CN106884028A - The method of enzyme' s catalysis niacinamide uracil dinucleotides - Google Patents
The method of enzyme' s catalysis niacinamide uracil dinucleotides Download PDFInfo
- Publication number
- CN106884028A CN106884028A CN201510939556.1A CN201510939556A CN106884028A CN 106884028 A CN106884028 A CN 106884028A CN 201510939556 A CN201510939556 A CN 201510939556A CN 106884028 A CN106884028 A CN 106884028A
- Authority
- CN
- China
- Prior art keywords
- sport
- mutant
- enzyme
- niacinamide
- dinucleotides
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
- C12P19/28—N-glycosides
- C12P19/30—Nucleotides
- C12P19/36—Dinucleotides, e.g. nicotineamide-adenine dinucleotide phosphate
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Method and its application the present invention relates to a kind of enzyme' s catalysis niacinamide uracil dinucleotides.It is catalyst using nicotinamide mononucleotide adenylase mutant, is catalyzed nicotinamide mononucleotide and uridine diphosphate guanosine triphosphate coupled reaction, prepares niacinamide uracil dinucleotides.The encoding gene of nicotinamide mononucleotide adenylase mutant is expressed in microbial cell, engineering bacteria synthesizes niacinamide uracil dinucleotides using endogenous metabolism thing, and intracellular niacinamide uracil dinucleotides can be used as coenzyme, selective mediated oxidative reduction reaction, improves target metabolic Product yields.In a representative instance, succinic acid production improves 35%.
Description
Technical field
The invention belongs to technical field of bioengineering, it is related to enzyme' s catalysis niacinamide uracil dinucleotides
The method of (nicotinamide uracil dinucleotide, NUD) and its application, in microbial cell
The encoding gene of interior expression nicotinamide mononucleotide adenylase mutant, engineering bacteria utilizes endogenous metabolism thing
Synthesis NUD, and intracellular NUD can be used as coenzyme, selective mediated oxidative reduction reaction, improves target metabolic
Product yields.
Background technology
NADH (NAD) and its reduction-state (NADH) grow in the breeding of cell,
Very important effect (W.Ying, et al.Antioxidants is all played in the vital movements such as differentiation, apoptosis
Redox Signaling.2008,10,179).In addition, NAD or many important oxidoreducing enzyme
Coenzyme, play a part of transmit hydrogen and electronics.Its structural formula is as follows:
Because NAD (H) simultaneously participates in various reactions in organism, therefore in the biological generation of most of target product
Thank in network, can all there is reaction of the one or multi-step using NAD (H).Co-factor work is generally used at this stage
Journey regulates and controls to target metabolic network.Common strategy has, and 1) change the synthesis of intracellular coenzyme, degraded is returned
Mend metabolism and the ability that mutually converts of different cofactor molecules, 2) change the coenzyme Preference of oxidoreducing enzyme, 3)
The enzyme of renewable coenzyme, such as GDH are expressed in the cell, and are additionally added in culture environment
The substrate of corresponding enzyme.But, because NAD (H) is a kind of general coenzyme, intracellular NAD (H) levels and difference
The disturbance of oxidation state often produces the influence of overall importance for being difficult to predict to cell physiological and metabolism etc..Therefore,
In order to realize specific regulatory control target metabolic network, needing a kind of method badly makes target metabolic network be metabolized from complexity
It is independent in network, that is, need to redesign out bio-orthogonal system (K.Shokat, et an al.Drug
Discovery Today.2002,7,872).
In the bio-orthogonal system for depending on NAD analogs, NAD (H) analog can be on the orthogonal metabolism way
Transmitted in footpath, without influenceing other using the metabolic pathway of NAD (H), equally, the NAD (H) in other metabolic pathways
Bio-orthogonal metabolic pathway is not interfered with yet.Therefore, only just can be with by regulating and controlling the content of NAD (H) analog
Specific metabolic regulation is carried out to biological orthogonal system, the purpose of target pathway yield is improved so as to reach.
Because the oxidoreducing enzyme for depending on NAD (H) occurs in adenine knot with its coenzyme mainly in combination with effect
Close domain, pyridine loop section mainly play a part of transmit electronics, therefore, in order to ensure NAD analogs oxidation also
Originality energy, can only transform the adenine loop section of NAD.
At present, most of NAD analogs are synthesized using chemical method.But, chemical method synthesis NAD analogs
Complex steps often are faced with, unstable chemcial property is separated, purified more difficult and relatively costly, it is impossible to
The problems such as directly applying to organism.Therefore, someone using enzymatic method synthesis NAD analogs, (H. enlightening is taken
You, D. Heindels, C. mayers, the enzyme' s catalysis of R. Shi Muke, CARBA-NAD, application number:
201080033434.1).It is by wild type niacinamide ribokinase (RNK) and nicotinamide mononucleotide gland
Glycosides transferase (NMNAT) carries out the enzymatic reaction synthesis of NAD analogs.Wherein, nicotinamide mononucleotide gland
Glycosides transferase (nicotinamide/nicotinic acid mononucleotide
Adenylyltransferase, NMNAT) it is different according to source of species, respectively can by gene nadD, nadM,
NadR is expressed, by nicotinamide mononucleotide (nicotinamide mononucleotide, NMN) or nicotinic acid
Mononucleotide (nicotinic acid mononucleotide, NaMN) and adenosine triphosphate (ATP) enter
Row condensation reaction synthesizes NAD or NaAD, is the key enzyme in NAD biosynthesis pathways.Although reacting in vitro
Under the conditions of, wild NMNAT can also show very low synthesis minority NAD analogs activity (M.Emanuelli,
Et al.Protein Expression and Purification.2003,27,357), but be not enough to
NAD analogs are directly synthesized for preparing or carrying out intracellular.
Niacinamide uracil dinucleotides (nicotinamide uracil dinucleotide, NUD) is
A kind of NAD analogs, can be used as coenzyme mediated oxidative reduction reaction.The redox of NUD is relied on by building
Enzyme, can set up the redox system of bio-orthogonal, for controlling endocellular metabolism process (D.Ji, et
Al.Journal of the American Chemical Society.2011,133,20857).Although
NUD can be synthesized by chemical method, but NUD is as NAD, it is impossible to cell membrane is freely passed through, as intracellular
Using the bottleneck of NUD.Accordingly, it would be desirable to a kind of method of enzyme' s catalysis NUD is set up, to utilize cellular endogenous generation
Thank to thing and directly synthesize NUD in intracellular.
The content of the invention
Synthesize NUD complex steps for chemical method, isolate and purify difficulty, NUD is difficult to the shortcomings of entering cell,
And at present not yet find can efficient catalytic synthesize NUD enzyme, it is an object of the invention to provide a kind of enzyme' s catalysis
The method of NUD, the mutant with nicotinamide mononucleotide adenylase as catalyst, with niacinamide monokaryon glycosides
Acid and uridine diphosphate guanosine triphosphate are substrate, catalyze and synthesize NUD, and by intracellular expression niacinamide monokaryon
The mutant of thuja acid adenylase, realizes directly synthesizing NUD in intracellular, is applied to selective regulation and was metabolized
Journey and raising target metabolic Product yields.
On the one hand, the invention provides a kind of method of enzyme' s catalysis niacinamide uracil dinucleotides (NUD),
Mutant with nicotinamide mononucleotide adenylase as catalyst, with nicotinamide mononucleotide (NMN) and
Uridine diphosphate guanosine triphosphate (UTP) is substrate, synthesizes niacinamide uracil dinucleotides.
In some embodiments, the amino acid sequence of nicotinamide mononucleotide adenylase is SEQ ID
NO:1, SEQ ID NO:2 or SEQ ID NO:One or two or more kinds in 3, wherein, SEQ ID NO:1 is
From the amino acid sequence of the NadD of Escherichia coli, SEQ ID NO:2 NadR's for being derived from Escherichia coli
Amino acid sequence, SEQ ID NO:3 are derived from the amino acid sequence that soil draws the NadM of hot Francisella.
The mutant of nicotinamide mononucleotide adenylase is more than 1 amino in above-mentioned amino acid sequence
Acid be mutated the mutant of acquisition, and mutational site is the one kind or two kinds in following sequences in amino acid sites
More than:
One kind is in SEQ ID NO:Mutational site in 1 amino acid sequence is:22 sport S, in L, A or G
One kind, 23 one kind sported in T, G or L, 45 one kind sported in W, Y or L, 82 mutation
It is K, the one kind in E, L or T, 84 sport K, the one kind in W, E, A, L, V, M, T or P, 86
Position sports R, the one kind in F, D, K, S or W, and 107 sport F, in V, R, L, S, A, W or P
One kind, 109 one kind sported in G, A or S, 118 sport D, H, T, P, G, N, A or R
In one kind, 132 sport I, the one kind in A, V, P, F, G, L, R or Q, and 174 sport I,
One kind in A, R, P, L, G, V, K, D or M, 175 sport T, K, S, N, M, W, E or G
In one kind, 176 sport M, the one kind in G, S, A, P, T, R or K, and 177 sport A, E,
One kind in L, P, R or S, or 178 sport P, the one kind in I, V, S, R, G, T or L, 174,
175,176 deletion mutations are two amino acid d, e, and wherein d is A, and the one kind in S, T or P, e is S,
One kind in P, G or A, or 174,175 insertion mutations are three amino acid d, e, f, and wherein d is K, L,
One kind in P, T, V or D, e is G, the one kind in P, M, L, V, T, R, D or I, and f is P, R, T,
One kind in E, Q, K, V or S, the novel protein of one or more mutation of generation;
Or, one kind is in SEQ ID NO:Mutational site in 2 amino acid sequence is:82 sport S, L, A or G
In one kind, 83 one kind sported in R, I or K, 88 sport F, the one kind in V, M or L, 148
Position sports N, the one kind in Q, H or S, 154 one kind sported in H, Y or F, and 176 sport G,
One kind in A or S, 205 sport P, the one kind in Q, V, R, G, K, N or L, and 176,177 are inserted
Enter to sport three amino acid a, b, c, wherein a is the one kind in P, G or I, and b is the one kind in V, S or A,
C is S, the one kind in C, I, H or W, or 203, and 204,205 deletion mutations are two amino acid d, e,
Wherein d is E, and the one kind in L, M, F, L or V, e is A, the one kind in E, D, N, G, V or I, is produced
One or more mutation novel proteins;
Or, one kind is in SEQ ID NO:Mutational site in 3 amino acid sequence is:21 sport M, S, K, T,
One kind in L, F, G, W, Q or R, 23 sport R, the one kind in T, L or Q, and 24 sport N,
One kind in W, K, S, F, R, G, V, T, D, P, E or A, 110 sport S, R, L, N or Q
In one kind, 130 sport P, the one kind in G, A or S, and 131 sport A, G, R, F, S, L,
One kind in E, V, C, W, I or P, 132 sport R, the one kind in W, V, A, S or G, 133
V is sported, the one kind in T, Q, L or E, 134 sport P, the one kind in E, A or G, 135 mutation
It is T, the one kind in G, S, K or R, 136 one kind sported in I, L or V, or 137 sport S,
One kind in H or D, the novel protein of one or more mutation of generation.
The present invention obtains the operating procedure of the nicotinamide mononucleotide adenylase mutant that can synthesize NUD
It is as follows:
1. selection derives from the NMNAT of known species for template is oriented evolution.
The species complete genome DNA is extracted, PCR amplifications obtain the gene order that the species express NMNAT, or entirely
The gene chemical synthesis gene orders.
2. the engineering bacteria of construction expression NMNAT.
By in gene cloning to the prokaryotic protein expression carrier for expressing NMNAT, and convert to Escherichia coli
BL21 (DE3) or DH10b, the positive colony of acquisition is sequenced, and correctly clone is open country to sequencing result
Raw type NMNAT expression engineering bacterias.
3. the crystal structure of the NMNAT of the species is downloaded or simulated to database.
If the NMNAT crystal structures have been parsed, and include ATP or NAD in crystal structure, then directly in PDB
Database (http://www.rcsb.org/pdb/home/home.do) be downloaded and analyze;If the NMNAT
Crystal structure do not parse or parsed but in crystal structure without ATP or NAD, then it is enterprising in NCBI websites
Row blast (http://blast.ncbi.nlm.nih.gov/), searching parsed containing ATP or NAD and
Crystal structure of the homology more than 30% is template, using Swiss-model
(http://swissmodel.expasy.org/) be simulated.
4. mutation strategy is designed.
By crystal structure analysis, claim 2, the amino acid described in 3,4, with degeneracy base NNK are chosen
(wherein N=adenines, guanine or cytimidine or thymidine;K=guanines or thymidine) replace mesh
The codon in mutational site is marked, mutant primer is designed, saturation mutation carrier is built.
5. mutated library is built.
The method cloned using RF, referring to document (F.van den Ent, et al.Journal of
Biochemical and Biophysical Methods.2006,67,67).First step RF I PCR mistakes
Cheng Zhong, template is wild type NMNAT expression vectors, and primer is the mutant primer containing degeneracy base NNK, is obtained
The PCR primer for arriving is the big primer of second step RF clones;During second step RF II PCR, template is still open country
Raw type NMNAT expression vectors, the product that PCR is obtained is digested with DpnI restriction enzymes, and is transferred to Escherichia coli
In competent cell, the saturation mutation library of the transformant for obtaining as NMNAT.
6. mutated library screening technique is built.
Mutated library screening is carried out using the existing oxidoreducing enzyme for being capable of identify that target NAD analogs, is used
Enzyme is coupled development process.Screening colour developing principle is shown in accompanying drawing 1.
In enzyme coupling process color, substrate UTP and NMN are carried out condensation reaction by the mutated library of NMNAT, synthesis
NAD analogs NUD.Those skilled in the art can use document (D.Ji, et al.Journal
Of The American Chemical Society.2011,133,20857) similar method, obtain
NUD can be made to be reduced to the oxidoreducing enzyme of NUDH as indicator enzyme, generate NUDH;Phenazine methosulfate (PMS)
With NBT (NBT) that macroscopic black purple is reduced in the presence of NUDH is insoluble
Thing.
7. mutated library is screened.
Picking mutant library single bacterium colony is inoculated in 96 deep-well plates LB fluid nutrient mediums, carry out strain culturing and
The induced expression of mutain;Collects thalline cell is crushed, centrifugation, and supernatant is dashes forward containing solvable
Become albumen crude enzyme liquid.The pH of the reaction system of enzyme coupling colour developing screening is 5.0~11.0, is contained in reaction solution
NMN, UTP, metal ion indicate oxidoreducing enzyme and its cosubstrate, PMS, NBT and crude enzyme liquid supernatant.
The corresponding mutant bacteria in hole that reaction solution shows blue is suspected target mutant bacteria, by suspected target mutant bacteria
Second secondary screening checking is carried out, verifies that correct bacterium is targeted mutagenesis bacterium.Targeted mutagenesis bacterium upgrading grain send survey
Sequence, identification amino acid mutation site.
8. pure enzymatic activity checking.
Targeted mutagenesis bacterium is amplified culture and induced expression, the medium centrifugal collects thalline for obtaining simultaneously is split
Solution, is collected by centrifugation lysate supernatant, is isolated and purified according to the characteristics of targeted mutagenesis body, what collection was obtained
Pure enzyme liquid checking activity.
Verify that the reaction condition of pure enzymatic activity is as follows:0.05~10mM of cushioning liquid pH 5.0~11.0, NMN,
The metal ion of 0.02~10mM UTP, 0.05~10mM, the pure enzyme liquid of 0.01~1mg/mL, 25~40 DEG C
2~4h of reaction, terminating reaction removes deproteinized, selects suitable method to isolate and purify and obtains NAD analogs.
The analog that obtains of purifying carries out NMR detections, and spectrogram is correctly afterwards i.e. it is believed that corresponding mutant is for can be with
Synthesize the nicotinamide mononucleotide adenylase mutant of NUD.
In some embodiments, the mutant of nicotinamide mononucleotide adenylase, by corresponding deoxidation
Ribonucleic acid (DNA) sequential coding.
In other implementation methods, the mutant of nicotinamide mononucleotide adenylase, its corresponding volume
Code DNA sequence dna, is cloned in a kind of protein expression vector, for controlled expression.
On the other hand, the present invention provides a kind of application of enzyme' s catalysis NUD methods.
In some embodiments, the mutant of nicotinamide mononucleotide adenylase, it is corresponding prominent by carrying
The microbial cell of the expression vector of variant is produced, and purifies corresponding mutant, and close for external enzymatic reaction
Into NUD, reaction condition is:PH 5.0-9.0,25 DEG C -55 DEG C of temperature, time 0.2-30h;Nicotinoyl
Amine mononucleotide, uridine diphosphate guanosine triphosphate, the use of nicotinamide mononucleotide adenylase mutant three
Amount molar ratio is 1: 0.02-50: 0.00002-0.1.
In some embodiments, described mutant protein is expressed in microbial cell, at the same expression with
NUD is one or more albumen of coenzyme, the metabolism system that structure can selectively be regulated and controled, for improving
Target metabolic Product yields.
In some embodiments, described mutant protein is expressed in colibacillus engineering, while table
It is mutated up to the 310th leucine from e. coli k12 with niacinamide uracil dinucleotides as coenzyme
It is lysine malic enzyme mutant ME*Dashed forward with the 151st isoleucine from Pseudomonas stutzeri WM88
It is changed into arginine phosphorous acid dehydrogenase mutant PDH*, and the culturing engineering bacterium cell in the presence of phosphorous acid, improve
Succinic acid production.
Explanation on method for expressing
ME*Represent:The mutation of lysine malate dehydrogenase is sported from the 310th leucine of e. coli k12
Body (D.Ji, et al.Journal of the American Chemical Society.2011,133,
20857)。
PDH*Represent:It is arginine phosphorous from the 151st isoleucine mutation of Pseudomonas stutzeri WM88
(Wang Lei are based on the metabolism circuit studies [doctorate of niacinamide cytimidine dinucleotides to acidohydrogenase mutant
Paper] Beijing:University of the Chinese Academy of Sciences, 2014).
In the implementation method for improving succinic acid production, the host of selection for E.coliKJ134 (K.Jantama,
Et al.Biotechnology Bioengineering.2008,5,881).Cross table simultaneously in host
Danone enough synthesizes the nicotinamide mononucleotide adenylase mutant of NUD, relies on NUD (H) coming for coenzyme
The 151st isoleucine mutation of Pseudomonas stutzeri WM88 is come from for arginic phosphorous acidohydrogenase is mutated
Body PDH*(NUD is reduced into NUDH while phosphorous acid is oxidized into phosphoric acid) and from e. coli k12
The 310th leucine sport the malic enzyme mutant ME of lysine*(it is catalyzed by reducing power of NUDH
Pyruvic acid generates malic acid), build the intracellular synthesis of NUD, reduction and regeneration orthogonal system.By phosphorous acid oxygen
NUD is reduced to NUDH while turning to phosphoric acid, intracellular other lifes with NAD (H) as co-factor are not being disturbed
It is reducing power catalysis pyruvic acid generation malic acid with NUDH in the case of life process, realizes the special of reducing power
Property distribution and malic acid downstream product butanedioic acid accumulation.
In some preferred embodiments, the specific amino acid sequence of mutant protein is SEQ ID NO:4, SEQ
ID NO:5, SEQ ID NO:One or two or more kinds in 6.Wherein, SEQ ID NO:4 are derived from large intestine
The amino acid sequence of the mutant of the NadD of bacillus, compared with wild type NadD, its 118 tyrosine are sported
Histidine, 175 proline sport lysine, and 176 tryptophans sport arginine;SEQ ID NO:5
Be originate Escherichia coli NadR mutant amino acid sequence, compared with wild type NadR, its 198th,
The aspartic acid of 199,200, proline, lysine deletion mutation are alanine and tyrosine;SEQ ID NO:6
The amino acid sequence of the mutant of the NadM of the soil hot Francisella of drawing is derived from, with wild type NadM phases
Than its 131st Aspartic acid mutations is proline.
Brief description of the drawings
The screening principle of Fig. 1 NMNAT mutated libraries.Wherein, UTP is the analog of ATP, and NUD is target NAD
Analog, NMNAT*It is nicotinamide nucleotide adenylase mutant, oxidoreducing enzyme is as indicator enzyme altogether
NAD analogs NUD is reduced into the NUDH with reducing property, phenazine methosulfate by substrate under conditions of existing
And NBT (NBT) is reduced to macroscopic black purple in the presence of NUDH (PMS)
Color insoluble matter.
Fig. 2 intracellular fabricated in situ NUD and the metabolic pathway for improving succinic acid production.Host cell is
WXYO2, the bacterial strain has knocked out ldhA, adhE, focA, pflB, mgsA, poxB, tdcDE, citF,
The pyruvic acid such as aspC, sfcA, pta-ackA, maeB, oxaloacetic acid Consumption;Overexpression can be with again
Synthesize the NadD of NUD3G10, it is the malic enzyme mutant ME of reducing power that specificity relies on NUDH*, NUDH can be made
The phosphorous acid dehydrogenase mutant PDH of regeneration*.Wherein, NadD3G10It is derived from the mutation of the NadD of Escherichia coli
Body, compared with wild type NadD, its 118 tyrosine sport histidine, and 175 proline sport bad
Propylhomoserin, 176 tryptophans sport arginine;ME*The 310th leucine for being derived from e. coli k12 is dashed forward
It is changed into lysine malic enzyme mutant;PDH*It is derived from the 151st different bright ammonia of Pseudomonas stutzeri WM88
Acid mutation is arginine phosphorous acid dehydrogenase mutant.
Specific embodiment
Following examples can be will be better understood so that the present invention is furture elucidated by reference to following embodiment
The present invention.These being for illustration only property of embodiment are illustrated, rather than the limitation present invention.
In the present invention, the operating procedure of the mutant that acquisition can synthesize NAD analogs NUD is shown in the content of the invention.
Expression vector establishment uses RF cloning process.First step PCR amplifications are obtained containing same with destination carrier
The target gene of source arm fragment, second step PCR is big primer with it, is cloned into destination carrier.
To product digested with DpnI restriction enzymes, and be transferred in host's competent cell, the transformant for obtaining is i.e.
For the mutated library of NMNAT mutant can be expressed.
Each mutant expression bacterium is numbered with xxx respectively in library, wherein, xxx is the group of numeral and letter
Close, naming method:Strain name adding carrier title;Mutation body expression vector naming method:In wild type table
Add "-xxx " after up to container name;Mutant protein naming method:Wild-type protein title adds upper right mark xxx
Name.Such as:From the expression vector of the nicotinamide mononucleotide adenylase NadD of Escherichia coli
PET-NadD is transferred in host BL21 (DE3), and the expression bacterium for obtaining is named as BL21 (DE3) (pET-NadD);
It is 3G10 to have a numbering in the mutant expression bacterium of NadD, and its expression bacterium is named as
BL21 (DE3) (pET-NadD-3G10), mutation body expression vector is named as pET-NadD-3G10, mutant egg
It is named as NadD in vain3G10。
Each mutant expression bacterium is numbered with xxx respectively in library, wherein, xxx is the group of numeral and letter
Close, one numbering of each mutant strain correspondence.The naming method for being mutated body expression vector is in wild type expression
Add "-xxx " after carrier, mutant is expressed bacterium and named with strain name and container name, and its protein product is with open country
Raw type protein name adds upper right mark xxx to name.
The induced expression condition of mutein is:Target single bacterium colony is chosen overnight to be lived in 37 DEG C of 200rpm
Change, transfer in new culture medium, add 0.01~1mM of IPTG, lured in 15 DEG C~37 DEG C 200rpm
Lead expression target protein.
Bibliography (J.Wang, et al.Protein Expression and Purification.2007,
53,97-103) method, carries out the induction of protein, expression, purifying.
The concentration mensuration of protein is carried out using Bole company determination of protein concentration kit with Bradford methods
Determine.
Gene knockout uses Red β recombination systems (T.Baba, et al.Molecular Systems
Biology.2006,2,1-11) and FLP restructuring enzyme system carry out unmarked knockout.
Intracellular co-factor concentration mensuration uses co-factor cyclic policy (S.Kern, et al.Methods in
Molecular Biology.2014,1149,311).
Determine NMNAT and its mutant enzyme using ATP synthesis NAD it is active when using document (E.Balducci,
Et al.Analytical Biochemistry.1995,228,64) in enzyme coupling method.
Determine NMNAT and its mutant enzyme using UTP synthesis NUD it is active when, added in reaction system:20~1000
The cushioning liquid pH 5.0~11.0 of mM, the NMN of 0.05~10mM, the UTP of 0.02~10mM, 0.05~10mM
Metal ion, the pure enzyme liquid of mutation of 0.01~1mg/mL, the L MALIC ACID of 5~10mM, the apple of 50U/mL
Tartaric acid enzyme mutant ME*Pure enzyme liquid, absorbance change at 340nm is measured under 25 DEG C of constant temperatures with spectrophotometric
Change.Wherein, ME*E. coli k12 is derived from, the 310th leucine sports the malate dehydrogenase of lysine
Mutant.Engineering bacteria BL21 (DE3) (pET24b-ME*) induced expression and ME*The same document of purification process (D.Ji,
Et al.Journal of the American Chemical Society.2011,133,20857).
PDH*The 151st isoleucine mutation of Pseudomonas stutzeri WM88 is derived from for arginine phosphorous acid is de-
(Wang Lei are based on metabolism circuit studies [the doctorate opinion of niacinamide cytimidine dinucleotides to hydrogen enzyme mutant
Text] Beijing:University of the Chinese Academy of Sciences, 2014).
Enzyme activity unit is defined:Enzyme amount needed for catalysis generation 1nmol products per minute under condition determination,
That is 1U=1nmol/min.The molar extinction coefficient of NADH and NUDH presses 6220M-1cm-1Meter.Specific enzyme activity
Calculated with formula 1.Wherein, Vt is reaction solution cumulative volume, and to add enzyme volume, C is enzyme concentration to Vs.
Formula 1
Wherein, Vt is reaction solution cumulative volume, and to add enzyme volume, C is enzyme concentration to Vs.
Isolating and purifying for enzyme reaction synthetic product uses document (D.Ji, et al.Journal of The
American Chemical Society.2011,133,20857-20862) method.
The qualitative and quantitative that crude enzyme liquid reaction terminates rear product NUD uses document (L.Sorci, et al.
Proceedings of the National Academy of Sciences of the United States of
America.2009,106,3083) in HPLC method.
Minimum mineral salts medium in fermentation medium uses document (T.Causey, et al.Proceeding
of the National Academy of Sciences of the United Stated of America.2003.
100,825) formula in.
The wild NadD of comparative example 1 catalyzes and synthesizes NUD
Bibliography (R.Mehl, et al.Journal of Bacteriology.2000,182,4372)
The expression vector of the wild type nicotinamide mononucleotide adenylase NadD from Escherichia coli is built, is turned
Enter in e. coli bl21 (DE3), obtain engineering bacteria BL21 (DE3) (pET-NadD).Bibliography (R.Mehl,
Et al.Journal of Bacteriology.2000,182,4372) induced expression and NadD is purified,
That is SEQ ID NO:1 corresponding albumen.Using above-mentioned and malic enzyme mutant ME*The method of coupling determines its profit
Synthesize the reactivity of NUD with UTP.Reaction condition:50mM containing HEPES, UTP in 150 μ L reaction systems
100 μM, NMN 4mM, MgCl210mM, MnCl25mM, NadD 6mg, L MALIC ACID 10mM,
Malic enzyme mutant ME*Pure enzyme 7.5U, pH 7.5,340 are measured under 25 DEG C of constant temperatures with spectrophotometric
Absorbance change at nm.The activity for measuring wild NadD synthesis NUD is 0.02U/mg.
The NadD of embodiment 13G10Catalyze and synthesize NUD
1. mutated library is built
(F.van den Ent, et al.Journal of Biochemical and are cloned using RF
Biophysical Methods.2006,67,67) method build mutated library.The first step, template is
Wild type NadD expression vectors (see comparative example 1), primer will treat that mutating acid site base is replaced with
Degeneracy base NNK, reclaims PCR primer;Second step, the same first step of template, primer is recovery in the first step
PCR primer, the product for obtaining is digested with DpnI restriction enzymes, and is transferred to BL21 (DE3) competent cell
In, the transformant for obtaining is the mutated library that can express NadD mutant, and each mutant expression bacterium is ordered respectively
Entitled BL21 (DE3) (pET-NadD-xxx), expressing protein product is named as NadDxxx.Wherein, xxx is number
The combination of word and letter, one numbering of each mutant strain correspondence, similarly hereinafter.
2. mutated library screening
Picking mutated library single bacterium colony is inoculated in 96 deep-well plates LB fluid nutrient mediums, in 30 DEG C, 200rpm
Culture 72h, induced expression mutant.15min collects thallines are centrifuged under the conditions of 3500rpm, add thin
Cellular lysate agent (50mM HPEPS, 1%Triton, 1mg/mL lysozymes, pH 7.5), in 37 DEG C, 200
Rpm crushes 1h, and 3500rpm centrifugations obtain crude enzyme liquid supernatant.Synthesis NUD is carried out using enzyme coupling coloration method
Screening active ingredients.60 μ L reaction conditions are:HEPES 50mM, UTP 2mM, NMN 4mM, MgCl210
MM, MnCl25mM, L MALIC ACID 10mM, malic enzyme mutant ME*Pure enzyme 7.5U, PES 0.4mM,
NBT 1mM, pH 7.5, adds crude enzyme liquid 10 μ L, 30 DEG C of reaction 1.5h, observes color change, shows
Bacterial strain corresponding to blue hole is the doubtful mutant strain that can synthesize NUD.Secondary screening is cultivated using amplification,
The induced expression mutant in 5mL LB fluid nutrient mediums, screening technique ibid, can repeat to show blue mutation
Bacterial strain is targeted mutagenesis bacterial strain.
The mutant bacteria faster that wherein develops the color is selected to be named as BL21 (DE3) (pET-NadD-3G10) and be sequenced,
Its expressing protein product NadD3G10Amino acid sequence be SEQ ID NO:4, compared with wild type NadD, it 118
Position tyrosine sports histidine, and 175 proline sport lysine, and 176 tryptophans sport smart ammonia
Acid.
3. NadD3G10Catalyze and synthesize NUD
The culture of mutant bacteria BL21 (DE3) (pET-NadD-3G10), induced expression and NadD3G10Purge process
With comparative example 1.Purifying obtains pure enzyme NadD from 9g wet thallus3G1027mg/mL, common 10mL.Determine
It utilizes UTP to synthesize the specific enzyme activity method of NUD with comparative example 1.The activity for measuring its synthesis NUD is 9.22
U/mg, 460 times are improve than wild type NadD.
It can be seen that, the pure enzyme NadD of mutant that the present invention is obtained3G10The activity for catalyzing and synthesizing NUD is significantly higher than accordingly
The activity of wild-type protein, new biocatalyst is provided to prepare NUD and synthesizing NUD in the cell.
The NadD of embodiment 23G10Pure enzyme prepares NUD
The pure enzyme NadD of 10mL3G10The system that NUD is synthesized contains Tris 50mM, UTP 2mM, NMN 4
MM, MgCl210mM, MnCl25mM, pure enzyme NadD3G1010mg, pH 8.0, in 37 DEG C, 200rpm
Reaction 1h, 15min is centrifuged then with ultra-filtration centrifuge tube in 5000g, under the conditions of 4 DEG C and removes deproteinized, ginseng
Examine literature method (D.Ji, et al.Journal of the American Chemical Society.2011,
133,20857) NUD 5.8mg, yield 45%, are isolated and purified to obtain.
Product nuclear magnetic resonance data:1H NMR (D2O, 400MHz):δ 9.36 (s, 1H), 9.20 (d,
J=6.2Hz, 1H), 8.88 (d, J=8.1Hz, 1H), 8.22 (pseudo t, J=6.6Hz,
1H), 7.79 (d, J=8.2Hz, 1H), 6.10 (d, J=5.4Hz, 1H), 5.82-5.80 (m,
2H), 4.52 (brs, 1H), 4.48-4.46 (m, 1H), 4.39-4.37 (m, 1H), 4.34-4.32
(m, 1H), 4.25-4.21 (m, 2H), 4.18-4.15 (m, 3H), 4.07-4.04 (m, 1H) .13C
NMR (D2O, 100MHz):δ 166.1,165.6,151.7,146.1,142.6,141.7,139.9,
133.9,128.7,102.5,99.9,88.5,87.0,82.9,77.6,73.7,70.7,69.5,64.9,
64.7.31P NMR (D2O, 162MHz):δ -11.1, -11.3.
The NadD of embodiment 33G10Crude enzyme liquid prepares NUD
By NadD3G10Expression engineering bacteria BL21 (DE3) (pET-NadD-3G10) line culture, picking single bacterium colony
It is inoculated in 5mL LB (μ of 50ng/ containing kanamycins L) fluid nutrient medium, in 37 DEG C, 200rpm
Activated overnight, the fresh LB of 50mL (50ng/ containing kanamycins μ L and IPTG 1mM) are inoculated in by its whole
In, in 30 DEG C, 200rpm cultures 24h.Thalline is collected by centrifugation, 5mL cell pyrolysis liquids (50 are added
MM HPEPS pH 7.5,1%Triton X-100,1mg/mL lysozyme), at 37 DEG C, under 200rpm
Cracking 1h.Centrifugation (12000g) treatment 10min, collects supernatant, obtains NadD3G10Crude enzyme liquid.
Contain in 300 μ L crude enzyme liquid reaction systems:100 μM of Tris 50mM, UTP, NMN 4mM,
MgCl210mM, MnCl25mM, NadD3G10The μ L, pH 8.0 of crude enzyme liquid 50, in 37 DEG C, 200rpm
Reaction 2h.Add the HClO of the 1.2M of 150 μ L ice precoolings4, ice bath 10min stops anti-after mixing
Should;At 4 DEG C, centrifugal force takes 300 μ L of supernatant and adds 80 μ L ice to process 1min under 12000g
The K of the 0.8M of precooling2CO3Solution, ice bath 10min is neutralized after mixing;At 4 DEG C, centrifugal force is
1min is processed under 12000g, the μ L of supernatant 300 is taken with carrying out HPLC analyses after 0.22 μm of membrane filtration.
At the end of quantitative analysis display reaction, 1.83mM containing NUD in reaction solution.
The NadD of embodiment 43G10Intracellular synthesizes NUD
Same NadD3G10The cultural method of engineering bacteria, recovers by line during crude enzyme liquid synthesis NUD, activated overnight
And after induced expression, take bacterium solution and be diluted to OD600It is 1.0, takes 1mL bacterium solutions centrifugation (12000g) treatment
2min, collects thalline;Add 500 μ L 50mM pH 7.2 phosphate buffer carry out it is resuspended, from
The heart (12000g) processes 2min, collects thalline;NUD adds the HCl of 150 μ L 0.2M when extracting,
55 DEG C of heating 10min, in the 5min that lowers the temperature in 0 DEG C;In adding the NaOH solution of 150 μ L 0.1M
With centrifugation (12000g) treatment 5min, supernatant is intracellular NUD extract solutions.
The measurement of intracellular NUD contents uses enzyme parameters.Contain in the reaction system of 100 μ L:50mM
HEPES, 10mM MgCl2, 5mM MnCl2, the malic enzyme mutant ME of 50U/mL*Pure enzyme liquid, 10mM
L MALIC ACID, 0.4mM PES, 1mM MTT and 15 μ L NUD extract solutions, pH 7.5.Measure engineering bacteria
BL21 (DE3) (pET-NadD-3G10) intracellular NUD contents are 23.1 μM.
The NadD of embodiment 53G10Regulation and control succinate fermentative yield
The host of succinate fermentative engineering bacteria is E.coli KJ134 (K.Jantama, et al.
Biotechnology Bioengineering.2008,5,881).With Red β recombination systems and FLP weights
Group enzyme system knocks out maeB genes, prevents malic acid to be consumed bacterial strain, and the engineered strain of acquisition is named as E.
Coli WXY01 (KJ134, Δ maeB).
Build the NadD that succinate fermentative engineering bacteria needs to be possible to synthesize NUD3G10, it is coenzyme to rely on NUD (H)
The 151st isoleucine mutation from Pseudomonas stutzeri WM88 be arginic phosphorous acidohydrogenase
Mutant enzyme PDH*(NUD is reduced into NUDH while phosphorous acid is oxidized into phosphoric acid) and from large intestine bar
310th leucine of bacterium K12 sports the malate dehydrogenase mutant enzyme ME of lysine*(it is reduction with NUDH
Power catalysis pyruvic acid generation malic acid), it is co-expressed in host E.coli WXYO1.Three enzyme coexpression vectors
With pK carriers, (Wang Lei are based on metabolism circuit studies [Ph.D. Dissertation] of niacinamide cytimidine dinucleotides
Beijing:University of the Chinese Academy of Sciences, 2014) it is template.The method cloned using three step RF.Used draws
Shown in thing and the following Tables 1 and 2 of template.The RF clone products for obtaining are identified just by conversion and bacterium colony PCR
Upgrading grain send sequencing, sequencing to be correctly destination carrier, be named as pK-ME after really*-NadD3G10-PDH*。
Table 1 builds the primer table used by coexpression vector
Primer | Primer sequence |
ME-F | GGATAACAATTTCACACAGGAAACACATATGGAACCAAAAACAAAAAAACAGC |
ME-R | GGCGGGTGTCGGGGCTGGCTTAATCAGTGGTGGTGGTGGTGGTGCTCGAG |
PK-ME-F | CCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCC |
PK-ME-R | GGAAAGAACATGTGAGCAAAAGGCCATCCCGGAGACGGTCACAGC |
PK-NadD-F | GCTGTGACCGTCTCCGGGATGGCCTTTTGCTCACATGTTCTTTCC |
PK-NadD-R | GGAAAGAACATGTGAGCAAAAGGCCATCCCGGAGACGGTCACAGC |
2 liang of step RF clone's the primers of table, template abridged table
By pK-ME*-NadD3G10-PDH*Electricity is transferred in WXY01 competent cells, the positive colony empirical tests for obtaining
After correct, the as engineering bacteria of the present embodiment is named as WXY02, its amber acid accumulation approach such as institute of accompanying drawing 2
Show.
It is LB fluid nutrient mediums that WXY02 fermentations produce the seed culture medium of butanedioic acid, and fermentation medium is minimum
Mineral salts medium adds 10% glucose, 100mM KHCO3, 0.15% sodium acetate, 100mM phosphorous acid and
0.4mM IPTG.The seed culture fluid of activated overnight is inoculated in 1.5L fermented and cultureds with 1: 50 rate of vaccination
In base, in 30 DEG C, 200rpm cultures 96h.
The content of butanedioic acid uses literature method (K.Jantama, et al.Biotechnology
Bioengineering.2008,5,881) using HPLC analyses, it is found that succinic acid content in fermentation broth is 97
G/L, and KJ134 is cultivated under the same terms, succinic acid content in fermentation broth is 72g/L.Show be with glucose
During carbon source, the succinic acid production of engineering bacteria WXY02 improves 35%.
The result explanation of the present embodiment, engineering bacteria WXY02 synthesizes NUD by intracellular, and in PDH*Effect
Under be reduced to NUDH, and then by ME*Utilize, promote ME*Approach overcomes thermodynamics barrier to be catalyzed malic acid synthesis,
Further increase succinic acid production.Therefore, intracellular synthesis NUD and its redox reaction system of mediation,
For metabolic engineering provides new technology.
Comparative example 2
Bibliography (N.Raffaelli, et al.Journal of Bacteriology.1999,181,
5509) will be from the gene of the nicotinamide mononucleotide adenylase NadR of e. coli bl21 (DE3)
NadR is subcloned to pK carriers, obtains the expression vector pK-NadR of wild type NadR, and its electricity is transferred into DH10b
In competent cell, obtain expressing the engineering bacteria of NadR, be named as DH10b (pK-NadR).Bibliography
(N.Raffaelli, et al.Journal of Bacteriology.1999,181,5509) is to work
Journey bacterium carries out induced expression and purifies, and obtains pure enzyme NadR, i.e. SEQ ID NO:2 corresponding albumen.Using right
NUD synthetase activity measure is carried out than identical method in embodiment 1.The activity for measuring wild NadR synthesis NUD is
0.01U/mg。
The NadR of embodiment 67G11Catalyze and synthesize NUD
The construction method of NadR mutated libraries is basic with embodiment 1, and difference is to obtain RF clones
PCR primer through DpnI digest after electricity be transferred in Escherichia coli DH10b competent cells, the transformant for obtaining
The mutated library of NadR mutant can be as expressed, each mutant expression bacterium is respectively designated as DH10b
(pK-NadR-xxx), expressing protein product is named as NadRxxx.Wherein, xxx is the combination of numeral and letter,
One numbering of each bacterial strain correspondence, similarly hereinafter.
, with embodiment 1, difference is enzyme coupling colour developing screening system for the screening of mutated library and secondary screening method
Middle NMN is reduced to 1mM by 4mM.
The mutant bacteria faster that wherein develops the color is selected to be named as DH10b (pK-NadR7G11) and be sequenced, its expression
Protein product NadR7G11Amino acid sequence be SEQ ID NO:5, compared with wild type NadR, its 198th,
The aspartic acid of 199,200, proline, lysine deletion mutation are alanine and tyrosine.
The culture of mutant bacteria DH10b (pK-NadR-7G11), induced expression and NadR7G11Purge process with right
Than embodiment 2.Purifying obtains pure enzyme NadR from 12g wet thallus7G11Concentration is 15mg/mL, common 10mL.
Determining it utilizes UTP to synthesize the specific enzyme activity method of NUD with comparative example 1.Measuring its activity for synthesizing NUD is
2.15U/mg, 210 times are improve than wild type NadR.
It can be seen that, the mutant protein NadR that the present invention is obtained7G11The activity for catalyzing and synthesizing NUD is significantly higher than corresponding open country
The activity of raw type albumen, new biocatalyst is provided to prepare NUD and synthesizing NUD in the cell.
The NadR of embodiment 77G11Pure enzyme prepares NUD
10mL NadR7G11The system of pure enzyme reaction synthesis NUD is as follows:HEPES 100mM, UTP 4mM,
NMN 4mM, MgCl210mM, MnCl25mM, NadR7G115mg, pH 8.6, in 30 DEG C, 200rpm
Reaction 2h, 15min is centrifuged then with ultra-filtration centrifuge tube in 5000g, under the conditions of 4 DEG C and removes deproteinized, ginseng
Examine literature method (D.Ji, et al.Journal of the American Chemical Society.2011,
133,20857) NUD 7.8mg, yield 30%, are isolated and purified to obtain.
The NadR of embodiment 87G11Intracellular synthesizes NUD
Intracellular synthesizes the extracting method of NUD and NUD with embodiment 4, except that using engineering bacteria DH10b
(pK-NadR-7G11), inductive condition is 0.1mM IPTG, in 20 DEG C, 200rpm cultures 60h.
The measurement of intracellular NUD contents is with embodiment 4.Measure engineering bacteria DH10b (pK-NadR-7G11) intracellular
NUD contents are 2.5 μM.
The wild NadM of comparative example 3 catalyzes and synthesizes NUD
Bibliography (L.Sorci, et al.Proceeding of the National Academy of
Sciences.2009,106,3083) build the niacinamide monokaryon glycosides that hot Francisella is drawn from soil
The expression vector of adenosine monophosphate transferase NadM, is transferred in e. coli bl21 (DE3), obtains engineering bacteria
BL21 (DE3) (pET-NadM), and induced expression, purifying obtain wild type NadM, i.e. SEQ ID NO:3 pairs
The albumen answered.NUD synthetase activity measure is carried out using identical method in comparative example 1.Measure wild NadM
The activity for synthesizing NUD is 0.07U/mg.
The NadM of embodiment 915C12Catalyze and synthesize NUD
The construction method of NadM mutated libraries is basic with embodiment 1, and the transformant for obtaining is can express NadM
The mutated library of mutant, each mutant expression bacterium is respectively designated as BL21 (DE3) (pET-NadM-xxx), table
NadM is named as up to protein productxxx.Wherein, xxx is the combination of numeral and letter, each bacterial strain correspondence one
Numbering, similarly hereinafter.
, with embodiment 1, difference is the inductive condition of mutated library for the screening of mutated library and secondary screening method
It is 20 DEG C, 200rpm, 96h, it is 0.1mM, enzyme coupling colour developing screening that IPTG concentration is added in culture medium
When NMN concentration reduced to 100 μM by 4mM.
The mutant bacteria faster that wherein develops the color is selected to be named as BL21 (DE3) (pET-NadM-15C12) and be sequenced,
Its expressing protein product NadM15C12Amino acid sequence be SEQ ID NO:6, compared with wild type NadM, it
131 Aspartic acid mutations are proline.
The culture of mutant bacteria BL21 (DE3) (pET-NadM-15C12), induced expression and NadM15C12Purge process
With comparative example 3.Purifying obtains pure enzyme NadM from 8g wet thallus15C12Concentration is 7.8mg/mL, common 5mL.
Determining it utilizes UTP to synthesize the specific enzyme activity method of NUD with comparative example 1.Measuring its activity for synthesizing NUD is
13.7U/mg, 196 times are improve than wild type NadM.
It can be seen that, the mutant protein NadM that the present invention is obtained15C12The activity for catalyzing and synthesizing NUD is significantly higher than corresponding open country
The activity of raw type albumen, new biocatalyst is provided to prepare NUD and synthesizing NUD in the cell.
Embodiment 10NadM15C12Pure enzyme prepares NUD
The system of the pure enzyme reaction synthesis NUD of 10mL is as follows:HEPES 50mM, UTP 4mM, NMN 4mM,
MgCl210mM, MnCl25mM, NadM15C1220mg, pH 7.0, at 25 DEG C, 200rpm reacts 4h,
Obtain product and then 15min is centrifuged under the conditions of 4 DEG C of 5000g except deproteinized, reference with ultra-filtration centrifuge tube
Literature method (D.Ji, et al.Journal of the American Chemical Society.2011,
133,20857) NUD 13.34mg, yield 52%, are isolated and purified to obtain.
Table 3 lists the activity of other parts NMNAT mutant in the present invention.
The present invention is catalyst using nicotinamide mononucleotide adenylase mutant, is catalyzed niacinamide monokaryon
Thuja acid and uridine diphosphate guanosine triphosphate coupled reaction, prepare niacinamide uracil dinucleotides.It is thin in microorganism
The encoding gene of intracellular expression nicotinamide mononucleotide adenylase mutant, engineering bacteria utilizes endogenous metabolism
Thing synthesize niacinamide uracil dinucleotides, and intracellular niacinamide uracil dinucleotides can as coenzyme,
Selective mediated oxidative reduction reaction, improves target metabolic Product yields.In a representative instance, amber
Acid yield improves 35%.
Claims (8)
1. a kind of method of enzyme' s catalysis niacinamide uracil dinucleotides, it is characterised in that:With niacinamide list
Nucleotides and uridine diphosphate guanosine triphosphate are substrate, and the mutant with nicotinamide mononucleotide adenylase is
Catalyst, synthesizes niacinamide uracil dinucleotides;
The amino acid sequence of the nicotinamide mononucleotide adenylase is SEQ ID NO:1, SEQ ID NO:2
Or SEQ ID NO:One or two or more kinds in 3,
The mutant of the nicotinamide mononucleotide adenylase is more than 1 in above-mentioned amino acid sequence
Amino acid be mutated the mutant of acquisition, mutational site be one kind in following sequences in amino acid sites or
More than two kinds:
One kind is in SEQ ID NO:Mutational site in 1 amino acid sequence is:22 sport S, L, A or G
In one kind, 23 one kind sported in T, G or L, 45 one kind sported in W, Y or L, 82
K is sported, the one kind in E, L or T, 84 sport K, the one kind in W, E, A, L, V, M, T or P,
86 sport R, the one kind in F, D, K, S or W, and 107 sport F, V, R, L, S, A, W or P
In one kind, 109 one kind sported in G, A or S, 118 sport D, H, T, P, G, N, A
Or the one kind in R, 132 sport I, the one kind in A, V, P, F, G, L, R or Q, 174 mutation
It is I, the one kind in A, R, P, L, G, V, K, D or M, 175 sport T, K, S, N, M, W,
One kind in E or G, 176 sport M, the one kind in G, S, A, P, T, R or K, and 177 sport A,
One kind in E, L, P, R or S, or 178 sport P, the one kind in I, V, S, R, G, T or L,
174,175,176 deletion mutations are two amino acid d, e, and wherein d is A, the one kind in S, T or P, e
It is S, the one kind in P, G or A, or 174,175 insertion mutations are three amino acid d, e, f, wherein d
It is K, the one kind in L, P, T, V or D, e is G, the one kind in P, M, L, V, T, R, D or I, f is
One kind in P, R, T, E, Q, K, V or S, the novel protein of one or more mutation of generation;
Or, one kind is in SEQ ID NO:Mutational site in 2 amino acid sequence is:82 sport S, L,
One kind in A or G, 83 one kind sported in R, I or K, 88 sport F, the one kind in V, M or L,
148 sport N, the one kind in Q, H or S, 154 one kind sported in H, Y or F, 176 mutation
It is the one kind in G, A or S, 205 sport P, the one kind in Q, V, R, G, K, N or L, 176,177
Position insertion mutation is three amino acid a, b, c, and wherein a is the one kind in P, G or I, during b is V, S or A
One kind, c is S, the one kind in C, I, H or W, or 203,204,205 deletion mutations are two amino acid
D, e, wherein d are E, and the one kind in L, M, F, L or V, e is A, the one kind in E, D, N, G, V or I,
The novel protein of one or more mutation for producing;
Or, one kind is in SEQ ID NO:Mutational site in 3 amino acid sequence is:21 sport M, S,
One kind in K, T, L, F, G, W, Q or R, 23 sport R, the one kind in T, L or Q, and 24 are dashed forward
It is changed into N, the one kind in W, K, S, F, R, G, V, T, D, P, E or A, 110 sport S, R, L,
One kind in N or Q, 130 sport P, the one kind in G, A or S, and 131 sport A, G, R, F, S,
One kind in L, E, V, C, W, I or P, 132 sport R, the one kind in W, V, A, S or G, 133
Position sports V, the one kind in T, Q, L or E, and 134 sport P, the one kind in E, A or G, and 135 are dashed forward
It is changed into T, the one kind in G, S, K or R, 136 one kind sported in I, L or V, or 137 sport
One kind in S, H or D, the novel protein of one or more mutation of generation.
2. in accordance with the method for claim 1, it is further characterized in that:Described nicotinamide mononucleotide gland
The mutant of glycosides transferase, by corresponding DNA sequence encoding.
3., according to the method described in claim 1 or 2, it is further characterized in that:Described nicotinamide mononucleotide
The mutant of adenylase, its corresponding DNA sequences encoding, is cloned in a kind of protein expression vector,
For controlled expression.
4., according to enzyme' s catalysis niacinamide uracil dinucleotides method described in claim 1, its feature also exists
In:The mutant of described nicotinamide mononucleotide adenylase, is carried by the expression for carrying corresponding mutant
The microbial cell of body is produced, and purifies corresponding mutant, and it is phonetic that nicotinoyl aminuria is synthesized for external enzymatic
Pyridine dinucleotides.
5., according to enzyme' s catalysis niacinamide uracil dinucleotides method described in claim 1 or 4, its feature is also
It is:Reaction condition is:PH 5.0-9.0,25 DEG C -55 DEG C of temperature, time 0.2-30h;Niacinamide list
Nucleotides, uridine diphosphate guanosine triphosphate, the consumption of nicotinamide mononucleotide adenylase mutant three rubs
Your ratio is 1: 0.02-50: 0.00002-0.1.
6. according to enzyme' s catalysis niacinamide uracil dinucleotides method described in claim 4, it is characterised in that:
The mutant protein described in claim 1 is expressed in microbial cell, while expression is with niacinamide uracil two
Nucleotides is one or more albumen of coenzyme, and the metabolism system that structure can selectively be regulated and controled is used for
Improve target metabolic Product yields.
7., according to enzyme' s catalysis niacinamide uracil dinucleotides method described in claim 4 or 5, its feature exists
In:The mutant protein described in claim 1 is expressed in colibacillus engineering, while expression is with niacinamide
Uracil dinucleotides sports lysine for the 310th leucine from e. coli k12 of coenzyme
Malic enzyme mutant and the 151st isoleucine mutation from Pseudomonas stutzeri WM88 are arginine
Phosphorous acid dehydrogenase mutant, and the culturing engineering bacterium cell in the presence of phosphorous acid improves succinic acid production.
8. according to enzyme' s catalysis niacinamide uracil dinucleotides method described in claim 1, it is characterised in that:
The specific amino acid sequence of mutant protein is SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:In 6
One or two or more kinds.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510939556.1A CN106884028B (en) | 2015-12-16 | 2015-12-16 | Method for enzymatic synthesis of nicotinamide uracil dinucleotide |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510939556.1A CN106884028B (en) | 2015-12-16 | 2015-12-16 | Method for enzymatic synthesis of nicotinamide uracil dinucleotide |
Publications (2)
Publication Number | Publication Date |
---|---|
CN106884028A true CN106884028A (en) | 2017-06-23 |
CN106884028B CN106884028B (en) | 2020-10-16 |
Family
ID=59174572
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510939556.1A Active CN106884028B (en) | 2015-12-16 | 2015-12-16 | Method for enzymatic synthesis of nicotinamide uracil dinucleotide |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106884028B (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN111549012A (en) * | 2020-06-08 | 2020-08-18 | 石家庄创组生物科技有限公司 | Ribose kinase mutant and application thereof |
WO2020258111A1 (en) * | 2019-06-27 | 2020-12-30 | 邦泰合盛生物科技(深圳)有限公司 | Enzymatic method for industrial production of nad |
CN113637652A (en) * | 2021-10-15 | 2021-11-12 | 华熙生物科技股份有限公司 | Adenylyltransferase mutant and application thereof |
CN115873820A (en) * | 2021-09-29 | 2023-03-31 | 尚科生物医药(上海)有限公司 | Nicotinamide mononucleotide adenyltransferase mutant |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102471793A (en) * | 2009-07-27 | 2012-05-23 | 霍夫曼-拉罗奇有限公司 | Enzymatic synthesis of CARBA-NAD |
CN103710321A (en) * | 2013-12-31 | 2014-04-09 | 邦泰生物工程(深圳)有限公司 | Nicotinamide mononucleotide adenylyltransferase (Nmnat) mutant as well as coding gene and application thereof |
-
2015
- 2015-12-16 CN CN201510939556.1A patent/CN106884028B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102471793A (en) * | 2009-07-27 | 2012-05-23 | 霍夫曼-拉罗奇有限公司 | Enzymatic synthesis of CARBA-NAD |
CN103710321A (en) * | 2013-12-31 | 2014-04-09 | 邦泰生物工程(深圳)有限公司 | Nicotinamide mononucleotide adenylyltransferase (Nmnat) mutant as well as coding gene and application thereof |
Non-Patent Citations (2)
Title |
---|
MUGGIA.FM,ET AL.: "《Concepts, Clinical Developments, and Therapeutic Advances in Cancer Chemotherapy》", 31 December 1987 * |
周志华等: "新功能生物元器件的筛选、设计与功能鉴定", 《生物产业技术》 * |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2020258111A1 (en) * | 2019-06-27 | 2020-12-30 | 邦泰合盛生物科技(深圳)有限公司 | Enzymatic method for industrial production of nad |
CN111549012A (en) * | 2020-06-08 | 2020-08-18 | 石家庄创组生物科技有限公司 | Ribose kinase mutant and application thereof |
CN111549012B (en) * | 2020-06-08 | 2022-05-13 | 石家庄创组生物科技有限公司 | Ribose kinase mutant and application thereof |
CN115873820A (en) * | 2021-09-29 | 2023-03-31 | 尚科生物医药(上海)有限公司 | Nicotinamide mononucleotide adenyltransferase mutant |
CN113637652A (en) * | 2021-10-15 | 2021-11-12 | 华熙生物科技股份有限公司 | Adenylyltransferase mutant and application thereof |
CN113637652B (en) * | 2021-10-15 | 2022-01-04 | 华熙生物科技股份有限公司 | Adenylyltransferase mutant and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN106884028B (en) | 2020-10-16 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Constant et al. | Genome data mining and soil survey for the novel group 5 [NiFe]-hydrogenase to explore the diversity and ecological importance of presumptive high-affinity H2-oxidizing bacteria | |
Lertsriwong et al. | Newly-isolated hydrogen-producing bacteria and biohydrogen production by Bacillus coagulans MO11 and Clostridium beijerinckii CN on molasses and agricultural wastewater | |
Graham et al. | Identification of the 7, 8-didemethyl-8-hydroxy-5-deazariboflavin synthase required for coenzyme F 420 biosynthesis | |
CN112159831B (en) | Method for preparing nicotinamide mononucleotide | |
CN106884029A (en) | The method of enzyme' s catalysis niacinamide cytimidine dinucleotides | |
CN106884028A (en) | The method of enzyme' s catalysis niacinamide uracil dinucleotides | |
Zhou et al. | Enhanced production of crude violacein from glucose in Escherichia coli by overexpression of rate-limiting key enzyme (s) involved in violacein biosynthesis | |
CN107794273A (en) | A kind of three gene co-expressing carriers of synthesis DL alanine and application | |
CN108949652B (en) | Engineering bacterium and application thereof in producing caffeic acid | |
CN106399216A (en) | Single-cell plant for efficiently synthesizing alpha-aminobutyric acid, as well as construction and application thereof | |
Dahm et al. | The role of isochorismate hydroxymutase genes entC and menF in enterobactin and menaquinone biosynthesis in Escherichia coli | |
CN108949649B (en) | Engineering bacterium and application thereof in producing levodopa | |
Ramp et al. | Physiological, biochemical, and structural bioinformatic analysis of the multiple inositol dehydrogenases from Corynebacterium glutamicum | |
Bender et al. | Genetic variation in symbiotic islands of natural variant strains of soybean Bradyrhizobium japonicum and Bradyrhizobium diazoefficiens differing in competitiveness and in the efficiency of nitrogen fixation | |
CN113583997A (en) | Phosphatase mutant and application thereof in catalyzing maltodextrin to prepare mannose | |
WO2024045796A1 (en) | Cyclodextrin glucosyltransferase with improved solvent tolerance and preparation thereof | |
CN112442518B (en) | Method for producing spermidine by using cheap substrate and engineering bacteria | |
CN106337068A (en) | Butanedione reductase application | |
CN110857444B (en) | Preparation method of scyllo-inositol | |
CN115927141B (en) | Double-enzyme co-expression strain for synthesizing NMN, construction method and application thereof | |
CN108949647B (en) | Engineering bacterium and application thereof in production of L-tyrosine | |
CN103820506B (en) | A kind of method of gene recombination bacterium fermentation preparation of cozymase Q 10 | |
Li et al. | Efficient chemoenzymatic synthesis of uridine 5′-diphosphate N-acetylglucosamine and uridine 5′-diphosphate N-trifluoacetyl glucosamine with three recombinant enzymes | |
CN103729576A (en) | Saccharopolyspora spinosa genome scale metabolic network model and construction method and application thereof | |
CN112695063B (en) | Enzymatic synthesis method of nicotinamide cytosine dinucleotide and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |