CN106884028B - Method for enzymatic synthesis of nicotinamide uracil dinucleotide - Google Patents

Abstract

The invention relates to a method for enzymatic synthesis of nicotinamide-uracil dinucleotide and application thereof. Nicotinamide mononucleotide adenosine transferase mutant is used as a catalyst to catalyze the coupling reaction of nicotinamide mononucleotide and uracil nucleoside triphosphate to prepare nicotinamide uracil dinucleotide. The coding gene of the nicotinamide mononucleotide adenyl transferase mutant is expressed in microbial cells, engineering bacteria synthesize nicotinamide uracil dinucleotide with endogenous metabolites, and intracellular nicotinamide uracil dinucleotide can be used as a coenzyme, selectively mediate an oxidation-reduction reaction, and the yield of target metabolites is improved. In a typical example, succinic acid production was increased by 35%.

Description

Method for enzymatic synthesis of nicotinamide uracil dinucleotide

Technical Field

The invention belongs to the technical field of biological engineering, and relates to a method for enzymatically synthesizing Nicotinamide Uracil Dinucleotide (NUD) and application thereof.

Background

Nicotinamide Adenine Dinucleotide (NAD) and its reduced state (NADH) play a very important role in the life activities of cells such as reproduction, growth, differentiation, apoptosis and the like (w.ying, et al. In addition, NAD is a coenzyme for many important oxidoreductases and functions to transport hydrogen and electrons. The structural formula is as follows:

because NAD (H) in organisms simultaneously participates in various reactions, one-step or multi-step reaction utilizing NAD (H) exists in a biological metabolism network of most target products. Cofactor engineering is usually used at the present stage to regulate the target metabolic network. Common strategies are 1) altering intracellular coenzyme synthesis, degradation, anabolism and the ability of different coenzyme molecules to interconvert, 2) altering the coenzyme preference of oxidoreductases, 3) expressing enzymes of renewable coenzymes in cells, such as glucose dehydrogenase and the like, and additionally adding substrates for the corresponding enzymes in the culture environment. However, as nad (h) is a common coenzyme, perturbation of intracellular nad (h) levels and different oxidation states often has unpredictable global effects on cell physiology, metabolism, etc. Therefore, in order to realize specific regulation of the target metabolic network, a method is needed to make the target metabolic network independent from the complex metabolic network, i.e. a bioorthogonal system needs to be redesigned (k.short, et al.drug discovery today.2002, 7, 872).

In a bioarthogonal system that relies on NAD analogs, NAD (h) analogs can be transported in this orthogonal metabolic pathway without affecting other metabolic pathways that utilize NAD (h), and likewise, NAD (h) in other metabolic pathways does not affect the bioorthogonal metabolic pathways. Therefore, the specific metabolic regulation of the bioorthogonal system can be carried out only by regulating the content of the NAD (H) analogue, thereby achieving the aim of improving the yield of the target pathway.

Since the major binding of NAD (h) -dependent oxidoreductase to its coenzyme occurs in the adenine-binding domain, the pyridine ring moiety is responsible for the electron transfer, and therefore, only the adenine ring moiety of NAD can be engineered to ensure the redox properties of NAD analogs.

Currently, most NAD analogs are chemically synthesized. However, chemical synthesis of NAD analogs generally suffers from the problems of complicated steps, unstable chemical properties, difficult separation and purification, high cost, and inability to be applied directly to organisms. Thus, enzymatic synthesis of NAD analogs has been used (enzymatic synthesis of H. difier, D. hydantoin der, C. meier, R. Schmk, CARBA-NAD, application No.: 201080033434.1). It is synthesized enzymatically by NAD analogs with the aid of wild-type nicotinamide Ribokinase (RNK) and nicotinamide mononucleotide adenyl transferase (NMNAT). Among them, nicotinamide mononucleotide adenylyltransferase (NMNAT) can be expressed by the genes nadD, nadM, nadR respectively according to different species sources, and Nicotinamide Mononucleotide (NMN) or nicotinic acid mononucleotide (NaMN) and Adenosine Triphosphate (ATP) are subjected to condensation reaction to synthesize NAD or NaAD, which is a key enzyme in the NAD biosynthesis pathway. Although wild-type NMNAT may also show low activity for the synthesis of a few NAD analogues under in vitro reaction conditions (m.Emanuelli, et al.protein Expression and purification.2003, 27, 357), it is not sufficient for the preparation or direct intracellular synthesis of NAD analogues.

Nicotinamide Uracil Dinucleotide (NUD) is an NAD analogue and can be used as coenzyme to mediate redox reaction. By constructing NUD-dependent oxidoreductases, bioorthogonal redox systems can be established for controlling intracellular metabolic processes (d.ji, et al. journal of the american chemical society.2011, 133, 20857). NUD can be synthesized chemically, but like NAD, NUD cannot freely permeate cell membranes, and becomes a bottleneck for intracellular application of NUD. Therefore, there is a need to establish a method for enzymatically synthesizing NUD to directly synthesize NUD intracellularly using cellular endogenous metabolites.

Disclosure of Invention

Aiming at the defects that the step of synthesizing NUD by a chemical method is complicated, the separation and purification are difficult, the NUD is difficult to enter cells and the like, and no enzyme capable of efficiently catalyzing and synthesizing the NUD is found at present, the invention aims to provide the method for enzymatically synthesizing the NUD.

In one aspect, the invention provides a method for enzymatically synthesizing Nicotinamide Uracil Dinucleotide (NUD), which synthesizes nicotinamide uracil dinucleotide by using a mutant of nicotinamide mononucleotide adenyltransferase as a catalyst and Nicotinamide Mononucleotide (NMN) and uracil nucleoside triphosphate (UTP) as substrates.

In some embodiments, the amino acid sequence of nicotinamide mononucleotide adenyl transferase is SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, wherein the amino acid sequence shown in SEQ ID NO: 1 is the amino acid sequence of NadD from e.coli, SEQ ID NO: 2 is the amino acid sequence of NadR from e.coli, SEQ ID NO: 3 is the amino acid sequence of NadM from francisella tularensis.

The mutant of the nicotinamide mononucleotide adenyl transferase is obtained by mutating more than 1 amino acid in the amino acid sequence, and the mutation site is one or more than two of the amino acid sites in the following sequence:

a polypeptide as set forth in SEQ ID NO: 1 is: 22-position mutation is one of S, L, A or G, 23-position mutation is one of T, G or L, 45-position mutation is one of W, Y or L, 82-position mutation is one of K, E, L or T, 84-position mutation is one of K, W, E, A, L, V, M, T or P, 86-position mutation is one of R, F, D, K, S or W, 107-position mutation is one of F, V, R, L, S, A, W or P, 109-position mutation is one of G, A or S, 118-position mutation is one of D, H, T, P, G, N, A or R, 132-position mutation is one of I, A, V, P, F, G, L, R or Q, 174-position mutation is one of I, A, R, P, L, G, V, K, D or M, 175-position mutation is one of M, K, W, M, W or P, mutation at position 176 to one of M, G, S, A, P, T, R or K, mutation at position 177 to one of A, E, L, P, R or S, or mutation at position 178 to one of P, I, V, S, R, G, T or L, deletion mutation at position 174, 175, 176 to two amino acids D, E, wherein D is one of A, S, T or P, E is one of S, P, G or A, or insertion mutation at position 174, 175 to three amino acids D, E, f, wherein D is one of K, L, P, T, V or D, E is one of G, P, M, L, V, T, R, D or I, f is one of P, R, T, E, Q, K, V or S, resulting in one or more than two mutated new proteins;

or, a polypeptide set forth in SEQ ID NO: 2 is: the 82 th mutation is one of S, L, A or G, the 83 th mutation is one of R, I or K, the 88 th mutation is one of F, V, M or L, the 148 th mutation is one of N, Q, H or S, the 154 th mutation is one of H, Y or F, the 176 th mutation is one of G, A or S, the 205 th mutation is one of P, Q, V, R, G, K, N or L, the 176 th and 177 th insertion mutations are three amino acids a, b and c, wherein a is one of P, G or I, b is one of V, S or A, C is one of S, C, I, H or W, or 203, 204 and 205 position deletion mutation into two amino acids d, e, wherein D is one of E, L, M, F, L or V, E is one of A, E, D, N, G, V or I, and one or more than two mutant novel proteins are generated;

or, a polypeptide set forth in SEQ ID NO: 3 is: 21-position mutation is one of M, S, K, T, L, F, G, W, Q or R, 23-position mutation is one of R, T, L or Q, 24-position mutation is one of N, W, K, S, F, R, G, V, T, D, P, E or A, 110-position mutation is one of S, R, L, N or Q, 130-position mutation is one of P, G, A or S, 131-position mutation is one of A, G, R, F, S, L, E, V, C, W, I or P, 132-position mutation is one of R, W, V, A, S or G, 133-position mutation is one of V, T, Q, L or E, 134-position is one of P, E, A or G, 135-position mutation is one of T, G, S, K or R, 136-position mutation is one of I, L or S, D, E or P, one or more than two mutant novel proteins are produced.

The operation steps of the invention for obtaining the nicotinamide mononucleotide adenyltransferase mutant capable of synthesizing NUD are as follows:

1. NMNAT from a known species was selected as a template for directed evolution.

Extracting the whole genome DNA of the species, and carrying out PCR amplification to obtain the gene sequence of the species expressing the NMNAT, or synthesizing the gene sequence by the whole gene.

2. And constructing engineering bacteria for expressing the NMNAT.

Cloning the gene expressing the NMNAT into a prokaryotic protein expression vector, converting the gene into escherichia coli BL21(DE3) or DH10b, sequencing the obtained positive clone, and obtaining the clone with the correct sequencing result, namely the wild type NMNAT expression engineering bacterium.

3. The database downloads or simulates the crystal structure of the NMNAT of the species.

If the NMNAT crystal structure is resolved and the crystal structure contains ATP or NAD, then directly storing in PDB database: (http://www.rcsb.org/pdb/home/home.do) Downloading and analyzing; if the crystal structure of the NMNAT is not resolved or is resolved but does not contain ATP in the crystal structure orNAD, then blast on NCBI website (http:// blast.ncbi.nlm.nih.gov/) Searching for a crystal structure containing ATP or NAD and having a homology of 30% or more as a template, and using Swiss-model (http://swissmodel.expasy.org/) A simulation was performed.

4. Mutation strategies were designed.

Through crystal structure analysis, degenerate base NNK (N ═ adenine, guanine or cytosine or thymine; K ═ guanine or thymine) is used for replacing codon of target mutation site, mutation primer is designed, and saturated mutation carrier is constructed.

5. Constructing a mutation library.

Methods using RF cloning are described in the literature (f. van den Ent, et al. journal of biochemical and Biophysical methods.2006, 67, 67). In the first step of RF I PCR process, a template is a wild type NMNAT expression vector, a primer is a mutation primer containing degenerate basic group NNK, and an obtained PCR product is a big primer of the second step of RF cloning; in the second step of RF II PCR process, the template is still the wild type NMNAT expression vector, the product obtained by PCR is digested by DpnI restriction enzyme and transferred into the escherichia coli competent cell, and the obtained transformant is the saturated mutation library of NMNAT.

6. Constructing a mutant library screening method.

Screening of a mutation library is performed by using an existing oxidoreductase capable of recognizing a target NAD analogue, and an enzyme-coupled color development method is adopted. The principle of screening and color development is shown in figure 1.

In the enzyme coupling color development process, the substrate UTP and NMN are subjected to condensation reaction by the mutation library of the NMNAT to synthesize the NAD analogue NUD. Those skilled in The art can obtain an oxidoreductase capable of reducing NUD to NUDH as an indicator enzyme to produce NUDH by a method similar to The literature (d.ji, et al. journal of The american chemical society.2011, 133, 20857); phenazine Methosulfate (PMS) and nitrotetrazolium blue chloride (NBT) are reduced to macroscopic dark purple insoluble substances under the action of NUDH.

7. Screening the mutant library.

Selecting a single colony of the mutant library to be inoculated in an LB liquid culture medium of a 96 deep-hole plate, and carrying out strain culture and induced expression of mutant protein; collecting the bacterial cells, crushing, centrifuging and obtaining supernatant as crude enzyme liquid containing soluble mutant protein. The pH value of a reaction system for enzyme coupling chromogenic screening is 5.0-11.0, and a reaction liquid contains NMN, UTP, metal ions, an indicating oxidoreductase and a co-substrate thereof, PMS, NBT and a crude enzyme liquid supernatant.

And (3) carrying out secondary re-screening verification on the suspected target mutant bacteria to verify that the correct bacteria are the target mutant bacteria. And sequencing the quality-improved particles of the target mutant bacteria, and identifying the amino acid mutation sites.

8. And (5) verifying the activity of the pure enzyme.

Carrying out amplification culture and induction expression on the target mutant, centrifugally collecting thalli from the obtained culture solution, cracking, centrifugally collecting lysate supernatant, carrying out separation and purification according to the characteristics of the target mutant, and collecting the obtained pure enzyme solution to verify the activity.

The reaction conditions for verifying the activity of the pure enzyme were as follows: the pH value of the buffer solution is 5.0-11.0, the NMN is 0.05-10 mM, the UTP is 0.02-10 mM, the metal ions are 0.05-10 mM, the pure enzyme solution is 0.01-1 mg/mL, the reaction is carried out for 2-4 h at the temperature of 25-40 ℃, the protein is removed after the reaction is terminated, and the NAD analogue is obtained by selecting a proper method for separation and purification.

And (4) carrying out NMR detection on the purified analogue, and determining that the corresponding mutant is a nicotinamide mononucleotide adenyltransferase mutant capable of synthesizing NUD after the spectrogram is correct.

In some embodiments, the mutant of nicotinamide mononucleotide adenyltransferase is encoded by a corresponding deoxyribonucleic acid (DNA) sequence.

In other embodiments, a mutant of nicotinamide mononucleotide adenyltransferase, its corresponding coding DNA sequence, is cloned into a protein expression vector for controlled expression.

In another aspect, the invention provides an application of a method for enzymatically synthesizing NUD.

In some embodiments, a mutant of nicotinamide mononucleotide adenyltransferase is produced by a microbial cell carrying an expression vector for the corresponding mutant, the corresponding mutant is purified and used in an in vitro enzymatic reaction to synthesize NUD, under the reaction conditions: the pH value is 5.0-9.0, the temperature is 25-55 ℃, and the time is 0.2-30 h; the molar ratio of the usage of the nicotinamide mononucleotide, the uracil nucleoside triphosphate and the nicotinamide mononucleotide adenosine transferase mutant is 1:0.02-50: 0.00002-0.1.

In some embodiments, the mutant protein is expressed in a microbial cell, and one or more than two proteins with NUD as a coenzyme are expressed simultaneously, so as to construct a metabolic system which can be selectively regulated and used for improving the yield of a target metabolite.

In some embodiments, the mutant protein is expressed in engineering bacteria of Escherichia coli, and the 310 th leucine derived from Escherichia coli K12 and taking nicotinamide uracil dinucleotide as a coenzyme is mutated into lysine malic enzyme mutant ME^*And isoleucine to arginine phosphite dehydrogenase mutant PDH at position 151 from Pseudomonas stutzeri WM88^*And culturing the engineering bacteria cells in the presence of phosphorous acid to improve the yield of succinic acid.

Description of the indicating method

ME^*Represents: the 310 th leucine mutation from E.coli K12 was a lysine malic enzyme mutant (D.Ji, et al. journal of the American Chemical society.2011, 133, 20857).

PDH^*Represents: isoleucine mutation at position 151 from Pseudomonas stutzeri WM88 to arginine phosphite dehydrogenase mutant (Wang Lei. Nicotinamide cytosine dinucleotide-based metabolic circuit research [ doctor's scientific thesis ]]Beijing: university of chinese academy of sciences, 2014).

In an embodiment for increasing succinic acid production, the host selected is e.coli KJ134(k.jantama, equivalent.biotechnology bioengineering.2008, 5, 881). Simultaneously over-expressing a nicotinamide mononucleotide adenyl transferase mutant capable of synthesizing NUD (non-nucleoside dehydrogenase) and a phosphite dehydrogenase mutant PDH (phosphate dehydrogenase) mutant with NUD (H) as a coenzyme and derived from pseudomonas stutzeri WM88, wherein isoleucine at position 151 is mutated into arginine^*(phosphorous acid oxygenReducing NUD to NUDH while converting NUD into phosphate) and malic enzyme mutant ME derived from Escherichia coli K12 and having leucine at position 310 mutated into lysine^*(the reduction force of NUDH is used for catalyzing pyruvic acid to generate malic acid), and an intracellular synthesis, reduction and regeneration orthogonal system of NUD is constructed. The method comprises the steps of oxidizing phosphorous acid into phosphoric acid, reducing NUD into NUDH, catalyzing pyruvic acid to generate malic acid by taking the NUDH as reducing power under the condition of not interfering other life processes taking NAD (H) as a cofactor in cells, and realizing specific distribution of the reducing power and accumulation of succinic acid as a downstream product of the malic acid.

In some preferred embodiments, the specific amino acid sequence of the mutant protein is SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 or more than two of them. Wherein, SEQ ID NO:4 is an amino acid sequence of a mutant of NadD derived from escherichia coli, wherein 118 th tyrosine is mutated into histidine, 175 th proline is mutated into lysine, 176 th tryptophan is mutated into arginine compared with wild type NadD; SEQ ID NO:5 is the amino acid sequence of the mutant of the NadR from the escherichia coli, and compared with the wild type NadR, the aspartic acid, the proline and the lysine at the 198 th, 199 th and 200 th positions are deleted and mutated into alanine and tyrosine; SEQ ID NO:6 is an amino acid sequence of a mutant of NadM derived from Francisella tularensis, in which aspartic acid at position 131 is mutated to proline as compared with wild-type NadM.

Drawings

Figure 1 screening principle of NMNAT mutation library. Wherein UTP is an analog of ATP, NUD is an analog of NAD of interest, NMNAT^*The nicotinamide riboside adenyl transferase mutant is characterized in that an oxidoreductase is used as an indicator enzyme to reduce an NAD analogue NUD into NUDH with a reducing property in the presence of a co-substrate, and Phenazine Methyl Sulfate (PMS) and nitrotetrazolium blue chloride (NBT) are reduced into a macroscopic dark purple insoluble substance under the action of the NUDH.

Figure 2 intracellular in situ synthesis of NUD and metabolic pathways for enhanced succinic acid production. The host cell is WXY02, and the strain has knock-out pyruvic acid such as ldhA, adhE, focA, pflB, mgsA, pOxB, tdcDE, citF, aspC, sfcA, pta-ackA, maeB, oxaloacetate consumption purposeDiameter; over-expression of NadD which can synthesize NUD^3G10Malic enzyme mutant ME with specificity dependent on NUDH as reducing power^*Phosphite dehydrogenase mutant PDH capable of regenerating NUDH^*. Wherein, NadD^3G10Is a mutant of NadD derived from escherichia coli, and compared with wild type NadD, the 118 th tyrosine is mutated into histidine, the 175 th proline is mutated into lysine, and the 176 th tryptophan is mutated into arginine; ME^*The 310 th leucine from Escherichia coli K12 is mutated into a lysine malic enzyme mutant; PDH^*Is derived from the mutation of isoleucine at position 151 of Pseudomonas stutzeri WM88 into arginine phosphite dehydrogenase mutant.

Detailed Description

The invention will be further illustrated by the following examples, which will be more readily understood by reference to the following examples. These examples are for illustrative purposes only and are not intended to limit the present invention.

In the present invention, the procedure for obtaining mutants capable of synthesizing the NAD analog NUD is described in the summary of the invention.

The expression vector construction adopts an RF cloning method. The first step of PCR amplification obtains a target gene containing a homologous arm segment with a target vector, and the second step of PCR uses the target gene as a large primer to clone the target gene onto the target vector. The obtained product is digested by DpnI restriction enzyme and transferred into host competent cells, and the obtained transformant is a mutant library capable of expressing the NMNAT mutant.

Each mutant expressing bacterium in the library is numbered by xxx, wherein xxx is the combination of number and letter, and the naming mode is as follows: the strain name loader name; mutant expression vector nomenclature: adding "-xxx" after the wild-type expression vector name; mutant protein nomenclature: wild type protein name plus upper right xxx name. Such as: an expression vector pET-NadD of nicotinamide mononucleotide adenyltransferase NadD derived from escherichia coli is transferred into a host BL21(DE3), and the obtained expression strain is named as BL21(DE3) (pET-NadD); one of the NadD mutant expression bacteria is numbered as 3G10, the expression bacteria is named as BL21(DE3) (pET-NadD-3G10), and the mutant expression vector is named as pETNadD-3G10, mutant protein named NadD^3G10。

Each mutant expression strain in the library is numbered with xxx, wherein xxx is the combination of number and letter, and each mutant strain corresponds to one number. The mutant expression vector is named after the wild type expression vector plus "-xxx", the mutant expression bacteria are named by the strain name and the vector name, and the protein product is named by the wild type protein name plus the upper right label xxx.

Conditions for inducible expression of the mutant protein were: selecting a target single colony to be activated overnight at 37 ℃ and 200rpm, transferring the single colony to a new culture medium, adding IPTG (isopropyl-beta-thiogalactoside) 0.01-1 mM, and carrying out induced expression on a target protein at 15-37 ℃ and 200 rpm.

The method of reference (J.Wang, et al. protein Expression and purification.2007, 53, 97-103) was used to induce, express and purify proteins.

The protein concentration was measured by Bradford method using a berle protein concentration measurement kit.

The gene knockout is carried out by adopting a Red beta recombination system (T.Baba, et al. molecular Systems biology.2006, 2, 1-11) and an FLP recombinase system for unmarked knockout.

Intracellular cofactor concentration was determined using a cofactor cycling strategy (s.kern, et al. methods in molecular biology.2014, 1149, 311).

The activity of NMNAT and its mutant enzymes in synthesizing NAD using ATP was measured by an enzyme coupling method in the literature (e.balducci, equivalent.analytical biochemistry.1995, 228, 64).

When the activity of synthesizing NUD by utilizing UTP by NMNAT and mutant enzyme thereof is measured, the following components are added into a reaction system: 20 to 1000mM of buffer solution with pH of 5.0 to 11.0, 0.05 to 10mM of NMN, 0.02 to 10mM of UTP, 0.05 to 10mM of metal ions, 0.01 to 1mg/mL of mutation pure enzyme solution, 5 to 10mM of L-malic acid, 50U/mL of malic enzyme mutant ME^*The enzyme solution was purified, and the change in absorbance at 340nm was measured by a spectrophotometer at a constant temperature of 25 ℃. Wherein, ME^*Is derived from Escherichia coli K12, and the 310 th leucine is mutated into the malic enzyme mutant of lysine. Engineering bacteria BL21(DE3) (pET24 b)-ME^*) Inducible expression and ME^*The purification method is as described in the literature (D.Ji, et al. journal of the American Chemical society.2011, 133, 20857).

PDH^*Is derived from the mutation of isoleucine at position 151 of Pseudomonas stutzeri WM88 into arginine phosphite dehydrogenase mutant (Wang Lei. Nicotinamide cytosine dinucleotide-based metabolic circuit research [ doctor's academic paper ]]Beijing: university of chinese academy of sciences, 2014).

Definition of enzyme activity unit: the amount of enzyme required to catalyze the production of 1nmol of product per minute under the conditions determined, i.e. 1 nmol/min. Molar extinction coefficients of NADH and NUDH of 6220M^-1cm^-1And (6) counting. The specific enzyme activity was calculated by equation 1. Wherein Vt is the total volume of the reaction solution, Vs is the volume of the added enzyme, and C is the enzyme concentration.

Wherein Vt is the total volume of the reaction solution, Vs is the volume of the added enzyme, and C is the enzyme concentration.

The product of The enzymatic reaction synthesis was isolated and purified by The method described in The literature (D.Ji, et al. journal of The American chemical society.2011, 133, 20857-20862).

The quality and quantity of the NUD product after the reaction of the crude enzyme solution were determined by HPLC method in the literature (L. Sorci, et al. proceedings of the National Academy of Sciences of the United States of America.2009, 106, 3083).

The minimum mineral salts medium in the fermentation medium was formulated in the literature (T.Causey, et al.proceedings of National Academy of Sciences of the United states of America.2003, 100, 825).

Comparative example 1 catalytic Synthesis of NUD from wild NadD

Reference (R.Mehl, et al. journal of bacteriology.2000, 182, 4372) an expression vector of wild-type nicotinamide mononucleotide adenyltransferase NadD derived from Escherichia coli was constructed and transferred into Escherichia coli BL21(DE3) to obtain an engineered bacterium BL21(DE3) (pET-NadD). Reference (r.mehl, et al. journal of bac)Biology.2000, 182, 4372) induced expression and purified NadD, SEQ ID NO: 1, or a pharmaceutically acceptable salt thereof. The above-mentioned malic enzyme mutant ME is adopted^*The coupling method measures the reactivity of the NUD synthesized using UTP. Reaction conditions are as follows: 150 μ L of the reaction system contained HEPES 50mM, UTP 100 μ M, NMN4mM, MgCl₂10mM，MnCl₂5mM, NadD 6mg, L-malic acid 10mM, malic enzyme mutant ME^*Pure enzyme 7.5U, pH 7.5, and absorbance change at 340nm with a spectrophotometer at a constant temperature of 25 ℃. The activity of synthesizing NUD from wild NadD was found to be 0.02U/mg.

Example 1 NadD^3G10Catalytic synthesis of NUD

1. Construction of a library of mutations

The mutant library was constructed by the method of RF cloning (F.van den Ent, et al. journal of Biochemical and Biophysical methods.2006, 67, 67). The first step, the template is wild type NadD expression vector (see comparative example 1), the primer replaces the base of the amino acid site to be mutated with degenerate base NNK, and the PCR product is recovered; secondly, digesting the obtained product by using DpnI restriction enzyme and transferring the product into BL21(DE3) competent cells, wherein the obtained transformant is a mutation library capable of expressing the NadD mutant, each mutant expression bacterium is named as BL21(DE3) (pET-NadD-xxx), and the expressed protein product is named as NadD^xxx. Where xxx is a combination of numbers and letters, one number for each mutant strain, as follows.

2. Mutant library screening

And (3) selecting a single colony of the mutation library, inoculating the single colony into a 96-deep-well plate LB liquid culture medium, culturing at 30 ℃ and 200rpm for 72h, and inducing to express the mutant. The cells were collected by centrifugation at 3500rpm for 15min, and a cell lysis reagent (50mM HPEPS, 1% Triton, 1mg/mL lysozyme, pH 7.5) was added thereto, disrupted at 37 ℃ and 200rpm for 1 hour, and centrifuged at 3500rpm to obtain a crude enzyme supernatant. And (3) carrying out activity screening for synthesizing NUD by adopting an enzyme coupling chromogenic method. The reaction conditions of 60. mu.L were: HEPES 50mM, UTP 2mM, NMN4mM, MgCl₂10mM，MnCl₂5mM, 10mM L-malic acid, malic enzyme mutant ME^*7.5U pure enzyme, 0.4mM PES, NBT1mM,and (3) adding 10 mu L of crude enzyme solution at the pH of 7.5, reacting at 30 ℃ for 1.5h, observing color change, wherein the strain corresponding to the hole showing blue is suspected to be the mutant strain capable of synthesizing NUD. And the rescreening adopts amplification culture, the mutant is induced and expressed in 5mL LB liquid culture medium, the screening method is the same as the above, and the mutant strain which can repeatedly show blue is the target mutant strain.

Selecting mutant strain with rapid color development and sequencing, wherein the mutant strain is named as BL21(DE3) (pET-NadD-3G10), and the mutant strain expresses protein product NadD^3G10The amino acid sequence of (a) is SEQ ID NO:4, compared with wild type NadD, tyrosine 118 is mutated to histidine, proline 175 to lysine, and tryptophan 176 to arginine.

3.NadD^3G10Catalytic synthesis of NUD

Culture of mutant BL21(DE3) (pET-NadD-3G10), induced expression and NadD^3G10The purification process of (1) was the same as in comparative example 1. The pure enzyme NadD was purified from 9g of wet cells^3G1027mg/mL, total 10 mL. The specific enzyme activity of the enzyme was measured by synthesizing NUD using UTP as in comparative example 1. The activity of synthesized NUD is measured to be 9.22U/mg, which is improved by 460 times compared with wild type NadD.

Therefore, the mutant pure enzyme NadD obtained by the invention^3G10The activity of catalyzing and synthesizing NUD is obviously higher than that of corresponding wild protein, and a new biocatalyst is provided for preparing NUD and synthesizing NUD in cells.

Example 2 NadD^3G10Preparation of NUD with pure enzyme

10mL of pure enzyme NadD^3G10The reaction system for synthesizing NUD contains Tris 50mM, UTP 2mM, NMN4mM, MgCl₂10mM，MnCl₂5mM, pure enzyme NadD^3G1010mg, pH 8.0, at 37 ℃ for 1h at 200rpm, followed by centrifugation in an ultrafiltration tube at 5000g for 15min at 4 ℃ to remove protein, according to the literature method (D.Ji, et al. journal of the American Chemical society.2011, 133, 20857), and was isolated and purified to obtain NUD 5.8mg with a yield of 45%.

Product nmr data:¹H NMR(D20，400MHz)：9.36(s，1H)，9.20(d，J＝6.2Hz，1H)，8.88(d，J＝8.1Hz，1H)，8.22(pseudo t，J＝6.6Hz，1H)，7.79(d，J＝8.2Hz，1H)，6.10(d，J＝5.4Hz，1H)，5.82-5.80(m，2H)，4.52(brs，1H)，4.48-4.46(m，1H)，4.39-4.37(m，1H)，4.34-4.32(m，1H)，4.25-4.21(m，2H)，4.18-4.15(m，3H)，4.07-4.04(m，1H).13C NMR(D20，100MHz)：166.1，165.6，151.7，146.1，142.6，141.7，139.9，133.9，128.7，102.5，99.9，88.5，87.0，82.9，77.6，73.7，70.7，69.5，64.9，64.7.31P NMR(D20，162MHz)：-11.1，-11.3.

example 3 NadD^3G10Preparation of NUD from crude enzyme solution

Adding NadD^3G10The expression engineering bacterium BL21(DE3) (pET-NadD-3G10) was streaked, and a single colony was picked up and inoculated into 5mL of LB liquid medium (containing 50 ng/. mu.L kanamycin), activated overnight at 37 ℃ at 200rpm, and the whole was inoculated into 50mL of fresh LB (containing 1mM kanamycin at 50 ng/. mu.L and IPTG), and cultured at 30 ℃ for 24 hours at 200 rpm. The cells were collected by centrifugation, and 5mL of cell lysate (50mM HPEPS pH 7.5, 1% Triton X-100, 1mg/mL lysozyme) was added thereto and lysed at 37 ℃ and 200rpm for 1 hour. Centrifuging (12000g) for 10min, and collecting supernatant to obtain NadD^3G10And (4) crude enzyme liquid.

A300. mu.L crude enzyme reaction system contained: tris 50mM, UTP 100. mu.M, NMN4mM, MgCl₂10mM，MnCl₂5mM，NadD^3G10The crude enzyme solution was reacted at 50. mu.L, pH 8.0, 37 ℃ and 200rpm for 2 hours. Add 150. mu.L of ice-chilled 1.2M HClO₄After mixing, the reaction is stopped in ice bath for 10 min; treating at 4 deg.C under centrifugal force of 12000g for 1min, collecting supernatant 300 μ L, adding ice-precooled 0.8M K80 μ L₂CO₃Mixing the solution, and performing ice bath for 10min for neutralization; the mixture was treated at 4 ℃ under a centrifugal force of 12000g for 1min, and 300. mu.L of the supernatant was filtered through a 0.22 μm filter and analyzed by HPLC. Quantitative analysis showed that NUD was 1.83mM in the reaction solution at the end of the reaction.

Example 4 NadD^3G10Intracellular synthesis of NUD

With NadD^3G10The culture method of engineering bacteria for synthesizing NUD from crude enzyme solution comprises recovering by streaking, activating overnight, inducing and expressing, and diluting the bacteria solution to OD₆₀₀Taking 1mL of bacterial liquid, centrifuging (12000g) for 2min, and collecting thalli; add 500. mu.L of 50mM pH 7.2, carrying out heavy suspension in a phosphate buffer solution, carrying out centrifugal treatment (12000g) for 2min, and collecting thalli; adding 150 μ L of 0.2M HCl during NUD extraction, heating at 55 deg.C for 10min, and cooling at 0 deg.C for 5 min; adding 150 μ L of 0.1M NaOH solution for neutralization, centrifuging (12000g) for 5min, and collecting supernatant as intracellular NUD extractive solution.

The intracellular NUD content is measured by an enzyme cycling method. The reaction system contained 100. mu.L of: 50mM HEPES, 10mM MgCl₂，5mM MnCl₂Malic enzyme mutant ME of 50U/mL^*Pure enzyme solution, 10mM L-malic acid, 0.4mM PES, 1mM MTT and 15 μ L NUD extract, pH 7.5. The intracellular NUD content of the engineering bacteria BL21(DE3) (pET-NadD-3G10) was found to be 23.1. mu.M.

Example 5 NadD^3G10Regulating succinic acid fermentation yield

The host of the succinic acid fermentation engineering bacteria is E.coli KJ134(K.Jantama, et al, Biotech Dology bioengineering.2008, 5, 881). The madB gene is knocked out by a Red beta recombination system and an FLP recombinase system, malic acid is prevented from being consumed by the strain, and the obtained engineering strain is named as E.coli WXY01(KJ134, delta maeB).

Construction of succinic acid fermentation engineering bacteria requires that NadD capable of synthesizing NUD^3G10Phosphite dehydrogenase mutant enzyme PDH having a mutation of isoleucine at position 151 to arginine from Pseudomonas stutzeri WM88 dependent on NUD (H) as a coenzyme^*(phosphorous acid is oxidized into phosphoric acid and NUD is reduced into NUDH) and malic enzyme mutant ME which is derived from Escherichia coli K12 and has leucine 310 mutated into lysine^*(catalytic pyruvate to malic acid using NUDH as reducing power) and co-expressed in E.coli WXY01 host. Tri-enzyme co-expression vector pK vector (Wanglie. Nicotinamide cytosine dinucleotide-based metabolic circuit research [ doctor's scientific paper ]]Beijing: university of chinese academy of sciences, 2014) as a template. The three-step RF cloning method is adopted. The primers and templates used are shown in tables 1 and 2 below. The obtained RF clone product is converted and the colony PCR is identified to be correct, then the plasmid is extracted and sequenced, and the correctly sequenced product is the target vector named as pK-ME^*-NadD^3G10-PDH^*。

TABLE 1 primer Table for construction of Co-expression vectors

Primer name	Primer sequences
		ME-F	GGATAACAATTTCACACAGGAAACACATATGGAACCAAAAACAAAAAAACAGC
ME-R	GGCGGGTGTCGGGGCTGGCTTAATCAGTGGTGGTGGTGGTGGTGCTCGAG
		PK-ME-F	CCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCC
PK-ME-R	GGAAAGAACATGTGAGCAAAAGGCCATCCCGGAGACGGTCACAGC
		PK-NadD-F	GCTGTGACCGTCTCCGGGATGGCCTTTTGCTCACATGTTCTTTCC
PK-NadD-R	GGAAAGAACATGTGAGCAAAAGGCCATCCCGGAGACGGTCACAGC

TABLE 2 primers, template profiles for two-step RF cloning

	RF1 primer	RF1 template	RF2 template	Object carrier
					1st	ME-F/R	pET24b-ME*	pK	pK-ME*
2nd	pK-ME-F/R	pK-ME*	pK-PDH*	pK-ME*-PDH*
					3rd	pK-NadD-F/R	pET-NadD-3G10	pK-ME*-PDH*	pK-ME*-NadD3G10-PDH*

Mixing pK-ME^*-NadD^3G10-PDH^*The obtained positive clone is the engineering bacterium of the embodiment after being verified correctly by electrotransformation into WXY01 competent cells, and is named as WXY02, and the succinic acid accumulation pathway is shown in figure 2.

The culture medium of the seed for producing succinic acid by WXY02 fermentation is LB liquid culture medium, the fermentation culture medium is minimum mineral salt culture medium added with 10% glucose, 100mM KHCO₃0.15% sodium acetate, 100mM phosphorous acid and 0.4mM IPTG. The overnight activated seed culture was inoculated into 1.5L fermentation medium at an inoculation rate of 1: 50 and cultured at 30 ℃ for 96h at 200 rpm.

Succinic acid content the succinic acid content of the fermentation broth was found to be 97g/L by HPLC analysis using literature methods (K.Jantama, et al.Biotechnology bioengineering.2008, 5, 881), whereas the succinic acid content of the fermentation broth was 72g/L when KJ134 was cultured under the same conditions. The result shows that the succinic acid yield of the engineering bacteria WXY02 is improved by 35% when glucose is used as a carbon source.

The results of this example demonstrate that the engineered bacterium WXY02 was produced by intracellular synthesis of NUD and in PDH^*Is reduced to NUDH by ME^*Utilizing, promoting ME^*The method overcomes thermodynamic barrier to catalyze malic acid synthesis, and further improves the yield of succinic acid. Therefore, the intracellular synthesis of NUD and the redox reaction system mediated by NUD provide a new technology for metabolic engineering.

Comparative example 2

Reference (n. raffalli, et al, journal of bacteriology.1999, 181, 5509) the NadR gene of NadR derived from escherichia coli BL21(DE3) was subcloned into pK vector to obtain expression vector pK-NadR of wild type NadR, which was electroporated into DH10b competent cells to obtain engineered bacteria capable of expressing NadR, named DH10b (pK-NadR). The engineered bacteria were induced and purified by reference (n. raffalli, et al, journal of bacteriology.1999, 181, 5509) to obtain the pure enzyme NadR, SEQ id no: 2, or a pharmaceutically acceptable salt thereof. The NUD synthetase activity assay was performed by the same method as in comparative example 1. The activity of synthesizing NUD from wild NadR was found to be 0.01U/mg.

Example 6 NadR^7G11Catalytic synthesis of NUD

The construction of the NadR mutant library was essentially the same as in example 1, except that the PCR product obtained by RF cloning was digested with DpnI and then electroporated into E.coli DH10b competent cellsThe obtained transformant is a mutation library capable of expressing NadR mutants, each mutant expression strain is named as DH10b (pK-NadR-xxx) and the expression protein product is named as NadR^xxx. Where xxx is a combination of numbers and letters, one number for each strain, as follows.

The mutant library was screened and rescreened as in example 1 except that NMN was reduced from 4mM to 1mM in the enzyme-coupled chromogenic screening system.

The mutant strain with faster color development was selected and named DH10b (pK-NadR7G11) and sequenced, and its expression protein product NadR^7G11The amino acid sequence of (a) is SEQ ID NO:5, compared with wild NadR, the deletion mutation of aspartic acid, proline and lysine at positions 198, 199 and 200 is alanine and tyrosine.

Cultivation of mutant DH10b (pK-NadR-7G11), induced expression and NadR^7G11The purification process of (1) was the same as in comparative example 2. The pure enzyme NadR was purified from 12g of wet cells^7G11The concentration was 15mg/mL for a total of 10 mL. The specific enzyme activity of the enzyme was measured by synthesizing NUD using UTP as in comparative example 1. The activity of synthesized NUD is measured to be 2.15U/mg, which is 210 times higher than that of wild NadR.

Therefore, the mutant protein NadR obtained by the invention^7G11The activity of catalyzing and synthesizing NUD is obviously higher than that of corresponding wild protein, and a new biocatalyst is provided for preparing NUD and synthesizing NUD in cells.

Example 7 NadR^7G11Preparation of NUD with pure enzyme

10mL NadR^7G11The system for synthesizing NUD by pure enzyme reaction is as follows: HEPES 100mM, UTP 4mM, NMN4mM, MgCl₂10mM，MnCl₂5mM，NadR^7G115mg, pH 8.6, at 30 ℃, 200rpm for 2h, followed by centrifugation in an ultrafiltration tube at 5000g, 4 ℃ for 15min to remove protein, according to the literature method (D.Ji, et al. journal of the American Chemical society.2011, 133, 20857), and was isolated and purified to give NUD 7.8mg, 30% yield.

Example 8 NadR^7G11Intracellular synthesis of NUD

The intracellular synthesis of NUD and extraction method of NUD was the same as example 4, except that the engineered strain DH10b (pK-NadR-7G11) was used, the induction conditions were 0.1mM IPTG, and the cells were cultured at 20 ℃ and 200rpm for 60 hours.

Intracellular NUD content was measured as in example 4. The intracellular NUD content of the engineering bacteria DH10b (pK-NadR-7G11) was found to be 2.5. mu.M.

Comparative example 3 catalytic Synthesis of NUD from wild NadM

Reference (l.sorci, et al. proceedings of the National Academy of sciences.2009, 106, 3083) constructs an expression vector of nicotinamide mononucleotide adenyl adenylyl transferase NadM derived from francisella tularensis, transfers it into escherichia coli BL21(DE3) to obtain engineering bacteria BL21(DE3) (pET-NadM), induces expression, and purifies to obtain wild type NadM, i.e. SEQ ID NO: 3, and (b) a protein corresponding to the protein. The NUD synthetase activity assay was performed by the same method as in comparative example 1. The activity of synthesizing NUD from wild NadM was found to be 0.07U/mg.

Example 9 NadM^15C12Catalytic synthesis of NUD

The construction method of the NadM mutant library is basically the same as that of example 1, the obtained transformant is the mutant library capable of expressing the NadM mutant, each mutant expression bacterium is named as BL21(DE3) (pET-NadM-xxx) respectively, and the expression protein product is named as NadM^xxx. Where xxx is a combination of numbers and letters, one number for each strain, as follows.

The mutant library was screened and rescreened in the same manner as in example 1 except that the mutant library was induced at 20 ℃ and 200rpm for 96 hours, IPTG was added to the medium at a concentration of 0.1mM, and the NMN concentration was reduced from 4mM to 100. mu.M in the enzyme-coupled chromogenic screening.

Selecting mutant strain with rapid color development and sequencing, wherein the mutant strain is named as BL21(DE3) (pET-NadM-15C12), and the expression protein product NadM is obtained^15C12The amino acid sequence of (a) is SEQ ID NO:6, aspartic acid at position 131 was mutated to proline compared to wild type NadM.

Culture of mutant BL21(DE3) (pET-NadM-15C12), induced expression and NadM^15C12The purification process of (3) was the same as in comparative example 3. The pure enzyme NadM was purified from 8g of wet cells^15C12The concentration was 7.8mg/mL, for a total of 5 mL. Method for determining specific enzyme activity of UTP (utilzied UTP) for synthesizing NUD (nucleic acid-binding protein)As in comparative example 1. The activity of synthesized NUD is measured to be 13.7U/mg, which is 196 times higher than that of wild type NadM.

Therefore, the mutant protein NadM obtained by the invention^15C12The activity of catalyzing and synthesizing NUD is obviously higher than that of corresponding wild protein, and a new biocatalyst is provided for preparing NUD and synthesizing NUD in cells.

Example 10 NadM^15C12Preparation of NUD with pure enzyme

The system for synthesizing NUD by 10mL pure enzyme reaction is as follows: HEPES 50mM, UTP 4mM, NMN4mM, MgCl₂10mM，MnCl₂5mM，NadM^15C1220mg, pH 7.0, at 25 ℃ for 4h at 200rpm to give a product which is then centrifuged at 5000g 4 ℃ for 15min using an ultrafiltration tube to remove protein by the reference method (D.Ji, et al. journal of the American Chemical society.2011, 133, 20857) and isolated and purified to give NUD 13.34mg with 52% yield.

Table 3 lists the activities of other NMNAT mutants of the invention.

The nicotinamide mononucleotide uracil dinucleotide is prepared by catalyzing the coupling reaction of nicotinamide mononucleotide and uracil nucleoside triphosphate with a nicotinamide mononucleotide adenyl transferase mutant as a catalyst. The coding gene of the nicotinamide mononucleotide adenyl transferase mutant is expressed in microbial cells, engineering bacteria synthesize nicotinamide uracil dinucleotide with endogenous metabolites, and intracellular nicotinamide uracil dinucleotide can be used as a coenzyme, selectively mediate an oxidation-reduction reaction, and the yield of target metabolites is improved. In a typical example, succinic acid production was increased by 35%.

Claims (8)

1. A method for enzymatically synthesizing nicotinamide uracil dinucleotide, comprising: synthesizing nicotinamide-uracil dinucleotide by using nicotinamide mononucleotide and uracil nucleoside triphosphate as substrates and using a mutant of nicotinamide mononucleotide adenosine transferase as a catalyst;

the nicotinamide mononucleotide adenyltransferase mutant is as follows:

the amino acid sequence is shown as SEQ ID NO: 1, and the mutation site is selected from any one of the following groups:

(1) the mutation at position 118 is H, the mutation at position 175 is K and the mutation at position 176 is R;

(2) the mutation at position 132 is I, the mutation at position 175 is M and the mutation at position 176 is S;

(3) mutation at position 22 to A, mutation at position 82 to K and mutation at position 84 to K;

(4) the 86-position mutation is F, the 109-position mutation is G and the 118-position mutation is N;

(5) 22-position mutation is G, 107-position mutation is V and 174-position mutation is R;

(6) deletion mutations at positions 174, 175 and 176 to PG;

(7) mutation at position 23 to G and mutation at position 118 to H;

or, the amino acid sequence is shown as SEQ ID NO: 2, and the mutation site is selected from any one of the following groups:

(1) deletion mutations at positions 198, 199, and 200 to AY;

(2) the 176 and 177 insertion mutation is PAS;

(3) the mutation at position 83 is R and the mutation at position 205 is N;

(4) deletion mutations at positions 203, 204 and 205 to EG;

or, the amino acid sequence is shown as SEQ ID NO: 3, and the mutation site is selected from any one of the following groups:

(1) mutation at position 131 to P;

(2) the 21-position mutation is R and the 110-position mutation is S;

(3) mutation at position 110 to L and mutation at position 133 to E;

(4) the 132 th mutation is R.

2. The method of claim 1, further characterized by: the mutant of nicotinamide mononucleotide adenyl transferase is coded by a corresponding DNA sequence.

3. The method of claim 2, further characterized by: the DNA sequence for coding the nicotinamide mononucleotide adenyl transferase mutant is cloned in a protein expression vector for controllable expression.

4. The process for the enzymatic synthesis of nicotinamide uracil dinucleotides according to claim 1, further characterized in that: the mutant of nicotinamide mononucleotide adenyl transferase is produced by microbial cells carrying expression vectors of corresponding mutants, the corresponding mutants are purified, and the mutant is used for synthesizing nicotinamide uracil dinucleotide through in vitro enzymatic reaction.

5. The process for the enzymatic synthesis of nicotinamide uracil dinucleotides according to claim 1 or 4, characterized in that: the reaction conditions are as follows: the pH value is 5.0-9.0, the temperature is 25-40 ℃, and the time is 0.2-30 h; the dosage molar ratio of the nicotinamide mononucleotide, the uracil nucleoside triphosphate and the nicotinamide mononucleotide adenosine transferase mutant is 1:0.02-50: 0.00002-0.1.

6. The process for the enzymatic synthesis of nicotinamide uracil dinucleotides according to claim 1, characterized in that: expressing the nicotinamide mononucleotide adenyl transferase mutant of claim 1 in a microbial cell, and simultaneously expressing one or more than two proteins with nicotinamide uracil dinucleotide as a coenzyme to construct a metabolic system capable of being selectively regulated and controlled, wherein the metabolic system is used for improving the yield of a target metabolite.

7. The process for the enzymatic synthesis of nicotinamide uracil dinucleotides according to claim 1, characterized in that: expressing the nicotinamide mononucleotide adenylyltransferase mutant of claim 1 in an escherichia coli engineering bacterium, simultaneously expressing a malic enzyme mutant which takes nicotinamide uracil dinucleotide as a coenzyme and is derived from 310 th leucine of escherichia coli K12 to be mutated into lysine and a phosphorous acid dehydrogenase mutant which is derived from 151 th isoleucine of pseudomonas stutzeri WM88 to be mutated into arginine, and culturing engineering bacterium cells in the presence of phosphorous acid to improve the yield of succinic acid.

8. The process for the enzymatic synthesis of nicotinamide uracil dinucleotides according to claim 1, characterized in that: the nicotinamide mononucleotide adenyl transferase mutant is any one or the combination of nicotinamide mononucleotide adenyl transferase mutants with amino acid sequences shown as SEQ ID NO. 4, SEQ ID NO. 5 or SEQ ID NO. 6.

Images