleotide sequence comprising ACACTA and 1-17 additional adjacent nucleotides of SEQ ID NO: 5. delete The pharmaceutical composition according to claim 1, wherein the miR-142-3p target nucleic acid comprises a nucleotide sequence represented by SEQ ID NO: 5. The pharmaceutical composition of claim 1, wherein the miR-142-3p target nucleic acid comprises a nucleotide sequence comprising ACTTTA. The pharmaceutical composition of claim 13, wherein the miR-142-3p target nucleic acid comprises a nucleotide sequence comprising ACTTTA and 1-15 additional contiguous nucleotides of SEQ ID NO: 7. delete The pharmaceutical composition according to claim 1, wherein the miR-142-3p target nucleic acid comprises a nucleotide sequence represented by SEQ ID NO: 7. The pharmaceutical composition according to claim 1, wherein the miR-142-3p target nucleic acid is repeated 2-10 times. The pharmaceutical composition according to claim 1, wherein the recombinant vector is a viral vector. The method of claim 18, wherein the viral vector is Adenovirus, Adeno-associated virus, Lentivirus, Retrovirus, Human immunodeficiency virus (HIV), Murine leukemia virus (MLV), and Avian sarcoma (ASLV). /leukosis), SNV (Spleen necrosis virus), RSV (Rous sarcoma virus), MMTV (Mouse mammary tumor virus), and Herpes simplex virus. The method of claim 18, wherein the viral vector is one or more selected from the group consisting of adeno-assisted virus (AAV), adenovirus, lentivirus, retrovirus, vaccinia virus, and herpes simplex virus. Pharmaceutical composition. delete The method of claim 1, wherein the neurological disease includes amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, retinal degeneration, mild cognitive impairment, Multi-infarct dementia, fronto-temporal dementia, dementia with Lewy bodies, Huntington's disease, neurodegenerative disease, metabolic brain disease, depression, Epilepsy, multiple sclerosis, corticobasal degeneration, multiple system atrophy, progressive supranuclear palsy, dentatorubropallidoluysian atrophy, A pharmaceutical composition, one or more selected from the group consisting of spinocerebella ataxia, primary lateral sclerosis, spinal muscular atrophy, and stroke. The pharmaceutical composition according to claim 22, wherein the neurological disease is amyotrophic lateral sclerosis (ALS). The pharmaceutical composition according to claim 23, wherein the treatment improves motor ability or extends lifespan of the subject. The composition of claim 1, wherein the vector is administered to the brain or spinal cord. 26. The composition of claim 25, wherein the vector is administered to the brain by stereotaxic injection.