WO2022055056A1 - Recombinant microorganism for producing s-methylmethionine, and method for preparing s-methylmethionine using same - Google Patents

Abstract

The present invention relates to a recombinant microorganism having the ability to produce S-methylmethionine (SMM) by overexpressing a gene that encodes methionine S-methylmethionine transferase (MMT) in a microorganism having glycolysis and S-adenosylmethionine (SAM) biosynthetic pathway processes, and a method for producing SMM using the recombinant microorganism. According to the present invention, S-methylmethionine can be produced with excellent yield through microbial biosynthesis, unlike conventional plant extraction or chemical synthesis, and this is expected to be usable as a core technology for S-methylmethionine production.

Description

Recombinant microorganism for production of S-methylmethionine and method for producing S-methylmethionine using the same

In the present invention, a gene encoding methionine S-methylmethionine transferase (MMT) is overexpressed in a microorganism having glycolysis and S-adenosylmethionine (SAM) biosynthetic pathway process, S It relates to a recombinant microorganism having the ability to produce -methylmethionine (S-Methylmethionine, SMM) and a method for producing SMM using the recombinant microorganism.

Optimization of fermentation conditions and manipulation of microbial metabolic circuits are mainly performed to improve the productivity of specific metabolites through microbial fermentation. The method of overexpressing and removing a specific gene on the microbial genome is the most fundamental approach in the field of metabolic engineering. In addition, in order to improve the production capacity of the target product, studies have been conducted to activate the metabolic circuit to the target product by cloning and overexpressing genes directly or indirectly related to production based on a plasmid.

On the other hand, S-Methylmethionine (SMM), a substance known as vitamin U, is abundantly present in cabbage, broccoli, carrots, seaweed, etc. As it is known to have various physiological functions, such as an inhibitory function, interest in SMM is increasing.

However, the currently produced SMM is only extracted from plants containing a large amount of SMM such as cabbage and carrot or made through chemical synthesis, and there is no report on the production of SMM through microbial fermentation.

Under the above-mentioned technical background, the present inventors were intensively researching on the production method of SMM through microbial fermentation, methionine S-methyl in microorganisms having glycolysis and S-adenosylmethionine (S-Adenosylmethionine, SAM) biosynthetic pathway process When introducing and overexpressing a gene encoding methionine S-methylmethionine transferase (MMT), it was confirmed that SMM could be produced in high yield, and the present invention was completed.

It is an object of the present invention to provide a recombinant microorganism designed to be metabolically engineered to have S-methylmethionine (SMM) producing ability.

Another object of the present invention is to provide a method for producing S-methylmethionine using the recombinant microorganism.

In order to solve the above problems, the present invention encodes methionine S-methylmethionine transferase (MMT) in a microorganism having a glycolysis process and a S-adenosylmethionine (S-adenosylmethionine, SAM) biosynthetic pathway process A gene is overexpressed to provide a recombinant microorganism having the ability to produce S-methylmethionine (SMM).

The present invention also comprises the steps of (a) culturing a recombinant microorganism having the S-methylmethionine (SMM) producing ability to produce S-methylmethionine; and (b) obtaining the produced S-methylmethionine; provides a method for producing S-methylmethionine comprising.

According to the present invention, S-methylmethionine can be produced in excellent yield through microbial biosynthesis, unlike conventional plant extraction or chemical synthesis, and it is expected that it can be used as a core technology for S-methylmethionine production.

1 shows a pathway for biosynthesis of SMM by introducing an MMT gene in Escherichia coli having a glycolysis process and a SAM biosynthetic pathway process according to the present invention.

Figure 2 shows the results of measuring the SMM production of the recombinant microorganism (E. coli) according to Example 1 of the present invention (dJ: ΔmetJ, dJMP: ΔmetJ, ΔmmuP, ΔmmuM, aK: pZA (metK), aKF: pZA(metK, metF), cM: pCDFDuet(A.MMT), sA ^* : pZS(metA ^* fbr), cBM: pCDFDuet(B.MMT), csfM: pCDFDuet(Sf.MMT)).

Figure 3 shows the results of measuring the SMM production for each MMT gene origin of the recombinant microorganism (E. coli) according to Example 1 of the present invention ( Arabidopsis thaliana (dJMP + aKcMsA ^* ), Barley (dJMP + aKcBMsA ^* ), Sunflower (dJMP+aKcsfMsA ^* )).

Figure 4 shows the results of measuring the SMM production of the recombinant microorganism (Saccharomyces cerevisiae) according to Example 2 of the present invention (Y1: BY4742 + pSH47 (MMT::URA). Y2: K6-1 + p425(MMT::Leu))

Figure 5 shows the results of measuring the SMM production of the recombinant microorganism (Bacillus subtilis) according to Example 3 of the present invention (BS + M (wtBacillus + pBE-S (MMT), BS + MK (wtBacillus + pBE) -S(metK, MMT))

6 shows the results of measuring the SMM production of the recombinant microorganism (Streptomyces Venezuela) according to Example 4 of the present invention.

7a to 7d show the results of multiple sequence alignment for MMT gene sequences of various origins.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is those well known and commonly used in the art.

In the present invention, unlike conventional plant extraction or chemical synthesis, a recombinant microorganism capable of producing S-methylmethionine in excellent yield through microbial biosynthesis was prepared, and the prepared recombinant microorganism exhibits excellent S-methylmethionine yield and productivity.

Therefore, in one aspect, the present invention is a glycolysis process and S-adenosylmethionine (S-adenosylmethionine, SAM) in a microorganism having a biosynthetic pathway process, methionine S-methylmethionine transferase (methionine S-methylmethionine transferase, MMT) encoding The gene is overexpressed, and relates to a recombinant microorganism having S-methylmethionine (SMM) producing ability (FIG. 1).

In one aspect of the present invention, Escherichia coli or Saccharomyces cerevisiae as a microorganism having the above glycolysis process and S-adenosylmethionine (SAM) biosynthetic pathway process was used, In order to receive a methyl group from SAM and generate S-methylmethionine from methionine, a gene encoding methionine S-methylmethionine transferase (MMT) was introduced and overexpressed.

According to the present invention, the S-methylmethionine may be S-methyl-L-methionine (S-Methyl-L-methionine).

In this case, the gene encoding the MMT may be represented by any one of SEQ ID NOs: 1 to 3, but is not limited thereto. In this case, the genes of SEQ ID NOs: 1 to 3 may be derived from Arabidopsis thaliana, barley, and sunflower, respectively.

In addition, the MMT-encoding gene may be any if the amino acid sequence corresponding to the MMT-encoding gene has at least 60% sequence homology with the amino acid sequence of SEQ ID NO: 47, which is the amino acid sequence corresponding to SEQ ID NO: 1. There, for example, the gene encoding the MMT is grape (scientific name: Vitis vinifera), coyote tobacco (scientific name: Nicotiana attenuata), mulberry (scientific name: Arabidopsis lyrata), corn (scientific name: Zea mays), tulip (scientific name: Anthurium amnicola) may be derived from, and their amino acid sequences may be those represented by SEQ ID NOs: 50 to 54, respectively.

In addition, in the present invention, in order to improve the ability to produce SMM, the gene metJ (methionine repressor), which encodes a repressor of a methionine biosynthesis pathway present in wild-type E. coli, was further deleted.

In addition, in the present invention, in order to improve the ability to produce SMM, a transport of S-methylmethionine (mmuP) gene and a homocysteine S-methyltransferase (mmuM) gene, which is a gene for synthesizing methionine from SMM, are additionally added. deleted it

In addition, in the present invention, in order to improve the ability to produce SMM, metK (S-adenosylmethionine synthetase) gene encoding S-adenosylmethionine synthetase, a gene that generates SAM that transfers a methyl group to methionine during SMM generation, and methionine, a precursor of SMM The metF gene encoding 5,10-methylenetetrahydrofolate reductase, which helps in production, was further overexpressed.

In addition, in the present invention, in order to improve the ability to produce SMM, the metA gene encoding homoserine O-succinyltransferase involved in methionine biosynthesis was mutated. In this case, the mutant gene of metA may be one in which cytosine, which is the 190th base, is substituted with guanine in the nucleotide sequence of the metA gene, and is represented by SEQ ID NO: 4.

In addition, the microorganism can be used without limitation as long as it has a glycolytic process and a S-adenosylmethionine (SAM) biosynthetic pathway process, for example, Escherichia coli ), yeast, Bacillus subtilis, or actinomycetes, wherein the yeast is Saccharomyces cerevisiae , the Bacillus subtilis is Bacillus subtilis , and the actinomycetes are Streptomyces venezuelae ( Streptomyces venezuelae ).

In another aspect, the present invention comprises the steps of (a) culturing the recombinant microorganism to produce S-methylmethionine; And (b) obtaining the produced S-methylmethionine; relates to a method for producing S-methylmethionine comprising a.

In this case, the method of culturing the recombinant microorganism may be performed using a method widely known in the art. Specifically, the culture is not particularly limited as long as SMM can be produced from the recombinant microorganism, but may be continuously cultured in a batch process or injection batch or repeated fed batch process.

The medium used for culture may contain a carbon source, a nitrogen source, amino acids, vitamins, etc., and must meet the requirements of a specific strain in an appropriate manner while controlling temperature, pH, etc.

In this case, the carbon source that can be used is sucrose, lactose, maltose, trehalose, turanose, cellobiose, raffinose, melechtose, malotriose, acarbose, stachyose, glucose, amylose, cellulose, fructose, anose, or It may be one or more selected from the group consisting of galactose. Examples of the nitrogen source that can be used include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, and glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its degradation products, defatted soybean cake or its degradation products, etc. can These nitrogen sources may be used alone or in combination. The medium may contain monopotassium phosphate, dipotassium phosphate and the corresponding sodium-containing salt as phosphorus. The phosphorus that may be used includes potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salt. In addition, as the inorganic compound, sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, and the like may be used. Finally, in addition to the above substances, essential growth substances such as amino acids and vitamins can be used.

In addition, precursors suitable for the culture medium may be used. The above-mentioned raw materials may be added in a batch, fed-batch or continuous manner by an appropriate method to the culture during the culturing process, but is not particularly limited thereto.

[Example]

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not to be construed as being limited by these examples. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

experimental method

Strain, Medium and Culture

In the present invention, MG1655 K-12 strain was used as E. coli, and S. cerevisiae K6-1 was used as yeast. Frozen stocks of E. coli and S. cerevisiae were prepared by adding 30% (v/v) glycerol to exponentially grow the cells. In the case of E. coli, cells were cultured using two different media. LB (Luria-Bertani) medium was used for E. coli cell growth. M9 medium was used as a minimal medium, and the composition of M9 is as follows: Na ₂ HPO ₄ 7H ₂ O (6g) _, KH ₂ PO ₄ (3g), NaCl (0.5g), NH ₄ Cl (1g), 1M MgSO ₄ 2mL, 1M CaCl ₂ 10uL and 50g/L glucose (40mL) in 1L bottle. YPD medium and SD medium were used for yeast culture. A minimal medium, SD medium, was prepared using yeast nitrogenous base w/o amino acids (6.7 g), H ₂ O (865 mL), AA-Mix 10x concentrate (10 mL) without L-leucine. E. coli cultures were grown with each required antibiotic (kanamycin, chloramphenicol, spectinomycin (25 mg/mL)). Agar plates were prepared with 20 g/L agar.

Plasmid and strain construction

E. coli DH5a was used for all plasmid cloning and propagation. All plasmids used were constructed using Gibson Asembly (New England BioLab.). The genes used were derived from E. coli MG1655 K-12 (metF, metH, metA) and Arabidopsis thaliana (MMT), Sunflower (MMT) and Barley (MMT). All MMT genes were integrated into the pCDFDuet vector. For yeast (K6-1), a pESC vector with a bidirectional promoter was used. Successful genomic integration of overexpression was confirmed by diagnostic PCR from Bionics.

Incubation and analysis

E. coli cells were cultured at 37 °C while shaking at 30 °C. First, in a conical tube, the antibiotic required for recombinant microorganisms for 1 day was inoculated into 5 mL LB. Then, for 24 hours, each was transferred to 5 mL of M9 medium (minimum medium) for acclimatization in the medium required for antibiotics. Next, the seeds were scaled up in 25 mL M9 medium to an initial OD (0.125) in unbaffled flasks for culture. E. coli was cultured to a maximum OD (4.2) for 48 h.

S. cerevisiae K6 (Sake yeast kyokai No.6) cells were cultured at 30° C. while shaking at 30 rpm. Yeast cells (S. cerevisiae K6-1 with pESC vector (MMT, SAM2)) were first inoculated into 5 mL YPD without additional amino acids for 36 hours, and then transferred to 5 mL SD medium (minimum medium) to adapt to the medium. Next, the seeds were scaled up in 25 mL SD medium, to an initial OD (0.125) in baffled flasks for cultivation. Yeast (S. cerevisiae K6-1) carrying a pESC vector (MMT, SAM2) was cultured at a maximum OD (5.0) for 72 hours.

S-methylmethionine and L-methionine were determined by high performance liquid chromatography using UV spectroscopy. Two mobile phases were used for the analysis (1: Sodium phosphate di-basic 8.51 g with 3 mL phosphoric acid in 3 L DW, 2: Acetonitrile (45), Methanol (45), DW (10) in 3 L bottle). In addition, Agilent's amino acid analysis column was used for all samples, and OPA reagent (Sigma-Aldrich) was used for amino acid derivatization.

Example 1. Preparation of recombinant E. coli

Escherichia as a microorganism having glycolysis and S-adenosylmethionine (SAM) biosynthetic pathway process coli K-12 MG1655) was used, and the names of strains or plasmids according to genetic manipulation, etc. are shown in Table 1 below.

strains or plasmids	Description	source
strains
dJ	Escherichia coli K-12 MG1655 △metJ	this study
dJMP	Escherichia coli K-12 MG1655 △metJ, △mmuM, △mmuP	this study
Plasmids
pRedET	λphage red γ,β,α-producing vector, pBAD_promoter; ori101 Tetr	Gene Bridges
707-FLP	Flp recombinase-producing vectors; Psc101 ori cI1578 Tetr	Gene Bridges
pKD4	FRT-flanked resistance cassette-involved vector; oriR γKmr	Datsenko KA and Wanner BL, 2000
aK	pZA (metK)	this study
aKF	pZA (metK, metF)	this study
cM	pCDFDuet (MMT)	this study
cBM	pCDFDuet (Barley MMT)	this study
csfM	pCDFDuet (Sunflower MMT)	this study
sA*	pZS(metA*)	this study
sA*H	pZS(metA*, metH)	this study

metJ deletion

wild type E. coli To remove the metJ gene of K-12 MG1655, a lambda red recombination method was used. First, an enzyme expression vector for preventing degradation of the linear gene introduced into the cell and increasing the efficiency of homologous recombination was introduced into the wild type E. coli K-12 MG1655 strain prepared as competent cells. A pRedET vector having a BAD promoter and resistant to tetracycline was used in the present invention, and transformation was confirmed. Next, a linear gene for homologous recombination was prepared. A pKD4 vector having an FRT-kanamycin-FRT cassette was used as a template. Homologous 50 base pairs on both sides of the metJ gene of wild type E. coli K-12 MG1655, the site at which homologous recombination occurs, and 20 base pairs for polymerization of the FRT-kanamycin-FRT cassette of pKD4 used as a template, a total of 70 base pairs was prepared as a primer, and a linear gene for removing the metJ gene was prepared using polymerase chain reaction. Kanamycin is used as a selection marker to confirm successful homologous recombination, and the FRT region serves to remove a selection marker for removal of other genes after the target gene is removed. In the next step, the MG1655+pRedET strain confirmed to be transformed with the pRedET vector was cultured at 30°C. The pRedET vector is a temperature-sensitive vector and loses its activity when it is over 37°C, so it was cultured at 30°C. In addition, when the OD600 reached about 0.3 after 1 hour of incubation, the expression of pRedET's red lambda recombinase was induced with 10% arabinose (L-arabinose). After culturing for an additional hour, when the OD600 reached about 0.6, the cells were transformed into competent cells for electroporation and then the prepared linear gene. After 1 hour incubation at 37° C. in LB medium, it was spread on LB solid medium to which 12.5 mg/ml of kanamycin was added and cultured for 12 hours. To check the success of homologous recombination, two primers were prepared. Homologous 20-24 base pairs on both sides of the metJ gene were designated as del metJ conf F and del metJ conf R (Table 2). When colony PCR was performed using these two primers, the presence of homologous recombination was confirmed through the length of the PCR product.

mmuM, mmuP deletion

In order to remove the mmuM and mmuP genes of the dJ strain, a lambda red recombination method was used. First, an enzyme expression vector for preventing degradation of the linear gene introduced into the cell and increasing the efficiency of homologous recombination was introduced into the dJ strain prepared as competent cells. A pRedET vector having a BAD promoter and resistant to tetracycline was used in the present invention, and transformation was confirmed. Next, a linear gene for homologous recombination was prepared. A pKD4 vector having an FRT-kanamycin-FRT cassette was used as a template. Homologous 50 base pairs on both sides of the metJ gene of wild type E. coli K-12 MG1655, the site where homologous recombination occurs, and 20 base pairs for polymerization of the FRT-kanamycin-FRT cassette of pKD4 used as a template, a total of 70 A base pair was prepared as a primer, and a linear gene for removing the metJ gene was prepared using polymerase chain reaction. Kanamycin is used as a selection marker to confirm successful homologous recombination, and the FRT region serves to remove a selection marker for removal of other genes after the target gene is removed. In the next step, the dJ+pRedET strain confirmed to be transformed with the pRedET vector was cultured at 30°C. The pRedET vector is a temperature-sensitive vector and loses its activity when it exceeds 37°C, so it was incubated at 30°C. In addition, when the OD600 reached about 0.3 after 1 hour of incubation, the expression of pRedET red lambda recombinase was induced with 10% arabinose (L-arabinose). After culturing for an additional hour, when the OD600 reached about 0.6, the cells were transformed into competent cells for electroporation, and then the prepared linear gene was transformed. After 1 hour incubation at 37° C. in LB medium, it was spread on LB solid medium to which 12.5 mg/ml of kanamycin was added and cultured for 12 hours. To confirm the success of homologous recombination, two primers were prepared. Homologous 20-24 base pairs on both sides of the metJ gene were named del mmuMP conf F and del mmuMP conf R (Table 2). When colony PCR was performed using these two primers, the presence of homologous recombination was confirmed through the length of the PCR product.

gene overexpression

All vectors used for gene overexpression according to the present invention were prepared through gibson assembly. The primers used to overexpress the metK gene, which produces a lot of S-adenosylmethionine, are shown in Table 2 below. After cloning using the corresponding primer, re-cloning was performed to match the gibson primer, and each fragment was combined through gibson assembly. A pZA (metK) vector was constructed in this way.

The primers used to overexpress the MMT gene, a gene that makes S-methylmethionine, are shown in Table 2 below. After cloning using the corresponding primer, re-cloning was performed according to the gibson primer, and each fragment was combined through gibson assembly. In this way, a pCDFDuet (MMT) vector was constructed.

The primers used to overexpress the mutant gene (SEQ ID NO: 4) of metA, which is a gene for synthesizing O-succinyl homoserine in the methionine biosynthesis pathway in E. coli, are shown in Table 2 below. After cloning using the corresponding primer, re-cloning was performed to match the gibson primer, and each fragment was combined through gibson assembly. In this way, a pZS(metA*) vector was constructed.

The primers used to overexpress metK, a gene that generates SAM, which transfers a methyl group to methionine during SMM generation, and metF, a gene that enhances the activity of the tetrahydrofolate cycle in E. coli, are shown in Table 2 below. After cloning using the corresponding primer, re-cloning was performed to match the gibson primer, and each fragment was combined through gibson assembly. A pZA (metK, metF) vector was constructed in this way.

Recombinant E. coli according to the present invention was prepared through transformation using the vectors prepared as above. Transformation was performed according to a method generally known in the art. Briefly, the strain to be transformed was cultured in a 5mL falcon tube, and after 24 hours, cell down was performed using a centrifuge, washed twice, and glycerol After releasing the cells with a 10% solution, the prepared vectors were added thereto, and then electricity of 1950V was applied.

Primer name	Sequence(5'-3')	Source	SEQ ID NO:
metK cut primer F	TTACATATAATTAGAGGAAGAAAAAATGGCAAAACACCTTTTTACGTC	this study	SEQ ID NO: 5
metK cut primer R	TTACTTCAGACCGGCAGCAT	this study	SEQ ID NO: 6
pZA_metK_fwd	TCTGAAGTAAATATCGAATTCCTGCAGC	this study	SEQ ID NO: 7
pZA_metK_rev	TTATATGTAACAAGCTTATCGATACCGTC	this study	SEQ ID NO: 8
metK gib F	GATAAGCTTGTTACATATAATTAGAGGAAGAAAAAATGGC	this study	SEQ ID NO: 9
metK gib R	AATTCGATATTTACTTCAGACCGGCAGC	this study	SEQ ID NO: 10
MMT F	ATGGCTGACCTGTCTAGCGT	this study	SEQ ID NO: 11
MMT R	TTAGTTAGCCAGAACGCTTT	this study	SEQ ID NO: 12
pCDFDuet_MMT_F	TTCTAACTGAGGGCCCGTCGACTAGCTT	this study	SEQ ID NO: 13
pCDFDuet_MMT_R	CAGCGGCCATGGGTGTAGCTCCTCCTTATTTGTTG	this study	SEQ ID NO: 14
MMT gib F	AGCTACACCCATGGCCGCTGCGGCGGGT	this study	SEQ ID NO: 15
MMT gib R	CGACGGGCCCTCAGTTAGAACCGTTAACTTTAGCGCCACCACCC	this study	SEQ ID NO: 16
metF cut primer F	ATGAGCTTTTTTCACGCCAG	this study	SEQ ID NO: 17
metF cut primer R	TTATAAACCAGGTCGAACCC	this study	SEQ ID NO: 18
pZA_metK_metF_gib F	TGGTTTATAAATATCGAATTCCTGCAGCC	this study	SEQ ID NO: 19
pZA_metK_metF_gib R	AAAAGCTCATTTACTTCAGACCGGCAGC	this study	SEQ ID NO: 20
metF gib F	TCTGAAGTAAATGAGCTTTTTTCACGCC	this study	SEQ ID NO: 21
metF gib R	AATTCGATATTTATAAACCAGGTCGAACC	this study	SEQ ID NO: 22
del metJ conf F	ATTTATTGACGAAGAGGATTAAGTATCTC	this study	SEQ ID NO: 23
del metJ conf R	AGCAAAAAAGAGCGGCGCGGAGTGGAATCG	this study	SEQ ID NO: 24
del mmuMP conf F	AACCTTCTTTGGATGTTTAGATGTCCA	this study	SEQ ID NO: 25
del mmuMP conf R	GGGTTTATCGGGTCTACATCGTTCATTG	this study	SEQ ID NO: 26

Example 2. Recombinant Yeast Preparation

Saccharomyces cerevisiae (BY4742, Sake koykai No.6) was used as a microorganism having glycolysis and S-adenosylmethionine (SAM) biosynthetic pathway process, and according to genetic manipulation, etc. The strain or plasmid names are shown in Table 3 below. In addition, all vectors used for gene overexpression according to the present invention were prepared through gibson assembly. The primers used to express the gene making S-methylmethionine are shown in Table 4 below. After cloning using the corresponding primer, re-cloning was performed to match the gibson primer, and each fragment was combined through gibson assembly. In this way, p425 (MMT) and pSH47 (MMT) were prepared. Thereafter, a recombinant yeast in which the MMT gene was overexpressed was prepared through the same method as the MMT gene overexpression method described in Example 1.

strains and plasmids	Description	source
strains
BY4742	Saccharomyces cerevisiae △His, △Leu, △Lys, △Ura	this study
K6-1	Saccharomyces cerevisiae sake K6 △Leu	this study
Plasmid
pSH47	pSH47 (MMT)	this study
p425	p425 (MMT)	this study

Primer name	Sequence(5'-3')	Source	SEQ ID NO:
MMT rbs F	GAGAATTTTATAAGGAGTCTTTATCATGGCTGACCTGTCTAGCGT	this study	SEQ ID NO:27
MMT rbs R	TTAGTTAGCAGAACGCTTTTGAACTGC	this study	SEQ ID NO:28
p425 MMT gib F	GCTGCAGGAATTCGATATCAGAGAATTTTATAAGGAGTCTTTATCATG	this study	SEQ ID NO:29
p425 MMT gib R	CGAGGTCGACGGTATCGATATTAGTTAGCCAGAACGCTTTTG	this study	SEQ ID NO:30
psh47_fwd	GGCTAACTAATCATATGTCACCATAAATATCAAATAATTATAG	this study	SEQ ID NO:31
psh47_rev	TTGATAATGAGAAAGGATTTCAACATCGAC	this study	SEQ ID NO:32
mmt with promoter_fwd	AAATCCTTTCTCATTATCAATACTGCCATTTCAAG	this study	SEQ ID NO:33
mmt with promoter_rev	TGACATATGATTAGTTAGCCAGAACGCTTTTG	this study	SEQ ID NO:34

Example 3. Preparation of recombinant Bacillus subtilis

Bacillus subtilis ATCC6633 was used as a microorganism having glycolysis process and S-adenosylmethionine (SAM) biosynthetic pathway process, and the names of strains or plasmids according to genetic manipulation, etc. are shown in Table 5 below. In addition, all vectors used for gene overexpression according to the present invention were prepared through gibson assembly. Primers used to overexpress the metK gene are shown in Table 6 below. After cloning using the corresponding primer, re-cloning was performed to match the gibson primer, and each fragment was combined through gibson assembly. In this way, a pBE-S (metK) vector was constructed. The primers used to overexpress the MMT gene are shown in Table 6 below. After cloning using the corresponding primer, re-cloning was performed to match the gibson primer, and each fragment was combined through gibson assembly. In this way, a pBE-S (MMT, metK) vector was constructed.

Thereafter, a recombinant Bacillus subtilis in which the MMT gene and the metK gene were overexpressed was prepared through the same method as the MMT gene overexpression and metK gene overexpression methods described in Example 1.

strains and plasmids	Description	source
strains
BS	wild type Bacillus subtilis	this study
Plasmid
pBE-S(M)	pBE-S (MMT)	this study
pBE-S(K,M)	pBE-S (metK, MMT)	this study

Primer name	Sequence(5'-3')	Source	SEQ ID NO:
pBE-S_fwd	ggctaactaagggatccgaattcaagcttgtc	this study	SEQ ID NO:35
pBE-S_rev	ttatatgtaatcgagggtaccgagctcc	this study	SEQ ID NO:36
pBE-S metK gib_fwd	gtaccctcgattacatataattagaggaagaaaaaatggc	this study	SEQ ID NO:37
pBE-S metK gib_rev	ttatttgttgttacttcagaccggcagc	this study	SEQ ID NO: 38
pBE-S MMT gib_fwd	tctgaagtaacaacaaataaggaggagctac	this study	SEQ ID NO:39
pBE-S MMT gib_rev	ttcggatcccttagttagccagaacgcttttg	this study	SEQ ID NO:40
pBE-S (MMT in) gib_fwd	ggctaactaagggatccgaattcaagcttgtc	this study	SEQ ID NO: 41
pBE-S (MMT in) gib_rev	ttatttgttgtcgagggtaccgagctcc	this study	SEQ ID NO:42
MMT gene cut to in pBE-S_fwd	gtaccctcgacaacaaataaggaggagctac	this study	SEQ ID NO:43
MMT gene cut to in pBE-S_rev	ttcggatcccttagttagccagaacgcttttg	this study	SEQ ID NO:44

Example 4. Preparation of Recombinant Actinomycetes

Streptomyces as a microorganism with glycolysis and S-adenosylmethionine (SAM) biosynthetic pathway process venezuelae ATCC 15439) was used, and the names of strains or plasmids according to genetic manipulation, etc. are shown in Table 7 below. In addition, all vectors used for gene overexpression according to the present invention were prepared through gibson assembly. Primers used to overexpress the MMT gene are shown in Table 8 below. MMT gene fragment was created using the corresponding primer, and backbone vector fragments cut with XbaI and NdeI were combined through gibson assembly. A pSET(M) vector was constructed in this way.

Thereafter, a recombinant actinomycete in which the MMT gene was overexpressed was prepared through the same method as the MMT gene overexpression method described in Example 1.

strains and plasmids	Description	source
strains
SV	wild type Streptomyces venezuelae ATCC 15439	this study
Plasmid
pSET(M)	pSET (MMT)	this study

Primer name	Sequence(5'-3')	Source	SEQ ID NO:
MMT-over40bp-F	CAGGAGAATACGACAGCG TGCAGGACTGGGGGAGTG CGCAATGGCTGACCTGTCTAGC	this study	SEQ ID NO:45
MMT-over40bp-R	CTATGACATGATTACGAATTCGATATCGCGCGCGGCCGCGTTAGTTAGCCAGAACGCTTTTG	this study	SEQ ID NO:46

Evaluation Example 1. Measurement of SMM production of recombinant E. coli

Recombinant E. coli according to Example 1 of the present invention was cultured in M9 (minimal media) medium supplemented with 10 g/L glucose for 24 hours, and SMM production was measured using HPLC. Agilent's Amino Acid Analysis column was used for the column, and A: Sodium phosphate diabasic, Phosphoric acid, DW / B: DW, Acetonitrile, and Methanol were used as mobile phases for HPLC.

Figure 2 shows the results of measuring the SMM production of the recombinant microorganism (E. coli) according to Example 1 of the present invention (J: ΔmetJ, dJMP: ΔmetJ, ΔmmuP, ΔmmuM, aK: pZA (metK), aKF:pZA(metK, metF), cM:pCDFDuet(A.MMT), sA ^* :pZS(metA ^* fbr), cBM:pCDFDuet(B.MMT), csfM:pCDFDuet(Sf.MMT)).

2, when recombinant E. coli according to the present invention is used, SMM can be produced in excellent yield without adding methionine, a precursor of SMM (0.063 g/L and 0.063 g/L and 0.07 g/L production) was confirmed.

Evaluation Example 2. Measurement of SMM production by various MMT gene-derived recombinant E. coli

Figure 3 shows the results of measuring the SMM production for each MMT gene origin of the recombinant microorganism (E. coli) according to Example 1 of the present invention ( Arabidopsis thaliana (dJMP + aKcMsA ^* ), Barley (dJMP + aKcBMsA ^* ), Sunflower (dJMP+aKcsfMsA ^* )). The culture conditions and the method of measuring the amount of SMM production are the same as those described in Evaluation Example 1 above.

3 shows that even without adding methionine, a precursor of SMM, the MMT gene derived from Arabidopsis thaliana, barley, and sunflower is introduced and overexpressed, indicating that SMM can be produced in excellent yield. Points (0.07 g/L, 0.039 g/L and 0.024 g/L production, respectively) were identified.

Evaluation Example 3. SMM production measurement of recombinant yeast (Saccharomyces cerevisiae)

The recombinant yeast according to Example 2 of the present invention was cultured for 24 hours in SD (minimal media) medium supplemented with 10 g/L glucose and 0.5 g/L methionine, and SMM production was measured using HPLC. Agilent's Amino Acid Analysis column was used for the column, and A: Sodium phosphate diabasic, Phosphoric acid, DW / B: DW, Acetonitrile, and Methanol were used as mobile phases for HPLC.

4 shows the results of measuring the SMM production of the recombinant microorganism (Saccharomyces cerevisiae) according to Example 2 of the present invention (Y1: BY4742 + pSH47 (MMT::URA). Y2: K6-1 + p425(MMT::Leu))

4, it was confirmed that even when using the recombinant yeast according to the present invention, SMM can be produced in excellent yield (Y1: 0.043 g/L, Y2: 0.105 g/L production).

Evaluation Example 4. Measurement of SMM production of recombinant Bacillus subtilis

Recombinant Bacillus subtilis according to Example 3 of the present invention was cultured for 24 hours in LB (rich media) medium supplemented with 10 g/L glucose and 0.5 g/L methionine, and SMM production was measured using HPLC. Agilent's Amino Acid Analysis column was used for the column, and A: Sodium phosphate diabasic, Phosphoric acid, DW / B: DW, Acetonitrile, and Methanol were used as mobile phases for HPLC.

Figure 5 shows the results of measuring the SMM production of the recombinant microorganism (Bacillus subtilis) according to Example 3 of the present invention (BS + M (wtBacillus + pBE-S (MMT), BS + MK (wtBacillus + pBE) -S(metK, MMT))

5, it was confirmed that even when using the recombinant Bacillus subtilis according to the present invention, SMM can be produced in excellent yield (BS+M (1.6 mg/L), BS+MK (3.2 mg/L)).

Evaluation Example 5. Measurement of SMM Production of Recombinant Actinomycetes

Recombinant actinomycetes according to Example 4 of the present invention were cultured for 96 hours in GYM medium supplemented with 0.5 g/L methionine, and SMM production was measured using HPLC. Agilent's Amino Acid Analysis column was used for the column, and A: Sodium phosphate diabasic, Phosphoric acid, DW / B: DW, Acetonitrile, and Methanol were used as mobile phases for HPLC.

6 shows the results of measuring the SMM production of the recombinant microorganism (Streptomyces Venezuela) according to Example 4 of the present invention.

6, it was confirmed that even when using the recombinant actinomycetes according to the present invention, SMM can be produced in an excellent yield (4.86 mg/L production).

Evaluation Example 6. Multiple sequence alignment

Various origins (Arabidopsis thaliana, Barley, Sunflower, Vitis vinifera, Nicotiana attenuata), Arabidopsis lyrata, Corn (Zea mays), Tulip (Anthurium amnicola) ), orchid (Apostasia shenzhenica), stink bug (Lygus hesperus)) change the MMT gene sequences to the corresponding amino acid sequences (shown in SEQ ID NOs: 47 to 56, respectively in order), and change to the FASTA format suitable for the format of ClustalX Similarity (%) and identity (%) were measured using the ClustalX program, and the results are shown in FIG. 5 below.

The multiple sequence alignment was performed through the ClustalX program, and as a result, unlike the amino acid sequence (SEQ ID NOs: 55 and 56) corresponding to the MMT gene possessed by orchids (Apostasia shenzhenica) and stink bug (Lygus hesperus), grapes (Vitis vinifera) , Coyote tobacco (Nicotiana attenuata), Arabidopsis lyrata, corn (Zea mays), the amino acid sequence corresponding to the MMT gene (SEQ ID NOs: 50 to 54) derived from tulips (Anthurium amnicola) Arabidopsis thaliana ), it was confirmed that the amino acid sequence (SEQ ID NO: 47) corresponding to the MMT gene (SEQ ID NO: 1) and the similarity and identity (similarity) and identity (identity) are at least 60%, and the MMT gene derived from them is also It was confirmed that the same can be applied to the invention.

As described above in detail a specific part of the content of the present invention, for those of ordinary skill in the art, it is clear that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. something to do. Accordingly, it is intended that the substantial scope of the present invention be defined by the appended claims and their equivalents.

According to the present invention, S-methylmethionine can be produced in excellent yield through microbial biosynthesis, unlike conventional plant extraction or chemical synthesis, and thus can be usefully used in various fields requiring S-methylmethionine production.

Claims (15)

1. In microorganisms having glycolysis and S-adenosylmethionine (SAM) biosynthetic pathway processes, the gene encoding methionine S-methylmethionine transferase (MMT) is overexpressed, resulting in S-methylmethionine (S-Methylmethionine, SMM) Recombinant microorganism having the ability to produce.
2. The method of claim 1,

   The S-methylmethionine is a recombinant microorganism, characterized in that S-methyl-L-methionine (S-Methyl-L-methionine).
3. The method of claim 1,

   The gene encoding the MMT is a recombinant microorganism, characterized in that represented by any one of SEQ ID NO: 1 to SEQ ID NO: 3.
4. 4. The method of claim 3,

   The gene encoding the MMT is a recombinant microorganism, characterized in that derived from Arabidopsis thaliana, barley, sunflower.
5. According to claim 1,

   The amino acid sequence corresponding to the gene encoding the MMT is a recombinant microorganism, characterized in that it has at least 60% sequence homology with the amino acid sequence of SEQ ID NO: 47, which is the amino acid sequence corresponding to SEQ ID NO: 1.
6. The method according to claim 5, wherein the gene encoding the MMT is derived from grapes (Vitis vinifera), coyote tobacco (Nicotiana attenuata), Arabidopsis lyrata, corn (Zea mays), and tulips (Anthurium amnicola). recombinant microorganisms.
7. The method of claim 1,

   A recombinant microorganism, characterized in that the metJ (methionine repressor) gene encoding a repressor of the methionine biosynthesis pathway is further deleted.
8. The method of claim 1,

   A recombinant microorganism, characterized in that the transport of S-methylmethionine (mmuP) gene and the homocysteine S-methyltransferase (mmuM) gene are further deleted.
9. The method of claim 1,

   S-adenosylmethionine synthetase (metK) gene encoding S-adenosylmethionine synthetase and metF gene encoding 5,10-methylenetetrahydrofolate reductase were additionally overexpressed Recombinant microorganisms characterized.
10. According to claim 1,

    A recombinant microorganism characterized in that the metA gene encoding homoserine O-succinyltransferase is mutated.
11. 11. The method of claim 10,

    The mutant gene of metA is a recombinant microorganism, characterized in that in the nucleotide sequence of the metA gene, cytosine, which is the 190th base, is substituted with guanine.
12. 12. The method of claim 11,

    The mutant gene of metA is a recombinant microorganism, characterized in that represented by SEQ ID NO: 4.
13. According to claim 1,

    Microorganisms having the glycolysis process and S-adenosylmethionine (SAM) biosynthetic pathway process are Escherichia coli ), Saccharomyces cerevisiae , Bacillus subtilis , or Streptomyces venezuelae Recombinant microorganism, characterized in that it is.
14. (a) culturing the recombinant microorganism of claim 1 to produce S-methylmethionine; and

    (b) obtaining the produced S-methylmethionine; Method for producing S-methylmethionine comprising
15. 15. The method of claim 14,

    The culture of step (a) is sucrose, lactose, maltose, trehalose, turanose, cellobiose, raffinose, melechtose, malotriose, acarbose, stachyose, glucose, amylose, cellulose, fructose, anose, Or at least one selected from the group consisting of galactose as a carbon source.

Images